Cytological basis of hypoxic preconditioned hUC-MSCs enhance the effect of treating ALI | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cytological basis of hypoxic preconditioned hUC-MSCs enhance the effect of treating ALI Lin Shen, Yujuan Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9650125/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Introduction Acute Lung Injury (ALI) is characterized by extensive pulmonary inflammation resulting from various endogenous and exogenous factors, often progressing rapidly to Acute Respiratory Distress Syndrome (ARDS). Human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) have emerged as a promising therapeutic strategy for ALI. Prior studies have shown that hUC-MSCs effectively attenuate ALI in mice, and hypoxic preconditioning further augments these therapeutic effects. However, the specific mechanisms underlying the enhanced efficacy of hypoxic preconditioned hUC-MSCs remain to be elucidated. Methods To investigate the impact of hypoxic preconditioning, we employed two hypoxic induction methods: chemical induction via Cobalt chloride (CoCl 2 ) and physical hypoxia using a tri-gas incubator. We comprehensively evaluated cell morphology, viability, hypoxic marker expression, paracrine function, anti-apoptotic capacity, and multilineage differentiation potential. Furthermore, we tracked the targeted migration and distribution of hypoxic hUC-MSCs in vivo using whole-body imaging and immunofluorescence. Results Both CoCl₂ stimulation and physical hypoxia effectively improve the biological functions of hUC-MSCs. Hypoxic preconditioning enhances the anti-apoptotic, paracrine, and multilineage differentiation capacities of hUC-MSCs, and strengthens their homing to damaged lung tissues and in vivo retention in ALI models. Conclusions Chemical and physical hypoxic preconditioning are valid strategies to optimize hUC-MSCs functions. This study provides a solid cytological foundation for the improved therapeutic efficacy of preconditioned hUC-MSCs in ALI treatment. Acute lung injury Hypoxic preconditioning Human umbilical cord-derived mesenchymal stem cells Paracrine function Cell homing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Acute Lung Injury (ALI) is a devastating clinical syndrome characterized pathologically by the disruption of the pulmonary vascular endothelium and alveolar epithelial barrier. Its most severe manifestation, Acute Respiratory Distress Syndrome (ARDS), represents a life-threatening respiratory emergency associated with persistently high mortality rates (Bakowitz et al., 2012 ; Rosová et al., 2008 ; Verma et al., 2025 ). Currently, conventional pharmacological interventions (such as glucocorticoid therapy) are often limited by suboptimal efficacy, drug resistance, and systemic adverse effects (Peter et al., 2008 ). Therefore, exploring innovative and effective therapeutic strategies in the treatment of ALI/ARDS is of paramount clinical importance (Fukatsu et al., 2022 ). Mesenchymal stromal cell (MSC) therapy exhibits broad potential in various inflammatory diseases due to its potent immunomodulatory and regenerative capacities (Chiara Giacomini, 2025 ). Among these, human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) have emerged as a promising and minimally invasive therapeutic modality. Owing to their ease of collection, robust self-renewal capacity, and potent paracrine activity, hUC-MSCs have shown significant therapeutic potential in preclinical models (Ding et al., 2015 ; Huang et al., 2018 ). For instance, in lipopolysaccharide (LPS)-induced ALI mice, hUC-MSCs modulate macrophages via PGE2 signaling to enhance PD-L1 expression, thereby suppressing hyper-inflammatory responses (Tu et al., 2022 ). Additionally, hUC-MSCs have been shown to attenuate pulmonary fibrosis, potentially through circFOXP1-mediated upregulation of the HuR-EZH2/STAT1/FOXK1 axis to enhance autophagy (Li et al., 2023 ). Furthermore, they facilitate alveolar epithelial repair through multilineage differentiation and the secretion of cytokines or miRNA-laden exosomes that target critical pathways such as PI3K/AKT, Wnt, and NF-κB (Fu et al., 2019 ). Therefore, the therapeutic efficacy of hUC-MSCs likely stems from a synergy of multiple mechanisms that collectively modulate the onset and progression of ALI. Despite this potential, direct hUC-MSC administration faces challenges, including pulmonary sequestration, poor targeted homing, and limited survival within the hostile injury microenvironment (Li Zhang, 2015). Furthermore, a profound mismatch exists between conventional in vitro culture conditions and the native physiological microenvironment. Standard normoxic culture (21% O₂) significantly exceeds the physiological oxygen levels in healthy tissues (3%–5%) (Rosová et al., 2008 ; Ward, 2008 ). Studies have shown that hypoxic preconditioning can significantly optimize the biological properties of MSCs. For instance, hypoxia facilitates differentiation into type II alveolar epithelial cells via miR-145 and bolsters anti-apoptotic capacity through the regulation of apoptosis-associated genes (Li et al., 2017 ; Wang et al., 2021 ). Recent evidence suggests that hypoxic preconditioning enhances the proliferation, secretome, and reparative capacity of hUC-MSCs, bridging the gap between experimental observations and clinical expectations (Han et al., 2015 ; Huang et al., 2024 ). Prior research has substantiated that hypoxic preconditioning empowers hUC-MSCs with enhanced therapeutic efficacy, as evidenced in rat models of bronchopulmonary dysplasia and its associated pulmonary sequelae (Hao et al., 2022 ; You et al., 2020 ). However, the comparative advantages and refined molecular mechanisms of different hypoxic preconditioning methods remain fully elucidated. In the present study, we systematically compared two hypoxic preconditioning strategies—chemical induction (CoCl 2 ) and physical hypoxia (hypoxic incubator). We evaluated their impacts on hUC-MSC morphology, viability, paracrine profile, anti-apoptotic capacity, and multilineage differentiation. Our findings aim to provide a robust cytological basis and novel strategies for the optimization of MSC-based therapies in ALI/ARDS. Materials and Methods Cell culture and Morphology The hUC-MSCs used in this study were obtained from Changchun Sigma Company. The cells were maintained at 37°C in a humidified incubator with 5% CO2. Upon reaching approximately 80%–90% confluence, the cells were detached using 0.25% trypsin and subcultured. All experiments were conducted using hUC-MSCs between passages 3 and 6 to ensure biological stability. Cell morphology and growth density were monitored daily under an inverted microscope (Olympus, Tokyo, Japan) (e.g., 10×, 20×, and 40× magnification) to ensure the absence of contamination. All cell culture procedures were performed under strict aseptic conditions. Characterization and identification of hUC-MSCs To ensure the biological integrity and therapeutic suitability of hUC-MSCs, a systematic identification process was conducted. First, cellular morphology was assessed using inverted microscopy. Second, the purity and immunophenotype of hUC-MSCs were analyzed via flow cytometry, focusing on the expression of specific surface markers. Finally, the multi-lineage differentiation potential was evaluated to confirm the stemness of the cells. Hypoxic Preconditioning Protocols Two hypoxic preconditioning strategies were employed in this study: chemical induction and physical hypoxia. Chemical hypoxia was induced using cobalt chloride (CoCl2), a hypoxia-mimetic agent, at final concentrations of 0, 10, 50, 100, 200, and 400 µmol/L. Physical hypoxia was implemented using a specialized tri-gas incubator to achieve precise atmospheric control. The experimental groups included: (1) 1% O2 group (1% O2, 5% CO2, and 94% N2), (2) 3% O2 group (3% O2, 5% CO2, and 92% N2), and (3) a normoxic control group maintained under standard atmospheric conditions (21% O2, 5% CO2, and 74% N2). Cell Proliferation and Viability Assay Cell proliferation was evaluated using the Cell Counting Kit-8 (CCK-8, Merck, St. Louis, MO, USA). hUC-MSCs at passage 6 were seeded into 96-well plates at a density of 5 × 10³ cells/well and incubated at 37°C with 5% CO2 for 48 h to ensure stable attachment. The cells were subsequently exposed to Cobalt chloride (CoCl2) at final concentrations of 0, 10, 50, 100, 200, and 400 µmol/L, with five biological replicates per group. After 24, 48, and 72 h of treatment, the culture medium was replaced with 100 µL of fresh medium supplemented with 10 µL of CCK-8 reagent. Following an additional incubation of 1–4 h, the absorbance was measured at 450 nm using a microplate reader. Cell morphology was also qualitatively assessed via inverted microscopy at each indicated time point. Enzyme-Linked Immunosorbent Assay (ELISA) To evaluate the paracrine profile of hUC-MSCs, cell culture supernatants were collected and centrifuged at 1,000 × g for 20 min at 4°C to remove insoluble debris. The levels of human vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), nerve growth factor (NGF), and keratinocyte growth factor (KGF) were then determined using corresponding ELISA kits (Abcam, Cambridge, MA, USA) according to the manufacturer’s protocols. All measurements were performed in triplicate, and the protein concentrations were calculated based on standard curves. Real-Time Quantitative PCR (RT-qPCR) Total RNA was isolated from hUC-MSCs using an RNA extraction kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. The concentration and purity of the extracted RNA were determined spectrophotometrically. Subsequently, cDNA was synthesized, and RT-qPCR was performed using a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The specific primer sequences are listed in Table 1 , with β-actin utilized as the internal reference gene. The thermocycling conditions consisted of an initial denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. All reactions were conducted in triplicate, and the relative mRNA expression levels were quantified using the 2 −ΔΔCt method. Table 1 Primers Used for Real-Time PCR (Species: Homo sapiens) genes Forward Reverse HGF CATCAAATGTCAGCCCTGGAGTTCC CTTCGTAGCGTACCTCTGGATTGC VEGF TGCCTTGCTGCTCTACCTCCAC AGATGTCCACCAGGGTCTCGATTG NGF GCAAGCGGTCATCATCCCATCC TCTGTGGCGGTGGTCTTATCCC KGF AAATGTGAACTGTTCCAGCCCTGAG TCTCTTGGGTCCCTTTTACTTTGCC PPARγ GCCCTTCACTACTGTTGACTTCTCC