Loss of expression of the E3 ligase and tumour suppressor FBW7 attenuates vitamin D signaling

preprint OA: closed
Full text JSON View at publisher
Full text 140,778 characters · extracted from preprint-html · click to expand
Loss of expression of the E3 ligase and tumour suppressor FBW7 attenuates vitamin D signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Loss of expression of the E3 ligase and tumour suppressor FBW7 attenuates vitamin D signaling Reyhaneh Salehi Tabar, Aiten Ismailova, Zoe Carter, John H. White This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9181172/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Hormonal 1,25-dihydroxyvitamin D (1,25D) and its analogues signal through the nuclear vitamin D receptor (VDR). While numerous preclinical studies have provided evidence for antiproliferative and antitumour activities of 1,25D (analogues), such compounds have failed in clinical trials because of acquired tumour resistance. We previously found that the E3 ligase FBW7 interacts with the VDR. FBW7 regulates turnover of cell cycle drivers and is a tumour suppressor that is mutated in multiple malignancies, including head and neck squamous cell carcinoma (HNSCC). 1,25D accelerates the proteasomal degradation of FBW7 target proteins in a VDR- and FBW7-dependent manner. Surprisingly. FBW7 is also required for 1,25D-dependent transactivation. Here, we investigated the effects of FBW7 ablation by CRISPR/Cas9 editing on gene expression in 1,25D-sensitive human SCC25 HNSCC cells. We find that FBW7 loss induces the expression of several genes implicated in tumour progression and represses expression of those inhibiting tumour growth. Fold induction of the vast majority of the top 50 genes induced or repressed by 1,25D is attenuated by FBW7 ablation, suppressing 1,25D-driven regulation of genes implicated in cell proliferation and immune responses. Collectively, these data reveal that FBW7 is a critical cofactor of 1,25D signaling and provide a mechanism of acquired tumour resistance. Biological sciences/Cancer Biological sciences/Cell biology Biological sciences/Molecular biology Health sciences/Oncology Vitamin D FBW7 tumour suppressor gene expression profiling pathways analysis cell cycle Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction While originally identified for its critical role in calcium homeostasis, vitamin D is now known to exert a range of physiological functions 1,2 . These include regulation of the innate and adaptive arms of the immune system. Vitamin D has also been investigated for its potential roles in cancer prevention and therapy. It is obtained from the diet or by photochemical and thermal conversion of the cholesterol precursor 7-dehydrocholesterol in the presence of sufficient solar ultraviolet B (UVB) irradiation 1,2 . While it may seem that vitamin D should be readily available, deficiency is a widespread problem. Dietary sources are limited and in many populations sun exposure is the main source of vitamin D. However, UVB is absorbed during passage through the ozone layer, and at sea level substantial cutaneous vitamin D synthesis occurs only when the sun is above 45°C; so-called vitamin D winter can last several months at temperate latitudes 3 . In the absence of sufficient supplementation, circulating vitamin D metabolite levels thus vary seasonally 4 . Moreover, cutaneous vitamin D production is dependent on skin color and declines with age 5 . These factors, coupled with sun avoidance and conservative dress, can lead to vitamin D deficiency in several populations worldwide 6–9 . Vitamin D obtained from the sun, diet or supplementation must undergo sequential hydroxylations, first at the 25 position of the cholesterol sidechain followed by tightly regulated 1α hydroxylation to produce the biologically active form 1,25-dihydroxyvitamin D (1,25D). 1,25D binds to and regulates the vitamin D receptor (VDR), a member of the nuclear receptor family of ligand-regulated transcription factors. In the presence of 1,25D, the VDR heterodimerizes with related retinoid X receptors and transactivates gene transcription by binding to cognate vitamin D response elements (VDREs). The hormone-bound VDR can also repress gene transcription by several, heterogenous mechanisms 10 The VDR and the critical 25-hydroxyvitamin D 1α-hydroxylase enzyme CYP27B1 are expressed in numerous tissues throughout the body 11 . Notably, 1,25D signaling has pro-differentiating and antiproliferative activities in a number of cell types and there is epidemiological evidence that maintaining vitamin D sufficiency is cancer preventive 12,13 . Typical of many findings, a recent scoping review provided evidence of links between vitamin D deficiency and an increased risk of oral cancer 12 . Intervention trials have given mixed results but are fraught with complications because of limited dosing in some cases and the fact that vitamin D is an essential nutrient, thus complicating placebo wings. Prevention trials are also compromised by their relatively short duration. Nonetheless, a meta-analysis of randomized, placebo-controlled trials concluded that vitamin D supplementation significantly reduced total cancer mortality but did not reduce total cancer incidence 14 . The potential of the anticancer properties of vitamin D signaling are supported by numerous preclinical studies of several cancer models 1 . While 1,25D or its analogues have shown encouraging efficacy in such studies, they have failed as cancer therapeutics because of acquired tumour resistance even though in most instances VDR expression is maintained. We have been interested in studying the anticancer properties of 1,25D (analogues) using mouse and human head and neck squamous cell carcinoma (HNSCC) as models 15–18 . In human SCC25 HNSCC cells, 1,25D is antiproliferative and induces a more differentiated state 15,19 . Biochemical studies have revealed a striking functional relationship between the VDR and the F box protein FBW7 (FBXW7/Sel-10/Ago/hCDC4) in HNSCC cells 18 . FBW7 is a subunit of SCF E3 ligase complexes (Skp1, Cullin-1, F box protein), which are key components of the ubiquitin proteasome system (UPS) as they catalyze the ubiquitination of substrates destined for degradation by the 26S proteasome. The UPS regulates numerous fundamental biological processes, including cell cycle progression, antigen processing, cellular defense, signaling pathways and gene transcription 20–22 . FBW7 is expressed in multiple isoforms of which α and γ are nuclear 23 . Our initial interest was in the role of FBW7 in the accelerated proteasomal turnover of the oncogenic transcription factor c-MYC observed in 1,25D-treated cells 17,18 . While 1,25D reduces expression of c-MYC in a manner partially dependent on FBW7, c-Myc accumulates in Vdr -null mice 17 . Unexpectedly, we also found that FBW7 is required for optimal transactivation by the hormone-bound VDR; FBW7, along with proteasomal subunits, was recruited to the DNA-bound VDR and FBW7 ablation substantially reduced transactivation of selected VDR target genes 18 . While expression of numerous transcription factors is controlled by proteasomal turnover 24 , the VDR does not appear to be a substrate of FBW7 even though the two proteins interact 18 . The best characterized FBW7 target is c-MYC; downregulation of FBW7 results in accumulation of cellular and chromatin-bound c-MYC 25 . In addition, FBW7 controls the turnover of several other proteins that drive cell cycle progression through recognition of “phosphodegron” motifs (consensus T/S-P-X-X-S/T/E), which are phosphorylated by GSK3β 26 . Consistent with this, FBW7 is a tumour suppressor and is one of the most frequently dysregulated UPS components in cancer 27 , including HNSCC 28,29 . Its functional relationship with the VDR is thus fascinating because its mutation may provide a mechanism of acquired resistance to 1,25D or its analogues. Indeed, ablation of FBW7 strongly impaired the antiproliferative activity of 1,25D in HNSCC cells 18 . Here, we have investigated broadly the interplay between FBW7 and vitamin D signaling by generating an SCC25 HNSCC variant in which FBW7 expression has been ablated by CRISPR/Cas genome editing and have analyzed its effects on 1,25D-regulated gene expression by RNAseq. We find that FBW7 ablation has multiple effects on SCC25 gene expression, consistent with its role as a tumour suppressor. We also find that FBW7 loss attenuates the induction of the vast majority of genes regulated by 1,25D, both activated and repressed. Accordingly, several signaling mechanisms regulated by 1,25D are attenuated in FBW7-deficient cells. Our results suggest that loss of tumour suppressor FBW7 function during cancer progression provides a mechanism of acquired resistance to vitamin D signaling. Results Ablation of FBW7 expression in SCC25 cells To disrupt FBW7 expression we used CRISPR/Cas genome editing (see Materials and Methods for details). The gene encoding FBW7 has multiple 5’ exons specific to each isoform (Fig. 1 A). Guide RNAs were generated that targeted exon c7, which encodes sequence lying in the WD40 domains and is common to all isoforms (Fig. 1 A). The WD40 domains contain the phosphodegron binding repeats and are hotspots for mutations in cancer 30 . The clone selected for RNAseq is homozygous for a 37 bp deletion and exhibits strongly reduced FBW7 mRNA expression (Fig. 1 B). Note that we did not test for endogenous protein expression because available antibodies against FBW7 are unreliable. Consistent with siRNA knockdown 18 , FBW7 ablation led to severely compromised induction of VDR target genes CYP24A1 and CAMP in the presence of 1,25D (Fig. 1 C). In control experiments, using control genes CYP24A1 and CAMP , we found was no substantial effect on 1,25D-regulated gene expression in transduced cell lines where FBW7 gene editing failed (Fig. S1 ). Moreover, the attenuated response to 1,25D in FBW7 -ablated cells was not due to loss of VDR gene or protein expression under any of the conditions tested (Figs. 1 D,E). To determine as broadly as possible the effects of FBW7 ablation on gene expression in SCC25 cells and on 1,25D signaling we performed in triplicate comparative RNAseq analyses in control and FBW7-ablated cells cultured in the presence of vehicle or 100nM 1,25D for 16h. Principal component analysis (Fig. 1 F) showed that gene expression patterns were highly similar between triplicates and that FBW7 ablation and/or 1,25D treatment produced distinct sets of regulated genes. Several hundred genes were differentially regulated by at least 1.5-fold when comparing vehicle- to 1,25D-treated control cells or control cells to those lacking FBW7 (Fig. 1 G). In contrast, treatment of FBW7 KO (knockout) cells with 1,25D produced a more limited set of differentially up- or downregulated genes (Fig. 1 G), with substantial but incomplete overlap with those regulated by 1,25D in control cells (Fig. 1 H). In both control and FBW7-depleted cells, 1,25D treatment led to activation of the vitamin D receptor pathway as determined by GSEA Wiki Pathways analysis (normalized enrichment scores in control and FBW7 cells are 2.79 [p-adjusted value: 3.64e-10] and 2.43 [p-adjusted value: 1.0e-05], respectively). Upon examination of DEGs regulated within the VDR pathway by a heatmap, 1,25D treatment in FBW7 KO cells led to attenuated regulation of several 1,25D-VDR target genes relative to 1,25D-treated control cells (Fig. S2 ). To probe the effects of FBW7 loss further, we compared the fold regulation of the top 50 most 1,25D-inducible genes in control and FBW KO cells. This revealed that, for 45 of the 50 genes, fold induction by 1,25D was partially or strongly reduced (Fig. 2 A). A similar inhibitory effect of FBW7 ablation was observed on genes downregulated by 1,25D signaling (Fig. 2 B). Differential regulation of a subset of upregulated and downregulated genes was validated independently by RT/qPCR (Fig. 2 C, D). As expected, one of the top upregulated genes whose expression was diminished was CAMP (Figs. 1 C, 2 A). FBW7 ablation decreased both the basal expression and induction by 1,25D of CAMP. It can be argued that the loss of effect of 1,25D on CAMP expression may be due to the loss of expression/activity of a cooperating transcription factor given the reduced basal expression. However, depletion of FBW7 had a wide range of effects on basal expression of 1,25D target genes. Notably, fold regulation by 1,25D of the ALP 1 and FEZF1 genes was also diminished in the absence of FBW7 even though their basal expression increased substantially (Fig. 2 C). Although KO does not substantially affect VDR expression (Fig. 1 ), another possible mechanism underlying attenuated 1,25D signaling would be suppressed expression of RXR heterodimeric partners. While RXRG encoding RXRγ is listed as a downregulated DEG, analysis of RNAseq data revealed that its expression is very weak (Fig. S3 A). Western blotting of RXRα, by far the most strongly expressed VDR heterodimeric partner ( RXRA , Fig. S3 A), revealed that its expression was not affected by knockdown (Fig. S3 B). Taken together, the above results indicate that attenuation of 1,25D-dependent gene regulation does not appear to be due to loss of the VDR or its major heterodimeric partner. They also show that FBW7 ablation broadly inhibits 1,25D-regulated gene expression in SCC25 cells. FBW7 loss induces pro-tumourigenic signaling pathways To further examine the consequences of FBW7 loss on SCC25 cell gene expression and on signaling by 1,25D, we performed pathways analyses to identify changes in gene expression signatures associated with molecular signaling pathways. We focused initially on the effects of FBW7 ablation. Gene set enrichment analysis (GSEA) for Gene Ontology biological processes revealed downregulated pathways related to innate immune responses, calcium ion transport into cytosol, migration and chemotaxis when FBW7 was ablated (Fig. 3 A). Similarly, Ingenuity Pathway Analysis (IPA) of enriched diseases and functions uncovered suppression of cell movement and calcium ion transport with FBW7 loss (Table S5). Interestingly, cancer cells evade apoptosis via decreasing calcium influx into the cytosol 31 . Conversely, epithelial cell development appeared as upregulated in FBW7-depleted cells. To further investigate this, we produced a heatmap of differentially expressed genes (DEGs) within the epithelial cell development category, which included the effects of 1,25D (Fig. 3 B). FBW7 ablation induced expression of a subset of genes (enclosed in red) that were not substantially regulated by 1,25D. These include several genes that encoded proteins involved in tumour promotion such as VIM and PODXL , associated with the epithelial-to-mesenchymal transition and accelerated tumour growth 32–34 , FSRL1 , a biomarker for cervical cancer diagnosis 35,36 , EPAS1, AMPD2 and XBP1 , biomarkers of colorectal cancer 37–42 , as well as RFX3 and IL6ST , which are molecular drivers of breast cancer and drug resistance to tumours 43,44 . The only exceptions were TMOD1 and ABCB1 , which are implicated in tumourigenesis 45,46 and are induced with 1,25D but not suppressed with FBW7 loss. Conversely, FBW7 depletion repressed a subset of genes that are not similarly regulated by 1,25D (enclosed in blue). These include genes that encoded proteins involved in tumour suppression such as the metastatic suppressors BMP4 and NFX6-1 47,48 and the tumour suppressors RAB25, RARG, EDNRB and PAX6 49–52 . There were a few exceptions with NR5A2 and RARB , nuclear receptors that function as negative regulators of tumour growth 53,54 , which were similarly downregulated with 1,25D and by FBW7 loss. We also found that pathways involved in actin-based motility, histone and DNA methylation, phosphoinositide 3-kinase (PI3K)/AKT signaling, integrin signaling and SPINK1 pancreatic cancer were activated in FBW7 KO cells as demonstrated by IPA enrichment for canonical pathways (Fig. 3 C). Aberrant activation of PI3K/AKT signaling is associated with cellular transformation, tumourigenesis, cancer progression, and drug resistance 55 . Increased signaling of the extracellular matrix through its receptors, the integrins, was previously shown to contribute to cancer cell survival and resistance to chemotherapy 56–58 . SPINK1 is a growth factor and inhibitor of apoptosis in several cancers 59 , and in human pancreatic cancer, SPINK1 promotes proliferation by inducing EGFR phosphorylation and subsequent downstream activation of the mitogen-activated protein kinase pathway 60 . In contrast, multiple pathways related to immune signaling and signaling by thyroid hormone (TR), PPAR and LXR nuclear receptors were strongly downregulated by FBW7 ablation (Fig. 3 C). While these receptors and the VDR share common heterodimeric partners, RXRs, as stated above it is unlikely that their attenuated signaling is due to loss of RXR expression. To investigate regulation of genes encoding histones, we generated a heatmap of DEGs within the histone category, which included the effects of 1,25D (Fig. 3 D). Interestingly, nearly all genes encoding histones were induced when FBW7 was ablated, and these effects were independent of 1,25D (Fig. 3 D). This is noteworthy as genes encoding histones are overexpressed in various cancers, which indicate a requirement for higher amounts of histones in proliferating cells undergoing high rates of replication, such as in cancer cells 61–64 . The sole exception was with H2AC25 , which is linked with shorter survival in oral squamous cell carcinoma 65 . Consistent with its induction of tumour promoting and proliferative histone genes, several enriched diseases and functions related to various cancers, which include development of head and neck tumours, were activated in FBW7 depleted cells (Table S4 ). Regulation of cell cycle drivers by 1,25D signaling A similar analysis was performed to identify 1,25D-regulated pathways. 