Recurrent Acute Liver Failure and Neutropenia сaused by a novel homozygous RINT1 variant: evidence for a population-specific disorder

preprint OA: closed
Full text JSON View at publisher
Full text 96,311 characters · extracted from preprint-html · click to expand
Recurrent Acute Liver Failure and Neutropenia сaused by a novel homozygous RINT1 variant: evidence for a population-specific disorder | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Recurrent Acute Liver Failure and Neutropenia сaused by a novel homozygous RINT1 variant: evidence for a population-specific disorder Еkaterina Nuzhnaya, Andrey Marakhonov, Nikolai Prokhorov, Nelly Kan, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7009438/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Oct, 2025 Read the published version in Human Genomics → Version 1 posted 7 You are reading this latest preprint version Abstract Background Recurrent acute liver failure in pediatric patients is a severe and life-threatening condition with heterogeneous genetic, immunologic, and environmental causes. Early diagnosis is critical to guide management and improve outcomes. The role of RINT1 variants in liver pathology has been underexplored, with limited data linking these mutations to hepatocellular dysfunction. Results We report an 8-year-old female proband from Chuvashia presenting with recurrent acute liver failure and neutropenia. Genetic analysis identified a homozygous RINT1 variant (NM_021930.6:c.1435G>C, p.Ala479Pro), with unaffected parents as heterozygous carriers. The proband experienced multiple episodes of fever- and infection-triggered liver failure, characterized by elevated alanine aminotransferase and aspartate aminotransferase levels, coagulopathy, hepatomegaly, and progressive liver fibrosis. Structural modeling using Alphafold revealed that the p.Ala479Pro variant is located within a conserved alpha-helical region of the RINT1/TIP20 domain, critical for protein stability and function. Population-specific analysis suggested the variant's origin in the Chuvash ethnic group, supporting its potential significance for genetic counseling. Additionally, we noted a novel clinical phenotype of RINT1 -related disorders, including neutropenia, and described affected siblings with similar manifestations, further supporting an autosomal recessive inheritance pattern. Conclusions This case expands the clinical spectrum of RINT1-related disorders by associating RINT1 variants with recurrent liver failure and neutropenia. Early genetic diagnosis through whole-exome sequencing and vigilant monitoring are essential to optimize patient outcomes. The findings also emphasize the importance of population-specific analyses in identifying pathogenic variants and guiding genetic counseling. Structural insights from bioinformatics modeling further highlight the functional consequences of the p.Ala479Pro mutation, offering avenues for future research into targeted therapeutic strategies. recurrent acute liver failure RALF infantile liver failure syndrome type 3 disorder of intracellular trafficking autophagy RINT1 neutropenia NBAS NRZ complex Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Infantile-onset recurrent acute liver failure (RALF) is a life-threatening condition affecting pediatric populations. It is characterized by episodic hepatic decompensation, typically triggered by fever, infections, or metabolic stress. Each episode carries significant risks, including severe coagulopathy unresponsive to parenteral vitamin K, with or without hepatic encephalopathy (HE) or milder coagulopathy with HE, and progressive liver fibrosis ( 1 , 2 ). Although liver function may recover between episodes, RALF underscores underlying genetic susceptibilities predisposing patients to liver crises. Advancements in genetic diagnostics, particularly through whole-exome sequencing (WES), have identified mutations in genes responsible for cellular trafficking and homeostasis, such as NBAS , RINT1 , and SCYL1 , as contributing factors in a significant subset of RALF cases. These genes play crucial roles in vesicular trafficking, regulating protein transport between the endoplasmic reticulum (ER) and the Golgi apparatus. Mutations in these genes can disrupt this pathway, leading to ER stress and impaired autophagy, which sensitizes hepatocytes to injury during infectious or febrile episodes ( 3 ). Margot A. Cousin et al. described a novel clinical phenotype associated with bi-allelic RINT1 variants, presenting as RALF alongside skeletal abnormalities. Their study analyzed three unrelated pediatric patients, all experiencing fever- or infection-triggered liver failure episodes coupled with distinctive skeletal features, such as vertebral and acetabular anomalies. Genetic analysis identified compound heterozygous RINT1 variants, including a shared splice-site alteration, leading to exon skipping and reduced RINT1 protein levels. Functional studies on fibroblasts revealed abnormal Golgi morphology and impaired autophagic flux, suggesting a pathogenic mechanism involving disrupted vesicular transport and autophagy. This study expanded the clinical spectrum of RINT1 -related disorders and led to the classification of this condition in OMIM as infantile liver failure syndrome type 3 (ILFS3, OMIM #618641) ( 4 ). Nathalie Launay et al. further elucidated the clinical and molecular consequences of biallelic RINT1 variants in patients with early-onset neurological symptoms, including spastic paraplegia, ataxia, optic nerve hypoplasia, and dysmorphic features. WES identified pathogenic RINT1 variants in three individuals from two unrelated families. Functional studies demonstrated that these variants impair lipid droplet biogenesis, disrupt lipid metabolism, and cause mitochondrial dysfunction, resulting in increased reactive oxygen species production and altered mitochondrial dynamics. Two patients presented with RALF: one, without neurological manifestations, succumbed to liver failure at 14 months of age, while the other experienced liver failure at 10 years, triggered by an infectious episode. These findings link RINT1 deficiency to both neurological impairments and RALF, underscoring its role in lipid homeostasis, autophagy, and organelle function ( 5 ). In this study, we describe a proband with RALF and neutropenia identified through WES to carry homozygous RINT1 variants. Notably, the proband's two siblings exhibit identical clinical manifestations, including RALF and neutropenia. This familial occurrence further supports the diagnosis and the causative nature of the identified RINT1 variant, reinforcing an autosomal recessive inheritance pattern. A similar case was reported in 2024, describing a child with RINT1 -associated RALF and intermittent neutropenia. However, the previous report did not include specific laboratory data, such as the absolute neutrophil count, leaving an important aspect of the phenotype unaddressed ( 6 ) 2. Materials and methods 2.1. The proband was examined at the Research and Counseling Department of the Research Centre for Medical Genetics (RCMG, Moscow) and at the Immunology Department of the Dmitry Rogachev National Research Center of Pediatric Hematology, Oncology and Immunology. Informed consent was obtained from all subjects involved in the study. Written informed consent has been obtained from the patient to publish this paper. The conducted laboratory and instrumental investigations included dynamic monitoring of hemogram, cytological tests of peripheral blood and bone marrow, flow cytometry for immunophenotyping of peripheral blood lymphocytes, biochemical assays, coagulation studies, and infectious disease screening to exclude hepatic involvement of infectious origin. Imaging studies comprised abdominal ultrasound, MRI, and liver elastography. Additionally, an endoscopic examination of the stomach was performed. Genetic analyses included a targeted gene panel for liver-associated disorders, whole-exome sequencing, and whole-genome sequencing. 2.2 Genetic testing: Blood samples from the proband and unaffected parents were collected, and genomic DNA was extracted by standard methods. Whole exome sequencing was performed for the proband. Target enrichment with a SeqCap EZ HyperCapWorkflow solution capture array (Roche Sequencing Solutions Inc., Santa Clara, CA, USA), including the coding regions of 20,000 genes and sequencing were carried out using Illumina NextSeq 500 (Illumina, San Diego, CA, USA). The coding sequence of RINT1 was completely covered when using this method. Sequencing data were processed using a standard computer-based algorithm from Illumina and BaseSpace software (Enrichment 3.1.0). Aligned sequences were visualized with Integrative Genomics Viewer (IGV) browser (7). Filtering of the variants was based on their frequency of less than 1% in gnomAD and coding region sequence effects such as missense, nonsense, coding indels, and splice sites. The variant’s clinical significance was evaluated according to the ACMG/AMP criteria (8). The revealed variant was named according to the reference transcript variant (NM_021930.6) for the RINT1 gene. Sanger sequencing was carried out to validate the variant in the proband and its presence in the parents. To amplify the fragment encompassing the candidate variant, custom primers were used: RINT1_10F :GTGGGATATTGTAGGTTTGTTTCTT RINT1_10R: AAAAACTACCACGTGAAAACAGTA 2.3. Bioinformatic analysis. Alphafold3 was used to generate computed structure models (CSMs) of the A479P variant of RINT1 . CSMs were visualized with UCSF ChimeraX v1.7 (9), (10). 2.4. Autozygosity mapping. Regions of autozygosity on WES and WGS data were analyzed using AutoMap v1.2 tool with the subsequent visual inspection of the region’s borders (11). The age of the mutation spread event was estimated using the method described in detail elsewhere (12), (13). For the interpolation of hg19 physical positions into the sex-averaged map positions in Kosambi cM, Rutgers Maps v.3 were used (14). 