CAGGCTCCACTTTGATTGCACTTTG C/EBPα TCGGTGGACAAGAACAGCAACG GGCGGTCATTGTCACTGGTCAG RUNX2 AGGCAGTTCCCAAGCATTTCATCC TGGCAGGTAGGTGTGGTAGTGAG Osterix ATAGTGGGCAGCTAGAAGGGAGTG ATTAGGGCAGTCGCAGGAGGAG Bcl-2 TCGCCCTGTGGATGACTGAGTAC ACAGCCAGGAGAAATCAAACAGAGG Caspase3 TTGAGACAGACAGTGGTGTTGATGATG TGGCACAAAGCGACTGGATGAAC HIF-1α CCATTAGAAAGCAGTTCCGCAAGC GTGGTAGTGGTGGCATTAGCAGTAG PI3K TCACTACCGCCACGAGTCTCTG ACTGCCTCCACGCTGTCCTC Akt CAGGAGGAGGAGGAGATGGACTTC CCCAGCAGCTTCAGGTACTCAAAC Western Blot Analysis Total protein was extracted from hUC-MSCs using RIPA lysis buffer supplemented with protease and phosphatase inhibitors. The lysates were centrifuged at 12,000 × g for 15 min at 4°C, and protein concentrations were determined using a BCA Protein Assay Kit. Equal amounts of protein (30 µg) were resolved by 12% SDS-PAGE and subsequently transferred onto PVDF membranes. After blocking with 5% non-fat milk in TBST for 1 h at room temperature, the membranes were incubated overnight at 4°C with primary antibodies against HIF-1α (1:1000; #79233; CST, Danvers, MA, USA), PI3K (1:1000; #4255; CST), AKT (1:1000; #4691; CST), p-AKT(Ser473) (1:1000; #4060; CST), Bcl-2 (1:1000; #2872; CST), and cleaved caspase-3 (1:1000; #9664; CST). After washing, the membranes were incubated with an HRP-conjugated goat anti-rabbit secondary antibody (1:1500; Affinity Biosciences) for 1 h. Protein bands were detected using an enhanced chemiluminescence (ECL) kit and visualized with a digital imaging system. Band intensities were quantified using ImageJ software (NIH, Bethesda, MD, USA), with β-actin used as the internal loading control for normalization. Multi-lineage Differentiation Assays To evaluate the impact of hypoxic preconditioning on the stemness of hUC-MSCs, osteogenic and adipogenic induction were performed with the addition of CoCl2 at concentrations of 0, 50, and 100 µmol/L. The CoCl2 concentration was strictly maintained throughout the medium replacement process, with each condition tested in duplicate. Following adipogenic induction, lipid accumulation was qualitatively assessed via Oil Red O staining. For quantitative analysis, 500 µL of isopropanol was added to each well and incubated with shaking for 10 min to completely dissolve the intracellular triglycerides. The resulting extracts were transferred to a 96-well plate (200 µL/well), and the absorbance was measured at 540 nm using a microplate reader. Lentiviral Transduction To enable visualization and tracking, hUC-MSCs were transduced with a GFP-tagged lentiviral vector. P2 hUC-MSCs were seeded into six-well plates and cultured until they reached 60%–70% confluence. For transduction, the lentiviral stock was thawed and added to the cells at various concentrations to determine the optimal dose. Six hours after viral exposure, the medium was replaced with fresh, pre-warmed complete medium. The transduction efficiency was evaluated by observing GFP expression under a fluorescence microscope at 24 and 72 h. The optimal multiplicity of infection (MOI) was calculated to ensure high labeling efficiency for subsequent experiments. In Vivo Distribution of hUC-MSCs in ALI Mice Male BALB/c mice were used to evaluate the pulmonary homing and biodistribution of hUC-MSCs. To establish the ALI model, mice were anesthetized with 5% chloral hydrate (0.1 mL/mouse) and intratracheally administered lipopolysaccharide (LPS; 5 mg/kg). Control mice received an equivalent volume of PBS. Four hours after LPS challenge, 1×10⁶ GFP-labeled hUC-MSCs (either normoxic or hypoxic-preconditioned) were injected via the tail vein. Two hours following cell administration, the mice were re-anesthetized and placed in an in vivo imaging system (IVIS) to monitor the localization and fluorescence intensity of the GFP-tagged hUC-MSCs. For the comparative study of hypoxic preconditioning, mice were divided into five experimental groups: (1) Control, (2) ALI model, (3) Normoxic hUC-MSCs, (4) CoCl2-preconditioned hUC-MSCs (100 µmol/L for 24 h), and (5) Physical hypoxia-preconditioned hUC-MSCs (3% O₂ for 48 h). All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Shaanxi Provincial People's Hospital. Tissue Processing and Fluorescence Imaging Following in vivo imaging, the mice were humanely euthanized. The lungs, kidneys, liver, and heart were harvested and fixed for subsequent immunofluorescence evaluation. Cryosections or paraffin sections of the tissues were prepared to examine the recruitment and distribution of the transplanted cells. Given the stable endogenous green fluorescence of the GFP-labeled hUC-MSCs, the distribution of the cells within various organs was directly visualized using a fluorescence microscope (IX73; Olympus, Tokyo, Japan) without supplementary antibody labeling. Statistical analysis All quantitative data are presented as the mean ± standard deviation (SD). Statistical analyses were conducted using GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). The normality of the data distribution was assessed using the Shapiro-Wilk test. For normally distributed data, statistical significance between two groups was determined using the two-tailed Student’s t-test, whereas comparisons among three or more groups were evaluated using one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. A value of p < 0.05 was considered statistically significant. Significance levels are indicated in the figures as follows: * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001. Results Effects of Hypoxic Preconditioning on hUC-MSC Morphology and Proliferation The hUC-MSCs exhibited typical spindle-shaped, adherent growth, consistent with the standard morphology of mesenchymal stem cells. To evaluate the effect of chemical hypoxia, hUC-MSCs were exposed to various concentrations of CoCl2 (0, 10, 50, 100, 200, and 400 µmol/L) for 72 h. Morphological analysis revealed no significant structural changes in cells treated with CoCl2 at concentrations up to 200 µmol/L; however, at 200 µmol/L, the cells appeared more scattered with less confluence. A marked decrease in cell density was observed when the concentration reached 400 µmol/L, although the spindle morphology remained discernible (Fig. 1 A–F). Regarding physical hypoxia, the morphology of hUC-MSCs remained stable across different O2 levels, while cell proliferation was notably affected. Compared to the normoxia group (21% O2), both the 1% and 3% O2 groups showed increased cell counts at 48 h relative to 24 h. Notably, the 3% O2 group exhibited the most significant increase in cell density and a corresponding decrease in intercellular spacing, indicating that 3% O2 for 48 h is likely the optimal condition for hypoxic preconditioning (Fig. 1 G). Effects of CoCl2-Induced Hypoxia on hUC-MSC Viability The impact of chemical hypoxia on hUC-MSC viability was assessed using various CoCl 2 concentrations (0, 10, 50, 100, 200, and 400 µmol/L) over 24, 48, and 72 h. In general, the inhibition rate of hUC-MSCs increased in a concentration- and time-dependent manner. Treatment with 10 µmol/L CoCl 2 exerted no inhibitory effect; rather, negative inhibition rates at 48 and 72 h indicated a slight promotion of cell proliferation at this low dosage. After 24 h of exposure, concentrations up to 200 µmol/L did not significantly impair cell viability. Notably, 100 µmol/L CoCl 2 treatment for 24 h showed the strongest capacity to enhance cell viability without cytotoxicity. Consequently, 100 µmol/L CoCl 2 for 24 h was identified as the optimal condition for hypoxic preconditioning, providing a standardized experimental basis for further functional studies (Fig. 2 ). Validation of the CoCl2-Induced Hypoxia Model To validate the hypoxia model in hUC-MSCs, we examined HIF-1α expression at both protein and mRNA levels under chemical hypoxia (CoCl₂) and physical hypoxia (low oxygen). As shown in Fig. 3 A, CoCl₂ treatment dose-dependently increased HIF-1α protein expression, with a significant elevation observed in the 200 µmol/L group ( p < 0.01). Consistently, HIF-1α mRNA expression was upregulated in a concentration-dependent manner, starting from 50 µmol/L CoCl₂ ( p < 0.05) and reaching a highly significant level at 100 and 200 µmol/L (both p < 0.0001, Fig. 3 B). For physical hypoxia, hUC-MSCs were exposed to 1% and 3% O₂. Western blot analysis revealed that HIF-1α protein was stabilized in a time-dependent manner under 1% and 3% O₂, with significant increases at 48 h ( p < 0.05 and p < 0.01, respectively, Fig. 3 C). Similarly, qPCR results showed that HIF-1α mRNA expression was significantly upregulated at 48 h under 3% O₂ ( p < 0.01, Fig. 3 D). These data confirm that both CoCl₂ and low oxygen effectively induce HIF-1α expression, successfully establishing the hypoxia model in hUC-MSCs. Hypoxic Preconditioning Enhances the Paracrine Potential of hUC-MSCs To determine the effects of hypoxic stimulation on the paracrine profile of hUC-MSCs, we quantified the concentrations of VEGF, HGF, NGF, and KGF. Compared to the normoxic control (0 µmol/L CoCl 2 ), 50 and 100 µmol/L CoCl 2 significantly increased VEGF secretion ( p < 0.0001), though this effect was not maintained at 200 µmol/L. Conversely, NGF and KGF levels were robustly elevated across all tested CoCl 2 concentrations ( p < 0.0001), while HGF showed a clear concentration-dependent increase (Fig. 4 A). At the transcriptional level, CoCl 2 treatment consistently upregulated the mRNA expression of all four growth factors, confirming that chemical hypoxia promotes their synthesis and secretion (Fig. 4 B). Parallel findings were observed under physical hypoxia, where 3% O 2 stimulation for 48 h significantly enhanced the expression of VEGF, NGF, KGF, and HGF. These data collectively suggest that both chemical and physical hypoxic preconditioning effectively bolster the secretome and paracrine function of hUC-MSCs (Fig. 4 C). Hypoxic Preconditioning Enhances the Anti-apoptotic Capacity of hUC-MSCs To investigate the anti-apoptotic effects of chemical hypoxia, we analyzed the expression of key apoptosis-related and survival-signaling proteins. Western blot analysis revealed that compared to the control group (0 µmol/L), the levels of cleaved caspase-3, total AKT, and phosphorylated AKT (p-AKT) were significantly increased in the 50, 100, and 200 µmol/L CoCl 2 groups (all p < 0.0001). Furthermore, the anti-apoptotic protein Bcl-2 was markedly upregulated following 100 µmol/L ( p < 0.0001) and 200 µmol/L ( p 0.05; Fig. 5 A). In contrast, physical hypoxia (1% and 3% O 2 ) led to a significant decrease in the expression of the pro-apoptotic protein cleaved caspase-3, alongside a concomitant increase in Bcl-2 levels and the activation of the PI3K/AKT pathway at both 24 and 48 h (p < 0.05). These results suggest that physical hypoxic preconditioning enhances the anti-apoptotic survival of hUC-MSCs, with the 3% O 2 for 48 h condition yielding the most significant improvement (Fig. 5 C–D). Correspondingly, RT-qPCR results confirmed the upregulation of PI3K, AKT, and Bcl-2 mRNA, while Caspase3 mRNA was significantly downregulated under these hypoxic conditions. Collectively, these data substantiate that physical hypoxia effectively bolsters the anti-apoptotic potential of hUC-MSCs (Fig. 5 E). Hypoxic Preconditioning Enhances the Multi-lineage Differentiation Potential of hUC-MSCs To evaluate the impact of hypoxia on stemness, hUC-MSCs were subjected to osteogenic and adipogenic induction. Alizarin Red S staining revealed that compared to the control group, cells treated with 50 µmol/L CoCl 2 exhibited granular calcified aggregates, while the 100 µmol/L group showed significantly more mature calcified nodules (Fig. 6 A). Regarding adipogenesis, Oil Red O staining identified an increased number of lipid-rich cells in the 50 µmol/L CoCl 2 group, with high-magnification imaging revealing characteristic bead-like chains of lipid droplets. The 100 µmol/L group displayed even greater adipocyte abundance with intense red staining and high refractivity (Fig. 6 B). Quantitative analysis confirmed a concentration-dependent increase in OD540 values; while the 50 µmol/L group showed only a marginal increase ( p > 0.05), the 100 µmol/L group exhibited a highly significant elevation ( p < 0.001) (Fig. 6 C). At the transcriptional level, mRNA expression of osteogenic markers (RUNX2 and Osterix) and adipogenic markers (PPARγ and C/EBPα) was significantly upregulated in the 200 µmol/L CoCl 2 group (Fig. 6 D). Similarly, physical hypoxia (3% O 2 for 48 h) significantly bolstered the expression of these lineage-specific genes compared to the normoxic control (Fig. 6 E). These results collectively indicate that both chemical and physical hypoxic preconditioning enhance the multi-lineage differentiation potential of hUC-MSCs. Lentiviral Transduction and Labeling Efficiency Optimization To achieve optimal fluorescence labeling, we evaluated the transduction efficiency of the GFP-tagged lentiviral vector in hUC-MSCs. With a fixed seeding density of 2 × 10⁵ cells per well in six-well plates, the highest efficiency was observed following the addition of 10 µL of viral stock. Considering the viral titer of 10⁸ TU/mL, the multiplicity of infection (MOI) was determined to be 5. Using this optimized MOI, a large scale of hUC-MSCs was successfully transduced with the GFP-labeled lentiviral vector, providing stable and highly visible cellular markers for the subsequent animal studies (Fig. 7 ). Hypoxic Preconditioning Promotes the Pulmonary Homing of hUC-MSCs in ALI Mice To evaluate the biodistribution of hUC-MSCs in vivo , we monitored GFP-labeled cells using an IVIS. No fluorescence was detected in the blank group. In the control group, only a minimal fluorescence signal was observed in the lungs, whereas the LPS-induced ALI group exhibited a dense accumulation of hUC-MSCs, characterized by an intense fluorescence signal. These results indicate that hUC-MSCs preferentially migrate to injured lung regions, a key step in their targeted therapeutic action (Fig. 8 A). Further comparison revealed that while normoxic hUC-MSCs successfully reached the damaged lungs, hypoxic preconditioning significantly amplified this effect. Specifically, mice receiving either CoCl2-pretreated or hypoxic incubator-pretreated hUC-MSCs showed substantially stronger pulmonary fluorescence signals than those receiving normoxic cells. These findings collectively substantiate that hypoxic preconditioning enhances the directional migration and pulmonary recruitment of hUC-MSCs, potentially improving their regenerative efficacy in the treatment of ALI (Fig. 8 B). Histological Distribution and Temporal Survival of hUC-MSCs Immunofluorescence analysis of lung tissues was performed to validate the recruitment of hUC-MSCs at the microscopic level. Consistent with the IVIS findings, a significantly higher density of GFP-positive cells was observed in the lungs of the hypoxic-preconditioned groups (both chemical and physical) compared to the normoxic and control groups. These cells were predominantly localized within the alveolar spaces and interstitial tissues of the damaged lungs. Temporal biodistribution analysis revealed that hUC-MSCs initially distributed to multiple systemic organs, including the liver, spleen, kidneys, and heart within 2 h of injection. The total pulmonary cell count and fluorescence intensity reached a peak at 24 h before gradually declining. Notably, hypoxic preconditioning significantly improved the long-term persistence of the cells; by Day 7, obvious green fluorescence was still discernible in the hypoxic-preconditioned groups, whereas signals in the normoxic group had largely dissipated. These results collectively demonstrate that hypoxic preconditioning bolsters the homing efficiency, survival, and retention time of hUC-MSCs in the context of ALI (Fig. 9 A–B). Discussion The pathogenesis of acute lung injury (ALI) is multifaceted, involving a complex cascade of pathological events such as the excessive secretion of pro-inflammatory cytokines, activation of the NLRP3 inflammasome, extensive cell apoptosis, and the catastrophic disruption of the pulmonary endothelial-epithelial barrier. These mechanisms synergistically exacerbate lung tissue damage, frequently progressing to acute respiratory distress syndrome (ARDS), which remains associated with high clinical mortality rates (Chacko et al., 2015 ; Liu et al., 2025 ). Given the constraints of current therapeutic interventions, the exploration of novel regenerative strategies is imperative. Human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) have emerged as a prominent research focus in ALI therapy due to their superior biological properties, including abundant accessibility, multi-lineage differentiation potential, and low immunogenicity (Lee et al., 2018 ). However, the precise mechanisms through which hypoxic preconditioning bolsters the therapeutic efficacy of hUC-MSCs in ALI require further elucidation. In the present study, we systematically investigated the effects of hypoxia on hUC-MSCs across multiple dimensions, including cellular morphology, viability, hypoxic marker expression, paracrine profiling, anti-apoptotic signaling, and multi-lineage differentiation potential. These findings provide a robust cytological basis and highlight the enhanced therapeutic potential of hypoxia-preconditioned hUC-MSCs for the repair of lung injury. In this study, we established a chemical hypoxia model in hUC-MSCs using CoCl2, confirmed by the significant upregulation of HIF-1α at both the protein and gene levels. CoCl 2 is a well-established hypoxia-mimetic agent that stabilizes HIF-1α, thereby initiating a broad adaptive response (Muñoz-Sánchez and Chánez‐Cárdenas, 2018 ). Our findings demonstrate that hypoxic stimulation significantly bolsters the hUC-MSC secretome, specifically increasing the levels of VEGF, NGF, KGF, and HGF. Interestingly, the secretion of VEGF, NGF, and KGF followed a bell-shaped distribution, peaking at moderate CoCl 2 concentrations before declining at 200 µmol/L, which likely reflects a transition from adaptive signaling to dose-dependent cytotoxicity. Crucially, hypoxic preconditioning activated the pro-survival PI3K/AKT signaling pathway in hUC-MSCs. The observed increase in the expression of PI3K, AKT, and phosphorylated AKT (p-AKT), coupled with the upregulation of the anti-apoptotic protein Bcl-2 and the concomitant inhibition of cleaved-caspase-3, suggests that hypoxia shifts the cellular rheostat toward survival and away from programmed cell death. This molecular reconfiguration effectively bolstered the proliferative capacity of hUC-MSCs while suppressing apoptosis. Furthermore, the enhanced osteogenic and adipogenic differentiation potential observed following CoCl₂ treatment indicates that hypoxic priming preserves, and potentially augments, hUC-MSC stemness. The upregulation of lineage-specific markers confirms that chemical hypoxia promotes the functional maturation and improves the multi-lineage differentiation capacity of these mesenchymal stem cells, which is vital for their regenerative efficacy upon transplantation into damaged lung tissues (Zhang et al., 2019 ). The significant upregulation of lineage-specific transcription factors—RUNX2 and Osterix for osteogenesis, and PPARγ and C/EBPα for adipogenesis—substantiates that CoCl₂ preconditioning effectively augments the multi-lineage differentiation potential of hUC-MSCs. These findings align with recent evidence suggesting that hypoxia-mimetic agents can maintain or even enhance the stemness and plasticity of mesenchymal stem cells (Andrietti et al., 2023 ; Karadeniz et al., 2022 ; Kim et al., 2024 ; Zhu et al., 2024 ). It is noteworthy, however, that the optimal CoCl₂ concentrations for enhancing paracrine secretion, anti-apoptotic signaling, and multi-lineage differentiation were not strictly uniform. Nevertheless, 100 µmol/L CoCl₂ for 24 h emerged as the most effective parameter for comprehensive cellular "priming," balancing functional enhancement with minimal cytotoxicity. Consistent with the effects of chemical hypoxia, physical hypoxia (3% O₂ for 48 h) also significantly bolstered the therapeutic profile of hUC-MSCs. Taken together, these results underscore that both chemical and physical hypoxic preconditioning serve as potent strategies to enhance the functional robustness of hUC-MSCs, highlighting the pivotal role of hypoxic priming in optimizing stem cell performance prior to therapeutic application. VEGF is a pivotal cytokine that stimulates the proliferation of vascular endothelial cells and comprises four primary isoforms: VEGF-A, -B, -C, and -D (Künnapuu et al., 2021 ). It plays an essential role in promoting the angiogenesis of vascular endothelial cells, maintaining endothelial differentiation, and modulating the permeability of microvessels. However, the functional specializations of these isoforms vary significantly (Lee et al., 2025 ; Sidharta et al., 