1,25D appeared to broadly suppress transcription of Myc target genes (Fig. 4 A). However, this effect was attenuated in FBW7-depleted cells. cMYC protein levels in the absence and presence of 1,25D were elevated relative to controls in FBW7 KO cells and expression of cMYC antagonist MXD1 induced by 1,25D was lost in the absence of FBW7 (Fig. 4 B). While 1,25D broadly suppressed transcription of Myc target genes in control cells (Figs. 4 C), the degree of their repression in the presence of 1,25D was generally reduced in FBW7 KO cells (Fig. 4 C). The only exception is the EXOSC5 gene, which encodes a protein correlated with advanced clinical stage of head and neck squamous cell carcinoma 66 . Its expression was downregulated by 1,25D or FBW7 ablation and further inhibited by 1,25D in KO cells (Fig. 4 C). In the absence of 1,25D, expression of roughly half of cMYC target genes was modestly or substantially upregulated in FBW7 KO cells, whereas expression of the remainder was lower, consistent with effects on FBW7 loss on cMYC target genes independent of cMYC expression. 1,25D treatment and FBW7 KO both strongly affect the expression of cyclins and cyclin-dependent kinases (Fig. 4 D). Expression of several of these genes whose elevated levels are associated with tumourigenesis was inhibited by 1,25D (for example, the CCNA1 and CCND2 genes encoding cyclins A and D2, respectively), consistent with antiproliferative properties of 1,25D. Effects of 1,25D on genes encoding cyclins or related proteins that are negative regulators of the cell cycle was more mixed. CCNG2 , encoding inhibitory cyclin G2, was strongly upregulated, whereas other related genes were modestly downregulated. FBW7 KO substantially disrupted basal expression of this gene set, with expression of 14 of the 23 genes strongly upregulated while that of 9 of 23 genes was downregulated. Upregulated genes encoded several proteins implicated in tumourigenesis (e.g. cyclins A1, D2 and J). However, expression of CDKN1A, encoding CDK inhibitor p21 WAF1/CIP1 was also strongly upregulated. Both 1,25D treatment and FBW7 KO also robustly affect expression of genes within the interferon alpha (IFN-α) response (Fig. 4 E). Expression of most of these genes were downregulated by 1,25D and even more inhibited in the KO (Fig. 4 E). The antitumourigenic and antiproliferative functions of IFN-α are documented 67,68 and it has been used as monotherapy or adjuvant treatment before chemotherapy to improve efficacy against HNSCC tumours 68 . Suppression of the antitumour IFN-α response in KO cells is consistent with the previously mentioned enriched tumour promoting pathways and genes. However, it is unclear why the IFN-α response is inhibited in response to antiproliferative 1,25D. One explanation may be due to well-known role of 1,25D signaling in suppressing inflammation 69,70 , and the IFN-α pathway is often upregulated and promotes pathogenesis of autoimmune conditions such as systemic lupus erythematosus (SLE) 71 . Notably, there is a negative correlation between circulating 25D levels and IFN-α serum level in SLE patients 72,73 and 1,25D was shown to suppress expression of IFN-α induced genes in these patients 74 . Effects of 1,25D signaling are suppressed with FBW7 ablation Next, we evaluated the effects of 1,25D signaling in FBW7 depleted cells. Disease ontology enrichment revealed loss of enrichment of several pathways related to infectious and autoimmune conditions in 1,25D-treated FBW7 depleted cells relative to 1,25D-exposed control cells (Fig. 5 A). Consistent with this, FBW7 loss decreased regulation (activation and suppression) of 1,25D-regulated canonical pathways (Figs. 5 B, C). As 1,25D is anti-inflammatory and anti-microbial 69 , we were interested in determining how 1,25D-regulated immune and inflammatory pathways were affected in the KO. Interestingly, FBW7 loss dampened 1,25D-induced signaling of innate immune responses and 1,25D-attentuated inflammation (Fig. 5 D). For instance, the pathways included KO-mediated suppression of 1,25D-induced expression of anti-microbial CAMP , ALPI , an anti-inflammatory metalloenzyme that attenuates TLR4 agonist activity 75 previously shown to be regulated by 1,25D in Caco-2 cells 76 , and TREM1 , a triggering receptor that demonstrates antiviral activity 77 . Discussion A combination of preclinical data and epidemiological studies have provided evidence that vitamin D deficiency increases the risk of cancer development 78–80 . Notably, a large prospective study showed that vitamin D sufficiency correlated with reduced total incidence and mortality from leukemias and digestive cancers 78 . The findings are significant as vitamin D deficiency remains a widespread problem. Most western diets are vitamin D-poor and combinations of inadequate solar UVB, sun avoidance, conservative dress and dark skin colour contribute to vitamin D deficiency in several populations in the absence of adequate supplementation 6–9 . Collectively, the above observations along with earlier findings spurred our interest in studying the anti-cancer properties of vitamin D signaling. We originally chose to study SCC25 cells as a model to test the potential cancer-preventive actions of vitamin D. Although derived from a tumour of the oral cavity, SCC25 cells are well differentiated and sensitive to the antiproliferative activity of 1,25D and its analogues 15,19 . Findings presented above substantiate the potential of vitamin D as an anticancer agent. For example, pathways analysis revealed that 1,25D signaling suppressed the expression of several genes regulated by the oncogenic transcription factor cMYC and regulated the expression of cyclins and cyclin-dependent kinase genes in manner consistent with cell cycle arrest. Previous work also showed that 1,25D signaling induced a more differentiated phenotype in SCC25 cells, notably by suppressing the expression of N-cadherin a marker of epithelial-mesenchymal transition 19 . Despite substantial evidence that maintenance of vitamin D sufficiency reduces cancer risk, 1,25D analogues have failed in cancer monotherapies because of acquired tumour resistance. Our present results are consistent with loss of FBW7 expression being one of the mutations contributing to vitamin D resistance. The FBW7 gene encodes a well-characterized tumour suppressor that is frequently dysregulated in cancer 27 , including HNSCC 28,29 . Other findings have noted that FBW7 mutations also correlate with resistance to other chemotherapeutic agents 81 . Our previous studies showed that the VDR and FBW7 function as cofactors; they interact in a partially 1,25D-dependent manner and FBW7 and other proteasomal subunits are recruited to genes whose expression is stimulated by 1,25D. We initially identified FBW7 as a VDR cofactor that contributed to the accelerated proteasomal turnover of cMYC observed in 1,25D-treated SCC25 cells 17,18 . We provided evidence that this occurs via 1,25D-dependent recruitment of FBW7 and the proteasome to DNA-bound cMYC. These findings provided a novel but highly specific mechanism of 1,25D-dependent repression of gene transcription. Unlike transactivation, which is generally initiated by VDR/RXR heterodimers binding to VDREs in regulatory regions of target genes, mechanisms of transrepression by the VDR are much more heterogeneous 10 . Therefore, in studies presented above, the observation that repression of gene transcription by 1,25D was generally attenuated in cells lacking FBW7 was unexpected (Fig. 2 ). The widespread reduction of fold regulation of 1,25D-induced genes was less of a surprise given that mechanisms of direct target gene regulation by the VDR are more homogeneous. Bioinformatic analyses presented above of the effects of FBW7 loss on gene expression and 1,25D signaling in SCC25 cells are consistent with its role as a tumour suppressor and a key cofactor of vitamin D signaling. Regulation of canonical pathways up- or downregulated by 1,25D was generally reduced in FBW7-deficient cells. Unsurprisingly, given the role of the VDR and FBW7 in regulating cMYC, inhibition by 1,25D of expression of target genes of cMYC, a driver of cell cycle progression, was generally attenuated by knockout of FBW7. There was also dysregulation of several genes encoding cyclins and cyclin-dependent kinases, largely consistent with enhanced cell proliferation (Fig. 4 ). In addition, the major GO biological pathway upregulated in FBW7-depleted cells was “epithelial cell development”, in which expression of several genes associated with tumour progression was enhanced, whereas that of genes associated with tumour suppression was inhibited (Fig. 3 ). FBW7 depletion also upregulated the expression of several genes encoding histones in a manner that was essentially independent of vitamin D signaling. Much of the focus of the current study was on the potential effects of FBW7 loss on the anticancer properties of 1,25D signaling. However, 1,25D is also a major regulator of innate immune pathways in epithelial cells and other innate immune cell types, notably through the induction of antimicrobial peptide genes such as CAMP . It is also anti-inflammatory 82 . Induction of CAMP expression by 1,25D in FBW7-deficient cells is strongly inhibited (Fig. 1 ). Moreover, pathways analysis revealed that the degree of upregulation by 1,25D of innate immune pathways and downregulation of inflammatory pathways was suppressed in the absence of FBW7 (Fig. 5 ). In conclusion, results presented above show that FBW7 depletion has widespread effects on gene expression in SCC25 cells, most of which are consistent with its loss being a marker of cancer progression. The results also strongly support FBW7 being a cofactor of the VDR that contributes broadly to both induction and repression of gene transcription observed in the presence of 1,25D. Finally, our findings are consistent with de novo FBW7 mutations being a plausible mechanism of acquired resistance to 1,25D analogue therapy. Materials and Methods CRISPR/Cas9 genome editing CRISPR/Cas9 genome editing was done using the protocol of Malina et al (1). The target sequence, AGATGCATACAACGCACAGTGG, was designed using the website https://chopchop.cbu.uib.no/ to target the human FBXW7 gene and then cloned in the LeGO-U6LTR-iGCas9-GFP plasmid. The plasmid is a gift from Dr. Jerry Pelletier, McGill University. To produce viral particles containing LeGO-U6LTR-iGCas9-GFP, HEK293T/17 cells (CRL-11268, ATCC) were transfected along with packaging plasmids using Calfectin (SL100478, Signagen) reagent. To transduce SCC25 cells (CRL-1628, ATCC), the medium from HEK293T/17 cells containing lentiviral particles was collected, filtered, and added to SCC25 cells. The cells were grown for 3 weeks and then a single-cell green fluorescence protein selection was made by fluorescence-activated cell sorting. Different clonal cell lines were then tested via FBXW7 genomic DNA PCR on the site of Crisper/Cas9-gRNA cut using AGGAAGCTGACAACACTAGCA and TGTCTGAGAACATTAGTGGGACA. Cell culture and treatment. We performed gene expression profiling studies by RNAseq in triplicate in wild-type and FBW7-depleted SCC25 to determine the effects of FBW7 ablation on nuclear 1,25D-dependent transactivation and repression. Cells were treated with 100nM 1,25D (BML-DM200, Enzo Life Sciences), or vehicle (dimethyl sulfoxide) for 16 hours to generate expression profiles enriched in primary target genes. RNA sequencing RNA sequencing was conducted essentially as described 83,84 . Total RNA was extracted using the FavorPrep Blood/Cultured Cell Total RNA Mini Kit (FABRK 001, Favorgen) according to the manufacturer's protocol. RNA samples with an OD 260/280 ratio higher than 1.7 and an RNA integrity number greater than 7 were kept for subsequent analysis. Next, these samples were submitted to Génome Québec for paired-end sequencing with 100M reads on an Illumina NovaSeq PE100 sequencer. Library preparation was performed using the polyA Enriched RNA Library Preparation. All samples were included in the analysis as they met quality standards by QC reports from Génome Québec. The quality of sequence reads was then verified using FastQC, with poor-quality reads determined based on the Phred score, which is logarithmically related to base calling error probabilities. The Phred offset quality score was greater than 30, and the minimum fragment size for alignment was set to 50. Using HISAT2 85 , reads were mapped to the human GRCh38 genome assembly. Gene expression was quantified by counting uniquely mapped reads with featureCounts, using default settings. Normalization of gene counts and differential gene expression analysis were executed with the edgeR Bioconductor R package 86 . Genes with ≥|1.5| fold-change and adjusted p-values ≤ 0.05 were considered significant. Differentially expressed genes from the RNAseq analysis are available in Tables S1-S3. Data availability The data presented in this study are deposited in the Gene expression omnibus (GEO) repository, accession number GSE312616 and are available at the following URL: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE312616 Bioinformatics and pathways analysis The overlap between conditions is illustrated using the DeepVenn website https://www.deepvenn.com/ 87 . Principal component analysis (PCA) was performed using the R function plotMDS and visualized with the limma R package. Pathways analyses enrichment was carried out using clusterProfiler, Disease Ontology (DOSE) and Gene set enrichment analysis (GSEA) R packages 88–90 . In addition, QIAGEN’s Ingenuity Pathway Analysis software (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity ) was used to probe for additional enriched pathways. For visualisation of expression level per gene by heatmaps, using edgeR, the logCPM (counts per million) was calculated for each gene using TMM (trimmed mean of M values) normalization method to calculate effective library sizes which are subsequently used as part of the per-sample normalization 91 . After this, a z-score normalization was performed to render features comparable 92 . Heatmaps with hierarchical clustering were constructed using the heatmap.2 package in R. RNA extraction, reverse transcription and qPCR RNA extraction was performed using the FavorPrep™ Tissue Total RNA Mini Kit (FATRK 001, Favorgen) according to the manufacturer’s instructions. cDNA was synthesized from 500 ng of RNA using the 5× All-in-One RT Mastermix (G485, abm) and diluted 5 times. Quantitative polymerase chain reaction (qPCR) was conducted with BrightGreen 2×qPCR MasterMix (MasterMix-LR-XL, abm) on a Roche Applied Science LightCycler 96 machine. Gene expression was normalized to Actin. Statistics A one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons was used using the dplyr R package. A p value of less than or equal to 0.05 was considered significant. To denote p values, symbols were used as follows: *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, and ns ≥ 0.05. Declarations Funding Declaration This work was supported by a grant from the Natural Sciences and Engineering Research Council (RGPIN-2023-04162) to J.H. White. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Author Contribution Wrote the paper: RST, JHW, AI. Conceived and designed experiments: JHW, RST, AI. Performed experiments (RST, ZC) and analysis of experimental data: RST, JHW. Methodology and analysis of RNAseq (bioinformatics): AI, RST. Supervision: JHW. Acknowledgement We are grateful to Dr. Jerry Pelletier and Dr. Francis Robert, McGill University, for the gift of the plasmid LeGO-U6LTR-iGCas9-GFP. Data Availability The data presented in this study are deposited in the Gene expression omnibus (GEO) repository, accession number GSE312616 and are available at the following URL: [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE312616](https:/www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE312616) References Bouillon, R. et al. Skeletal and extraskeletal actions of vitamin D: current evidence and outstanding questions. Endocr. Rev. 40 , 1109-1151 (2019). Artusa, P. & White, J. H. Vitamin D and its analogs in immune system regulation. Pharmacological reviews 77 , 100032 (2025). https://doi.org/https://doi.org/10.1016/j.pharmr.2024.100032 Tavera-Mendoza, L., White, J.H. Cell defenses and the sunshine vitamin. Scientific American 297 , 62-72 (2007). Hyppönen, E. & Power, C. Hypovitaminosis D in British adults at age 45 y: nationwide cohort study of dietary and lifestyle predictors. The American journal of clinical nutrition 85 , 860-868 (2007). Webb, A. R. Who, what, where and when—influences on cutaneous vitamin D synthesis. Progress in Biophysics and Molecular Biology 92 , 17-25 (2006). https://doi.org/https://doi.org/10.1016/j.pbiomolbio.2006.02.004 Arabi, A., El Rassi, R. & El-Hajj Fuleihan, G. Hypovitaminosis D in developing countries-prevalence, risk factors and outcomes. Nat Rev Endocrinol 6 , 550-561 (2010). Gonzalez-Gross, M. et al. Vitamin D status among adolescents in Europe: the Healthy Lifestyle in Europe by Nutrition in Adolescence study. British Journal of Nutrition 107 , 755-764 (2012). https://doi.org/10.1017/s0007114511003527 Cashman, K. D. et al. Vitamin D deficiency in Europe: pandemic? American Journal of Clinical Nutrition 103 , 1033-1044 (2016). https://doi.org/10.3945/ajcn.115.120873 Mogire, R. M. et al. Prevalence of vitamin D deficiency in Africa: a systematic review and meta-analysis. The Lancet Global Health 8 , e134-e142 (2020). https://doi.org/https://doi.org/10.1016/S2214-109X(19)30457-7 White, J. H., Sarmadi, F. & Artusa, P. in Feldman and Pike' s Vitamin D (Fifth Edition) (eds Martin Hewison et al. ) 241-259 (Academic Press, 2024). Zehnder, D. et al. Extrarenal Expression of 25-Hydroxyvitamin D3-1α-Hydroxylase. Journal of Clinical Endocrinology & Metabolism 86 , 888-894 (2001). https://doi.org/10.1210/jc.86.2.888 Hung, M., Almpani, K., Thao, B., Sudweeks, K. & Lipsky, M. S. Vitamin D in the prevention and treatment of oral cancer: a scoping review. Nutrients 15 , 2346 (2023). Talib, W. H. et al. Role of vitamins A, C, D, E in cancer prevention and therapy: Therapeutic potentials and mechanisms of action. Frontiers in Nutrition 10 , 1281879 (2024). Keum, N., Lee, D. H., Greenwood, D. C., Manson, J. E. & Giovannucci, E. Vitamin D supplementation and total cancer incidence and mortality: a meta-analysis of randomized controlled trials. Annals of Oncology 30 , 733-743 (2019). https://doi.org/10.1093/annonc/mdz059 Akutsu, N. et al. Regulation of gene expression by 1 alpha,25-dihydroxyvitamin D-3 and its analog EB1089 under growth-inhibitory conditions in squamous carcinoma cells. Molecular Endocrinology 15 , 1127-1139 (2001). https://doi.org/10.1210/me.15.7.1127 Prudencio, J. et al. Action of low calcemic 1 alpha,25-dihydroxyvitamin D-3 analogue EB1089 in head and neck squamous cell carcinoma. Journal of the National Cancer Institute 93 , 745-753 (2001). https://doi.org/10.1093/jnci/93.10.745 Salehi-Tabar, R. et al. Vitamin D receptor as a master regulator of the c-MYC/MXD1 network. Proceedings of the National Academy of Sciences of the United States of America 109 , 18827-18832 (2012). https://doi.org/10.1073/pnas.1210037109 Salehi-Tabar, R. et al. The Tumor Suppressor FBW7 and the Vitamin D Receptor Are Mutual Cofactors in Protein Turnover and Transcriptional Regulation. Molecular Cancer Research 17 , 709 (2019). https://doi.org/10.1158/1541-7786.MCR-18-0991 Lin, R. et al. Expression Profiling in Squamous Carcinoma Cells Reveals Pleiotropic Effects of Vitamin D3 Analog EB1089 Signaling on Cell Proliferation, Differentiation, and Immune System Regulation. Molecular Endocrinology 16 , 1243-1256 (2002). https://doi.org/10.1210/me.16.6.1243 Nandi, D., Tahiliani, P., Kumar, A. & Chandu, D. The ubiquitin-proteasome system. Journal of biosciences 31 , 137-155 (2006). Nawaz, Z. & O'Malley, B. W. Urban renewal in the nucleus: Is protein turnover by proteasomes absolutely required for nuclear receptor-regulated transcription? Molecular Endocrinology 18 , 493-499 (2004). https://doi.org/10.1210/me.2003-0388 Muratani, M. & Tansey, W. R. How the ubiquitin-proteasome system controls transcription. Nature Reviews Molecular Cell Biology 4 , 192-201 (2003). https://doi.org/10.1038/nrm1049 Welcker, M., Orian, A., Grim, J. A., Eisenman, R. N. & Clurman, B. E. A nucleolar isoform of the Fbw7 ubiquitin ligase regulates c-Myc and cell size. Curr. Biol. 14 , 1852-1857 (2004). https://doi.org/10.1016/j.cub.2004.09.083 Mark, K. G. & Rape, M. Ubiquitin‐dependent regulation of transcription in development and disease. EMBO reports 22 , e51078 (2021). Sato, M. et al. MYC is a critical target of FBXW7. Oncotarget 6 , 3292 (2015). Welcker, M. et al. The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-Myc protein degradation. Proceedings of the National Academy of Sciences 101 , 9085-9090 (2004). Yeh, C.-H., Bellon, M. & Nicot, C. FBXW7: a critical tumor suppressor of human cancers. Molecular cancer 17 , 1-19 (2018). Agrawal, N. et al. Exome Sequencing of Head and Neck Squamous Cell Carcinoma Reveals Inactivating Mutations in NOTCH1. Science 333 , 1154-1157 (2011). https://doi.org/10.1126/science.1206923 Nwachuku, K., Johnson, D. E. & Grandis, J. R. in Early Detection and Treatment of Head & Neck Cancers: Theoretical Background and Newly Emerging Research 107-122 (Springer, 2021). Eliana, K., Federica, L., Roya, B. & Abdolrahman, N. Colorectal cancer: a pathology of the colon-rectum and a disease of the genome. Intern. Med 3 , 10.4172 (2013). Prevarskaya, N., Ouadid-Ahidouch, H., Skryma, R. & Shuba, Y. Remodelling of Ca2+ transport in cancer: how it contributes to cancer hallmarks? Philos Trans R Soc Lond B Biol Sci 369 , 20130097 (2014). https://doi.org/10.1098/rstb.2013.0097 Gu, C. et al. FSTL1 interacts with VIM and promotes colorectal cancer metastasis via activating the focal adhesion signalling pathway. Cell Death & Disease 9 , 654 (2018). https://doi.org/10.1038/s41419-018-0695-6 Zhang, J. et al. PODXL, negatively regulated by KLF4, promotes the EMT and metastasis and serves as a novel prognostic indicator of gastric cancer. Gastric Cancer 22 , 48-59 (2019). He, S., Du, W., Li, M., Yan, M. & Zheng, F. PODXL might be a new prognostic biomarker in various cancers: a meta-analysis and sequential verification with TCGA datasets. BMC cancer 20 , 620 (2020). Dai, Y., Li, C., Cheng, S., Wang, H. & Zhuang, X. Bioinformatics and experimental insights into F2RL1 as a key biomarker in cervical cancer diagnosis and prognosis. Scientific Reports 15 , 5228 (2025). https://doi.org/10.1038/s41598-025-89746-y Ossovskaya, V. S. & Bunnett, N. W. Protease-activated receptors: contribution to physiology and disease. Physiological reviews (2004). Islam, F., Gopalan, V., Lu, C. T., Pillai, S. & Lam, A. K. Identification of novel mutations and functional impacts of EPAS1 in colorectal cancer. Cancer Medicine 10 , 5557-5573 (2021). Rawłuszko-Wieczorek, A. A., Horbacka, K., Krokowicz, P., Misztal, M. & Jagodziński, P. P. Prognostic potential of DNA methylation and transcript levels of HIF1A and EPAS1 in colorectal cancer. Molecular cancer research 12 , 1112-1127 (2014). Gao, Q.-Z. et al. Overexpression of AMPD2 indicates poor prognosis in colorectal cancer patients via the Notch3 signaling pathway. World Journal of Clinical Cases 8 , 3197 (2020). Wang, F. et al. High expression of AMPD2 and obesity are associated with poor prognosis in colorectal cancer. International Journal of Clinical and Experimental Pathology 11 , 216 (2018). Chen, S. et al. The emerging role of XBP1 in cancer. Biomedicine & Pharmacotherapy 127 , 110069 (2020). Zhao, Y. et al. XBP1 regulates the protumoral function of tumor-associated macrophages in human colorectal cancer. Signal Transduction and Targeted Therapy 6 , 357 (2021). Légaré, S., Chabot, C. & Basik, M. SPEN, a new player in primary cilia formation and cell migration in breast cancer. Breast Cancer Research 19 , 104 (2017). Vathiotis, I. A. et al. Alpha-smooth muscle actin expression in the stroma predicts resistance to trastuzumab in patients with early-stage HER2-positive breast cancer. Clinical Cancer Research 27 , 6156-6163 (2021). Suzuki, T. et al. Overexpression of TMOD1 is associated with enhanced regional lymph node metastasis in human oral cancer. International journal of oncology 48 , 607-612 (2015). Zhu, Y. et al. Inhibition of ABCB1 expression overcomes acquired docetaxel resistance in prostate cancer. Molecular cancer therapeutics 12 , 1829-1836 (2013). Cao, Y. et al. BMP4 inhibits breast cancer metastasis by blocking myeloid-derived suppressor cell activity. Cancer research 74 , 5091-5102 (2014). Li, H. J. et al. NKX6.1 functions as a metastatic suppressor through epigenetic regulation of the epithelial-mesenchymal transition. Oncogene 35 , 2266-2278 (2016). https://doi.org/10.1038/onc.2015.289 Goldenring, J. R. & Nam, K. T. Rab25 as a tumour suppressor in colon carcinogenesis. Br J Cancer 104 , 33-36 (2011). https://doi.org/10.1038/sj.bjc.6605983 Chen, C. F., Goyette, P. & Lohnes, D. RARgamma acts as a tumor suppressor in mouse keratinocytes. Oncogene 23 , 5350-5359 (2004). https://doi.org/10.1038/sj.onc.1207682 Chen, C. et al. Hypermethylation of EDNRB promoter contributes to the risk of colorectal cancer. Diagn Pathol 8 , 199 (2013). https://doi.org/10.1186/1746-1596-8-199 Shyr, C. R. et al. Tumor suppressor PAX6 functions as androgen receptor co-repressor to inhibit prostate cancer growth. Prostate 70 , 190-199 (2010). https://doi.org/10.1002/pros.21052 Gkikas, D. et al. Nuclear receptor NR5A2 negatively regulates cell proliferation and tumor growth in nervous system malignancies. Proc Natl Acad Sci U S A 118 (2021). https://doi.org/10.1073/pnas.2015243118 Houle, B., Rochette-Egly, C. & Bradley, W. E. Tumor-suppressive effect of the retinoic acid receptor beta in human epidermoid lung cancer cells. Proc Natl Acad Sci U S A 90 , 985-989 (1993). https://doi.org/10.1073/pnas.90.3.985 Mayer, I. A. & Arteaga, C. L. The PI3K/AKT pathway as a target for cancer treatment. Annual review of medicine 67 , 11-28 (2016). Giancotti, F. G. & Ruoslahti, E. Integrin signaling. science 285 , 1028-1033 (1999). Hood, J. D. & Cheresh, D. A. Role of integrins in cell invasion and migration. Nature Reviews Cancer 2 , 91-100 (2002). Lee, J. W. & Juliano, R. Mitogenic signal transduction by integrin-and growth factor receptor-mediated pathways. Molecules and cells 17 , 188-202 (2004). Räsänen, K., Itkonen, O., Koistinen, H. & Stenman, U.-H. Emerging roles of SPINK1 in cancer. Clinical chemistry 62 , 449-457 (2016). Ozaki, N. et al. Serine protease inhibitor Kazal type 1 promotes proliferation of pancreatic cancer cells through the epidermal growth factor receptor. Molecular Cancer Research 7 , 1572-1581 (2009). Ragusa, D. & Vagnarelli, P. Contribution of histone variants to aneuploidy: a cancer perspective. Frontiers in genetics 14 , 1290903 (2023). Shah, M. A., Denton, E. L., Arrowsmith, C. H., Lupien, M. & Schapira, M. A global assessment of cancer genomic alterations in epigenetic mechanisms. Epigenetics & chromatin 7 , 29 (2014). Ferrand, J., Rondinelli, B. & Polo, S. E. Histone variants: guardians of genome integrity. Cells 9 , 2424 (2020). Ghiraldini, F. G., Filipescu, D. & Bernstein, E. Solid tumours hijack the histone variant network. Nature Reviews Cancer 21 , 257-275 (2021). Oh, S. Y. et al. Chromatin remodeling-driven autophagy activation induces cisplatin resistance in oral squamous cell carcinoma. Cell Death & Disease 15 , 589 (2024). Zhang, X., Zhao, M., Chu, T., Wei, J. & Jia, Q. Comprehensive bioinformatics analysis of EXOSC family genes in head and neck squamous cell carcinoma. Scientific Reports 15 , 30361 (2025). Ferrantini, M., Capone, I. & Belardelli, F. Interferon-α and cancer: Mechanisms of action and new perspectives of clinical use. Biochimie 89 , 884-893 (2007). https://doi.org/https://doi.org/10.1016/j.biochi.2007.04.006 Zolfaghari, K. et al. Interferon signaling and STING pathway in head and neck cancers: unlocking immune secrets and therapeutic frontiers. Cancer Cell International 25 , 324 (2025). L Bishop, E., Ismailova, A., Dimeloe, S., Hewison, M. & White, J. H. Vitamin D and immune regulation: antibacterial, antiviral, anti-inflammatory. Journal of Bone and Mineral Research plus 5 , e10405 (2021). Ismailova, A. & White, J. H. Vitamin D, infections and immunity. Reviews in Endocrine and Metabolic Disorders 23 , 265-277 (2022). Poole, B. D., Niewold, T. B., Clark, D. N. & Salloum, R. Interferon alpha in systemic lupus erythematosus. Journal of Biomedicine and Biotechnology 2010 , 948364 (2010). Abdel Galil, S. M., El-Shafey, A. M., Abdul-Maksoud, R. S. & El-Boshy, M. Interferon alpha gene expression and serum level association with low vitamin D levels in Egyptian female patients with systemic lupus erythematosus. Lupus 27 , 199-209 (2018). https://doi.org/10.1177/0961203317716321 Yap, K. S., Northcott, M., Hoi, A. B. Y., Morand, E. F. & Nikpour, M. Association of low vitamin D with high disease activity in an Australian systemic lupus erythematosus cohort. Lupus Science & Medicine 2 , e000064 (2015). https://doi.org/10.1136/lupus-2014-000064 Ben-Zvi, I. et al. The impact of vitamin D on dendritic cell function in patients with systemic lupus erythematosus. PLoS One 5 , e9193 (2010). https://doi.org/10.1371/journal.pone.0009193 Parlato, M. et al. Human ALPI deficiency causes inflammatory bowel disease and highlights a key mechanism of gut homeostasis. EMBO Molecular Medicine 10 , e8483 (2018). https://doi.org/https://doi.org/10.15252/emmm.201708483 Noda, S., Yamada, A., Nakaoka, K. & Goseki-Sone, M. 1-alpha, 25-Dihydroxyvitamin D3 up-regulates the expression of 2 types of human intestinal alkaline phosphatase alternative splicing variants in Caco-2 cells and may be an important regulator of their expression in gut homeostasis. Nutrition Research 46 , 59-67 (2017). Roe, K., Gibot, S. & Verma, S. Triggering receptor expressed on myeloid cells-1 (TREM-1): a new player in antiviral immunity? Frontiers in microbiology 5 , 627 (2014). Giovannucci, E. et al. Prospective Study of Predictors of Vitamin D Status and Cancer Incidence and Mortality in Men. Journal of the National Cancer Institute 98 , 451-459 (2006). https://doi.org/10.1093/jnci/djj101 Feldman, D., Krishnan, A. V., Swami, S., Giovannucci, E. & Feldman, B. J. The role of vitamin D in reducing cancer risk and progression. Nature reviews cancer 14 , 342-357 (2014). Deeb, K. K., Trump, D. L. & Johnson, C. S. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. Nat Rev Cancer 7 , 684-700 (2007). https://doi.org/http://www.nature.com/nrc/journal/v7/n9/suppinfo/nrc2196_S1.html Fan, J. et al. Clinical significance of FBXW7 loss of function in human cancers. Mol Cancer 21 , 87 (2022). https://doi.org/10.1186/s12943-022-01548-2 Ismailova, A. & White, J. H. Vitamin D, infections and immunity. Reviews in Endocrine and Metabolic Disorders (2021). https://doi.org/10.1007/s11154-021-09679-5 Ismailova, A. et al. The interplay between hormonal vitamin D and lipopolysaccharide signaling on human neutrophil transcriptional responses. Frontiers in Immunology 16 , 1683913 (2025). Ismailova, A. et al. Identification of a forkhead box protein transcriptional network induced in human neutrophils in response to inflammatory stimuli. Frontiers in Immunology 14 , 1123344 (2023). Pertea, M., Kim, D., Pertea, G. M., Leek, J. T. & Salzberg, S. L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nature protocols 11 , 1650-1667 (2016). Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. bioinformatics 26 , 139-140 (2010). Hulsen, T. DeepVenn--a web application for the creation of area-proportional Venn diagrams using the deep learning framework Tensorflow. js. arXiv preprint arXiv:2210.04597 (2022). Yu, G., Wang, L.-G., Han, Y. & He, Q.-Y. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics: a journal of integrative biology 16 , 284-287 (2012). Yu, G., Wang, L.-G., Yan, G.-R. & He, Q.-Y. DOSE: an R/Bioconductor package for disease ontology semantic and enrichment analysis. Bioinformatics 31 , 608-609 (2014). Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences 102 , 15545-15550 (2005). Robinson, M. D. & Oshlack, A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome biology 11 , R25 (2010). Cheadle, C., Vawter, M. P., Freed, W. J. & Becker, K. G. Analysis of microarray data using Z score transformation. J Mol Diagn 5 , 73-81 (2003). https://doi.org/10.1016/s1525-1578(10)60455-2 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFiguresTables.pdf Supplementary Figures & Tables SupplementaryDatasetFileTableS1DEGs125Dvs.WT.xlsx Supplementary Dataset File-Table S1- DEGs 1,25D vs. WT SupplementaryDatasetFileTableS2DEGsFBW7KOvs.WT.xlsx Supplementary Dataset File-Table S2- DEGs FBW7 KO vs. WT SupplementaryDatasetFileTableS3DEGsFBW7KO125Dvs.WT125D.xlsx Supplementary Daset File-Table S3- DEGs FBW7 KO 1,25D vs. WT 1,25D Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 11 May, 2026 Reviews received at journal 06 May, 2026 Reviews received at journal 15 Apr, 2026 Reviewers agreed at journal 13 Apr, 2026 Reviewers agreed at journal 13 Apr, 2026 Reviewers invited by journal 13 Apr, 2026 Editor assigned by journal 07 Apr, 2026 Editor invited by journal 02 Apr, 2026 Submission checks completed at journal 31 Mar, 2026 First submitted to journal 31 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9181172","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":623688905,"identity":"f67d9eb1-07de-45c0-b673-432c88af15db","order_by":0,"name":"Reyhaneh Salehi Tabar","email":"","orcid":"","institution":"McGill University","correspondingAuthor":false,"prefix":"","firstName":"Reyhaneh","middleName":"Salehi","lastName":"Tabar","suffix":""},{"id":623688906,"identity":"e998ac8b-b4fa-41a6-bc0a-5e19066aa9a6","order_by":1,"name":"Aiten Ismailova","email":"","orcid":"","institution":"McGill University","correspondingAuthor":false,"prefix":"","firstName":"Aiten","middleName":"","lastName":"Ismailova","suffix":""},{"id":623688907,"identity":"f9c1031a-c95d-42bb-b08f-f668aa358a69","order_by":2,"name":"Zoe Carter","email":"","orcid":"","institution":"McGill University","correspondingAuthor":false,"prefix":"","firstName":"Zoe","middleName":"","lastName":"Carter","suffix":""},{"id":623688908,"identity":"dc3e455b-1be8-4f77-b97d-6dc8440aadf8","order_by":3,"name":"John H. White","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYBACxgYeEHUASDIfADIkZPiI1sLDwJYA0sLDRtgeiBYgxWMA5hLUwtzee+wBY9sdGXv2nq8bfvyyAGphfvgBr8N6zqUbMLY94+HhObvtZm8fyGFsxhJ4tczIMZNg3HaYh0cid9ttxh6QFh4GIrXIv3kG08L8g0hbeNhuM/wAa2HDb0vPGTOJxH9ALWfSzG72NgC1MLOZWeDTYtjeYybx4cxhe/b2w89u/PhTJ8fP3vz4Bl4tDUAiAW5nG5BgxqceCORRuX8IKB8Fo2AUjIIRCQCng0D2Xiq7EgAAAABJRU5ErkJggg==","orcid":"","institution":"McGill University","correspondingAuthor":true,"prefix":"","firstName":"John","middleName":"H.","lastName":"White","suffix":""}],"badges":[],"createdAt":"2026-03-20 17:38:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9181172/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9181172/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107487579,"identity":"2bb04261-d3a1-45cd-a342-be1fbd7b9a89","added_by":"auto","created_at":"2026-04-22 02:42:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":200829,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eSchematic representation of the \u003cem\u003eFBW7 \u003c/em\u003egene structure and protein domains. The CRISPR/Cas9-generated mutation was in exon c7 (asterisk) in sequence encoding the WD40 domains. \u003cstrong\u003eB. \u003c/strong\u003e(i) Agarose gel analysis of PCR fragments amplified from wild-type and \u003cem\u003eFBW7\u003c/em\u003e-mutated SCC25 cells (see Fig. 1A). (ii) RT/qPCR analysis of \u003cem\u003eFBW7 \u003c/em\u003emRNA expression in wild-type and FBW7-mutated cells in the absence and presence of 1,25D (D). RT/qPCR analysis of \u003cem\u003eCYP24A1\u003c/em\u003e, \u003cem\u003eCAMP \u003c/em\u003e\u003cstrong\u003e(C)\u003c/strong\u003e\u003cem\u003e \u003c/em\u003eand\u003cem\u003e VDR \u003c/em\u003e\u003cstrong\u003e(D)\u003c/strong\u003e in control-treated (C),\u003cstrong\u003e \u003c/strong\u003e1,25D-treated (D),\u003cstrong\u003e \u003c/strong\u003eFBW7 depleted (KO) and 1,25D-treated FBW7 depleted cells (KO+D). Graphics representative of 3 biological replicates. Graphics are mean ± SD from 3 technical replicates from a representative sample and one-way ANOVAs were used to determine significance (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 and ns ≥0.05). \u003cstrong\u003eE. \u003c/strong\u003eWestern blotting of VDR expression in wild-type and \u003cem\u003eFBW7\u003c/em\u003e-depleted cells. \u003cstrong\u003eF.\u003c/strong\u003e Principal component analysis of triplicate untreated control cells, 1,25D-treated control cells,\u003cstrong\u003e \u003c/strong\u003eFBW7 depleted and 1,25D-treated FBW7 depleted cells. (See uncropped gel images in Supplementary Fig. S4) \u003cstrong\u003eG.\u003c/strong\u003e Table of differentially expressed genes (DEGs) regulated 1.5-fold (p\u0026lt;0.05) by 1,25D and KO alone relative to control as well as by 1,25D-treated KO cells relative to KO. \u003cstrong\u003eH.\u003c/strong\u003e Venn diagrams of 1.5-fold regulated gene expression changes in cells treated by 1,25D (yellow), FBW7-depleted cells (green), and 1,25D-treated KO cells (aqua).\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/8010e3a38d008559e0e120d0.png"},{"id":107358450,"identity":"1f41b0f6-38aa-413d-a028-fd2a0638fbdc","added_by":"auto","created_at":"2026-04-20 17:33:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":82367,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eRegulation of top 50 1,25D-inducible genes in control and FBW7-depleted cells. \u003cstrong\u003eB\u003c/strong\u003e. Regulation of top 50 1,25D-repressed genes in control and FBW7-depleted cells. \u003cstrong\u003eC, D.\u003c/strong\u003e RT/qPCR analysis of a subset of genes from A-B. The changes in fold regulation are shown as insets in each figure.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/79c34dee761c0afa625583f6.png"},{"id":107358452,"identity":"383b1615-3147-48ca-a3c1-fbf97862bbeb","added_by":"auto","created_at":"2026-04-20 17:33:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":257028,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eDotplot of enriched GO biological pathways as determined by Gene set enrichment analysis (GSEA) in FBW7-depleted cells relative to control. FDR = False discovery rate. Gene ratio refers to the ratio of differentially expressed genes (DEGs) being up or downregulated relative to the total number of DEGs within a pathway. \u003cstrong\u003eB. \u003c/strong\u003eHeatmap of regulation of genes within the ‘Epithelial cell development’ category in the absence and presence of 1,25D and in control and FBW7 depleted cells. Upregulated DEGs within the category are depicted as orange, and those downregulated are blue. \u003cstrong\u003eC.\u003c/strong\u003e Heatmap of regulation of genes encoding histones in the absence and presence of 1,25D and in control and FBW7 depleted cells.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/a0fa21eba9b0e8d86da5156c.png"},{"id":107358454,"identity":"a5d74b2d-1afb-4a8d-9790-fba10bb9a9aa","added_by":"auto","created_at":"2026-04-20 17:33:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":537702,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eDotplot of enriched hallmark pathways as determined by GSEA in 1,25D-treated cells relative to control.\u003cstrong\u003e B. \u003c/strong\u003eWestern blotting of cMYC protein and cMYC antagonist MXD1 expression in the absence and presence of 1,25D in control and FBW7 KO cells. Heatmaps of regulation of genes encoding Myc targets. (See uncropped gel images in Supplementary Fig. S4) (\u003cstrong\u003eC\u003c/strong\u003e), cyclins and cyclin dependent kinases (\u003cstrong\u003eD\u003c/strong\u003e) and interferon α-responsive proteins (\u003cstrong\u003eE\u003c/strong\u003e) in the absence and presence of 1,25D and in control and FBW7 depleted cells.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/7383a17486f75b111bc344fd.png"},{"id":107487344,"identity":"87536be4-0900-4dca-84f7-e6fbe89965f4","added_by":"auto","created_at":"2026-04-22 02:41:02","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":327573,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eEnriched disease ontologies in 1,25D-treated control and FBW7-depleted cells relative to control and FBW7 KO, respectively. \u003cstrong\u003eB-D.\u003c/strong\u003e Heatmaps of 1,25D-regulated pathways in control and FBW7 KO cells.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/5c67f8f59259e233a47440b5.png"},{"id":107489220,"identity":"fb13f147-c3d9-42ae-8a43-67f11475e1c3","added_by":"auto","created_at":"2026-04-22 02:46:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1970453,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/b7a0d2b5-71b5-4da5-a99b-0fa57bc5c4fa.pdf"},{"id":107358447,"identity":"d1032006-dd64-4f43-a948-aea76ba5be8f","added_by":"auto","created_at":"2026-04-20 17:33:01","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":939745,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figures \u0026amp; Tables\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"SupplementaryFiguresTables.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/827541530d8f033766bec6a8.pdf"},{"id":107486600,"identity":"59d203dc-e438-4c40-9701-0734f5b1bfb5","added_by":"auto","created_at":"2026-04-22 02:38:27","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":445656,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Dataset File-Table S1- DEGs 1,25D vs. WT\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"SupplementaryDatasetFileTableS1DEGs125Dvs.WT.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/9f1efcd2ca788f4c4e511175.xlsx"},{"id":107485031,"identity":"448b55e7-7562-4adf-82d3-d65bf8978b0d","added_by":"auto","created_at":"2026-04-22 02:33:32","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":510637,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Dataset File-Table S2- DEGs FBW7 KO vs. WT\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"SupplementaryDatasetFileTableS2DEGsFBW7KOvs.WT.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/61dff0ae074b9f300c657fe9.xlsx"},{"id":107487451,"identity":"1fe6ce12-9578-47ac-b39b-a8bc96575c1b","added_by":"auto","created_at":"2026-04-22 02:41:48","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":507581,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Daset File-Table S3- DEGs FBW7 KO 1,25D vs. WT 1,25D\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"SupplementaryDatasetFileTableS3DEGsFBW7KO125Dvs.WT125D.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9181172/v1/9bcd21d766a1e79292dd6585.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Loss of expression of the E3 ligase and tumour suppressor FBW7 attenuates vitamin D signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWhile originally identified for its critical role in calcium homeostasis, vitamin D is now known to exert a range of physiological functions \u003csup\u003e1,2\u003c/sup\u003e. These include regulation of the innate and adaptive arms of the immune system. Vitamin D has also been investigated for its potential roles in cancer prevention and therapy. It is obtained from the diet or by photochemical and thermal conversion of the cholesterol precursor 7-dehydrocholesterol in the presence of sufficient solar ultraviolet B (UVB) irradiation \u003csup\u003e1,2\u003c/sup\u003e. While it may seem that vitamin D should be readily available, deficiency is a widespread problem. Dietary sources are limited and in many populations sun exposure is the main source of vitamin D. However, UVB is absorbed during passage through the ozone layer, and at sea level substantial cutaneous vitamin D synthesis occurs only when the sun is above 45\u0026deg;C; so-called vitamin D winter can last several months at temperate latitudes \u003csup\u003e3\u003c/sup\u003e. In the absence of sufficient supplementation, circulating vitamin D metabolite levels thus vary seasonally \u003csup\u003e4\u003c/sup\u003e. Moreover, cutaneous vitamin D production is dependent on skin color and declines with age \u003csup\u003e5\u003c/sup\u003e. These factors, coupled with sun avoidance and conservative dress, can lead to vitamin D deficiency in several populations worldwide \u003csup\u003e6\u0026ndash;9\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eVitamin D obtained from the sun, diet or supplementation must undergo sequential hydroxylations, first at the 25 position of the cholesterol sidechain followed by tightly regulated 1α hydroxylation to produce the biologically active form 1,25-dihydroxyvitamin D (1,25D). 