3. Case presentation Clinical Findings The proband was an 8 year old female born to non consanguineous parents from Chuvashia. Delivery occurred at 37 weeks of gestation, with a birth weight of 3160 grams (+0.66 SD) and a length of 52 cm (+1.95 SD). The perinatal period was uneventful, and neonatal screening results were normal. Her developmental milestones were within expected ranges, neutropenia (400 cells/µl) was first recorded but at the age of 6 months. She was noted to have partial congenital anal atresia and has experienced persistent constipation. Since the age of 9 months, she has experienced RALF, typically coinciding with episodes of fever and respiratory infections. Her peak serum aspartate aminotransferase, alanine aminotransferase AST/ALT levels reached 12,030/9,050 U/L, and coagulopathy was occasionally observed during episodes of acute liver failure. Notably, her biochemical laboratory values either were within normal ranges or only mildly elevated between episodes. Her absolute neutrophil count ranged from 400 to 1500 cells/μL both between and during episodes (Table 1). Table 1. The comparison of clinical features between proband and siblings Patients Sibling 1 Sibling 2 Proband Maternal allele not available not available c.1435G>С, p.(Ala479Pro) Paternal allele not available not available c.1435G>С, p.(Ala479Pro) Ancestry Chuvash Chuvash Chuvash Consanguinity none none None Sex male male Female Gestation born at 38 weeks born at 38 weeks born at 37 weeks Neonatal jaundice none yes None Dysmorphisms - - - Age of first ALF episode 1 y 1 y 9 m 9 m Episodes of ALF or acutely elevated transaminases 1 9 14 Age at last assessment died at 1 y (during the first episode) died at 8 years 9 y now Growth Weight at evaluation normal normal Normal Birth weight 4040 g 3800 g 3160 g Length 55 cm 54 cm 52 cm Head circumference normal normal Normal Development Motor development normal normal Normal Language acquisition normal normal Normal Age at last episode of ALF/ acutely elevated transaminases 1 y 8 y 9 y Suspected triggers of episodes fever, acute respiratory infection fever, acute respiratory infection, enterovirus meningitis, pneumonia, varicella zoster fever, acute respiratory infection, pneumonia Hepatic involvement Hepatomegaly N/A + + Fibrosis N/A - + Laboratory finding during ALF episodes Glucose (normal range: 3.3-5.3 mmol/l) N/A 4.3 5.03 ALT (normal range: <40 U/l) N/A 3060 5400 AST (normal range: <40 U/l) N/A 4760 6250 Total bilirubin (normal range: 3.7-20.5 µmol/l) 98 48.8 23.3 Prothrombin time (normal range: 14-15.4 s) 41 53.3 23.7 INR (normal range: 0.87-1.2) N/A 5.7 1.64 Maximal AST/ALT (U/L) during ALF (normal range: <40 U/l) N/A 5280/ 5670 12030/9150 Lowest AST/ALT (U/L) between episodes (normal range: <40 U/l) N/A 28.8/20.6 44/17.5 Other manifestations Congenital malformation - - partial congenital anal atresia, constipation Retroperitoneal ultrasound left renal pyelectasis 6 mm at 1 month normal Normal Echocardiogram minimal tricuspid, pulmonary insufficiency normal minimal mitral valve prolapses Absolute neutrophil count (ANC) (normal range: 1500-8500 cells/µl) 1056 cells/µl 1340 cells/µl 400-2000 cells/µl Age of first ANC episode 3 m 1 y 3 m 9 m Lowest ANC 910 cells/µl at 1 y 670 cells/µl at 5 y 2m 200 cells/µl at 6 y ALF acute liver failure episode, ALT—alanine aminotransferase; AST—aspartate aminotransferase; ALP—alkaline phosphatase; GGT—-glutamyltranspeptidase, INR— international normalized ratio; m—months; N/A—not available; y—years, WT - wild-type. She presents with hepatomegaly and instrumental signs of liver fibrosis. Cytological examination of a peripheral blood smear did not reveal significant morphological changes in neutrophils. Cytological examination of the bone marrow revealed a moderate depletion of the neutrophil lineage without morphological changes in cells. Cytogenetic examination of the bone marrow showed a reduced number of mitoses. Immunophenotyping of peripheral blood lymphocytes did not show any abnormalities: CD3 (T-lym): 2.09 10⁶/ml, CD3+CD4+ (Th cells): 1.22 10⁶/ml (naive 73%), CD3+CD8+ (Tc cells): 0.71 10⁶/ml (naive 74.3%), B cells (CD19+): 0.44 10⁶/ml (switched – 11.3%; CD21lowCD38low – 3.9% CD3-CD16+CD56+ Lym (NK-cells): 0.23 10⁶/ml. NK-cells degranulation was normal. The proband's family history is notable: her brother passed away at the age of 1 year and 1 month due to acute liver failure following an acute viral infection, presenting with coagulopathy and hepatomegaly. Another brother experienced acute liver failure at 1 year and 9 months, associated with fever and an acute respiratory infection. His clinical presentation mirrored that of the proband, with elevated transaminase levels during febrile episodes and infections, followed by near complete normalization of values between episodes. A gene panel analysis identified no causative variants. Sadly, he succumbed to multi-organ failure at the age of 8 years and 1 month during a subsequent episode. As illustrated in Figure 1, the proband and both brothers share a consistent clinical presentation, characterized by elevated transaminase levels associated with recurrent infections, along with neutropenia observed in all patients. The proband is currently enrolled in home-based education to minimize exposure to infections. She is being monitored by a hematologist for idiopathic neutropenia and is receiving granulocyte colony-stimulating factor therapy with effective hematology answer. Concurrently, she remains under the care of gastroenterologists for the management of recurrent liver failure. 3.2 Genetic Analysis Molecular genetic analysis of the proband was performed using WES. The only candidate variant identified was a novel single nucleotide variant, NM_021930.6:c.1435G>C, in a heterozygous state in the exon 10 of the RINT1 gene as shown in Figure 2. This variant results in a missense substitution of the highly conservative amino acid residue p.(Ala479Pro) within the RINT1/TIP20 domain in the RINT1 protein. The identified nucleotide sequence variant is not registered in the control sample of the Genome Aggregation Database (gnomAD v.4.1.0). Most bioinformatic predictors suggest that the variant is likely to be damaging as shown in Suppl. Table S1. Sanger sequencing confirmed a homozygous state of the variant in proband and heterozygous state in parents. Considering the available information, the variant is currently categorized as a variant of unknown clinical significance (PM2, PP3). The functional implications of the identified missense substitution were further investigated through 3D structural modeling of the wild-type (WT) and mutant proteins (Figure 3). The analysis demonstrated that the conserved Ala-479 residue is situated within the alpha-helix of the RINT1/TIP20 domain. Substitution with proline introduces significant structural constraints due to the rigid side-chain ring that incorporates the nitrogen atom, preventing rotation around the N⎯C (alpha) bond. Consequently, proline residues disrupt helix stability by introducing a destabilizing kink and exhibit a low propensity to participate in helix formation (15), (16). Since the identified variant was detected in a proband in a homozygous state, we conducted detailed genetic counseling for the family to investigate potential consanguinity. The parents, however, were unable to establish a direct genealogical link between their pedigrees. This observation suggests a possible common origin of the identified variant within the Chuvash population, from which the proband's parents originated. To further explore this, we performed an analysis of runs of homozygosity (ROH) using whole-exome sequencing (WES) data. This analysis revealed an extensive ROH at chromosome 7 spanning 18.5 Mb, with boundaries at chr7:102,605,864–121,125,900 as shown in Figure 4, encompassing the entire RINT1 locus (chr7:105,172,648–105,208,124). Using Rutgers Map v.2 the physical boundaries of autozygosity regions determined by the WES data were converted into 111.43–126.31 cM (Kosambi) sex-averaged genetic distances, which corresponds to a common ancestor of 6.72 generations ago. Based on the average length of generations in humans of 25 years, these estimates suggest the age of the mutation spread of 168.01 years. 4. Discussion The proband and her siblings exhibit hallmark signs of RALF. The whole-exome sequencing revealed a homozygous RINT1 variant in the proband, resulting in an alanine to proline substitution at position 479, while the parents were found to be heterozygous carriers, consistent with an autosomal recessive inheritance pattern. According to AСMG criteria, this variant is classified as a variant of uncertain clinical significance. However, we also conducted whole-genome sequencing for the proband, which revealed no other causes for RALF and neutropenia. We predicted that this RINT1 mutation, located within a helix bundle, could disrupt the tertiary structure of the protein by altering the core structural integrity, potentially compromising its stability and function. The extensive ROH region encompassing the RINT1 locus in the patient suggests a potential common origin of the variant within the Chuvash population. As the fifth largest ethnic group in Russia, the Chuvash population has a distinct genetic history marked by a population bottleneck effect ( 17 ). This historical event has contributed to a unique genetic landscape, characterized by an increased genetic load of pathogenic variants and the specific distribution of hereditary diseases ( 18 ), ( 19 ), ( 20 ), ( 21 ), ( 22 ), ( 17 ). Based on this, we hypothesize that RINT1 -associated recurrent acute liver failure (RALF) could represent a population-specific disorder with increased prevalence within the Chuvash population. The clinical and genetic characteristics observed in the proband and her siblings strongly indicate that this mutation in RINT1 plays a pivotal role in the pathogenesis of RALF and associated neutropenia. The clinical findings in the individuals we describe show notable similarities to previously published data. Nearly all reported patients with RINT1 mutations experience episodes of acute liver failure triggered by infections, fever, or other stressors. Skeletal abnormalities, such as vertebral hypoplasia and deformities, have been frequently documented, as reported by Margot A. Cousin ( 4 ); however, these features were