2018 ). Previous studies have established that MSCs bolster the expression of epithelial tight junction-associated genes through a VEGF-dependent mechanism (Yang et al., 2015 ; Yang et al., 2016 ). Further evidence by Tunstead et al. demonstrated that MSCs activated by serum from patients with hyperinflammatory ARDS exhibit superior therapeutic potential in ALI models. These activated MSCs not only suppress the release of pro-inflammatory cytokines (e.g., IL-6, TNF-α) but also significantly reinforce lung epithelial barrier function, mitigate pulmonary permeability, and improve overall outcomes through VEGF-dependent signaling (Tunstead et al., 2024 ). HGF is a pleiotropic growth factor, that mainly acts on epithelial and endothelial cells, playing an important regulatory role in cell division, proliferation, differentiation, survival, immunomodulation, and tissue remodeling (He et al., 2021 ). In terms of cytoprotection, HGF protects epithelial and endothelial cells and attenuates lung injury primarily by activating the HGF/c-Met-mediated PI3K/Akt signaling pathway (Bi et al., 2025 ; Ito et al., 2014 ). The anti-inflammatory properties of HGF have been validated in various models: HGF gene overexpression significantly reduced TNF-α and IL-6 levels in bleomycin-induced lung injury (Watanabe et al., 2005 ), while HGF treatment effectively alleviated inflammatory responses in allergic airway models (Ito et al., 2005 ). Additionally, VEGF and HGF exhibit synergistic effects in maintaining endothelial barrier function (Fan et al., 2025 ). NGF is a foundational member of the neurotrophin family, primarily recognized for its pivotal role in nerve injury repair (Rocco et al., 2018 ; Zha et al., 2021 ). As research has progressed, its biological repertoire has been found to encompass the regulation of MSCs. Multiple studies indicate that NGF exerts significant modulatory effects on MSCs. For instance, treatment with 100 ng/mL NGF has been shown to maximize the neurogenic differentiation potential of hUC-MSCs (Jahan et al., 2017 ). Mechanistically, NGF binds to its high-affinity receptor, TrkA, expressed on the plasma membrane. Following ligand binding, the NGF/TrkA complex is internalized to trigger the recruitment of key pro-differentiation and pro-survival signaling molecules. These intracellular cascades predominantly involve the PI3K/Akt and Ras/MAPK signaling axes (Zha et al., 2021 ), which collectively promote neuronal survival and lineage commitment. Similarly, in bone marrow-derived MSCs (BMSCs), NGF supplementation effectively bolsters cell viability and attenuates diketone-induced apoptosis in vitro. These findings suggest that NGF can enhance the regenerative efficacy of MSCs post-transplantation by bolstering their resistance to pro-apoptotic stimuli in the injured microenvironment (Bai et al., 2020 ; Wang et al., 2019 ). Furthermore, evidence suggests that NGF promotes the proliferation of bone marrow-derived MSCs (BMSCs) by activating the PI3K/Akt signaling pathway, thereby stimulating Akt phosphorylation and cellular expansion (Gharibi et al., 2012 ). Notably, these pro-proliferative effects can be abolished by specific PI3K inhibitors. Regarding the regulation of apoptosis, Bad—a downstream effector of Akt—is modulated by Akt-mediated phosphorylation. The dephosphorylated (active) form of Bad facilitates the activation of Caspase-3, the terminal executioner of the apoptotic cascade (Kamada et al., 2007 ). Previous experiments have demonstrated that NGF treatment significantly attenuates the apoptotic rate and Caspase-3 activity in BMSCs, a cytoprotective effect that is completely abrogated by Akt inhibitors (Kim et al., 2016 ). Collectively, these data imply that the anti-apoptotic influence of NGF on MSCs is mediated primarily through the Akt/Bad signaling axis (Wang et al., 2019 ). Consistently, the present study observed a reduction in Caspase-3 activity and a marked upregulation of Bcl-2 expression under hypoxic preconditioning (both chemical and physical), indicating a robust enhancement of the anti-apoptotic capacity in hUC-MSCs. Nevertheless, whether the hypoxia-induced upregulation of NGF directly orchestrates this anti-apoptotic response in hUC-MSCs via the Akt/Bad signaling axis remains a compelling subject for future investigation. KGF is a soluble basic protein, also designated as FGF-7, is a heparin-binding protein. Secreted primarily by cells of mesenchymal origin, KGF selectively stimulates the proliferation, differentiation, and migration of epithelial cells, playing a pivotal role in the alveolar epithelial repair following injury (Shyamsundar et al., 2014 ; Yu et al., 2023 ). Alveolar type II (AT2) cells are essential for pulmonary surfactant production and alveolar regeneration, serving as a critical determinant of survival in ALI/ARDS patients (Fan et al., 2025 ). Research has demonstrated that MSC-derived KGF modulates the expression of the epithelial sodium channel (ENaC)—the rate-limiting factor in alveolar fluid clearance—via the Gab1/ERK/NF-κB signaling axis, thereby alleviating LPS-induced ALI (Xin et al., 2025 ). In our study, CoCl₂ treatment significantly elevated KGF levels in the hUC-MSC supernatant, suggesting that chemical hypoxia enhances the secretome’s capacity to support alveolar epithelial restoration (Yang et al., 2018 ). Collectively, these findings indicate that the coordinated upregulation of VEGF, NGF, KGF, and HGF following hypoxic preconditioning is intrinsically linked to the enhanced cytoprotective effects of hUC-MSCs. This multifaceted paracrine response likely mitigates lung injury by attenuating inflammation and bolstering anti-apoptotic resilience, offering a promising therapeutic strategy for the management of ALI/ARDS. Finally, this study investigated the biological mechanisms underlying two hypoxic preconditioning methods (CoCl₂ and hypoxic incubator) for hUC-MSCs through a seamless integration of in vitro cellular experiments and a mouse model of ALI. The findings revealed that both CoCl₂ and hypoxic incubators effectively induce a robust hypoxic response in hUC-MSCs. The optimal parameters for CoCl₂ treatment were identified as 100 µmol/L for 24 h, whereas 3% O₂ for 48 h was ideal for the hypoxic incubator. After hypoxic preconditioning, hUC-MSCs demonstrated significantly enhanced anti-apoptotic resilience and augmented multi-lineage differentiation potential, as well as improved migration and targeted homing to lung injury sites, ultimately resulting in markedly extended in vivo persistence. Recent evidence has shown that enhancing the expression of homing-related factors (e.g., SDF-1, ICAM-1, CXCL5, and IGF-1) through external stimuli like pulsed-focused ultrasound (pFUS) significantly improves hUC-MSC recruitment and survival, thereby optimizing ARDS outcomes (Wang et al., 2025 ). Building upon these findings, we hypothesize that the enhanced directional homing and sustained survival of hypoxia-preconditioned hUC-MSCs in vivo serve as fundamental prerequisites and functional safeguards for their superior therapeutic efficacy in lung repair. In summary, CoCl₂-mediated chemical hypoxia demonstrated comparable, or in certain parameters superior, stimulatory effects compared to physical hypoxia, while offering the practical advantages of shorter processing intervals and greater procedural simplicity. These results highlight its potential as a robust and efficient alternative for establishing hUC-MSC hypoxic preconditioning protocols. Future research should be directed toward further elucidating the molecular underpinnings of CoCl₂-preconditioned hUC-MSCs in LPS-induced ALI models and identifying the specific downstream signaling pathways involved. Such investigations will provide essential theoretical foundations and experimental evidence to refine and advance hypoxia-preconditioned MSC-based strategies for the clinical management of acute lung injury. Declarations Funding Statement This study was funded by the science and technology incubation program (2023YJY-09) and the science and technology talent support program (2023JY-19 and 2023JY-45) of Shaanxi Provincial People's Hospital. Author Disclosure Statement The authors declared no potential conflicts of interest. Author Contribution Lin Shen and Yujuan Wang: Conceptualization, Writing - original draft. All authors have read and agreed to the published version of the manuscript. Data Availablity Statement The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request. References Andrietti ALP, Durgam SS, Naumann B, Stewart M. Basal and inducible Osterix expression reflect equine mesenchymal progenitor cell osteogenic capacity. Front Veterinary Sci. 2023;10. https://doi.org/10.3389/fvets.2023.1125893 . Bai Q, Zou M, Zhang J, Tian Y, Wu F, Gao B, Piao F. NGF mediates protection of mesenchymal stem cells-conditioned medium against 2,5-hexanedione-induced apoptosis of VSC4.1 cells via Akt/Bad pathway. Mol Cell Biochem. 2020;469:53–64. https://doi.org/10.1007/s11010-020-03727-5 . Bakowitz M, Bruns B, McCunn M. Acute lung injury and the acute respiratory distress syndrome in the injured patient. Scand J Trauma Resusc Emerg Med. 2012;20. https://doi.org/10.1186/1757-7241-20-54 . Bi J, Li Y, Lu L, Yin T, Mao S, Zhang R, He J, Ni X, Wang K, Bi J. Luteolin attenuates inflammation and apoptosis in LPS-induced ALI mice by activating the HGF/c-Met pathway. Front Pharmacol. 2025;16. https://doi.org/10.3389/fphar.2025.1641486 . Chacko B, Peter JV, Tharyan P, John G, Jeyaseelan L. 2015. Pressure-controlled versus volume-controlled ventilation for acute respiratory failure due to acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Cochrane Database of Systematic Reviews. https://doi.org/10.1002/14651858.CD008807.pub2 Chiara Giacomini FD. 2025. MSC Manufacture. Advances in Experimental Medicine and Biology 1486, 217–25. https://doi.org/DOI: 10.1007/978-3-031-97297-3_17 Ding D-C, Chang Y-H, Shyu W-C, Lin S-Z. Human Umbilical Cord Mesenchymal Stem Cells: A New Era for Stem Cell Therapy. Cell Transplant. 2015;24:339–47. https://doi.org/10.3727/096368915x686841 . Fan Y, Moser J, Jongman RM, Borghuis T, Vonk JM, Timens W, van Meurs M, Pillay J, Burgess JK. Compositional changes of the lung extracellular matrix in acute respiratory distress syndrome. Am J Physiology-Cell Physiol. 