1,25D binds to and regulates the vitamin D receptor (VDR), a member of the nuclear receptor family of ligand-regulated transcription factors. In the presence of 1,25D, the VDR heterodimerizes with related retinoid X receptors and transactivates gene transcription by binding to cognate vitamin D response elements (VDREs). The hormone-bound VDR can also repress gene transcription by several, heterogenous mechanisms \u003csup\u003e10\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThe VDR and the critical 25-hydroxyvitamin D 1α-hydroxylase enzyme CYP27B1 are expressed in numerous tissues throughout the body \u003csup\u003e11\u003c/sup\u003e. Notably, 1,25D signaling has pro-differentiating and antiproliferative activities in a number of cell types and there is epidemiological evidence that maintaining vitamin D sufficiency is cancer preventive \u003csup\u003e12,13\u003c/sup\u003e. Typical of many findings, a recent scoping review provided evidence of links between vitamin D deficiency and an increased risk of oral cancer \u003csup\u003e12\u003c/sup\u003e. Intervention trials have given mixed results but are fraught with complications because of limited dosing in some cases and the fact that vitamin D is an essential nutrient, thus complicating placebo wings. Prevention trials are also compromised by their relatively short duration. Nonetheless, a meta-analysis of randomized, placebo-controlled trials concluded that vitamin D supplementation significantly reduced total cancer mortality but did not reduce total cancer incidence \u003csup\u003e14\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe potential of the anticancer properties of vitamin D signaling are supported by numerous preclinical studies of several cancer models \u003csup\u003e1\u003c/sup\u003e. While 1,25D or its analogues have shown encouraging efficacy in such studies, they have failed as cancer therapeutics because of acquired tumour resistance even though in most instances VDR expression is maintained. We have been interested in studying the anticancer properties of 1,25D (analogues) using mouse and human head and neck squamous cell carcinoma (HNSCC) as models \u003csup\u003e15\u0026ndash;18\u003c/sup\u003e. In human SCC25 HNSCC cells, 1,25D is antiproliferative and induces a more differentiated state \u003csup\u003e15,19\u003c/sup\u003e. Biochemical studies have revealed a striking functional relationship between the VDR and the F box protein FBW7 (FBXW7/Sel-10/Ago/hCDC4) in HNSCC cells \u003csup\u003e18\u003c/sup\u003e. FBW7 is a subunit of SCF E3 ligase complexes (Skp1, Cullin-1, F box protein), which are key components of the ubiquitin proteasome system (UPS) as they catalyze the ubiquitination of substrates destined for degradation by the 26S proteasome. The UPS regulates numerous fundamental biological processes, including cell cycle progression, antigen processing, cellular defense, signaling pathways and gene transcription \u003csup\u003e20\u0026ndash;22\u003c/sup\u003e. FBW7 is expressed in multiple isoforms of which α and γ are nuclear \u003csup\u003e23\u003c/sup\u003e. Our initial interest was in the role of FBW7 in the accelerated proteasomal turnover of the oncogenic transcription factor c-MYC observed in 1,25D-treated cells \u003csup\u003e17,18\u003c/sup\u003e. While 1,25D reduces expression of c-MYC in a manner partially dependent on FBW7, c-Myc accumulates in \u003cem\u003eVdr\u003c/em\u003e-null mice \u003csup\u003e17\u003c/sup\u003e. Unexpectedly, we also found that FBW7 is required for optimal transactivation by the hormone-bound VDR; FBW7, along with proteasomal subunits, was recruited to the DNA-bound VDR and FBW7 ablation substantially reduced transactivation of selected VDR target genes \u003csup\u003e18\u003c/sup\u003e. While expression of numerous transcription factors is controlled by proteasomal turnover \u003csup\u003e24\u003c/sup\u003e, the VDR does not appear to be a substrate of FBW7 even though the two proteins interact \u003csup\u003e18\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe best characterized FBW7 target is c-MYC; downregulation of FBW7 results in accumulation of cellular and chromatin-bound c-MYC \u003csup\u003e25\u003c/sup\u003e. In addition, FBW7 controls the turnover of several other proteins that drive cell cycle progression through recognition of \u0026ldquo;phosphodegron\u0026rdquo; motifs (consensus T/S-P-X-X-S/T/E), which are phosphorylated by GSK3β \u003csup\u003e26\u003c/sup\u003e. Consistent with this, FBW7 is a tumour suppressor and is one of the most frequently dysregulated UPS components in cancer \u003csup\u003e27\u003c/sup\u003e, including HNSCC \u003csup\u003e28,29\u003c/sup\u003e. Its functional relationship with the VDR is thus fascinating because its mutation may provide a mechanism of acquired resistance to 1,25D or its analogues. Indeed, ablation of FBW7 strongly impaired the antiproliferative activity of 1,25D in HNSCC cells \u003csup\u003e18\u003c/sup\u003e. Here, we have investigated broadly the interplay between FBW7 and vitamin D signaling by generating an SCC25 HNSCC variant in which FBW7 expression has been ablated by CRISPR/Cas genome editing and have analyzed its effects on 1,25D-regulated gene expression by RNAseq.\u0026nbsp;We find that FBW7 ablation has multiple effects on SCC25 gene expression, consistent with its role as a tumour suppressor. We also find that FBW7 loss attenuates the induction of the vast majority of genes regulated by 1,25D, both activated and repressed. Accordingly, several signaling mechanisms regulated by 1,25D are attenuated in FBW7-deficient cells. Our results suggest that loss of tumour suppressor FBW7 function during cancer progression provides a mechanism of acquired resistance to vitamin D signaling.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAblation of FBW7 expression in SCC25 cells\u003c/h2\u003e \u003cp\u003eTo disrupt FBW7 expression we used CRISPR/Cas genome editing (see Materials and Methods for details). The gene encoding FBW7 has multiple 5\u0026rsquo; exons specific to each isoform (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Guide RNAs were generated that targeted exon c7, which encodes sequence lying in the WD40 domains and is common to all isoforms (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The WD40 domains contain the phosphodegron binding repeats and are hotspots for mutations in cancer \u003csup\u003e30\u003c/sup\u003e. The clone selected for RNAseq is homozygous for a 37 bp deletion and exhibits strongly reduced \u003cem\u003eFBW7\u003c/em\u003e mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Note that we did not test for endogenous protein expression because available antibodies against FBW7 are unreliable. Consistent with siRNA knockdown \u003csup\u003e18\u003c/sup\u003e, \u003cem\u003eFBW7\u003c/em\u003e ablation led to severely compromised induction of VDR target genes \u003cem\u003eCYP24A1\u003c/em\u003e and \u003cem\u003eCAMP\u003c/em\u003e in the presence of 1,25D (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). In control experiments, using control genes \u003cem\u003eCYP24A1\u003c/em\u003e and \u003cem\u003eCAMP\u003c/em\u003e, we found was no substantial effect on 1,25D-regulated gene expression in transduced cell lines where \u003cem\u003eFBW7\u003c/em\u003e gene editing failed (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Moreover, the attenuated response to 1,25D in \u003cem\u003eFBW7\u003c/em\u003e-ablated cells was not due to loss of VDR gene or protein expression under any of the conditions tested (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD,E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo determine as broadly as possible the effects of FBW7 ablation on gene expression in SCC25 cells and on 1,25D signaling we performed in triplicate comparative RNAseq analyses in control and FBW7-ablated cells cultured in the presence of vehicle or 100nM 1,25D for 16h. Principal component analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF) showed that gene expression patterns were highly similar between triplicates and that FBW7 ablation and/or 1,25D treatment produced distinct sets of regulated genes. Several hundred genes were differentially regulated by at least 1.5-fold when comparing vehicle- to 1,25D-treated control cells or control cells to those lacking FBW7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). In contrast, treatment of FBW7 KO (knockout) cells with 1,25D produced a more limited set of differentially up- or downregulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG), with substantial but incomplete overlap with those regulated by 1,25D in control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). In both control and FBW7-depleted cells, 1,25D treatment led to activation of the vitamin D receptor pathway as determined by GSEA Wiki Pathways analysis (normalized enrichment scores in control and FBW7 cells are 2.79 [p-adjusted value: 3.64e-10] and 2.43 [p-adjusted value: 1.0e-05], respectively).\u003c/p\u003e \u003cp\u003eUpon examination of DEGs regulated within the VDR pathway by a heatmap, 1,25D treatment in FBW7 KO cells led to attenuated regulation of several 1,25D-VDR target genes relative to 1,25D-treated control cells (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). To probe the effects of FBW7 loss further, we compared the fold regulation of the top 50 most 1,25D-inducible genes in control and FBW KO cells. This revealed that, for 45 of the 50 genes, fold induction by 1,25D was partially or strongly reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). A similar inhibitory effect of FBW7 ablation was observed on genes downregulated by 1,25D signaling (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Differential regulation of a subset of upregulated and downregulated genes was validated independently by RT/qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, D). As expected, one of the top upregulated genes whose expression was diminished was \u003cem\u003eCAMP\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). FBW7 ablation decreased both the basal expression and induction by 1,25D of \u003cem\u003eCAMP.\u003c/em\u003e It can be argued that the loss of effect of 1,25D on \u003cem\u003eCAMP\u003c/em\u003e expression may be due to the loss of expression/activity of a cooperating transcription factor given the reduced basal expression. However, depletion of FBW7 had a wide range of effects on basal expression of 1,25D target genes. Notably, fold regulation by 1,25D of the \u003cem\u003eALP 1\u003c/em\u003e and \u003cem\u003eFEZF1\u003c/em\u003e genes was also diminished in the absence of FBW7 even though their basal expression increased substantially (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAlthough KO does not substantially affect VDR expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), another possible mechanism underlying attenuated 1,25D signaling would be suppressed expression of RXR heterodimeric partners. While \u003cem\u003eRXRG\u003c/em\u003e encoding RXRγ is listed as a downregulated DEG, analysis of RNAseq data revealed that its expression is very weak (Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eA). Western blotting of RXRα, by far the most strongly expressed VDR heterodimeric partner (\u003cem\u003eRXRA\u003c/em\u003e, Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eA), revealed that its expression was not affected by knockdown (Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eB). Taken together, the above results indicate that attenuation of 1,25D-dependent gene regulation does not appear to be due to loss of the VDR or its major heterodimeric partner. They also show that FBW7 ablation broadly inhibits 1,25D-regulated gene expression in SCC25 cells.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFBW7 loss induces pro-tumourigenic signaling pathways\u003c/h3\u003e\n\u003cp\u003eTo further examine the consequences of FBW7 loss on SCC25 cell gene expression and on signaling by 1,25D, we performed pathways analyses to identify changes in gene expression signatures associated with molecular signaling pathways. We focused initially on the effects of FBW7 ablation. Gene set enrichment analysis (GSEA) for Gene Ontology biological processes revealed downregulated pathways related to innate immune responses, calcium ion transport into cytosol, migration and chemotaxis when FBW7 was ablated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Similarly, Ingenuity Pathway Analysis (IPA) of enriched diseases and functions uncovered suppression of cell movement and calcium ion transport with FBW7 loss (Table S5). Interestingly, cancer cells evade apoptosis via decreasing calcium influx into the cytosol \u003csup\u003e31\u003c/sup\u003e. Conversely, epithelial cell development appeared as upregulated in FBW7-depleted cells. To further investigate this, we produced a heatmap of differentially expressed genes (DEGs) within the epithelial cell development category, which included the effects of 1,25D (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). FBW7 ablation induced expression of a subset of genes (enclosed in red) that were not substantially regulated by 1,25D. These include several genes that encoded proteins involved in tumour promotion such as \u003cem\u003eVIM\u003c/em\u003e and \u003cem\u003ePODXL\u003c/em\u003e, associated with the epithelial-to-mesenchymal transition and accelerated tumour growth \u003csup\u003e32\u0026ndash;34\u003c/sup\u003e, \u003cem\u003eFSRL1\u003c/em\u003e, a biomarker for cervical cancer diagnosis \u003csup\u003e35,36\u003c/sup\u003e, \u003cem\u003eEPAS1, AMPD2\u003c/em\u003e and \u003cem\u003eXBP1\u003c/em\u003e, biomarkers of colorectal cancer \u003csup\u003e37\u0026ndash;42\u003c/sup\u003e, as well as \u003cem\u003eRFX3\u003c/em\u003e and \u003cem\u003eIL6ST\u003c/em\u003e, which are molecular drivers of breast cancer and drug resistance to tumours \u003csup\u003e43,44\u003c/sup\u003e. The only exceptions were \u003cem\u003eTMOD1\u003c/em\u003e and \u003cem\u003eABCB1\u003c/em\u003e, which are implicated in tumourigenesis \u003csup\u003e45,46\u003c/sup\u003e and are induced with 1,25D but not suppressed with FBW7 loss. Conversely, FBW7 depletion repressed a subset of genes that are not similarly regulated by 1,25D (enclosed in blue). These include genes that encoded proteins involved in tumour suppression such as the metastatic suppressors \u003cem\u003eBMP4\u003c/em\u003e and \u003cem\u003eNFX6-1\u003c/em\u003e \u003csup\u003e47,48\u003c/sup\u003e and the tumour suppressors \u003cem\u003eRAB25, RARG, EDNRB\u003c/em\u003e and \u003cem\u003ePAX6\u003c/em\u003e \u003csup\u003e49\u0026ndash;52\u003c/sup\u003e. There were a few exceptions with \u003cem\u003eNR5A2\u003c/em\u003e and \u003cem\u003eRARB\u003c/em\u003e, nuclear receptors that function as negative regulators of tumour growth \u003csup\u003e53,54\u003c/sup\u003e, which were similarly downregulated with 1,25D and by FBW7 loss.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe also found that pathways involved in actin-based motility, histone and DNA methylation, phosphoinositide 3-kinase (PI3K)/AKT signaling, integrin signaling and SPINK1 pancreatic cancer were activated in FBW7 KO cells as demonstrated by IPA enrichment for canonical pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Aberrant activation of PI3K/AKT signaling is associated with cellular transformation, tumourigenesis, cancer progression, and drug resistance \u003csup\u003e55\u003c/sup\u003e. Increased signaling of the extracellular matrix through its receptors, the integrins, was previously shown to contribute to cancer cell survival and resistance to chemotherapy \u003csup\u003e56\u0026ndash;58\u003c/sup\u003e. SPINK1 is a growth factor and inhibitor of apoptosis in several cancers \u003csup\u003e59\u003c/sup\u003e, and in human pancreatic cancer, SPINK1 promotes proliferation by inducing EGFR phosphorylation and subsequent downstream activation of the mitogen-activated protein kinase pathway \u003csup\u003e60\u003c/sup\u003e. In contrast, multiple pathways related to immune signaling and signaling by thyroid hormone (TR), PPAR and LXR nuclear receptors were strongly downregulated by \u003cem\u003eFBW7\u003c/em\u003e ablation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). While these receptors and the VDR share common heterodimeric partners, RXRs, as stated above it is unlikely that their attenuated signaling is due to loss of RXR expression.\u003c/p\u003e \u003cp\u003eTo investigate regulation of genes encoding histones, we generated a heatmap of DEGs within the histone category, which included the effects of 1,25D (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Interestingly, nearly all genes encoding histones were induced when FBW7 was ablated, and these effects were independent of 1,25D (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). This is noteworthy as genes encoding histones are overexpressed in various cancers, which indicate a requirement for higher amounts of histones in proliferating cells undergoing high rates of replication, such as in cancer cells \u003csup\u003e61\u0026ndash;64\u003c/sup\u003e. The sole exception was with \u003cem\u003eH2AC25\u003c/em\u003e, which is linked with shorter survival in oral squamous cell carcinoma \u003csup\u003e65\u003c/sup\u003e. Consistent with its induction of tumour promoting and proliferative histone genes, several enriched diseases and functions related to various cancers, which include development of head and neck tumours, were activated in FBW7 depleted cells (Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eRegulation of cell cycle drivers by 1,25D signaling\u003c/h3\u003e\n\u003cp\u003eA similar analysis was performed to identify 1,25D-regulated pathways. 