absent in our proband and her siblings. Additionally, our patients did not exhibit neurological findings similar to those described in the study by Nathalie Launay( 5 ). Furthermore, our proband and her siblings exhibited hematological manifestations – neutropenia, underscoring the multisystemic nature of RINT1 -related pathology. RINT1 (Rad50-Interacting Protein 1) plays a critical role in maintaining cellular homeostasis by regulating retrograde vesicular transport between the ER and the Golgi apparatus as part of the NRZ complex (NBAS-RINT1-ZW10). It ensures proper Golgi morphology, protein recycling, and membrane trafficking. RINT1 is also involved in autophagy, with its deficiency leading to impaired autophagic flux and disrupted waste clearance. Additionally, RINT1 influences lipid droplet biogenesis and lipid metabolism, affecting triglyceride synthesis and phospholipid balance. It further impacts mitochondrial function by regulating reactive oxygen species (ROS) levels, mitochondrial membrane potential, and dynamics. RINT1 is ubiquitously expressed in all tissues, highlighting its essential role in fundamental cellular processes. According to previously published studies, functional analyses of RINT1 variants identified in patients with ILFS3 revealed a significant reduction in RINT1 protein levels caused by pathogenic mutations. Western blot analysis of fibroblasts demonstrated decreased RINT1 expression, accompanied by reduced levels of associated NRZ complex components, such as ZW10 and NBAS. Furthermore, immunofluorescence studies showed abnormal RINT1 localization within the endoplasmic reticulum and disrupted Golgi morphology ( 4 ), ( 5 ). These findings indicate that the identified RINT1 variants result in protein instability and degradation, leading to impaired retrograde vesicular transport and defective autophagy pathways. We explain neutropenia in RINT1-deficient patients by disruptions in key cellular processes, including impaired retrograde vesicular transport, defective autophagy, and mitochondrial dysfunction. These defects compromise neutrophil development, reduce survival, and promote apoptosis. The hypothesis that recurrent acute liver failure in patients with RINT1 deficiency could be due to immune dysregulation and immune-mediated attack on liver cells is supported by several lines of evidence. RINT1 -related infantile liver failure syndrome-3 (ILFS3) has been characterized by recurrent episodes of liver failure triggered by febrile illnesses. This suggests that immune system overactivation during infections may play a role in pathology. While direct studies connecting RINT1 to immune-mediated liver cell attack are limited, the involvement of immune dysregulation in other liver failure contexts provides indirect support for this hypothesis ( 5 ), ( 23 ). Notably, patients with NBAS mutations, another component of the NRZ complex, also exhibit immunological complications such as hypogammaglobulinemia, B-cell deficiency, reduced CD8 + T cells, low NK cell levels, and recurrent infections. Given that RINT1 and NBAS interact within the NRZ complex to regulate cellular transport, these overlapping immunological features highlight the critical role of their interaction in maintaining immune cell function ( 24 ). 5. Conclusions In our work, we identified a patient with homozygous variant NM_021930.6:c.1435G>C in the RINT1 gene, causing ILFS3 and neutropenia. We suggest that, due to the specific phenotype and high mortality observed in our cases, there is a critical need for early detection and vigilant monitoring in patients with similar mutations, facilitated by whole-exome sequencing. Abbreviations ALF acute liver failure episode, ALT—alanine aminotransferase; AST—aspartate aminotransferase; ALP—alkaline phosphatase; GGT—-glutamyltranspeptidase, INR— international normalized ratio; m—months; N/A—not available; y—years, WT - wild-type. Declarations Ethics approval and consent to participate: The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of Research Centre for Medical Genetics (the approval number 11 from 23 November 2021). Consent for publication: written informed consent was obtained from the patient’s legal guardians for publication of this case report Availability of data and materials: the datasets used and/or analyzed during this study are available from the corresponding author upon reasonable request. Competing interests: the authors declare that they have no competing interests. Funding: this research received no external funding. Authors’ Contributions: Ekaterina Nuzhnaya, Natalia Semenova, and Andrey Marakhonov designed the study. Polina Tsygankova, Anna Efremovа performed laboratory experiments and data analysis. Ekaterina Nuzhnaya, Natalia Semenova, Nelly Kan, Yulia Rodina, Anna Shcherbina collected and interpreted the clinical data. Andrey Marakhonov did statistical and bioinformatic analysis. Nikolai Prokhorov did protein structural modeling. Ekaterina Nuzhnaya drafted the manuscript. Natalia Semenova, Nelly Kan, Yulia Rodina, Anna Shcherbina revised the manuscript critically for scientific content. All authors gave scientific and technical input to the study and approved the final version of the manuscript and revision. Acknowledgments: The authors sincerely thank the patients and their families for their invaluable support and participation in this study. We are also deeply grateful to the staff of the institution “Research Centre For Medical Genetics” and the Dmitry Rogachev National Research Center of Pediatric Hematology, Oncology, and Immunology for their expert assistance in performing genetic sequencing and conducting a comprehensive clinical evaluation of the patient. References Squires JE, McKiernan PJ, Squires RH. Acute Liver Dysfunction Criteria in Critically Ill Children: The PODIUM Consensus Conference. Pediatrics. 2022 г.;149(Supplement_1):S59–65. Squires JE, Alonso EM, Ibrahim SH, Kasper V, Kehar M, Martinez M, и др. North American Society for Pediatric Gastroenterology, Hepatology, and Nutrition Position Paper on the Diagnosis and Management of Pediatric Acute Liver Failure. J Pediatr Gastroenterol Nutr. 2021 г.;Publish Ahead of Print(1). Peters B, Dattner T, Schlieben LD, Sun T, Staufner C, Lenz D. Disorders of vesicular trafficking presenting with recurrent acute liver failure: NBAS, RINT1, and SCYL1 deficiency. J Inherit Metab Dis. 2024 г.;(6). Cousin MA, Conboy E, Wang JS, Lenz D, Schwab TL, Williams M, и др. RINT1 Bi-allelic Variations Cause Infantile-Onset Recurrent Acute Liver Failure and Skeletal Abnormalities. Am J Hum Genet. 2019 г.;105(1):108–21. Launay N, Ruiz M, Planas-Serra L, Verdura E, Agustí Rodríguez-Palmero, Schlüter A, и др. RINT1 deficiency disrupts lipid metabolism and underlies a complex hereditary spastic paraplegia. J Clin Invest. 2023 г.;133(14). Fever Triggered Recurrent Acute Liver Failure due to RINT1 Deficiency. Доступно на: https://link.springer.com/article/10.1007/s12098-024-05230-x Thorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform. 2012 г.;14(2):178–92. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, и др. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med Off J Am Coll Med Genet. 2015 г.;17(5):405–24. Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, и др. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 2024 г.;630(630):493–500. Goddard TD, Huang CC, Meng EC, Pettersen EF, Couch GS, Morris JH, и др. UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci. 2017 г.;27(1):14–25. Quinodoz M, Peter VG, Bedoni N, Royer Bertrand B, Cisarova K, Salmaninejad A, и др. AutoMap is a high performance homozygosity mapping tool using next-generation sequencing data. Nat Commun. 2021 г.;12(1):1–7. Dmitrii Subbotin, Sofya Ionova, Andrey Marakhonov, Saifullina E, Artem Borovikov, Akhmadeeva L, и др. The frequent variant A57F in the GNE gene in patients from Russia has Finno-Ugric Mari origin. Front Genet. 2024 г.;15(15). Budde B, Namavar Y, Barth P, Bwee Tien Poll-Thé, Nürnberg G, Becker C, и др. tRNA splicing endonuclease mutations cause pontocerebellar hypoplasia. Nat Genet. 2008 г.;40(9):1113–8. Matise TC, Chen F, Chen W, De FM, Hansen M, He C, и др. A second-generation combined linkage–physical map of the human genome: Table 1. Genome Res. 2007 г.;17(12):1783–6. D Gunasekaran, Sridhar J, V Suryanarayanan, Manimaran NC, Sanjeev Kumar Singh. Molecular modeling and structural analysis of nAChR variants uncovers the mechanism of resistance to snake toxins. J Biomol Struct Dyn. 2016 г.;35(8):1654–71. Kim MK, Kang YK. Positional preference of proline in α-helices. Protein Sci. 1999 г.;8(7):1492–9. Petrova NV, Marakhonov AV, Balinova NV, Abrukova AV, Konovalov FA, Kutsev SI, и др. Genetic Variant c.245A>G (p.Asn82Ser) in GIPC3 Gene Is a Frequent Cause of Hereditary Nonsyndromic Sensorineural Hearing Loss in Chuvash Population. Genes. 2021 г.;12(6):820. Bliznetz EA, Tverskaya SM, Zinchenko RA, Abrukova AV, Savaskina EN, Nikulin MV, и др. Genetic analysis of autosomal recessive osteopetrosis in Chuvashiya: the unique splice site mutation in TCIRG1 gene spread by the founder effect. Eur J Hum Genet. 2009 г.;17(5):664–72. Age of Arg200Trp mutation in the VHL gene, which leads to the development of autosomal recessive erythrocytosis in Chuvashia, Med. Genet., 207, vol. 6, no. 9, pp. 31–36. Kazantseva A, Goltsov A, Zinchenko R, Grigorenko AP, Abrukova AV, Moliaka YK, и др. Human Hair Growth Deficiency Is Linked to a Genetic Defect in the Phospholipase Gene LIPH. Science. 2006 г.;314(5801):982–5. Zernov NV, Mikhail Skoblov, Marakhonov AV, Shimomura Y, T.A. Vasilyeva, Konovalov FA, и др. Autosomal Recessive Hypotrichosis with Woolly Hair Caused by a Mutation in the Keratin 25 Gene Expressed in Hair Follicles. 6. 2016 г.;136(6):1097–105. Stepanova AA, Abrukova AV, Savaskina EN, Poliakov AV. Mutation p.E92K is the primary cause of cystic fibrosis in Chuvashes. Genetika. 2012 г.;48(7):863–71. Alicja Dąbrowska, Bartosz Wilczyński, Mastalerz J, Kucharczyk J, Julita Kulbacka, Szewczyk A, и др. The Impact of Liver Failure on the Immune System. Int J Mol Sci. 2024 г.;25(17):9522–9522. Ricci S, Lodi L, Serranti D, Moroni M, Belli G, Mancano G, и др. Immunological Features of Neuroblastoma Amplified Sequence Deficiency: Report of the First Case Identified Through Newborn Screening for Primary Immunodeficiency and Review of the Literature. Front Immunol. 