2025;328:C1279–92. https://doi.org/10.1152/ajpcell.01007.2024 . Fu X, Liu G, Halim A, Ju Y, Luo Q, Song G. 2019. Mesenchymal Stem Cell Migration and Tissue Repair. Cells 8. https://doi.org/10.3390/cells8080784 Fukatsu M, Ohkawara H, Wang X, Alkebsi L, Furukawa M, Mori H, Fukami M, Fukami S-i, Sano T, Takahashi H, Harada-Shirado K, Kimura S, Sugimoto K, Ogawa K, Ikezoe T. The suppressive effects of Mer inhibition on inflammatory responses in the pathogenesis of LPS-induced ALI/ARDS. Sci Signal. 2022;15. https://doi.org/10.1126/scisignal.abd2533 . Gharibi B, Ghuman MS, Hughes FJ. Akt- and Erk‐mediated regulation of proliferation and differentiation during PDGFRβ‐induced MSC self‐renewal. J Cell Mol Med. 2012;16:2789–801. https://doi.org/10.1111/j.1582-4934.2012.01602.x . Han KH, Kim AK, Kim MH, Kim DH, Go HN, Kim DI. Enhancement of angiogenic effects by hypoxia-preconditioned human umbilical cord‐derived mesenchymal stem cells in a mouse model of hindlimb ischemia. Cell Biol Int. 2015;40:27–35. https://doi.org/10.1002/cbin.10519 . Hao C, You J, Qiu H, Zhou O, Liu J, Zou W, Yang K, Fu Z, Zou L. Hypoxic preconditioning improves the survival and pro-angiogenic capacity of transplanted human umbilical cord mesenchymal stem cells via HIF-1α signaling in a rat model of bronchopulmonary dysplasia. Biochem Biophys Res Commun. 2022;605:111–8. https://doi.org/10.1016/j.bbrc.2022.03.044 . He Y, Guo X, Lan T, Xia J, Wang J, Li B, Peng C, Chen Y, Hu X, Meng Z. Human umbilical cord-derived mesenchymal stem cells improve the function of liver in rats with acute-on-chronic liver failure via downregulating Notch and Stat1/Stat3 signaling. Stem Cell Res Ther. 2021;12. https://doi.org/10.1186/s13287-021-02468-6 . Huang Q-M, Zhuo Y-Q, Duan Z-X, Long Y-l, Wang J-N, Zhang Z-h, Fan S-Y, Huang Y-M, Deng K-Y, Xin H-B. Long-term hypoxic atmosphere enhances the stemness, immunoregulatory functions, and therapeutic application of human umbilical cord mesenchymal stem cells. Bone Joint Res. 2024;13:763–77. https://doi.org/10.1302/2046-3758.1312.Bjr-2024-0136.R2 . Huang Z, Liu H, Zhang X, Wen G, Zhu C, Zhao Y, Niu W, Qin Y, Chen H, Bai C, Liu G. Transcriptomic analysis of lung tissues after hUC-MSCs and FTY720 treatment of lipopolysaccharide-induced acute lung injury in mouse models. Int Immunopharmacol. 2018;63:26–34. https://doi.org/10.1016/j.intimp.2018.06.036 . Ito W, Kanehiro A, Matsumoto K, Hirano A, Ono K, Maruyama H, Kataoka M, Nakamura T, Gelfand EW, Tanimoto M. Hepatocyte Growth Factor Attenuates Airway Hyperresponsiveness, Inflammation, and Remodeling. Am J Respir Cell Mol Biol. 2005;32:268–80. https://doi.org/10.1165/rcmb.2004-0058OC . Ito Y, Correll K, Schiel JA, Finigan JH, Prekeris R, Mason RJ. Lung fibroblasts accelerate wound closure in human alveolar epithelial cells through hepatocyte growth factor/c-Met signaling. Am J Physiology-Lung Cell Mol Physiol. 2014;307:L94–105. https://doi.org/10.1152/ajplung.00233.2013 . Jahan S, Kumar D, Kumar A, Rajpurohit CS, Singh S, Srivastava A, Pandey A, Pant AB. Neurotrophic factor mediated neuronal differentiation of human cord blood mesenchymal stem cells and their applicability to assess the developmental neurotoxicity. Biochem Biophys Res Commun. 2017;482:961–7. https://doi.org/10.1016/j.bbrc.2016.11.140 . Kamada H, Nito C, Endo H, Chan PH. Bad as a Converging Signaling Molecule between Survival PI3-K/Akt and Death JNK in Neurons after Transient Focal Cerebral Ischemia in Rats. J Cereb Blood Flow Metabolism. 2007;27:521–33. https://doi.org/10.1038/sj.jcbfm.9600367 . Karadeniz F, Oh JH, Jo HJ, Yang J, Lee H, Seo Y, Kong C-S. Dracunculin Inhibits Adipogenesis in Human Bone Marrow-Derived Mesenchymal Stromal Cells by Activating AMPK and Wnt/β-Catenin Signaling. Int J Mol Sci. 2022;23. https://doi.org/10.3390/ijms23020653 . Kim H-Y, Jang H-J, Muthamil S, Shin UC, Lyu J-H, Kim S-W, Go Y, Park S-H, Lee HG, Park JH. Novel insights into regulators and functional modulators of adipogenesis. Biomed Pharmacother. 2024;177. https://doi.org/10.1016/j.biopha.2024.117073 . Kim H, Choi H, Lee SK, Longnecker RM. Epstein-Barr Virus MicroRNA miR-BART20-5p Suppresses Lytic Induction by Inhibiting BAD -Mediated caspase-3-Dependent Apoptosis. J Virol. 2016;90:1359–68. https://doi.org/10.1128/jvi.02794-15 . Künnapuu J, Bokharaie H, Jeltsch M. 2021. Proteolytic Cleavages in the VEGF Family: Generating Diversity among Angiogenic VEGFs, Essential for the Activation of Lymphangiogenic VEGFs. Biology 10. https://doi.org/10.3390/biology10020167 Lee C, Kim M-J, Kumar A, Lee H-W, Yang Y, Kim Y. Vascular endothelial growth factor signaling in health and disease: from molecular mechanisms to therapeutic perspectives. Signal Transduct Target Therapy. 2025;10. https://doi.org/10.1038/s41392-025-02249-0 . Lee JH, Park J, Lee JW. Therapeutic use of mesenchymal stem cell–derived extracellular vesicles in acute lung injury. Transfusion. 2018;59:876–83. https://doi.org/10.1111/trf.14838 . Li R, Zhang H, Zhang J, Ji Y, Liu W, Liu W, Wang M, Lv C, Song X, Li H, Li M. hucMSCs Treatment Ameliorated Pulmonary Fibrosis via Downregulating the circFOXP1-HuR-EZH2/STAT1/FOXK1 Autophagic Axis. Stem Cells. 2023;41:928–43. https://doi.org/10.1093/stmcls/sxad053 . Li Y, Shi X, Yang L, Mou Y, Li Y, Dang R, Li C. 2017. Hypoxia promotes the skewed differentiation of umbilical cord mesenchymal stem cells toward type II alveolar epithelial cells by regulating microRNA-145. Gene 630, 68–75. https://doi.org/10.1016/j.gene.2017.08.006 Li Zhang JY, Tian Y-M, Guo H, Zhang Y. Beneficial Effects of Hypoxic Preconditioning on Human Umbilical Cord Mesenchymal Stem Cells. Chin J Physiol. 2015;58:343–53. https://doi.org/DOI:10.4077/CJP.2015.BAE36910.4077/CJP.2015.BAE369 . Liu H, Dong J, Xu C, Ni Y, Ye Z, Sun Z, Fan H, Chen Y. Acute lung injury: pathogenesis and treatment. J Translational Med. 2025;23. https://doi.org/10.1186/s12967-025-06994-2 . Muñoz-Sánchez J, Chánez‐Cárdenas ME. The use of cobalt chloride as a chemical hypoxia model. J Appl Toxicol. 2018;39:556–70. https://doi.org/10.1002/jat.3749 . Peter JV, John P, Graham PL, Moran JL, George IA, Bersten A. Corticosteroids in the prevention and treatment of acute respiratory distress syndrome (ARDS) in adults: meta-analysis. BMJ. 2008;336:1006–9. https://doi.org/10.1136/bmj.39537.939039.BE . Rocco ML, Soligo M, Manni L, Aloe L. Nerve Growth Factor: Early Studies and Recent Clinical Trials. Curr Neuropharmacol. 2018;16:1455–65. https://doi.org/10.2174/1570159x16666180412092859 . Rosová I, Dao M, Capoccia B, Link D, Nolta JA. Hypoxic Preconditioning Results in Increased Motility and Improved Therapeutic Potential of Human Mesenchymal Stem Cells. Stem Cells. 2008;26:2173–82. https://doi.org/10.1634/stemcells.2007-1104 . Shyamsundar M, McAuley DF, Ingram RJ, Gibson DS, O’Kane D, McKeown ST, Edwards A, Taggart C, Elborn JS, Calfee CS, Matthay MA, O’Kane CM. Keratinocyte Growth Factor Promotes Epithelial Survival and Resolution in a Human Model of Lung Injury. Am J Respir Crit Care Med. 2014;189:1520–9. https://doi.org/10.1164/rccm.201310-1892OC . Sidharta VM, Herningtyas EH, Lagonda CA, Fauza D, Kusnadi Y, Susilowati R, Partadiredja G. High VEGF Level is Produced by Human Umbilical Cord- Mesenchymal Stem Cells (hUC-MSCs) in Amino Acid-Rich Medium and under Hypoxia Condition. Indonesian Biomedical J. 2018;10:222–30. https://doi.org/10.18585/inabj.v10i3.457 . Tu C, Wang Z, Xiang E, Zhang Q, Zhang Y, Wu P, Li C, Wu D. 2022. Human Umbilical Cord Mesenchymal Stem Cells Promote Macrophage. PD-L1 Expression and Attenuate Acute Lung Injury in Mice. Curr Stem Cell Res Therapy 17, 564–75. https://doi.org/10.2174/1574888x17666220127110332 Tunstead C, Volkova E, Dunbar H, Hawthorne IJ, Bell A, Crowe L, Masterson JC, Dos Santos CC, McNicholas B, Laffey JG, English K. The ARDS microenvironment enhances MSC-induced repair via VEGF in experimental acute lung inflammation. Mol Ther. 2024;32:3422–32. https://doi.org/10.1016/j.ymthe.2024.08.003 . Verma N, Hochhegger B, Mukhopadhyay S, Teixeira e Silva Torres PP, Mohammed T-L. Acute Lung Injury. J Thorac Imaging. 2025;40. https://doi.org/10.1097/rti.0000000000000820 . Wang B-Y, Zhang X, Li T-T, Qin W-W, Liu X, Lu K-M, Sun L-X, Han W. Ultrasound assisted homing of human umbilical cord mesenchymal stem cells promotes recovery from acute respiratory distress syndrome. Stem Cell Res Ther. 2025;16. https://doi.org/10.1186/s13287-025-04545-6 . Wang Q, Chen R, Zhang C, Inam u l, Piao F, Shi X. NGF protects bone marrow mesenchymal stem cells against 2,5-hexanedione-induced apoptosis in vitro via Akt/Bad signal pathway. Mol Cell Biochem. 2019;457:133–43. https://doi.org/10.1007/s11010-019-03518-7 . Wang Y, Li H, Li X, Su X, Xiao H, Yang J. Hypoxic Preconditioning of Human Umbilical Cord Mesenchymal Stem Cells Is an Effective Strategy for Treating Acute Lung Injury. Stem Cells Dev. 2021;30:128–34. https://doi.org/10.1089/scd.2020.0174 . Ward JPT. 2008. Oxygen sensors in context. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1777, 1–14. https://doi.org/10.1016/j.bbabio.2007.10.010 Watanabe M, Ebina M, Orson FM, Nakamura A, Kubota K, Koinuma D, Akiyama K-i, Maemondo M, Okouchi S, Tahara M, Matsumoto K, Nakamura T, Nukiwa T. Hepatocyte Growth Factor Gene Transfer to Alveolar Septa for Effective Suppression of Lung Fibrosis. Mol Ther. 2005;12:58–67. https://doi.org/10.1016/j.ymthe.2005.02.019 . Xin S, Ding Y, Yu T, Fu Y, Cui Y, Nie H. Mesenchymal stem cell-secreted KGF ameliorates acute lung injury via the Gab1/ERK/NF-κB signaling axis. Cell Mol Biol Lett. 2025;30. https://doi.org/10.1186/s11658-025-00757-z . Yang J-n, Jiang Y-y, Yuan C, Liu Z-g, Liu X-c. Paracrine abilities of adipose-derived mesenchymal stem cells and umbilical cord mesenchymal stem cells under different oxygen concentrations. J Clin Rehabilitative Tissue Eng Res. 2018;22:3322–7. https://doi.org/DOI:10.3969/j.issn.2095-4344.0880 . Yang Y, Chen Q-h, Liu A-r, Xu X-p, Han J-b, Qiu H-b. Synergism of MSC-secreted HGF and VEGF in stabilising endothelial barrier function upon lipopolysaccharide stimulation via the Rac1 pathway. Stem Cell Res Ther. 2015;6. https://doi.org/10.1186/s13287-015-0257-0 . Yang Y, Hu S, Xu X, Li J, Liu A, Han J, Liu S, Liu L, Qiu H. 2016. The Vascular Endothelial Growth Factors-Expressing Character of Mesenchymal Stem Cells Plays a Positive Role in Treatment of Acute Lung InjuryIn Vivo. Mediators of Inflammation 2016, 1–12. https://doi.org/10.1155/2016/2347938 You J, Zhou O, Liu J, Zou W, Zhang L, Tian D, Dai J, Luo Z, Liu E, Fu Z, Zou L. Human Umbilical Cord Mesenchymal Stem Cell-Derived Small Extracellular Vesicles Alleviate Lung Injury in Rat Model of Bronchopulmonary Dysplasia by Affecting Cell Survival and Angiogenesis. Stem Cells Dev. 2020;29:1520–32. https://doi.org/10.1089/scd.2020.0156 . Yu T, Cui Y, Xin S, Fu Y, Ding Y, Hao L, Nie H. Mesenchymal stem cell conditioned medium alleviates acute lung injury through KGF-mediated regulation of epithelial sodium channels. Biomed Pharmacother. 