1,25D appeared to broadly suppress transcription of Myc target genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). However, this effect was attenuated in FBW7-depleted cells. cMYC protein levels in the absence and presence of 1,25D were elevated relative to controls in FBW7 KO cells and expression of cMYC antagonist MXD1 induced by 1,25D was lost in the absence of FBW7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). While 1,25D broadly suppressed transcription of Myc target genes in control cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), the degree of their repression in the presence of 1,25D was generally reduced in FBW7 KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). The only exception is the \u003cem\u003eEXOSC5\u003c/em\u003e gene, which encodes a protein correlated with advanced clinical stage of head and neck squamous cell carcinoma \u003csup\u003e66\u003c/sup\u003e. Its expression was downregulated by 1,25D or FBW7 ablation and further inhibited by 1,25D in KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). In the absence of 1,25D, expression of roughly half of cMYC target genes was modestly or substantially upregulated in FBW7 KO cells, whereas expression of the remainder was lower, consistent with effects on FBW7 loss on cMYC target genes independent of cMYC expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e1,25D treatment and FBW7 KO both strongly affect the expression of cyclins and cyclin-dependent kinases (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Expression of several of these genes whose elevated levels are associated with tumourigenesis was inhibited by 1,25D (for example, the \u003cem\u003eCCNA1\u003c/em\u003e and \u003cem\u003eCCND2\u003c/em\u003e genes encoding cyclins A and D2, respectively), consistent with antiproliferative properties of 1,25D. Effects of 1,25D on genes encoding cyclins or related proteins that are negative regulators of the cell cycle was more mixed. \u003cem\u003eCCNG2\u003c/em\u003e, encoding inhibitory cyclin G2, was strongly upregulated, whereas other related genes were modestly downregulated. FBW7 KO substantially disrupted basal expression of this gene set, with expression of 14 of the 23 genes strongly upregulated while that of 9 of 23 genes was downregulated. Upregulated genes encoded several proteins implicated in tumourigenesis (e.g. cyclins A1, D2 and J). However, expression of CDKN1A, encoding CDK inhibitor p21\u003csup\u003eWAF1/CIP1\u003c/sup\u003e was also strongly upregulated.\u003c/p\u003e \u003cp\u003eBoth 1,25D treatment and FBW7 KO also robustly affect expression of genes within the interferon alpha (IFN-α) response (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Expression of most of these genes were downregulated by 1,25D and even more inhibited in the KO (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). The antitumourigenic and antiproliferative functions of IFN-α are documented \u003csup\u003e67,68\u003c/sup\u003e and it has been used as monotherapy or adjuvant treatment before chemotherapy to improve efficacy against HNSCC tumours \u003csup\u003e68\u003c/sup\u003e. Suppression of the antitumour IFN-α response in KO cells is consistent with the previously mentioned enriched tumour promoting pathways and genes. However, it is unclear why the IFN-α response is inhibited in response to antiproliferative 1,25D. One explanation may be due to well-known role of 1,25D signaling in suppressing inflammation \u003csup\u003e69,70\u003c/sup\u003e, and the IFN-α pathway is often upregulated and promotes pathogenesis of autoimmune conditions such as systemic lupus erythematosus (SLE) \u003csup\u003e71\u003c/sup\u003e. Notably, there is a negative correlation between circulating 25D levels and IFN-α serum level in SLE patients \u003csup\u003e72,73\u003c/sup\u003e and 1,25D was shown to suppress expression of IFN-α induced genes in these patients \u003csup\u003e74\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003eEffects of 1,25D signaling are suppressed with FBW7 ablation\u003c/h3\u003e\n\u003cp\u003eNext, we evaluated the effects of 1,25D signaling in FBW7 depleted cells. Disease ontology enrichment revealed loss of enrichment of several pathways related to infectious and autoimmune conditions in 1,25D-treated FBW7 depleted cells relative to 1,25D-exposed control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Consistent with this, FBW7 loss decreased regulation (activation and suppression) of 1,25D-regulated canonical pathways (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, C). As 1,25D is anti-inflammatory and anti-microbial \u003csup\u003e69\u003c/sup\u003e, we were interested in determining how 1,25D-regulated immune and inflammatory pathways were affected in the KO. Interestingly, FBW7 loss dampened 1,25D-induced signaling of innate immune responses and 1,25D-attentuated inflammation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). For instance, the pathways included KO-mediated suppression of 1,25D-induced expression of anti-microbial \u003cem\u003eCAMP\u003c/em\u003e, \u003cem\u003eALPI\u003c/em\u003e, an anti-inflammatory metalloenzyme that attenuates TLR4 agonist activity \u003csup\u003e75\u003c/sup\u003e previously shown to be regulated by 1,25D in Caco-2 cells \u003csup\u003e76\u003c/sup\u003e, and \u003cem\u003eTREM1\u003c/em\u003e, a triggering receptor that demonstrates antiviral activity \u003csup\u003e77\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eA combination of preclinical data and epidemiological studies have provided evidence that vitamin D deficiency increases the risk of cancer development \u003csup\u003e78\u0026ndash;80\u003c/sup\u003e. Notably, a large prospective study showed that vitamin D sufficiency correlated with reduced total incidence and mortality from leukemias and digestive cancers \u003csup\u003e78\u003c/sup\u003e. The findings are significant as vitamin D deficiency remains a widespread problem. Most western diets are vitamin D-poor and combinations of inadequate solar UVB, sun avoidance, conservative dress and dark skin colour contribute to vitamin D deficiency in several populations in the absence of adequate supplementation \u003csup\u003e6\u0026ndash;9\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCollectively, the above observations along with earlier findings spurred our interest in studying the anti-cancer properties of vitamin D signaling. We originally chose to study SCC25 cells as a model to test the potential cancer-preventive actions of vitamin D. Although derived from a tumour of the oral cavity, SCC25 cells are well differentiated and sensitive to the antiproliferative activity of 1,25D and its analogues \u003csup\u003e15,19\u003c/sup\u003e. Findings presented above substantiate the potential of vitamin D as an anticancer agent. For example, pathways analysis revealed that 1,25D signaling suppressed the expression of several genes regulated by the oncogenic transcription factor cMYC and regulated the expression of cyclins and cyclin-dependent kinase genes in manner consistent with cell cycle arrest. Previous work also showed that 1,25D signaling induced a more differentiated phenotype in SCC25 cells, notably by suppressing the expression of N-cadherin a marker of epithelial-mesenchymal transition \u003csup\u003e19\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eDespite substantial evidence that maintenance of vitamin D sufficiency reduces cancer risk, 1,25D analogues have failed in cancer monotherapies because of acquired tumour resistance. Our present results are consistent with loss of \u003cem\u003eFBW7\u003c/em\u003e expression being one of the mutations contributing to vitamin D resistance. The \u003cem\u003eFBW7\u003c/em\u003e gene encodes a well-characterized tumour suppressor that is frequently dysregulated in cancer \u003csup\u003e27\u003c/sup\u003e, including HNSCC \u003csup\u003e28,29\u003c/sup\u003e. Other findings have noted that \u003cem\u003eFBW7\u003c/em\u003e mutations also correlate with resistance to other chemotherapeutic agents \u003csup\u003e81\u003c/sup\u003e. Our previous studies showed that the VDR and FBW7 function as cofactors; they interact in a partially 1,25D-dependent manner and FBW7 and other proteasomal subunits are recruited to genes whose expression is stimulated by 1,25D. We initially identified FBW7 as a VDR cofactor that contributed to the accelerated proteasomal turnover of cMYC observed in 1,25D-treated SCC25 cells \u003csup\u003e17,18\u003c/sup\u003e. We provided evidence that this occurs via 1,25D-dependent recruitment of FBW7 and the proteasome to DNA-bound cMYC. These findings provided a novel but highly specific mechanism of 1,25D-dependent repression of gene transcription. Unlike transactivation, which is generally initiated by VDR/RXR heterodimers binding to VDREs in regulatory regions of target genes, mechanisms of transrepression by the VDR are much more heterogeneous \u003csup\u003e10\u003c/sup\u003e. Therefore, in studies presented above, the observation that repression of gene transcription by 1,25D was generally attenuated in cells lacking FBW7 was unexpected (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The widespread reduction of fold regulation of 1,25D-induced genes was less of a surprise given that mechanisms of direct target gene regulation by the VDR are more homogeneous.\u003c/p\u003e \u003cp\u003eBioinformatic analyses presented above of the effects of FBW7 loss on gene expression and 1,25D signaling in SCC25 cells are consistent with its role as a tumour suppressor and a key cofactor of vitamin D signaling. Regulation of canonical pathways up- or downregulated by 1,25D was generally reduced in FBW7-deficient cells. Unsurprisingly, given the role of the VDR and FBW7 in regulating cMYC, inhibition by 1,25D of expression of target genes of cMYC, a driver of cell cycle progression, was generally attenuated by knockout of FBW7. There was also dysregulation of several genes encoding cyclins and cyclin-dependent kinases, largely consistent with enhanced cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In addition, the major GO biological pathway upregulated in FBW7-depleted cells was \u0026ldquo;epithelial cell development\u0026rdquo;, in which expression of several genes associated with tumour progression was enhanced, whereas that of genes associated with tumour suppression was inhibited (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). FBW7 depletion also upregulated the expression of several genes encoding histones in a manner that was essentially independent of vitamin D signaling.\u003c/p\u003e \u003cp\u003eMuch of the focus of the current study was on the potential effects of FBW7 loss on the anticancer properties of 1,25D signaling. However, 1,25D is also a major regulator of innate immune pathways in epithelial cells and other innate immune cell types, notably through the induction of antimicrobial peptide genes such as \u003cem\u003eCAMP\u003c/em\u003e. It is also anti-inflammatory \u003csup\u003e82\u003c/sup\u003e. Induction of \u003cem\u003eCAMP\u003c/em\u003e expression by 1,25D in FBW7-deficient cells is strongly inhibited (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Moreover, pathways analysis revealed that the degree of upregulation by 1,25D of innate immune pathways and downregulation of inflammatory pathways was suppressed in the absence of FBW7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn conclusion, results presented above show that FBW7 depletion has widespread effects on gene expression in SCC25 cells, most of which are consistent with its loss being a marker of cancer progression. The results also strongly support FBW7 being a cofactor of the VDR that contributes broadly to both induction and repression of gene transcription observed in the presence of 1,25D. Finally, our findings are consistent with \u003cem\u003ede novo\u003c/em\u003e FBW7 mutations being a plausible mechanism of acquired resistance to 1,25D analogue therapy.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCRISPR/Cas9 genome editing\u003c/h2\u003e \u003cp\u003eCRISPR/Cas9 genome editing was done using the protocol of Malina et al (1). The target sequence, AGATGCATACAACGCACAGTGG, was designed using the website \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://chopchop.cbu.uib.no/\u003c/span\u003e\u003cspan address=\"https://chopchop.cbu.uib.no/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e to target the human \u003cem\u003eFBXW7\u003c/em\u003e gene and then cloned in the LeGO-U6LTR-iGCas9-GFP plasmid. The plasmid is a gift from Dr. Jerry Pelletier, McGill University. To produce viral particles containing LeGO-U6LTR-iGCas9-GFP, HEK293T/17 cells (CRL-11268, ATCC) were transfected along with packaging plasmids using Calfectin (SL100478, Signagen) reagent. To transduce SCC25 cells (CRL-1628, ATCC), the medium from HEK293T/17 cells containing lentiviral particles was collected, filtered, and added to SCC25 cells. The cells were grown for 3 weeks and then a single-cell green fluorescence protein selection was made by fluorescence-activated cell sorting. Different clonal cell lines were then tested via \u003cem\u003eFBXW7\u003c/em\u003e genomic DNA PCR on the site of Crisper/Cas9-gRNA cut using AGGAAGCTGACAACACTAGCA and TGTCTGAGAACATTAGTGGGACA.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell culture and treatment.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe performed gene expression profiling studies by RNAseq in triplicate in wild-type and FBW7-depleted SCC25 to determine the effects of FBW7 ablation on nuclear 1,25D-dependent transactivation and repression. Cells were treated with 100nM 1,25D (BML-DM200, Enzo Life Sciences), or vehicle (dimethyl sulfoxide) for 16 hours to generate expression profiles enriched in primary target genes.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRNA sequencing\u003c/h3\u003e\n\u003cp\u003eRNA sequencing was conducted essentially as described \u003csup\u003e83,84\u003c/sup\u003e. Total RNA was extracted using the FavorPrep Blood/Cultured Cell Total RNA Mini Kit (FABRK 001, Favorgen) according to the manufacturer's protocol. RNA samples with an OD 260/280 ratio higher than 1.7 and an RNA integrity number greater than 7 were kept for subsequent analysis. Next, these samples were submitted to G\u0026eacute;nome Qu\u0026eacute;bec for paired-end sequencing with 100M reads on an Illumina NovaSeq PE100 sequencer. Library preparation was performed using the polyA Enriched RNA Library Preparation. All samples were included in the analysis as they met quality standards by QC reports from G\u0026eacute;nome Qu\u0026eacute;bec. The quality of sequence reads was then verified using FastQC, with poor-quality reads determined based on the Phred score, which is logarithmically related to base calling error probabilities. The Phred offset quality score was greater than 30, and the minimum fragment size for alignment was set to 50. Using HISAT2 \u003csup\u003e85\u003c/sup\u003e, reads were mapped to the human GRCh38 genome assembly. Gene expression was quantified by counting uniquely mapped reads with featureCounts, using default settings. Normalization of gene counts and differential gene expression analysis were executed with the edgeR Bioconductor R package \u003csup\u003e86\u003c/sup\u003e. Genes with \u0026ge;|1.5| fold-change and adjusted p-values\u0026thinsp;\u0026le;\u0026thinsp;0.05 were considered significant. Differentially expressed genes from the RNAseq analysis are available in Tables S1-S3.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data presented in this study are deposited in the Gene expression omnibus (GEO) repository, accession number GSE312616 and are available at the following URL: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE312616\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE312616\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics and pathways analysis\u003c/h2\u003e \u003cp\u003eThe overlap between conditions is illustrated using the DeepVenn website \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.deepvenn.com/\u003c/span\u003e\u003cspan address=\"https://www.deepvenn.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003csup\u003e87\u003c/sup\u003e. Principal component analysis (PCA) was performed using the R function plotMDS and visualized with the limma R package. Pathways analyses enrichment was carried out using clusterProfiler, Disease Ontology (DOSE) and Gene set enrichment analysis (GSEA) R packages \u003csup\u003e88\u0026ndash;90\u003c/sup\u003e. In addition, QIAGEN\u0026rsquo;s Ingenuity Pathway Analysis software (IPA\u0026reg;, QIAGEN Redwood City, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.qiagen.com/ingenuity\u003c/span\u003e\u003cspan address=\"http://www.qiagen.com/ingenuity\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to probe for additional enriched pathways. For visualisation of expression level per gene by heatmaps, using edgeR, the logCPM (counts per million) was calculated for each gene using TMM (trimmed mean of M values) normalization method to calculate effective library sizes which are subsequently used as part of the per-sample normalization \u003csup\u003e91\u003c/sup\u003e. After this, a z-score normalization was performed to render features comparable \u003csup\u003e92\u003c/sup\u003e. Heatmaps with hierarchical clustering were constructed using the heatmap.2 package in R.