2019 г.;10. Additional Declarations No competing interests reported. Supplementary Files AdditionalfileSupplementaryTableS1.pdf Supporting information Additional supporting information can be found online in the Supporting Information section at the end of this article. Cite Share Download PDF Status: Published Journal Publication published 07 Oct, 2025 Read the published version in Human Genomics → Version 1 posted Editorial decision: Revision requested 02 Aug, 2025 Reviews received at journal 02 Aug, 2025 Reviewers agreed at journal 23 Jul, 2025 Reviewers invited by journal 11 Jul, 2025 Editor assigned by journal 01 Jul, 2025 Submission checks completed at journal 01 Jul, 2025 First submitted to journal 30 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7009438","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":484352793,"identity":"712d7d27-be8c-4f4b-8182-8bf539d4e608","order_by":0,"name":"Еkaterina Nuzhnaya","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYHACNjDJD8QSpGmRbCBZi8EBYrWYS6Q/e1xQc1je+NrhgzcYftnkMUifMcCrxXJGQrrxjGOHDbfdTku2YOxLK2bgy8GvxeBGwjFpHrbDjNtu55hJ/+05nNjAw0NIS2KbNM+/w/abZ+d/k2Ds+U+MlmQ2ad62w4kbpHPYJBh+HCBCy5lnQC196ckzbqcZWzA2JCe28bAV4NdyPP2ZNM83a9v+2ckPbzD8sUvs52HegFcLFDRDKMY2WDQRBnVQ+g+R6kfBKBgFo2BEAQDOTUOd/p0FsQAAAABJRU5ErkJggg==","orcid":"","institution":"Research Centre for Medical Genetics","correspondingAuthor":true,"prefix":"","firstName":"Еkaterina","middleName":"","lastName":"Nuzhnaya","suffix":""},{"id":484352794,"identity":"6e7199a5-6bfc-482d-85ff-6f80265c10b7","order_by":1,"name":"Andrey Marakhonov","email":"","orcid":"","institution":"Research Centre for Medical Genetics","correspondingAuthor":false,"prefix":"","firstName":"Andrey","middleName":"","lastName":"Marakhonov","suffix":""},{"id":484352795,"identity":"c9af1ccf-e2c4-46bf-bd37-b024b021ab34","order_by":2,"name":"Nikolai Prokhorov","email":"","orcid":"","institution":"Indiana University Bloomington","correspondingAuthor":false,"prefix":"","firstName":"Nikolai","middleName":"","lastName":"Prokhorov","suffix":""},{"id":484352797,"identity":"268717ae-1cc3-49bf-8b61-06be5c0ebec7","order_by":3,"name":"Nelly Kan","email":"","orcid":"","institution":"Dmitry Rogachev National Research Center of Pediatric Hematology, Oncology and Immunology","correspondingAuthor":false,"prefix":"","firstName":"Nelly","middleName":"","lastName":"Kan","suffix":""},{"id":484352798,"identity":"9516a9e0-1db1-4ffc-ac04-12f40eeea6f7","order_by":4,"name":"Yulia Rodina","email":"","orcid":"","institution":"Dmitry Rogachev National Research Center of Pediatric Hematology, Oncology and Immunology","correspondingAuthor":false,"prefix":"","firstName":"Yulia","middleName":"","lastName":"Rodina","suffix":""},{"id":484352799,"identity":"f9e973a5-0368-4794-a769-20231db45083","order_by":5,"name":"Anna Shcherbina","email":"","orcid":"","institution":"Dmitry Rogachev National Research Center of Pediatric Hematology, Oncology and Immunology","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Shcherbina","suffix":""},{"id":484352800,"identity":"f4e7e63f-cf72-4953-b854-a927232d66e2","order_by":6,"name":"Polina Tsygankova","email":"","orcid":"","institution":"Research Centre for Medical Genetics","correspondingAuthor":false,"prefix":"","firstName":"Polina","middleName":"","lastName":"Tsygankova","suffix":""},{"id":484352803,"identity":"790637dc-8d77-4783-b54d-74a3529a231f","order_by":7,"name":"Anna Efremovа","email":"","orcid":"","institution":"Research Centre for Medical Genetics","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Efremovа","suffix":""},{"id":484352804,"identity":"6f14d441-70c4-4c89-a44d-d61b559aedae","order_by":8,"name":"Natalia Semenova","email":"","orcid":"","institution":"Research Centre for Medical Genetics","correspondingAuthor":false,"prefix":"","firstName":"Natalia","middleName":"","lastName":"Semenova","suffix":""}],"badges":[],"createdAt":"2025-06-30 10:23:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7009438/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7009438/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s40246-025-00827-5","type":"published","date":"2025-10-07T15:57:14+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":87028743,"identity":"a9f29ae3-aab0-499e-b437-39882fb5b9f7","added_by":"auto","created_at":"2025-07-18 12:35:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":176566,"visible":true,"origin":"","legend":"\u003cp\u003e(a), (b) Longitudinal analysis of ALT and AST Levels with episodes of elevation triggered by factors such as fever and acute respiratory infections (c) longitudinal analysis of absolute neutrophil counts in three patients\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7009438/v1/f6cd51f694084856d08ad6de.png"},{"id":87028752,"identity":"0ccabcab-5a72-4127-8c5c-7d093839a62d","added_by":"auto","created_at":"2025-07-18 12:35:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":120176,"visible":true,"origin":"","legend":"\u003cp\u003eFamily pedigree and genetic testing of the proband with the variant in \u003cem\u003eRINT1\u003c/em\u003e.\u003cbr\u003e\na) Family tree showing the affected proband and siblings with an undetermined genetic status and unaffected parents\u003c/p\u003e\n\u003cp\u003eb) Sanger sequencing results demonstrating c.1435G\u0026gt;C \u003cem\u003eRINT1 \u003c/em\u003evariant in the homozygous state in the proband and in the heterozygous state in both parents\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7009438/v1/3a5c7b9914c6f3cce97ccd4a.png"},{"id":87028745,"identity":"186e369c-d778-43a8-a410-74a9357b8383","added_by":"auto","created_at":"2025-07-18 12:35:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":302834,"visible":true,"origin":"","legend":"\u003cp\u003eA: Modelling of the substitution A479P in the RINT1 protein. The five best Alphafold 2 computed structure models (CSMs) of WT RINT1 (grey) and the five best AF2 CSMs of the A479P variant (pink) are superimposed. B: Superposition of the best CSMs of WT RINT1 and A479P variant in the proximity to the mutation illustrating moderate local changes in the structure.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7009438/v1/9ae2d1b7f8d07e3aa23c31d8.png"},{"id":87030231,"identity":"5420cee4-745b-4271-a3c6-dbdf8279887c","added_by":"auto","created_at":"2025-07-18 12:43:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":70693,"visible":true,"origin":"","legend":"\u003cp\u003eMapping of runs of homozygosity (ROH) in WES data for the proband. Blue lines represent ROH regions distributed across the chromosomes, shown along the X-axis, with their respective positions and lengths\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7009438/v1/8d1503aebb4f83c996967565.png"},{"id":93419641,"identity":"a1833df1-573c-4f8f-a064-9bb09f92dd40","added_by":"auto","created_at":"2025-10-13 16:05:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1278790,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7009438/v1/dcd2cab8-a5ad-4c0a-a1a0-86c9710c4d8d.pdf"},{"id":87030232,"identity":"7a60363d-bee3-4fd6-a2df-35c68652f8e0","added_by":"auto","created_at":"2025-07-18 12:43:10","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":195696,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupporting information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdditional supporting information can be found online in the Supporting Information section at the end of this article.\u003c/p\u003e","description":"","filename":"AdditionalfileSupplementaryTableS1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7009438/v1/d43e4a7b603f15eadcbe933d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Recurrent Acute Liver Failure and Neutropenia сaused by a novel homozygous RINT1 variant: evidence for a population-specific disorder","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eInfantile-onset recurrent acute liver failure (RALF) is a life-threatening condition affecting pediatric populations. It is characterized by episodic hepatic decompensation, typically triggered by fever, infections, or metabolic stress. Each episode carries significant risks, including severe coagulopathy unresponsive to parenteral vitamin K, with or without hepatic encephalopathy (HE) or milder coagulopathy with HE, and progressive liver fibrosis (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Although liver function may recover between episodes, RALF underscores underlying genetic susceptibilities predisposing patients to liver crises.\u003c/p\u003e\u003cp\u003eAdvancements in genetic diagnostics, particularly through whole-exome sequencing (WES), have identified mutations in genes responsible for cellular trafficking and homeostasis, such as \u003cem\u003eNBAS\u003c/em\u003e, \u003cem\u003eRINT1\u003c/em\u003e, and \u003cem\u003eSCYL1\u003c/em\u003e, as contributing factors in a significant subset of RALF cases. These genes play crucial roles in vesicular trafficking, regulating protein transport between the endoplasmic reticulum (ER) and the Golgi apparatus. Mutations in these genes can disrupt this pathway, leading to ER stress and impaired autophagy, which sensitizes hepatocytes to injury during infectious or febrile episodes (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eMargot A. Cousin et al. described a novel clinical phenotype associated with bi-allelic \u003cem\u003eRINT1\u003c/em\u003e variants, presenting as RALF alongside skeletal abnormalities. Their study analyzed three unrelated pediatric patients, all experiencing fever- or infection-triggered liver failure episodes coupled with distinctive skeletal features, such as vertebral and acetabular anomalies. Genetic analysis identified compound heterozygous \u003cem\u003eRINT1\u003c/em\u003e variants, including a shared splice-site alteration, leading to exon skipping and reduced RINT1 protein levels. Functional studies on fibroblasts revealed abnormal Golgi morphology and impaired autophagic flux, suggesting a pathogenic mechanism involving disrupted vesicular transport and autophagy. This study expanded