2023;169. https://doi.org/10.1016/j.biopha.2023.115896 . Zha K, Yang Y, Tian G, Sun Z, Yang Z, Li X, Sui X, Liu S, Zhao J, Guo Q. Nerve growth factor (NGF) and NGF receptors in mesenchymal stem/stromal cells: Impact on potential therapies. Stem Cells Translational Med. 2021;10:1008–20. https://doi.org/10.1002/sctm.20-0290 . Zhang M, Shi X, Wu J, Wang Y, Lin J, Zhao Y, Li H, Ren M, Hu R, Liu F, Deng H. CoCl2 induced hypoxia enhances osteogenesis of rat bone marrow mesenchymal stem cells through cannabinoid receptor 2. Arch Oral Biol. 2019;108. https://doi.org/10.1016/j.archoralbio.2019.104525 . Zhu S, Chen W, Masson A, Li Y-P. 2024. Cell signaling and transcriptional regulation of osteoblast lineage commitment, differentiation, bone formation, and homeostasis. Cell Discovery 10. https://doi.org/10.1038/s41421-024-00689-6 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9650125","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":636654224,"identity":"d66eade2-f018-4c60-8d13-0a1ca38243cb","order_by":0,"name":"Lin Shen","email":"","orcid":"","institution":"Shaanxi Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Shen","suffix":""},{"id":636654225,"identity":"32f46fc8-3cbc-49aa-bc90-df747e343c84","order_by":1,"name":"Yujuan Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA80lEQVRIie2QsWoCQRCGd1nYamTbWZKHWDi4IIi+yolw1ZHaKiwIVkHbE3wO65EDbS6xFazExuKK9QESsiSkCWTPUnC/Yorh/2D+YSwSuVXgewoiN+6BUvY6BRmTw2NZ54+6pKsVSJLOtOoZm4XTZvtWnZtx/0U9UIogd2AYcXcpAkr9nHeX9Qj1LMsR4QBPwgq9WP2vpFSk/h5CU7MNGjxA15IUnZCya34VPsXMvIOhrEXZF8npRxHCp6ldGeyblPsuevEq+dHSCHS5ngS76HmROP8xpUC56uOzP1BqsnaXgOKR+GfBbTDvEa4tEYlEInfOF/PNUwq0zRrhAAAAAElFTkSuQmCC","orcid":"","institution":"Shaanxi Provincial People's Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yujuan","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2026-05-08 07:08:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9650125/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9650125/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":108979848,"identity":"e34c5186-c255-4087-81ab-ed61138563c7","added_by":"auto","created_at":"2026-05-11 12:01:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2800271,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMorphological characteristics and growth of hUC-MSCs under hypoxic preconditioning.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A–F)\u003c/strong\u003eRepresentative micrographs of hUC-MSCs following 72 h of stimulation with various CoCl₂ concentrations (original magnification: 40×). Panels A through F represent CoCl₂ concentrations of 0, 10, 50, 100, 200, and 400 μmol/L, respectively. \u003cstrong\u003e(G)\u003c/strong\u003e Growth and morphology of hUC-MSCs under physical hypoxia (original magnification: 100×). Experimental groups included normoxia (21% O₂) and physical hypoxia (1% O₂ and 3% O₂) for durations of 24 h and 48 h. These images illustrate the adaptive growth response of hUC-MSCs to varying chemical and physical hypoxic environments.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/f760fa08358642f44ae80f59.png"},{"id":108979912,"identity":"d6c8e0e4-aa04-435c-bbd7-c04628e441a9","added_by":"auto","created_at":"2026-05-11 12:02:13","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":37403,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of CoCl₂ on hUC-MSC viability and proliferation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe CCK-8 assay was employed to evaluate the viability of hUC-MSCs after exposure to different concentrations of CoCl₂ (0, 10, 50, 100, 200, and 400 μmol/L) for 24, 48, and 72 h. Data illustrate the dose- and time-dependent effects of chemical hypoxia on the proliferative capacity of hUC-MSCs.\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/b0d3894bbd9779d7a5e862d3.jpeg"},{"id":108979847,"identity":"b405778c-fef9-48e0-b101-7ec8d9342cec","added_by":"auto","created_at":"2026-05-11 12:01:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":894218,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValidation of the hUC-MSC hypoxic model through HIF-1α expression. \u0026nbsp;(A)\u003c/strong\u003e Protein levels of HIF-1α following CoCl₂ treatment as determined by Western blot analysis, with quantitative densitometry shown in the accompanying bar graphs.\u003cstrong\u003e (B) \u003c/strong\u003eRelative mRNA expression of HIF1A after CoCl₂ stimulation as measured by qPCR, including the corresponding statistical analysis. \u003cstrong\u003e(C)\u003c/strong\u003e Protein expression of HIF-1α under various oxygen tensions (physical hypoxia) analyzed by Western blot, with the quantitative results presented in the adjacent panels. \u003cstrong\u003e(D)\u003c/strong\u003e qPCR analysis of \u003cem\u003eHIF-1α \u003c/em\u003emRNA levels under different oxygen concentrations and the associated statistical results.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/4395cdaeb8de0b461ac2cdcb.png"},{"id":108979780,"identity":"67858959-2a38-4bf5-9ae5-5f4efcc4561b","added_by":"auto","created_at":"2026-05-11 12:01:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1037192,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of hypoxic preconditioning on the production of paracrine factors (VEGF, HGF, NGF, and KGF).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Protein levels of VEGF, HGF, NGF, and KGF in the culture supernatants of hUC-MSCs following CoCl₂ stimulation, as quantified by ELISA. The accompanying bar graphs represent the statistical analysis of cytokine concentrations. \u003cstrong\u003e(B)\u003c/strong\u003e Relative mRNA expression of VEGFA, HGF, NGF, and FGF7 (KGF) in hUC-MSCs after CoCl₂ treatment, as determined by qPCR. \u003cstrong\u003e(C) \u003c/strong\u003eTranscriptional profiles of the four paracrine factors in hUC-MSCs cultured under different oxygen tensions (physical hypoxia), with corresponding statistical summaries.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/3bfd234c9b2416912d5e4e5b.png"},{"id":108979781,"identity":"c990f131-1e14-4368-8722-0f77ce3d5b15","added_by":"auto","created_at":"2026-05-11 12:01:33","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":150427,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRegulation of the PI3K/Akt pathway and apoptosis-related factors by hypoxic preconditioning.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Western blot analysis of total Akt, phosphorylated Akt (p-Akt), Bcl-2, and cleaved Caspase-3 (c-Caspase-3) protein levels following CoCl₂ treatment. The accompanying bar graphs show the quantitative densitometric analysis. \u003cstrong\u003e(B)\u003c/strong\u003e Relative mRNA expression of \u003cem\u003eCASP3\u003c/em\u003e, \u003cem\u003eBCL2\u003c/em\u003e, \u003cem\u003eAKT\u003c/em\u003e, and\u003cem\u003e PI3K\u003c/em\u003e in hUC-MSCs after CoCl₂ stimulation, as measured by qPCR.\u003cstrong\u003e (C)\u003c/strong\u003e Protein expression profiles of PI3K, Akt, p-Akt, Bcl-2, and c-Caspase-3 in hUC-MSCs subjected to physical hypoxia (various O₂ concentrations) for 24 h and 48 h, determined by Western blot. \u003cstrong\u003e(D)\u003c/strong\u003e Statistical quantification of the protein expression levels shown in panel (C). \u003cstrong\u003e(E)\u003c/strong\u003e qPCR analysis of \u003cem\u003eCASP3\u003c/em\u003e, \u003cem\u003eBCL2\u003c/em\u003e, \u003cem\u003eAKT\u003c/em\u003e, and \u003cem\u003ePI3K\u003c/em\u003e mRNA levels under physical hypoxic conditions for 24 h and 48 h, with the corresponding statistical results.\u003c/p\u003e","description":"","filename":"image5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/f205e0e38a3457dbe4c95def.jpeg"},{"id":108979784,"identity":"3b499a2b-6a4e-4884-bd5b-fad7b9a46393","added_by":"auto","created_at":"2026-05-11 12:01:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1648908,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEnhancement of hUC-MSC multi-lineage differentiation potential by hypoxic preconditioning.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Representative micrographs of Alizarin Red S staining to evaluate the osteogenic differentiation of hUC-MSCs following CoCl₂ preconditioning. \u003cstrong\u003e(B)\u003c/strong\u003e Representative micrographs of Oil Red O staining depicting adipogenic differentiation in hUC-MSCs after CoCl₂ treatment. \u003cstrong\u003e(C)\u003c/strong\u003eQuantitative analysis of mineralized nodules and lipid droplet area in hUC-MSCs following chemical hypoxic induction. \u003cstrong\u003e(D)\u003c/strong\u003e qPCR analysis of lineage-specific markers, including osteogenic genes (\u003cem\u003eRUNX2\u003c/em\u003e, \u003cem\u003eOsterix\u003c/em\u003e) and adipogenic genes (\u003cem\u003ePPARγ\u003c/em\u003e, \u003cem\u003eC/EBPα\u003c/em\u003e), in hUC-MSCs stimulated by CoCl₂.\u003cstrong\u003e (E)\u003c/strong\u003e Relative mRNA expression levels of osteogenic and adipogenic markers in hUC-MSCs subjected to physical hypoxia (hypoxic incubator).\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/1c1fcafa84cc06755ca337be.png"},{"id":109067787,"identity":"d807f06f-cd8f-44d9-8156-fd63072b828b","added_by":"auto","created_at":"2026-05-12 10:00:54","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":651432,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLentiviral transduction and GFP labeling of hUC-MSCs.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRepresentative micrographs demonstrate the morphology and transduction efficiency of hUC-MSCs. The characteristic spindle-shaped fibroblastic morphology of the cells is visible under bright-field illumination. Correspondingly, a strong fluorescent signal is observed under fluorescence microscopy, confirming the successful integration and expression of Green Fluorescent Protein (GFP).\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/52aeb2d38869620f5f303226.png"},{"id":108979830,"identity":"a2199c74-1f50-4678-a00c-b21abe0eb62b","added_by":"auto","created_at":"2026-05-11 12:01:46","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":503306,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003etracking and biodistribution of GFP-labeled hUC-MSCs in ALI mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e The distribution of normal hUC-MSCs in mice.