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction, reverse transcription and qPCR\u003c/h2\u003e \u003cp\u003eRNA extraction was performed using the FavorPrep\u0026trade; Tissue Total RNA Mini Kit (FATRK 001, Favorgen) according to the manufacturer\u0026rsquo;s instructions. cDNA was synthesized from 500 ng of RNA using the 5\u0026times; All-in-One RT Mastermix (G485, abm) and diluted 5 times. Quantitative polymerase chain reaction (qPCR) was conducted with BrightGreen 2\u0026times;qPCR MasterMix (MasterMix-LR-XL, abm) on a Roche Applied Science LightCycler 96 machine. Gene expression was normalized to Actin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistics\u003c/h2\u003e \u003cp\u003eA one-way ANOVA followed by Tukey\u0026rsquo;s \u003cem\u003epost hoc\u003c/em\u003e test for multiple comparisons was used using the dplyr R package. A p value of less than or equal to 0.05 was considered significant. To denote p values, symbols were used as follows: *P\u0026thinsp;\u0026le;\u0026thinsp;0.05, **P\u0026thinsp;\u0026le;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026le;\u0026thinsp;0.001, and ns\u0026thinsp;\u0026ge;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding Declaration\u003c/h2\u003e\n\u003cp\u003eThis work was supported by a grant from the Natural Sciences and Engineering Research Council (RGPIN-2023-04162) to J.H. White. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eWrote the paper: RST, JHW, AI. Conceived and designed experiments: JHW, RST, AI. Performed experiments (RST, ZC) and analysis of experimental data: RST, JHW. Methodology and analysis of RNAseq (bioinformatics): AI, RST. Supervision: JHW.\u003c/p\u003e\n\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eWe are grateful to Dr. Jerry Pelletier and Dr. Francis Robert, McGill University, for the gift of the plasmid LeGO-U6LTR-iGCas9-GFP.\u003c/p\u003e\n\u003ch2\u003eData Availability\u003c/h2\u003e\n\u003cp\u003eThe data presented in this study are deposited in the Gene expression omnibus (GEO) repository, accession number GSE312616 and are available at the following URL: [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE312616](https:/www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE312616)\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBouillon, R.\u003cem\u003e et al.\u003c/em\u003e Skeletal and extraskeletal actions of vitamin D: current evidence and outstanding questions. \u003cem\u003eEndocr. Rev.\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 1109-1151 (2019).\u003c/li\u003e\n\u003cli\u003eArtusa, P. \u0026amp; White, J. H. Vitamin D and its analogs in immune system regulation. \u003cem\u003ePharmacological reviews\u003c/em\u003e \u003cstrong\u003e77\u003c/strong\u003e, 100032 (2025). https://doi.org/https://doi.org/10.1016/j.pharmr.2024.100032\u003c/li\u003e\n\u003cli\u003eTavera-Mendoza, L., White, J.H. Cell defenses and the sunshine vitamin. \u003cem\u003eScientific American\u003c/em\u003e \u003cstrong\u003e297\u003c/strong\u003e, 62-72 (2007).\u003c/li\u003e\n\u003cli\u003eHypp\u0026ouml;nen, E. \u0026amp; Power, C. Hypovitaminosis D in British adults at age 45 y: nationwide cohort study of dietary and lifestyle predictors. \u003cem\u003eThe American journal of clinical nutrition\u003c/em\u003e \u003cstrong\u003e85\u003c/strong\u003e, 860-868 (2007).\u003c/li\u003e\n\u003cli\u003eWebb, A. R. Who, what, where and when\u0026mdash;influences on cutaneous vitamin D synthesis. \u003cem\u003eProgress in Biophysics and Molecular Biology\u003c/em\u003e \u003cstrong\u003e92\u003c/strong\u003e, 17-25 (2006). https://doi.org/https://doi.org/10.1016/j.pbiomolbio.2006.02.004\u003c/li\u003e\n\u003cli\u003eArabi, A., El Rassi, R. \u0026amp; El-Hajj Fuleihan, G. Hypovitaminosis D in developing countries-prevalence, risk factors and outcomes. \u003cem\u003eNat Rev Endocrinol\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 550-561 (2010).\u003c/li\u003e\n\u003cli\u003eGonzalez-Gross, M.\u003cem\u003e et al.\u003c/em\u003e Vitamin D status among adolescents in Europe: the Healthy Lifestyle in Europe by Nutrition in Adolescence study. \u003cem\u003eBritish Journal of Nutrition\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e, 755-764 (2012). https://doi.org/10.1017/s0007114511003527\u003c/li\u003e\n\u003cli\u003eCashman, K. D.\u003cem\u003e et al.\u003c/em\u003e Vitamin D deficiency in Europe: pandemic? \u003cem\u003eAmerican Journal of Clinical Nutrition\u003c/em\u003e \u003cstrong\u003e103\u003c/strong\u003e, 1033-1044 (2016). https://doi.org/10.3945/ajcn.115.120873\u003c/li\u003e\n\u003cli\u003eMogire, R. M.\u003cem\u003e et al.\u003c/em\u003e Prevalence of vitamin D deficiency in Africa: a systematic review and meta-analysis. \u003cem\u003eThe Lancet Global Health\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, e134-e142 (2020). https://doi.org/https://doi.org/10.1016/S2214-109X(19)30457-7\u003c/li\u003e\n\u003cli\u003eWhite, J. H., Sarmadi, F. \u0026amp; Artusa, P. in \u003cem\u003eFeldman and Pike\u0026apos; s Vitamin D (Fifth Edition)\u003c/em\u003e (eds Martin Hewison\u003cem\u003e et al.\u003c/em\u003e) 241-259 (Academic Press, 2024).\u003c/li\u003e\n\u003cli\u003eZehnder, D.\u003cem\u003e et al.\u003c/em\u003e Extrarenal Expression of 25-Hydroxyvitamin D3-1\u0026alpha;-Hydroxylase. \u003cem\u003eJournal of Clinical Endocrinology \u0026amp; Metabolism\u003c/em\u003e \u003cstrong\u003e86\u003c/strong\u003e, 888-894 (2001). https://doi.org/10.1210/jc.86.2.888\u003c/li\u003e\n\u003cli\u003eHung, M., Almpani, K., Thao, B., Sudweeks, K. \u0026amp; Lipsky, M. S. Vitamin D in the prevention and treatment of oral cancer: a scoping review. \u003cem\u003eNutrients\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 2346 (2023).\u003c/li\u003e\n\u003cli\u003eTalib, W. H.\u003cem\u003e et al.\u003c/em\u003e Role of vitamins A, C, D, E in cancer prevention and therapy: Therapeutic potentials and mechanisms of action. \u003cem\u003eFrontiers in Nutrition\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1281879 (2024).\u003c/li\u003e\n\u003cli\u003eKeum, N., Lee, D. H., Greenwood, D. C., Manson, J. E. \u0026amp; Giovannucci, E. Vitamin D supplementation and total cancer incidence and mortality: a meta-analysis of randomized controlled trials. \u003cem\u003eAnnals of Oncology\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 733-743 (2019). https://doi.org/10.1093/annonc/mdz059\u003c/li\u003e\n\u003cli\u003eAkutsu, N.\u003cem\u003e et al.\u003c/em\u003e Regulation of gene expression by 1 alpha,25-dihydroxyvitamin D-3 and its analog EB1089 under growth-inhibitory conditions in squamous carcinoma cells. \u003cem\u003eMolecular Endocrinology\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1127-1139 (2001). https://doi.org/10.1210/me.15.7.1127\u003c/li\u003e\n\u003cli\u003ePrudencio, J.\u003cem\u003e et al.\u003c/em\u003e Action of low calcemic 1 alpha,25-dihydroxyvitamin D-3 analogue EB1089 in head and neck squamous cell carcinoma. \u003cem\u003eJournal of the National Cancer Institute\u003c/em\u003e \u003cstrong\u003e93\u003c/strong\u003e, 745-753 (2001). https://doi.org/10.1093/jnci/93.10.745\u003c/li\u003e\n\u003cli\u003eSalehi-Tabar, R.\u003cem\u003e et al.\u003c/em\u003e Vitamin D receptor as a master regulator of the c-MYC/MXD1 network. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e \u003cstrong\u003e109\u003c/strong\u003e, 18827-18832 (2012). https://doi.org/10.1073/pnas.1210037109\u003c/li\u003e\n\u003cli\u003eSalehi-Tabar, R.\u003cem\u003e et al.\u003c/em\u003e The Tumor Suppressor FBW7 and the Vitamin D Receptor Are Mutual Cofactors in Protein Turnover and Transcriptional Regulation. \u003cem\u003eMolecular Cancer Research\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 709 (2019). https://doi.org/10.1158/1541-7786.MCR-18-0991\u003c/li\u003e\n\u003cli\u003eLin, R.\u003cem\u003e et al.\u003c/em\u003e Expression Profiling in Squamous Carcinoma Cells Reveals Pleiotropic Effects of Vitamin D3 Analog EB1089 Signaling on Cell Proliferation, Differentiation, and Immune System Regulation. \u003cem\u003eMolecular Endocrinology\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1243-1256 (2002). https://doi.org/10.1210/me.16.6.1243\u003c/li\u003e\n\u003cli\u003eNandi, D., Tahiliani, P., Kumar, A. \u0026amp; Chandu, D. The ubiquitin-proteasome system. \u003cem\u003eJournal of biosciences\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 137-155 (2006).\u003c/li\u003e\n\u003cli\u003eNawaz, Z. \u0026amp; O\u0026apos;Malley, B. W. Urban renewal in the nucleus: Is protein turnover by proteasomes absolutely required for nuclear receptor-regulated transcription? \u003cem\u003eMolecular Endocrinology\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 493-499 (2004). https://doi.org/10.1210/me.2003-0388\u003c/li\u003e\n\u003cli\u003eMuratani, M. \u0026amp; Tansey, W. R. How the ubiquitin-proteasome system controls transcription. \u003cem\u003eNature Reviews Molecular Cell Biology\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 192-201 (2003). https://doi.org/10.1038/nrm1049\u003c/li\u003e\n\u003cli\u003eWelcker, M., Orian, A., Grim, J. A., Eisenman, R. N. \u0026amp; Clurman, B. E. A nucleolar isoform of the Fbw7 ubiquitin ligase regulates c-Myc and cell size. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1852-1857 (2004). https://doi.org/10.1016/j.cub.2004.09.083\u003c/li\u003e\n\u003cli\u003eMark, K. G. \u0026amp; Rape, M. Ubiquitin‐dependent regulation of transcription in development and disease. \u003cem\u003eEMBO reports\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, e51078 (2021).\u003c/li\u003e\n\u003cli\u003eSato, M.\u003cem\u003e et al.\u003c/em\u003e MYC is a critical target of FBXW7. \u003cem\u003eOncotarget\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 3292 (2015).\u003c/li\u003e\n\u003cli\u003eWelcker, M.\u003cem\u003e et al.\u003c/em\u003e The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-Myc protein degradation. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e101\u003c/strong\u003e, 9085-9090 (2004).\u003c/li\u003e\n\u003cli\u003eYeh, C.-H., Bellon, M. \u0026amp; Nicot, C. FBXW7: a critical tumor suppressor of human cancers. \u003cem\u003eMolecular cancer\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 1-19 (2018).\u003c/li\u003e\n\u003cli\u003eAgrawal, N.\u003cem\u003e et al.\u003c/em\u003e Exome Sequencing of Head and Neck Squamous Cell Carcinoma Reveals Inactivating Mutations in NOTCH1. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e333\u003c/strong\u003e, 1154-1157 (2011). https://doi.org/10.1126/science.1206923\u003c/li\u003e\n\u003cli\u003eNwachuku, K., Johnson, D. E. \u0026amp; Grandis, J. R. in \u003cem\u003eEarly Detection and Treatment of Head \u0026amp; Neck Cancers: Theoretical Background and Newly Emerging Research\u003c/em\u003e 107-122 (Springer, 2021).\u003c/li\u003e\n\u003cli\u003eEliana, K., Federica, L., Roya, B. \u0026amp; Abdolrahman, N. Colorectal cancer: a pathology of the colon-rectum and a disease of the genome. \u003cem\u003eIntern. Med\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 10.4172 (2013).\u003c/li\u003e\n\u003cli\u003ePrevarskaya, N., Ouadid-Ahidouch, H., Skryma, R. \u0026amp; Shuba, Y. Remodelling of Ca2+ transport in cancer: how it contributes to cancer hallmarks? \u003cem\u003ePhilos Trans R Soc Lond B Biol Sci\u003c/em\u003e \u003cstrong\u003e369\u003c/strong\u003e, 20130097 (2014). https://doi.org/10.1098/rstb.2013.0097\u003c/li\u003e\n\u003cli\u003eGu, C.\u003cem\u003e et al.\u003c/em\u003e FSTL1 interacts with VIM and promotes colorectal cancer metastasis via activating the focal adhesion signalling pathway. \u003cem\u003eCell Death \u0026amp; Disease\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 654 (2018). https://doi.org/10.1038/s41419-018-0695-6\u003c/li\u003e\n\u003cli\u003eZhang, J.\u003cem\u003e et al.\u003c/em\u003e PODXL, negatively regulated by KLF4, promotes the EMT and metastasis and serves as a novel prognostic indicator of gastric cancer. \u003cem\u003eGastric Cancer\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 48-59 (2019).\u003c/li\u003e\n\u003cli\u003eHe, S., Du, W., Li, M., Yan, M. \u0026amp; Zheng, F. PODXL might be a new prognostic biomarker in various cancers: a meta-analysis and sequential verification with TCGA datasets. \u003cem\u003eBMC cancer\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 620 (2020).\u003c/li\u003e\n\u003cli\u003eDai, Y., Li, C., Cheng, S., Wang, H. \u0026amp; Zhuang, X. Bioinformatics and experimental insights into F2RL1 as a key biomarker in cervical cancer diagnosis and prognosis. \u003cem\u003eScientific Reports\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 5228 (2025). https://doi.org/10.1038/s41598-025-89746-y\u003c/li\u003e\n\u003cli\u003eOssovskaya, V. S. \u0026amp; Bunnett, N. W. Protease-activated receptors: contribution to physiology and disease. \u003cem\u003ePhysiological reviews\u003c/em\u003e (2004).\u003c/li\u003e\n\u003cli\u003eIslam, F., Gopalan, V., Lu, C. T., Pillai, S. \u0026amp; Lam, A. K. Identification of novel mutations and functional impacts of EPAS1 in colorectal cancer. \u003cem\u003eCancer Medicine\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 5557-5573 (2021).\u003c/li\u003e\n\u003cli\u003eRawłuszko-Wieczorek, A. A., Horbacka, K., Krokowicz, P., Misztal, M. \u0026amp; Jagodziński, P. P. Prognostic potential of DNA methylation and transcript levels of HIF1A and EPAS1 in colorectal cancer. \u003cem\u003eMolecular cancer research\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1112-1127 (2014).\u003c/li\u003e\n\u003cli\u003eGao, Q.-Z.\u003cem\u003e et al.\u003c/em\u003e Overexpression of AMPD2 indicates poor prognosis in colorectal cancer patients via the Notch3 signaling pathway. \u003cem\u003eWorld Journal of Clinical Cases\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 3197 (2020).\u003c/li\u003e\n\u003cli\u003eWang, F.\u003cem\u003e et al.\u003c/em\u003e High expression of AMPD2 and obesity are associated with poor prognosis in colorectal cancer. \u003cem\u003eInternational Journal of Clinical and Experimental Pathology\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 216 (2018).\u003c/li\u003e\n\u003cli\u003eChen, S.\u003cem\u003e et al.\u003c/em\u003e The emerging role of XBP1 in cancer. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e \u003cstrong\u003e127\u003c/strong\u003e, 110069 (2020).\u003c/li\u003e\n\u003cli\u003eZhao, Y.\u003cem\u003e et al.\u003c/em\u003e XBP1 regulates the protumoral function of tumor-associated macrophages in human colorectal cancer. \u003cem\u003eSignal Transduction and Targeted Therapy\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 357 (2021).\u003c/li\u003e\n\u003cli\u003eL\u0026eacute;gar\u0026eacute;, S., Chabot, C. \u0026amp; Basik, M. SPEN, a new player in primary cilia formation and cell migration in breast cancer. \u003cem\u003eBreast Cancer Research\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 104 (2017).\u003c/li\u003e\n\u003cli\u003eVathiotis, I. A.\u003cem\u003e et al.\u003c/em\u003e Alpha-smooth muscle actin expression in the stroma predicts resistance to trastuzumab in patients with early-stage HER2-positive breast cancer. \u003cem\u003eClinical Cancer Research\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 6156-6163 (2021).\u003c/li\u003e\n\u003cli\u003eSuzuki, T.\u003cem\u003e et al.\u003c/em\u003e Overexpression of TMOD1 is associated with enhanced regional lymph node metastasis in human oral cancer. \u003cem\u003eInternational journal of oncology\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 607-612 (2015).\u003c/li\u003e\n\u003cli\u003eZhu, Y.\u003cem\u003e et al.\u003c/em\u003e Inhibition of ABCB1 expression overcomes acquired docetaxel resistance in prostate cancer. \u003cem\u003eMolecular cancer therapeutics\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1829-1836 (2013).\u003c/li\u003e\n\u003cli\u003eCao, Y.\u003cem\u003e et al.