the clinical spectrum of \u003cem\u003eRINT1\u003c/em\u003e-related disorders and led to the classification of this condition in OMIM as infantile liver failure syndrome type 3 (ILFS3, OMIM #618641) (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eNathalie Launay et al. further elucidated the clinical and molecular consequences of biallelic \u003cem\u003eRINT1\u003c/em\u003e variants in patients with early-onset neurological symptoms, including spastic paraplegia, ataxia, optic nerve hypoplasia, and dysmorphic features. WES identified pathogenic \u003cem\u003eRINT1\u003c/em\u003e variants in three individuals from two unrelated families. Functional studies demonstrated that these variants impair lipid droplet biogenesis, disrupt lipid metabolism, and cause mitochondrial dysfunction, resulting in increased reactive oxygen species production and altered mitochondrial dynamics. Two patients presented with RALF: one, without neurological manifestations, succumbed to liver failure at 14 months of age, while the other experienced liver failure at 10 years, triggered by an infectious episode. These findings link RINT1 deficiency to both neurological impairments and RALF, underscoring its role in lipid homeostasis, autophagy, and organelle function (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn this study, we describe a proband with RALF and neutropenia identified through WES to carry homozygous \u003cem\u003eRINT1\u003c/em\u003e variants. Notably, the proband's two siblings exhibit identical clinical manifestations, including RALF and neutropenia. This familial occurrence further supports the diagnosis and the causative nature of the identified \u003cem\u003eRINT1\u003c/em\u003e variant, reinforcing an autosomal recessive inheritance pattern. A similar case was reported in 2024, describing a child with \u003cem\u003eRINT1\u003c/em\u003e-associated RALF and intermittent neutropenia. However, the previous report did not include specific laboratory data, such as the absolute neutrophil count, leaving an important aspect of the phenotype unaddressed (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e)\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cp\u003e2.1. The proband was examined at the Research and Counseling Department of the Research Centre for Medical Genetics (RCMG, Moscow) and at the Immunology Department of the Dmitry Rogachev National Research Center of Pediatric Hematology, Oncology and Immunology. Informed consent was obtained from all subjects involved in the study. Written informed consent has been obtained from the patient to publish this paper.\u003c/p\u003e\n\u003cp\u003eThe conducted laboratory and instrumental investigations included dynamic monitoring of hemogram, cytological tests of peripheral blood and bone marrow, flow cytometry for immunophenotyping of peripheral blood lymphocytes, biochemical assays, coagulation studies, and infectious disease screening to exclude hepatic involvement of infectious origin. Imaging studies comprised abdominal ultrasound, MRI, and liver elastography. Additionally, an endoscopic examination of the stomach was performed. Genetic analyses included a targeted gene panel for liver-associated disorders, whole-exome sequencing, and whole-genome sequencing.\u003c/p\u003e\n\u003cp\u003e2.2 Genetic testing: Blood samples from the proband and unaffected parents were collected, and genomic DNA was extracted by standard methods. Whole exome sequencing was performed for the proband. Target enrichment with a SeqCap EZ HyperCapWorkflow solution capture array (Roche Sequencing Solutions Inc., Santa Clara, CA, USA), including the coding regions of 20,000 genes and sequencing were carried out using Illumina NextSeq 500 (Illumina, San Diego, CA, USA). The coding sequence of \u003cem\u003eRINT1\u0026nbsp;\u003c/em\u003ewas completely covered when using this method. Sequencing data were processed using a standard computer-based algorithm from Illumina and BaseSpace software (Enrichment 3.1.0). Aligned sequences were visualized with Integrative Genomics Viewer (IGV) browser (7). Filtering of the variants was based on their frequency of less than 1% in gnomAD and coding region sequence effects such as missense, nonsense, coding indels, and splice sites. The variant\u0026rsquo;s clinical significance was evaluated according to the ACMG/AMP criteria (8). The revealed variant was named according to the reference transcript variant (NM_021930.6) for the \u003cem\u003eRINT1\u003c/em\u003e gene. Sanger sequencing was carried out to validate the variant in the proband and its presence in the parents. To amplify the fragment encompassing the candidate variant, custom primers were used:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRINT1_10F\u003c/em\u003e:GTGGGATATTGTAGGTTTGTTTCTT\u0026nbsp;\u003cem\u003eRINT1_10R:\u003c/em\u003eAAAAACTACCACGTGAAAACAGTA\u003cbr\u003e2.3. Bioinformatic analysis. Alphafold3 was used to generate computed structure models (CSMs) of the A479P variant of \u003cem\u003eRINT1\u003c/em\u003e. CSMs were visualized with UCSF ChimeraX v1.7 (9), (10).\u003c/p\u003e\n\u003cp\u003e2.4. Autozygosity mapping. Regions of autozygosity on WES and WGS data were analyzed using AutoMap v1.2 tool with the subsequent visual inspection of the region\u0026rsquo;s borders (11). The age of the mutation spread event was estimated using the method described in detail elsewhere (12), (13). For the interpolation of hg19 physical positions into the sex-averaged map positions in Kosambi cM, Rutgers Maps v.3 were used (14).\u003c/p\u003e"},{"header":"3.\tCase presentation ","content":"\u003cp\u003eClinical Findings\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe proband was an 8 year old female born to non consanguineous parents from Chuvashia. Delivery occurred at 37 weeks of gestation, with a birth weight of 3160 grams (+0.66 SD) and a length of 52 cm (+1.95 SD). The perinatal period was uneventful, and neonatal screening results were normal. Her developmental milestones were within expected ranges, neutropenia (400 cells/\u0026micro;l) was first recorded but at the age of 6 months. She was noted to have partial congenital anal atresia and has experienced persistent constipation. Since the age of 9 months, she has experienced RALF, typically coinciding with episodes of fever and respiratory infections. Her peak serum aspartate aminotransferase, alanine aminotransferase AST/ALT levels reached 12,030/9,050 U/L, and coagulopathy was occasionally observed during episodes of acute liver failure. Notably, her biochemical\u0026nbsp;laboratory values either were within normal ranges or only mildly elevated between episodes. Her absolute neutrophil count ranged from 400 to 1500 cells/\u0026mu;L both between and during episodes (Table 1).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 1. The comparison of clinical features between proband and siblings\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePatients\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSibling 1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSibling 2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eProband\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMaternal\u0026nbsp;allele\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enot available\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enot available\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ec.1435G\u0026gt;С, p.(Ala479Pro)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePaternal\u0026nbsp;allele\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enot available\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enot available\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ec.1435G\u0026gt;С, p.(Ala479Pro)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAncestry\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eChuvash\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eChuvash\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eChuvash\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eConsanguinity\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003emale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003emale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGestation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eborn at 38 weeks\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eborn at 38 weeks\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eborn at 37 weeks\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNeonatal jaundice\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eyes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNone\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDysmorphisms\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAge of first ALF episode\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1 y\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1 y 9 m\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e9 m\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eEpisodes of ALF or acutely elevated transaminases\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAge at last assessment\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003edied at 1 y (during the first episode)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003edied at 8 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e9 y now\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGrowth\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eWeight at evaluation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNormal\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBirth weight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4040 g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3800 g\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3160 g\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLength\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55 cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e54 cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e52 cm\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHead circumference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNormal\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDevelopment\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMotor development\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNormal\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLanguage acquisition\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNormal\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAge at last episode of ALF/ acutely elevated transaminases\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1 y\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e8 y\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e9 y\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSuspected triggers of episodes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003efever, acute respiratory infection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003efever, acute respiratory infection, enterovirus meningitis, pneumonia, varicella zoster\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003efever, acute respiratory infection, pneumonia\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHepatic involvement\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHepatomegaly\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFibrosis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eLaboratory finding during ALF episodes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGlucose (normal range: 3.3-5.3 mmol/l)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4.3\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5.03\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eALT (normal range: \u0026lt;40 U/l)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3060\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5400\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAST (normal range: \u0026lt;40 U/l)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4760\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e6250\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTotal bilirubin (normal range: 3.7-20.5 \u0026micro;mol/l)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e48.8\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e23.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eProthrombin time (normal range: 14-15.4 s)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e41\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e53.3\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e23.7\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eINR (normal range: 0.87-1.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5.7\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.64\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMaximal AST/ALT (U/L) during ALF (normal range: \u0026lt;40 U/l)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5280/ 5670\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12030/9150\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLowest AST/ALT (U/L) between episodes (normal range: \u0026lt;40 U/l)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.8/20.6\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e44/17.5\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eOther manifestations\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCongenital malformation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003epartial congenital anal atresia, constipation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eRetroperitoneal ultrasound\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eleft renal pyelectasis 6 mm at 1 month\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNormal\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eEchocardiogram\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eminimal tricuspid, pulmonary insufficiency\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003enormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eminimal mitral valve prolapses\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAbsolute neutrophil count (ANC) (normal range: 1500-8500 cells/\u0026micro;l)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1056 cells/\u0026micro;l\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1340 cells/\u0026micro;l\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e400-2000 cells/\u0026micro;l\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAge of first ANC episode\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3 m\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1 y 3 m\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e9 m\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLowest ANC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e910 cells/\u0026micro;l at 1 y\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e670 cells/\u0026micro;l at\u0026nbsp;5 y 2m\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e200 cells/\u0026micro;l at 6 y\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eALF acute liver failure episode, ALT\u0026mdash;alanine aminotransferase; AST\u0026mdash;aspartate aminotransferase; ALP\u0026mdash;alkaline phosphatase; GGT\u0026mdash;-glutamyltranspeptidase, INR\u0026mdash; international normalized ratio; m\u0026mdash;months; N/A\u0026mdash;not available; y\u0026mdash;years, WT - wild-type.\u003c/p\u003e\n\u003cp\u003eShe presents with hepatomegaly and instrumental signs of liver fibrosis. Cytological examination of a peripheral blood smear did not reveal significant morphological changes in neutrophils. Cytological examination of the bone marrow revealed a moderate depletion of the neutrophil lineage without morphological changes in cells. Cytogenetic examination of the bone marrow showed a reduced number of mitoses.\u003c/p\u003e\n\u003cp\u003eImmunophenotyping of peripheral blood lymphocytes did not show any abnormalities: CD3 (T-lym): 2.09 10⁶/ml, CD3+CD4+ (Th cells): 1.22 10⁶/ml (naive 73%), CD3+CD8+ (Tc cells): 0.71 10⁶/ml (naive 74.3%), B cells (CD19+): 0.44 10⁶/ml (switched \u0026ndash; 11.3%; CD21lowCD38low \u0026ndash; 3.9% CD3-CD16+CD56+ Lym (NK-cells): 0.23 10⁶/ml. NK-cells degranulation was normal.\u003c/p\u003e\n\u003cp\u003eThe proband\u0026apos;s family history is notable: her brother passed away at the age of 1 year and 1 month due to acute liver failure following an acute viral infection, presenting with coagulopathy and hepatomegaly. Another brother experienced acute liver failure at 1 year and 9 months, associated with fever and an acute respiratory infection. His clinical presentation mirrored that of the proband, with elevated transaminase levels during febrile episodes and infections, followed by near complete normalization of values between episodes. A gene panel analysis identified no causative variants. Sadly, he succumbed to multi-organ failure at the age of 8 years and 1 month during a subsequent episode.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAs illustrated in Figure 1, the proband and both brothers share a consistent clinical presentation, characterized by elevated transaminase levels associated with recurrent infections, along with neutropenia observed in all patients.\u003c/p\u003e\n\u003cp\u003eThe proband is currently enrolled in home-based education to minimize exposure to infections. She is being monitored by a hematologist for idiopathic neutropenia and is receiving granulocyte colony-stimulating factor therapy with effective hematology answer. Concurrently, she remains under the care of gastroenterologists for the management of recurrent liver failure.\u003c/p\u003e\n\u003cp\u003e3.2 Genetic Analysis\u003c/p\u003e\n\u003cp\u003eMolecular genetic analysis of the proband was performed using WES. The only candidate variant identified was a novel single nucleotide variant, NM_021930.6:c.1435G\u0026gt;C, in a heterozygous state in the exon 10 of the \u003cem\u003eRINT1\u003c/em\u003e gene as shown in Figure 2.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis variant results in a missense substitution of the highly conservative amino acid residue p.(Ala479Pro) within the RINT1/TIP20 domain in the RINT1 protein. The identified nucleotide sequence variant is not registered in the control sample of the Genome Aggregation Database (gnomAD v.4.1.0). Most bioinformatic predictors suggest that the variant is likely to be damaging as shown in Suppl. Table S1. Sanger sequencing confirmed a homozygous state of the variant in proband and heterozygous state in parents. Considering the available information, the variant is currently categorized as a variant of unknown clinical significance (PM2, PP3).\u003c/p\u003e\n\u003cp\u003eThe functional implications of the identified missense substitution were further investigated through 3D structural modeling of the wild-type (WT) and mutant proteins (Figure 3).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe analysis demonstrated that the conserved Ala-479 residue is situated within the alpha-helix of the RINT1/TIP20 domain. Substitution with proline introduces significant structural constraints due to the rigid side-chain ring that incorporates the nitrogen atom, preventing rotation around the N⎯C (alpha) bond. Consequently, proline residues disrupt helix stability by introducing a destabilizing kink and exhibit a low propensity to participate in helix formation (15), (16).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSince the identified variant was detected in a proband in a homozygous state, we conducted detailed genetic counseling for the family to investigate potential consanguinity. The parents, however, were unable to establish a direct genealogical link between their pedigrees. This observation suggests a possible common origin of the identified variant within the Chuvash population, from which the proband\u0026apos;s parents originated. To further explore this, we performed an analysis of runs of homozygosity (ROH) using whole-exome sequencing (WES) data. This analysis revealed an extensive ROH at chromosome 7 spanning 18.5 Mb, with boundaries at chr7:102,605,864\u0026ndash;121,125,900 as shown in Figure 4, encompassing the entire \u003cem\u003eRINT1\u0026nbsp;\u003c/em\u003elocus (chr7:105,172,648\u0026ndash;105,208,124).