\u003cstrong\u003e (B) \u003c/strong\u003eThe distribution of hypoxic preconditioned hUC-MSCs in mice.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/803217a3c5ed908fe694d578.png"},{"id":108979969,"identity":"8dc42334-de8a-4991-b0f4-b01702eae0ee","added_by":"auto","created_at":"2026-05-11 12:02:51","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":838725,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDirectional distribution of GFP-labeled hUC-MSCs in lungs.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eThe distribution of hypoxic preconditioned hUC-MSCs in lungs over time. \u003cstrong\u003e(B) \u003c/strong\u003eThe distribution of hypoxic preconditioned hUC-MSCs in lung, heart, liver, kidney, spleen over time.\u003c/p\u003e","description":"","filename":"image9.png","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/2996ba01cacc97bea4571629.png"},{"id":109461121,"identity":"10d89ed0-af5b-4ba0-a117-ba82dfde1e3e","added_by":"auto","created_at":"2026-05-18 10:56:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":10566826,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9650125/v1/42800518-37a2-4a77-a6af-9b16fa95a39e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cytological basis of hypoxic preconditioned hUC-MSCs enhance the effect of treating ALI","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAcute Lung Injury (ALI) is a devastating clinical syndrome characterized pathologically by the disruption of the pulmonary vascular endothelium and alveolar epithelial barrier. Its most severe manifestation, Acute Respiratory Distress Syndrome (ARDS), represents a life-threatening respiratory emergency associated with persistently high mortality rates (Bakowitz et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Rosov\u0026aacute; et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Verma et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Currently, conventional pharmacological interventions (such as glucocorticoid therapy) are often limited by suboptimal efficacy, drug resistance, and systemic adverse effects (Peter et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Therefore, exploring innovative and effective therapeutic strategies in the treatment of ALI/ARDS is of paramount clinical importance (Fukatsu et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMesenchymal stromal cell (MSC) therapy exhibits broad potential in various inflammatory diseases due to its potent immunomodulatory and regenerative capacities (Chiara Giacomini, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Among these, human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) have emerged as a promising and minimally invasive therapeutic modality. Owing to their ease of collection, robust self-renewal capacity, and potent paracrine activity, hUC-MSCs have shown significant therapeutic potential in preclinical models (Ding et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Huang et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). For instance, in lipopolysaccharide (LPS)-induced ALI mice, hUC-MSCs modulate macrophages via PGE2 signaling to enhance PD-L1 expression, thereby suppressing hyper-inflammatory responses (Tu et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Additionally, hUC-MSCs have been shown to attenuate pulmonary fibrosis, potentially through circFOXP1-mediated upregulation of the HuR-EZH2/STAT1/FOXK1 axis to enhance autophagy (Li et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Furthermore, they facilitate alveolar epithelial repair through multilineage differentiation and the secretion of cytokines or miRNA-laden exosomes that target critical pathways such as PI3K/AKT, Wnt, and NF-κB (Fu et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Therefore, the therapeutic efficacy of hUC-MSCs likely stems from a synergy of multiple mechanisms that collectively modulate the onset and progression of ALI.\u003c/p\u003e \u003cp\u003eDespite this potential, direct hUC-MSC administration faces challenges, including pulmonary sequestration, poor targeted homing, and limited survival within the hostile injury microenvironment (Li Zhang, 2015). Furthermore, a profound mismatch exists between conventional in vitro culture conditions and the native physiological microenvironment. Standard normoxic culture (21% O₂) significantly exceeds the physiological oxygen levels in healthy tissues (3%\u0026ndash;5%) (Rosov\u0026aacute; et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Ward, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Studies have shown that hypoxic preconditioning can significantly optimize the biological properties of MSCs. For instance, hypoxia facilitates differentiation into type II alveolar epithelial cells via miR-145 and bolsters anti-apoptotic capacity through the regulation of apoptosis-associated genes (Li et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Recent evidence suggests that hypoxic preconditioning enhances the proliferation, secretome, and reparative capacity of hUC-MSCs, bridging the gap between experimental observations and clinical expectations (Han et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Huang et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Prior research has substantiated that hypoxic preconditioning empowers hUC-MSCs with enhanced therapeutic efficacy, as evidenced in rat models of bronchopulmonary dysplasia and its associated pulmonary sequelae (Hao et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; You et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, the comparative advantages and refined molecular mechanisms of different hypoxic preconditioning methods remain fully elucidated.\u003c/p\u003e \u003cp\u003eIn the present study, we systematically compared two hypoxic preconditioning strategies\u0026mdash;chemical induction (CoCl\u003csub\u003e2\u003c/sub\u003e) and physical hypoxia (hypoxic incubator). We evaluated their impacts on hUC-MSC morphology, viability, paracrine profile, anti-apoptotic capacity, and multilineage differentiation. Our findings aim to provide a robust cytological basis and novel strategies for the optimization of MSC-based therapies in ALI/ARDS.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and Morphology\u003c/h2\u003e \u003cp\u003eThe hUC-MSCs used in this study were obtained from Changchun Sigma Company. The cells were maintained at 37\u0026deg;C in a humidified incubator with 5% CO2. Upon reaching approximately 80%\u0026ndash;90% confluence, the cells were detached using 0.25% trypsin and subcultured. All experiments were conducted using hUC-MSCs between passages 3 and 6 to ensure biological stability. Cell morphology and growth density were monitored daily under an inverted microscope (Olympus, Tokyo, Japan) (e.g., 10\u0026times;, 20\u0026times;, and 40\u0026times; magnification) to ensure the absence of contamination. All cell culture procedures were performed under strict aseptic conditions.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCharacterization and identification of hUC-MSCs\u003c/h3\u003e\n\u003cp\u003eTo ensure the biological integrity and therapeutic suitability of hUC-MSCs, a systematic identification process was conducted. First, cellular morphology was assessed using inverted microscopy. Second, the purity and immunophenotype of hUC-MSCs were analyzed via flow cytometry, focusing on the expression of specific surface markers. Finally, the multi-lineage differentiation potential was evaluated to confirm the stemness of the cells.\u003c/p\u003e\n\u003ch3\u003eHypoxic Preconditioning Protocols\u003c/h3\u003e\n\u003cp\u003eTwo hypoxic preconditioning strategies were employed in this study: chemical induction and physical hypoxia. Chemical hypoxia was induced using cobalt chloride (CoCl2), a hypoxia-mimetic agent, at final concentrations of 0, 10, 50, 100, 200, and 400 \u0026micro;mol/L. Physical hypoxia was implemented using a specialized tri-gas incubator to achieve precise atmospheric control. The experimental groups included: (1) 1% O2 group (1% O2, 5% CO2, and 94% N2), (2) 3% O2 group (3% O2, 5% CO2, and 92% N2), and (3) a normoxic control group maintained under standard atmospheric conditions (21% O2, 5% CO2, and 74% N2).\u003c/p\u003e\n\u003ch3\u003eCell Proliferation and Viability Assay\u003c/h3\u003e\n\u003cp\u003eCell proliferation was evaluated using the Cell Counting Kit-8 (CCK-8, Merck, St. Louis, MO, USA). hUC-MSCs at passage 6 were seeded into 96-well plates at a density of 5 \u0026times; 10\u0026sup3; cells/well and incubated at 37\u0026deg;C with 5% CO2 for 48 h to ensure stable attachment. The cells were subsequently exposed to Cobalt chloride (CoCl2) at final concentrations of 0, 10, 50, 100, 200, and 400 \u0026micro;mol/L, with five biological replicates per group. After 24, 48, and 72 h of treatment, the culture medium was replaced with 100 \u0026micro;L of fresh medium supplemented with 10 \u0026micro;L of CCK-8 reagent. Following an additional incubation of 1\u0026ndash;4 h, the absorbance was measured at 450 nm using a microplate reader. Cell morphology was also qualitatively assessed via inverted microscopy at each indicated time point.\u003c/p\u003e\n\u003ch3\u003eEnzyme-Linked Immunosorbent Assay (ELISA)\u003c/h3\u003e\n\u003cp\u003eTo evaluate the paracrine profile of hUC-MSCs, cell culture supernatants were collected and centrifuged at 1,000 \u0026times; g for 20 min at 4\u0026deg;C to remove insoluble debris. The levels of human vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), nerve growth factor (NGF), and keratinocyte growth factor (KGF) were then determined using corresponding ELISA kits (Abcam, Cambridge, MA, USA) according to the manufacturer\u0026rsquo;s protocols. All measurements were performed in triplicate, and the protein concentrations were calculated based on standard curves.