\u003c/em\u003e BMP4 inhibits breast cancer metastasis by blocking myeloid-derived suppressor cell activity. \u003cem\u003eCancer research\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 5091-5102 (2014).\u003c/li\u003e\n\u003cli\u003eLi, H. J.\u003cem\u003e et al.\u003c/em\u003e NKX6.1 functions as a metastatic suppressor through epigenetic regulation of the epithelial-mesenchymal transition. \u003cem\u003eOncogene\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 2266-2278 (2016). https://doi.org/10.1038/onc.2015.289\u003c/li\u003e\n\u003cli\u003eGoldenring, J. R. \u0026amp; Nam, K. T. Rab25 as a tumour suppressor in colon carcinogenesis. \u003cem\u003eBr J Cancer\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e, 33-36 (2011). https://doi.org/10.1038/sj.bjc.6605983\u003c/li\u003e\n\u003cli\u003eChen, C. F., Goyette, P. \u0026amp; Lohnes, D. RARgamma acts as a tumor suppressor in mouse keratinocytes. \u003cem\u003eOncogene\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 5350-5359 (2004). https://doi.org/10.1038/sj.onc.1207682\u003c/li\u003e\n\u003cli\u003eChen, C.\u003cem\u003e et al.\u003c/em\u003e Hypermethylation of EDNRB promoter contributes to the risk of colorectal cancer. \u003cem\u003eDiagn Pathol\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 199 (2013). https://doi.org/10.1186/1746-1596-8-199\u003c/li\u003e\n\u003cli\u003eShyr, C. R.\u003cem\u003e et al.\u003c/em\u003e Tumor suppressor PAX6 functions as androgen receptor co-repressor to inhibit prostate cancer growth. \u003cem\u003eProstate\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e, 190-199 (2010). https://doi.org/10.1002/pros.21052\u003c/li\u003e\n\u003cli\u003eGkikas, D.\u003cem\u003e et al.\u003c/em\u003e Nuclear receptor NR5A2 negatively regulates cell proliferation and tumor growth in nervous system malignancies. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e (2021). https://doi.org/10.1073/pnas.2015243118\u003c/li\u003e\n\u003cli\u003eHoule, B., Rochette-Egly, C. \u0026amp; Bradley, W. E. Tumor-suppressive effect of the retinoic acid receptor beta in human epidermoid lung cancer cells. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e90\u003c/strong\u003e, 985-989 (1993). https://doi.org/10.1073/pnas.90.3.985\u003c/li\u003e\n\u003cli\u003eMayer, I. A. \u0026amp; Arteaga, C. L. The PI3K/AKT pathway as a target for cancer treatment. \u003cem\u003eAnnual review of medicine\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 11-28 (2016).\u003c/li\u003e\n\u003cli\u003eGiancotti, F. G. \u0026amp; Ruoslahti, E. Integrin signaling. \u003cem\u003escience\u003c/em\u003e \u003cstrong\u003e285\u003c/strong\u003e, 1028-1033 (1999).\u003c/li\u003e\n\u003cli\u003eHood, J. D. \u0026amp; Cheresh, D. A. Role of integrins in cell invasion and migration. \u003cem\u003eNature Reviews Cancer\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 91-100 (2002).\u003c/li\u003e\n\u003cli\u003eLee, J. W. \u0026amp; Juliano, R. Mitogenic signal transduction by integrin-and growth factor receptor-mediated pathways. \u003cem\u003eMolecules and cells\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 188-202 (2004).\u003c/li\u003e\n\u003cli\u003eR\u0026auml;s\u0026auml;nen, K., Itkonen, O., Koistinen, H. \u0026amp; Stenman, U.-H. Emerging roles of SPINK1 in cancer. \u003cem\u003eClinical chemistry\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e, 449-457 (2016).\u003c/li\u003e\n\u003cli\u003eOzaki, N.\u003cem\u003e et al.\u003c/em\u003e Serine protease inhibitor Kazal type 1 promotes proliferation of pancreatic cancer cells through the epidermal growth factor receptor. \u003cem\u003eMolecular Cancer Research\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1572-1581 (2009).\u003c/li\u003e\n\u003cli\u003eRagusa, D. \u0026amp; Vagnarelli, P. Contribution of histone variants to aneuploidy: a cancer perspective. \u003cem\u003eFrontiers in genetics\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1290903 (2023).\u003c/li\u003e\n\u003cli\u003eShah, M. A., Denton, E. L., Arrowsmith, C. H., Lupien, M. \u0026amp; Schapira, M. A global assessment of cancer genomic alterations in epigenetic mechanisms. \u003cem\u003eEpigenetics \u0026amp; chromatin\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 29 (2014).\u003c/li\u003e\n\u003cli\u003eFerrand, J., Rondinelli, B. \u0026amp; Polo, S. E. Histone variants: guardians of genome integrity. \u003cem\u003eCells\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 2424 (2020).\u003c/li\u003e\n\u003cli\u003eGhiraldini, F. G., Filipescu, D. \u0026amp; Bernstein, E. Solid tumours hijack the histone variant network. \u003cem\u003eNature Reviews Cancer\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 257-275 (2021).\u003c/li\u003e\n\u003cli\u003eOh, S. Y.\u003cem\u003e et al.\u003c/em\u003e Chromatin remodeling-driven autophagy activation induces cisplatin resistance in oral squamous cell carcinoma. \u003cem\u003eCell Death \u0026amp; Disease\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 589 (2024).\u003c/li\u003e\n\u003cli\u003eZhang, X., Zhao, M., Chu, T., Wei, J. \u0026amp; Jia, Q. Comprehensive bioinformatics analysis of EXOSC family genes in head and neck squamous cell carcinoma. \u003cem\u003eScientific Reports\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 30361 (2025).\u003c/li\u003e\n\u003cli\u003eFerrantini, M., Capone, I. \u0026amp; Belardelli, F. Interferon-\u0026alpha; and cancer: Mechanisms of action and new perspectives of clinical use. \u003cem\u003eBiochimie\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e, 884-893 (2007). https://doi.org/https://doi.org/10.1016/j.biochi.2007.04.006\u003c/li\u003e\n\u003cli\u003eZolfaghari, K.\u003cem\u003e et al.\u003c/em\u003e Interferon signaling and STING pathway in head and neck cancers: unlocking immune secrets and therapeutic frontiers. \u003cem\u003eCancer Cell International\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 324 (2025).\u003c/li\u003e\n\u003cli\u003eL Bishop, E., Ismailova, A., Dimeloe, S., Hewison, M. \u0026amp; White, J. H. Vitamin D and immune regulation: antibacterial, antiviral, anti-inflammatory. \u003cem\u003eJournal of Bone and Mineral Research plus\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, e10405 (2021).\u003c/li\u003e\n\u003cli\u003eIsmailova, A. \u0026amp; White, J. H. Vitamin D, infections and immunity. \u003cem\u003eReviews in Endocrine and Metabolic Disorders\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 265-277 (2022).\u003c/li\u003e\n\u003cli\u003ePoole, B. D., Niewold, T. B., Clark, D. N. \u0026amp; Salloum, R. Interferon alpha in systemic lupus erythematosus. \u003cem\u003eJournal of Biomedicine and Biotechnology\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, 948364 (2010).\u003c/li\u003e\n\u003cli\u003eAbdel Galil, S. M., El-Shafey, A. M., Abdul-Maksoud, R. S. \u0026amp; El-Boshy, M. Interferon alpha gene expression and serum level association with low vitamin D levels in Egyptian female patients with systemic lupus erythematosus. \u003cem\u003eLupus\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 199-209 (2018). https://doi.org/10.1177/0961203317716321\u003c/li\u003e\n\u003cli\u003eYap, K. S., Northcott, M., Hoi, A. B. Y., Morand, E. F. \u0026amp; Nikpour, M. Association of low vitamin D with high disease activity in an Australian systemic lupus erythematosus cohort. \u003cem\u003eLupus Science \u0026amp; Medicine\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, e000064 (2015). https://doi.org/10.1136/lupus-2014-000064\u003c/li\u003e\n\u003cli\u003eBen-Zvi, I.\u003cem\u003e et al.\u003c/em\u003e The impact of vitamin D on dendritic cell function in patients with systemic lupus erythematosus. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, e9193 (2010). https://doi.org/10.1371/journal.pone.0009193\u003c/li\u003e\n\u003cli\u003eParlato, M.\u003cem\u003e et al.\u003c/em\u003e Human ALPI deficiency causes inflammatory bowel disease and highlights a key mechanism of gut homeostasis. \u003cem\u003eEMBO Molecular Medicine\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e8483 (2018). https://doi.org/https://doi.org/10.15252/emmm.201708483\u003c/li\u003e\n\u003cli\u003eNoda, S., Yamada, A., Nakaoka, K. \u0026amp; Goseki-Sone, M. 1-alpha, 25-Dihydroxyvitamin D3 up-regulates the expression of 2 types of human intestinal alkaline phosphatase alternative splicing variants in Caco-2 cells and may be an important regulator of their expression in gut homeostasis. \u003cem\u003eNutrition Research\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e, 59-67 (2017).\u003c/li\u003e\n\u003cli\u003eRoe, K., Gibot, S. \u0026amp; Verma, S. Triggering receptor expressed on myeloid cells-1 (TREM-1): a new player in antiviral immunity? \u003cem\u003eFrontiers in microbiology\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 627 (2014).\u003c/li\u003e\n\u003cli\u003eGiovannucci, E.\u003cem\u003e et al.\u003c/em\u003e Prospective Study of Predictors of Vitamin D Status and Cancer Incidence and Mortality in Men. \u003cem\u003eJournal of the National Cancer Institute\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 451-459 (2006). https://doi.org/10.1093/jnci/djj101\u003c/li\u003e\n\u003cli\u003eFeldman, D., Krishnan, A. V., Swami, S., Giovannucci, E. \u0026amp; Feldman, B. J. The role of vitamin D in reducing cancer risk and progression. \u003cem\u003eNature reviews cancer\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 342-357 (2014).\u003c/li\u003e\n\u003cli\u003eDeeb, K. K., Trump, D. L. \u0026amp; Johnson, C. S. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. \u003cem\u003eNat Rev Cancer\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 684-700 (2007). https://doi.org/http://www.nature.com/nrc/journal/v7/n9/suppinfo/nrc2196_S1.html\u003c/li\u003e\n\u003cli\u003eFan, J.\u003cem\u003e et al.\u003c/em\u003e Clinical significance of FBXW7 loss of function in human cancers. \u003cem\u003eMol Cancer\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 87 (2022). https://doi.org/10.1186/s12943-022-01548-2\u003c/li\u003e\n\u003cli\u003eIsmailova, A. \u0026amp; White, J. H. Vitamin D, infections and immunity. \u003cem\u003eReviews in Endocrine and Metabolic Disorders\u003c/em\u003e (2021). https://doi.org/10.1007/s11154-021-09679-5\u003c/li\u003e\n\u003cli\u003eIsmailova, A.\u003cem\u003e et al.\u003c/em\u003e The interplay between hormonal vitamin D and lipopolysaccharide signaling on human neutrophil transcriptional responses. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1683913 (2025).\u003c/li\u003e\n\u003cli\u003eIsmailova, A.\u003cem\u003e et al.\u003c/em\u003e Identification of a forkhead box protein transcriptional network induced in human neutrophils in response to inflammatory stimuli. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1123344 (2023).\u003c/li\u003e\n\u003cli\u003ePertea, M., Kim, D., Pertea, G. M., Leek, J. T. \u0026amp; Salzberg, S. L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. \u003cem\u003eNature protocols\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1650-1667 (2016).\u003c/li\u003e\n\u003cli\u003eRobinson, M. D., McCarthy, D. J. \u0026amp; Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. \u003cem\u003ebioinformatics\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 139-140 (2010).\u003c/li\u003e\n\u003cli\u003eHulsen, T. DeepVenn--a web application for the creation of area-proportional Venn diagrams using the deep learning framework Tensorflow. js. \u003cem\u003earXiv preprint arXiv:2210.04597\u003c/em\u003e (2022).\u003c/li\u003e\n\u003cli\u003eYu, G., Wang, L.-G., Han, Y. \u0026amp; He, Q.-Y. clusterProfiler: an R package for comparing biological themes among gene clusters. \u003cem\u003eOmics: a journal of integrative biology\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 284-287 (2012).\u003c/li\u003e\n\u003cli\u003eYu, G., Wang, L.-G., Yan, G.-R. \u0026amp; He, Q.-Y. DOSE: an R/Bioconductor package for disease ontology semantic and enrichment analysis. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 608-609 (2014).\u003c/li\u003e\n\u003cli\u003eSubramanian, A.\u003cem\u003e et al.\u003c/em\u003e Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e102\u003c/strong\u003e, 15545-15550 (2005).\u003c/li\u003e\n\u003cli\u003eRobinson, M. D. \u0026amp; Oshlack, A. A scaling normalization method for differential expression analysis of RNA-seq data. \u003cem\u003eGenome biology\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, R25 (2010).\u003c/li\u003e\n\u003cli\u003eCheadle, C., Vawter, M. P., Freed, W. J. \u0026amp; Becker, K. G. Analysis of microarray data using Z score transformation. \u003cem\u003eJ Mol Diagn\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 73-81 (2003). https://doi.org/10.1016/s1525-1578(10)60455-2\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Vitamin D, FBW7, tumour suppressor, gene expression profiling, pathways analysis, cell cycle","lastPublishedDoi":"10.21203/rs.3.rs-9181172/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9181172/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHormonal 1,25-dihydroxyvitamin D (1,25D) and its analogues signal through the nuclear vitamin D receptor (VDR). While numerous preclinical studies have provided evidence for antiproliferative and antitumour activities of 1,25D (analogues), such compounds have failed in clinical trials because of acquired tumour resistance. We previously found that the E3 ligase FBW7 interacts with the VDR. FBW7 regulates turnover of cell cycle drivers and is a tumour suppressor that is mutated in multiple malignancies, including head and neck squamous cell carcinoma (HNSCC). 1,25D accelerates the proteasomal degradation of FBW7 target proteins in a VDR- and FBW7-dependent manner. Surprisingly. FBW7 is also required for 1,25D-dependent transactivation. Here, we investigated the effects of \u003cem\u003eFBW7\u003c/em\u003e ablation by CRISPR/Cas9 editing on gene expression in 1,25D-sensitive human SCC25 HNSCC cells. We find that FBW7 loss induces the expression of several genes implicated in tumour progression and represses expression of those inhibiting tumour growth. Fold induction of the vast majority of the top 50 genes induced or repressed by 1,25D is attenuated by FBW7 ablation, suppressing 1,25D-driven regulation of genes implicated in cell proliferation and immune responses. Collectively, these data reveal that FBW7 is a critical cofactor of 1,25D signaling and provide a mechanism of acquired tumour resistance.\u003c/p\u003e","manuscriptTitle":"Loss of expression of the E3 ligase and tumour suppressor FBW7 attenuates vitamin D signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-20 17:32:56","doi":"10.21203/rs.3.rs-9181172/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-05-11T15:22:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-06T14:00:00+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-15T13:43:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"189008947854643682763198584991138982603","date":"2026-04-13T15:21:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"191709468972351027511262538827009392438","date":"2026-04-13T10:24:53+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-13T09:54:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-07T12:42:42+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-04-02T10:43:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-31T15:30:21+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-03-31T15:24:01+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b3765ba6-a47f-4ac2-8904-fea019cc9a3a","owner":[],"postedDate":"April 20th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Revision requested","date":"2026-05-11T15:22:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-06T14:00:00+00:00","index":43,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":66377117,"name":"Biological sciences/Cancer"},{"id":66377118,"name":"Biological sciences/Cell biology"},{"id":66377119,"name":"Biological sciences/Molecular biology"},{"id":66377120,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2026-05-11T15:38:07+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-20 17:32:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9181172","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9181172","identity":"rs-9181172","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00