\u003c/p\u003e\n\u003cp\u003eUsing Rutgers Map v.2 the physical boundaries of autozygosity regions determined by the WES data were converted into 111.43\u0026ndash;126.31 cM (Kosambi) sex-averaged genetic distances, which corresponds to a common ancestor of 6.72 generations ago. Based on the average length of generations in humans of 25 years, these estimates suggest the age of the mutation spread of 168.01 years.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe proband and her siblings exhibit hallmark signs of RALF. The whole-exome sequencing revealed a homozygous \u003cem\u003eRINT1\u003c/em\u003e variant in the proband, resulting in an alanine to proline substitution at position 479, while the parents were found to be heterozygous carriers, consistent with an autosomal recessive inheritance pattern. According to AСMG criteria, this variant is classified as a variant of uncertain clinical significance. However, we also conducted whole-genome sequencing for the proband, which revealed no other causes for RALF and neutropenia. We predicted that this \u003cem\u003eRINT1\u003c/em\u003e mutation, located within a helix bundle, could disrupt the tertiary structure of the protein by altering the core structural integrity, potentially compromising its stability and function.\u003c/p\u003e\u003cp\u003eThe extensive ROH region encompassing the \u003cem\u003eRINT1\u003c/em\u003e locus in the patient suggests a potential common origin of the variant within the Chuvash population. As the fifth largest ethnic group in Russia, the Chuvash population has a distinct genetic history marked by a population bottleneck effect (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). This historical event has contributed to a unique genetic landscape, characterized by an increased genetic load of pathogenic variants and the specific distribution of hereditary diseases (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e), (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e), (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Based on this, we hypothesize that \u003cem\u003eRINT1\u003c/em\u003e-associated recurrent acute liver failure (RALF) could represent a population-specific disorder with increased prevalence within the Chuvash population. The clinical and genetic characteristics observed in the proband and her siblings strongly indicate that this mutation in \u003cem\u003eRINT1\u003c/em\u003e plays a pivotal role in the pathogenesis of RALF and associated neutropenia.\u003c/p\u003e\u003cp\u003eThe clinical findings in the individuals we describe show notable similarities to previously published data. Nearly all reported patients with \u003cem\u003eRINT1\u003c/em\u003e mutations experience episodes of acute liver failure triggered by infections, fever, or other stressors. Skeletal abnormalities, such as vertebral hypoplasia and deformities, have been frequently documented, as reported by Margot A. Cousin (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e); however, these features were absent in our proband and her siblings. Additionally, our patients did not exhibit neurological findings similar to those described in the study by Nathalie Launay(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Furthermore, our proband and her siblings exhibited hematological manifestations \u0026ndash; neutropenia, underscoring the multisystemic nature of \u003cem\u003eRINT1\u003c/em\u003e-related pathology.\u003c/p\u003e\u003cp\u003eRINT1 (Rad50-Interacting Protein 1) plays a critical role in maintaining cellular homeostasis by regulating retrograde vesicular transport between the ER and the Golgi apparatus as part of the NRZ complex (NBAS-RINT1-ZW10). It ensures proper Golgi morphology, protein recycling, and membrane trafficking. \u003cem\u003eRINT1\u003c/em\u003e is also involved in autophagy, with its deficiency leading to impaired autophagic flux and disrupted waste clearance. Additionally, \u003cem\u003eRINT1\u003c/em\u003e influences lipid droplet biogenesis and lipid metabolism, affecting triglyceride synthesis and phospholipid balance. It further impacts mitochondrial function by regulating reactive oxygen species (ROS) levels, mitochondrial membrane potential, and dynamics. \u003cem\u003eRINT1\u003c/em\u003e is ubiquitously expressed in all tissues, highlighting its essential role in fundamental cellular processes.\u003c/p\u003e\u003cp\u003eAccording to previously published studies, functional analyses of \u003cem\u003eRINT1\u003c/em\u003e variants identified in patients with ILFS3 revealed a significant reduction in RINT1 protein levels caused by pathogenic mutations. Western blot analysis of fibroblasts demonstrated decreased \u003cem\u003eRINT1\u003c/em\u003e expression, accompanied by reduced levels of associated NRZ complex components, such as ZW10 and NBAS. Furthermore, immunofluorescence studies showed abnormal RINT1 localization within the endoplasmic reticulum and disrupted Golgi morphology (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e), (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). These findings indicate that the identified \u003cem\u003eRINT1\u003c/em\u003e variants result in protein instability and degradation, leading to impaired retrograde vesicular transport and defective autophagy pathways.\u003c/p\u003e\u003cp\u003eWe explain neutropenia in RINT1-deficient patients by disruptions in key cellular processes, including impaired retrograde vesicular transport, defective autophagy, and mitochondrial dysfunction. These defects compromise neutrophil development, reduce survival, and promote apoptosis. The hypothesis that recurrent acute liver failure in patients with RINT1 deficiency could be due to immune dysregulation and immune-mediated attack on liver cells is supported by several lines of evidence. \u003cem\u003eRINT1\u003c/em\u003e-related infantile liver failure syndrome-3 (ILFS3) has been characterized by recurrent episodes of liver failure triggered by febrile illnesses. This suggests that immune system overactivation during infections may play a role in pathology. While direct studies connecting RINT1 to immune-mediated liver cell attack are limited, the involvement of immune dysregulation in other liver failure contexts provides indirect support for this hypothesis (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e), (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eNotably, patients with \u003cem\u003eNBAS\u003c/em\u003e mutations, another component of the NRZ complex, also exhibit immunological complications such as hypogammaglobulinemia, B-cell deficiency, reduced CD8\u0026thinsp;+\u0026thinsp;T cells, low NK cell levels, and recurrent infections. Given that \u003cem\u003eRINT1\u003c/em\u003e and \u003cem\u003eNBAS\u003c/em\u003e interact within the NRZ complex to regulate cellular transport, these overlapping immunological features highlight the critical role of their interaction in maintaining immune cell function (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn our work, we identified a patient with homozygous variant NM_021930.6:c.1435G\u0026gt;C \u0026nbsp;in the \u003cem\u003eRINT1\u0026nbsp;\u003c/em\u003egene, causing ILFS3 and neutropenia. We suggest that, due to the specific phenotype and high mortality observed in our cases, there is a critical need for early detection and vigilant monitoring in patients with similar mutations, facilitated by whole-exome sequencing.\u0026nbsp;\u003c/p\u003e\n"},{"header":"Abbreviations","content":"\u003cp\u003eALF acute liver failure episode, ALT—alanine aminotransferase; AST—aspartate aminotransferase; ALP—alkaline phosphatase; GGT—-glutamyltranspeptidase, INR— international normalized ratio; m—months; N/A—not available; y—years, WT - wild-type.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003eThe study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of Research Centre for Medical Genetics (the approval number 11 from 23 November 2021).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003ewritten informed consent was obtained from the patient’s legal guardians for publication of this case report\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003ethe datasets used and/or analyzed during this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e the authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003ethis research received no external funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ Contributions:\u003c/strong\u003e Ekaterina \u0026nbsp; Nuzhnaya, Natalia Semenova, and Andrey \u0026nbsp; Marakhonov designed the study. Polina Tsygankova, Anna Efremovа performed laboratory experiments and data analysis. Ekaterina Nuzhnaya, Natalia Semenova, Nelly Kan, Yulia Rodina, Anna Shcherbina collected and interpreted the clinical data. \u0026nbsp;Andrey Marakhonov did statistical and bioinformatic analysis. \u0026nbsp;Nikolai Prokhorov did protein structural modeling. Ekaterina Nuzhnaya drafted the manuscript. Natalia Semenova, Nelly \u0026nbsp;Kan, Yulia \u0026nbsp;Rodina, Anna Shcherbina revised the manuscript critically for scientific content. All authors gave scientific and technical input to the study and approved the final version of the manuscript and revision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u0026nbsp;\u003c/strong\u003eThe authors sincerely thank the patients and their families for their invaluable support and participation in this study. We are also deeply grateful to the staff of the institution “Research Centre For Medical Genetics” and the Dmitry Rogachev National Research Center of Pediatric Hematology, Oncology, and Immunology for their expert assistance in performing genetic sequencing and conducting a comprehensive clinical evaluation of the patient.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eSquires JE, McKiernan PJ, Squires RH. Acute Liver Dysfunction Criteria in Critically Ill Children: The PODIUM Consensus Conference. Pediatrics. 2022 г.;149(Supplement_1):S59\u0026ndash;65.\u003c/li\u003e\n \u003cli\u003eSquires JE, Alonso EM, Ibrahim SH, Kasper V, Kehar M, Martinez M, и др. North American Society for Pediatric Gastroenterology, Hepatology, and Nutrition Position Paper on the Diagnosis and Management of Pediatric Acute Liver Failure. J Pediatr Gastroenterol Nutr. 2021 г.;Publish Ahead of Print(1).\u003c/li\u003e\n \u003cli\u003ePeters B, Dattner T, Schlieben LD, Sun T, Staufner C, Lenz D. Disorders of vesicular trafficking presenting with recurrent acute liver failure: NBAS, RINT1, and SCYL1 deficiency. J Inherit Metab Dis. 2024 г.;(6).\u003c/li\u003e\n \u003cli\u003eCousin MA, Conboy E, Wang JS, Lenz D, Schwab TL, Williams M, и др. RINT1 Bi-allelic Variations Cause Infantile-Onset Recurrent Acute Liver Failure and Skeletal Abnormalities. Am J Hum Genet. 2019 г.;105(1):108\u0026ndash;21.\u003c/li\u003e\n \u003cli\u003eLaunay N, Ruiz M, Planas-Serra L, Verdura E, Agust\u0026iacute; Rodr\u0026iacute;guez-Palmero, Schl\u0026uuml;ter A, и др. RINT1 deficiency disrupts lipid metabolism and underlies a complex hereditary spastic paraplegia. J Clin Invest. 2023 г.;133(14).\u003c/li\u003e\n \u003cli\u003eFever Triggered Recurrent Acute Liver Failure due to RINT1 Deficiency. Доступно на: https://link.springer.com/article/10.1007/s12098-024-05230-x\u003c/li\u003e\n \u003cli\u003eThorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform. 2012 г.;14(2):178\u0026ndash;92.\u003c/li\u003e\n \u003cli\u003eRichards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, и др. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med Off J Am Coll Med Genet. 2015 г.;17(5):405\u0026ndash;24.\u003c/li\u003e\n \u003cli\u003eAbramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, и др. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 2024 г.;630(630):493\u0026ndash;500.\u003c/li\u003e\n \u003cli\u003eGoddard TD, Huang CC, Meng EC, Pettersen EF, Couch GS, Morris JH, и др. UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci. 2017 г.;27(1):14\u0026ndash;25.\u003c/li\u003e\n \u003cli\u003eQuinodoz M, Peter VG, Bedoni N, Royer Bertrand B, Cisarova K, Salmaninejad A, и др. AutoMap is a high performance homozygosity mapping tool using next-generation sequencing data. Nat Commun. 2021 г.;12(1):1\u0026ndash;7.\u003c/li\u003e\n \u003cli\u003eDmitrii Subbotin, Sofya Ionova, Andrey Marakhonov, Saifullina E, Artem Borovikov, Akhmadeeva L, и др. The frequent variant A57F in the GNE gene in patients from Russia has Finno-Ugric Mari origin. Front Genet. 2024 г.;15(15).\u003c/li\u003e\n \u003cli\u003eBudde B, Namavar Y, Barth P, Bwee Tien Poll-Th\u0026eacute;, N\u0026uuml;rnberg G, Becker C, и др. tRNA splicing endonuclease mutations cause pontocerebellar hypoplasia. Nat Genet. 2008 г.;40(9):1113\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eMatise TC, Chen F, Chen W, De FM, Hansen M, He C, и др. A second-generation combined linkage\u0026ndash;physical map of the human genome: Table 1. Genome Res. 2007 г.;17(12):1783\u0026ndash;6.\u003c/li\u003e\n \u003cli\u003eD Gunasekaran, Sridhar J, V Suryanarayanan, Manimaran NC, Sanjeev Kumar Singh. Molecular modeling and structural analysis of nAChR variants uncovers the mechanism of resistance to snake toxins. J Biomol Struct Dyn. 2016 г.;35(8):1654\u0026ndash;71.\u003c/li\u003e\n \u003cli\u003eKim MK, Kang YK. Positional preference of proline in \u0026alpha;-helices. Protein Sci. 1999 г.;8(7):1492\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003ePetrova NV, Marakhonov AV, Balinova NV, Abrukova AV, Konovalov FA, Kutsev SI, и др. Genetic Variant c.245A\u0026gt;G (p.Asn82Ser) in GIPC3 Gene Is a Frequent Cause of Hereditary Nonsyndromic Sensorineural Hearing Loss in Chuvash Population. Genes. 2021 г.;12(6):820.\u003c/li\u003e\n \u003cli\u003eBliznetz EA, Tverskaya SM, Zinchenko RA, Abrukova AV, Savaskina EN, Nikulin MV, и др. Genetic analysis of autosomal recessive osteopetrosis in Chuvashiya: the unique splice site mutation in TCIRG1 gene spread by the founder effect. Eur J Hum Genet. 2009 г.;17(5):664\u0026ndash;72.\u003c/li\u003e\n \u003cli\u003eAge of Arg200Trp mutation in the VHL gene, which leads to the development of autosomal recessive erythrocytosis in Chuvashia, Med. Genet., 207, vol. 6, no. 9, pp. 31\u0026ndash;36.\u003c/li\u003e\n \u003cli\u003eKazantseva A, Goltsov A, Zinchenko R, Grigorenko AP, Abrukova AV, Moliaka YK, и др. Human Hair Growth Deficiency Is Linked to a Genetic Defect in the Phospholipase Gene LIPH. Science. 2006 г.;314(5801):982\u0026ndash;5.\u003c/li\u003e\n \u003cli\u003eZernov NV, Mikhail Skoblov, Marakhonov AV, Shimomura Y, T.A. Vasilyeva, Konovalov FA, и др. Autosomal Recessive Hypotrichosis with Woolly Hair Caused by a Mutation in the Keratin 25 Gene Expressed in Hair Follicles. 6. 2016 г.;136(6):1097\u0026ndash;105.\u003c/li\u003e\n \u003cli\u003eStepanova AA, Abrukova AV, Savaskina EN, Poliakov AV. Mutation p.E92K is the primary cause of cystic fibrosis in Chuvashes. Genetika. 2012 г.;48(7):863\u0026ndash;71.\u003c/li\u003e\n \u003cli\u003eAlicja Dąbrowska, Bartosz Wilczyński, Mastalerz J, Kucharczyk J, Julita Kulbacka, Szewczyk A, и др. The Impact of Liver Failure on the Immune System. Int J Mol Sci. 2024 г.;25(17):9522\u0026ndash;9522.\u003c/li\u003e\n \u003cli\u003eRicci S, Lodi L, Serranti D, Moroni M, Belli G, Mancano G, и др. Immunological Features of Neuroblastoma Amplified Sequence Deficiency: Report of the First Case Identified Through Newborn Screening for Primary Immunodeficiency and Review of the Literature. Front Immunol. 2019 г.;10.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"human-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"hugm","sideBox":"Learn more about [Human Genomics](http://humgenomics.biomedcentral.com/)","snPcode":"40246","submissionUrl":"https://submission.nature.com/new-submission/40246/3","title":"Human Genomics","twitterHandle":"@OAgenetics","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"recurrent acute liver failure, RALF, infantile liver failure syndrome type 3, disorder of intracellular trafficking, autophagy, RINT1, neutropenia, NBAS, NRZ complex","lastPublishedDoi":"10.21203/rs.3.rs-7009438/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7009438/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground\u003c/p\u003e\n\u003cp\u003eRecurrent acute liver failure \u0026nbsp;in pediatric patients is a severe and life-threatening condition with heterogeneous genetic, immunologic, and environmental causes. Early diagnosis is critical to guide management and improve outcomes. The role of RINT1 variants in liver pathology has been underexplored, with limited data linking these mutations to hepatocellular dysfunction.\u003c/p\u003e\n\u003cp\u003eResults\u003c/p\u003e\n\u003cp\u003eWe report an 8-year-old female proband from Chuvashia presenting with recurrent acute liver failure and neutropenia. Genetic analysis identified a homozygous \u003cem\u003eRINT1\u003c/em\u003e variant (NM_021930.6:c.1435G\u0026gt;C, p.Ala479Pro), with unaffected parents as heterozygous carriers. The proband experienced multiple episodes of fever- and infection-triggered liver failure, characterized by elevated alanine aminotransferase and aspartate aminotransferase levels, coagulopathy, hepatomegaly, and progressive liver fibrosis. Structural modeling using Alphafold revealed that the p.Ala479Pro variant is located within a conserved alpha-helical region of the RINT1/TIP20 domain, critical for protein stability and function. Population-specific analysis suggested the variant's origin in the Chuvash ethnic group, supporting its potential significance for genetic counseling. Additionally, we noted a novel clinical phenotype of \u003cem\u003eRINT1\u003c/em\u003e-related disorders, including neutropenia, and described affected siblings with similar manifestations, further supporting an autosomal recessive inheritance pattern.\u003c/p\u003e\n\u003cp\u003eConclusions\u003c/p\u003e\n\u003cp\u003eThis case expands the clinical spectrum of RINT1-related disorders by associating \u003cem\u003eRINT1 \u003c/em\u003evariants with recurrent liver failure and neutropenia. Early genetic diagnosis through whole-exome sequencing and vigilant monitoring are essential to optimize patient outcomes. The findings also emphasize the importance of population-specific analyses in identifying pathogenic variants and guiding genetic counseling. Structural insights from bioinformatics modeling further highlight the functional consequences of the p.Ala479Pro mutation, offering avenues for future research into targeted therapeutic strategies.\u003c/p\u003e","manuscriptTitle":"Recurrent Acute Liver Failure and Neutropenia сaused by a novel homozygous RINT1 variant: evidence for a population-specific disorder","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-18 12:35:05","doi":"10.21203/rs.3.rs-7009438/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-02T06:46:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-02T05:17:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"301549241840011281369826469894003755006","date":"2025-07-23T19:23:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-11T05:41:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-01T23:40:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-01T23:39:31+00:00","index":"","fulltext":""},{"type":"submitted","content":"Human Genomics","date":"2025-06-30T10:21:15+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"human-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"hugm","sideBox":"Learn more about [Human Genomics](http://humgenomics.biomedcentral.com/)","snPcode":"40246","submissionUrl":"https://submission.nature.com/new-submission/40246/3","title":"Human Genomics","twitterHandle":"@OAgenetics","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e94f190e-8b77-480a-8617-f3f6ad5eb97d","owner":[],"postedDate":"July 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-10-13T15:59:45+00:00","versionOfRecord":{"articleIdentity":"rs-7009438","link":"https://doi.org/10.1186/s40246-025-00827-5","journal":{"identity":"human-genomics","isVorOnly":false,"title":"Human Genomics"},"publishedOn":"2025-10-07 15:57:14","publishedOnDateReadable":"October 7th, 2025"},"versionCreatedAt":"2025-07-18 12:35:05","video":"","vorDoi":"10.1186/s40246-025-00827-5","vorDoiUrl":"https://doi.org/10.1186/s40246-025-00827-5","workflowStages":[]},"version":"v1","identity":"rs-7009438","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7009438","identity":"rs-7009438","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00