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eReal-Time Quantitative PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from hUC-MSCs using an RNA extraction kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer\u0026rsquo;s protocol. The concentration and purity of the extracted RNA were determined spectrophotometrically. Subsequently, cDNA was synthesized, and RT-qPCR was performed using a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The specific primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, with β-actin utilized as the internal reference gene. The thermocycling conditions consisted of an initial denaturation at 95\u0026deg;C for 2 min, followed by 40 cycles of 95\u0026deg;C for 15 s and 60\u0026deg;C for 30 s. All reactions were conducted in triplicate, and the relative mRNA expression levels were quantified using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers Used for Real-Time PCR (Species: Homo sapiens)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003egenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHGF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCATCAAATGTCAGCCCTGGAGTTCC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTTCGTAGCGTACCTCTGGATTGC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVEGF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eTGCCTTGCTGCTCTACCTCCAC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGATGTCCACCAGGGTCTCGATTG\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNGF\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eGCAAGCGGTCATCATCCCATCC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eTCTGTGGCGGTGGTCTTATCCC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eKGF\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eAAATGTGAACTGTTCCAGCCCTGAG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eTCTCTTGGGTCCCTTTTACTTTGCC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePPARγ\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eGCCCTTCACTACTGTTGACTTCTCC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eCAGGCTCCACTTTGATTGCACTTTG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC/EBPα\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTCGGTGGACAAGAACAGCAACG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eGGCGGTCATTGTCACTGGTCAG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRUNX2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eAGGCAGTTCCCAAGCATTTCATCC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eTGGCAGGTAGGTGTGGTAGTGAG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eOsterix\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eATAGTGGGCAGCTAGAAGGGAGTG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eATTAGGGCAGTCGCAGGAGGAG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBcl-2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTCGCCCTGTGGATGACTGAGTAC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eACAGCCAGGAGAAATCAAACAGAGG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCaspase3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTTGAGACAGACAGTGGTGTTGATGATG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eTGGCACAAAGCGACTGGATGAAC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHIF-1α\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCCATTAGAAAGCAGTTCCGCAAGC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eGTGGTAGTGGTGGCATTAGCAGTAG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePI3K\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTCACTACCGCCACGAGTCTCTG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eACTGCCTCCACGCTGTCCTC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAkt\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCAGGAGGAGGAGGAGATGGACTTC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eCCCAGCAGCTTCAGGTACTCAAAC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eWestern Blot Analysis\u003c/h3\u003e\n\u003cp\u003eTotal protein was extracted from hUC-MSCs using RIPA lysis buffer supplemented with protease and phosphatase inhibitors. The lysates were centrifuged at 12,000 \u0026times; g for 15 min at 4\u0026deg;C, and protein concentrations were determined using a BCA Protein Assay Kit. Equal amounts of protein (30 \u0026micro;g) were resolved by 12% SDS-PAGE and subsequently transferred onto PVDF membranes. After blocking with 5% non-fat milk in TBST for 1 h at room temperature, the membranes were incubated overnight at 4\u0026deg;C with primary antibodies against HIF-1α (1:1000; #79233; CST, Danvers, MA, USA), PI3K (1:1000; #4255; CST), AKT (1:1000; #4691; CST), p-AKT(Ser473) (1:1000; #4060; CST), Bcl-2 (1:1000; #2872; CST), and cleaved caspase-3 (1:1000; #9664; CST). After washing, the membranes were incubated with an HRP-conjugated goat anti-rabbit secondary antibody (1:1500; Affinity Biosciences) for 1 h. Protein bands were detected using an enhanced chemiluminescence (ECL) kit and visualized with a digital imaging system. Band intensities were quantified using ImageJ software (NIH, Bethesda, MD, USA), with β-actin used as the internal loading control for normalization.\u003c/p\u003e\n\u003ch3\u003eMulti-lineage Differentiation Assays\u003c/h3\u003e\n\u003cp\u003eTo evaluate the impact of hypoxic preconditioning on the stemness of hUC-MSCs, osteogenic and adipogenic induction were performed with the addition of CoCl2 at concentrations of 0, 50, and 100 \u0026micro;mol/L. The CoCl2 concentration was strictly maintained throughout the medium replacement process, with each condition tested in duplicate. Following adipogenic induction, lipid accumulation was qualitatively assessed via Oil Red O staining. For quantitative analysis, 500 \u0026micro;L of isopropanol was added to each well and incubated with shaking for 10 min to completely dissolve the intracellular triglycerides. The resulting extracts were transferred to a 96-well plate (200 \u0026micro;L/well), and the absorbance was measured at 540 nm using a microplate reader.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eLentiviral Transduction\u003c/h2\u003e \u003cp\u003eTo enable visualization and tracking, hUC-MSCs were transduced with a GFP-tagged lentiviral vector. P2 hUC-MSCs were seeded into six-well plates and cultured until they reached 60%\u0026ndash;70% confluence. For transduction, the lentiviral stock was thawed and added to the cells at various concentrations to determine the optimal dose. Six hours after viral exposure, the medium was replaced with fresh, pre-warmed complete medium. The transduction efficiency was evaluated by observing GFP expression under a fluorescence microscope at 24 and 72 h. The optimal multiplicity of infection (MOI) was calculated to ensure high labeling efficiency for subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eIn Vivo Distribution of hUC-MSCs in ALI Mice\u003c/h2\u003e \u003cp\u003eMale BALB/c mice were used to evaluate the pulmonary homing and biodistribution of hUC-MSCs. To establish the ALI model, mice were anesthetized with 5% chloral hydrate (0.1 mL/mouse) and intratracheally administered lipopolysaccharide (LPS; 5 mg/kg). Control mice received an equivalent volume of PBS. Four hours after LPS challenge, 1\u0026times;10⁶ GFP-labeled hUC-MSCs (either normoxic or hypoxic-preconditioned) were injected via the tail vein. Two hours following cell administration, the mice were re-anesthetized and placed in an \u003cem\u003ein vivo\u003c/em\u003e imaging system (IVIS) to monitor the localization and fluorescence intensity of the GFP-tagged hUC-MSCs.\u003c/p\u003e \u003cp\u003eFor the comparative study of hypoxic preconditioning, mice were divided into five experimental groups: (1) Control, (2) ALI model, (3) Normoxic hUC-MSCs, (4) CoCl2-preconditioned hUC-MSCs (100 \u0026micro;mol/L for 24 h), and (5) Physical hypoxia-preconditioned hUC-MSCs (3% O₂ for 48 h). All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Shaanxi Provincial People's Hospital.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTissue Processing and Fluorescence Imaging\u003c/h2\u003e \u003cp\u003eFollowing \u003cem\u003ein vivo\u003c/em\u003e imaging, the mice were humanely euthanized. The lungs, kidneys, liver, and heart were harvested and fixed for subsequent immunofluorescence evaluation. Cryosections or paraffin sections of the tissues were prepared to examine the recruitment and distribution of the transplanted cells. Given the stable endogenous green fluorescence of the GFP-labeled hUC-MSCs, the distribution of the cells within various organs was directly visualized using a fluorescence microscope (IX73; Olympus, Tokyo, Japan) without supplementary antibody labeling.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll quantitative data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical analyses were conducted using GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). The normality of the data distribution was assessed using the Shapiro-Wilk test. For normally distributed data, statistical significance between two groups was determined using the two-tailed Student\u0026rsquo;s t-test, whereas comparisons among three or more groups were evaluated using one-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s multiple comparisons test. A value of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. Significance levels are indicated in the figures as follows: *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and ****\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEffects of Hypoxic Preconditioning on hUC-MSC Morphology and Proliferation\u003c/h2\u003e \u003cp\u003eThe hUC-MSCs exhibited typical spindle-shaped, adherent growth, consistent with the standard morphology of mesenchymal stem cells. To evaluate the effect of chemical hypoxia, hUC-MSCs were exposed to various concentrations of CoCl2 (0, 10, 50, 100, 200, and 400 \u0026micro;mol/L) for 72 h. Morphological analysis revealed no significant structural changes in cells treated with CoCl2 at concentrations up to 200 \u0026micro;mol/L; however, at 200 \u0026micro;mol/L, the cells appeared more scattered with less confluence. A marked decrease in cell density was observed when the concentration reached 400 \u0026micro;mol/L, although the spindle morphology remained discernible (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u0026ndash;F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eRegarding physical hypoxia, the morphology of hUC-MSCs remained stable across different O2 levels, while cell proliferation was notably affected. Compared to the normoxia group (21% O2), both the 1% and 3% O2 groups showed increased cell counts at 48 h relative to 24 h. Notably, the 3% O2 group exhibited the most significant increase in cell density and a corresponding decrease in intercellular spacing, indicating that 3% O2 for 48 h is likely the optimal condition for hypoxic preconditioning (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eEffects of CoCl2-Induced Hypoxia on hUC-MSC Viability\u003c/h2\u003e \u003cp\u003eThe impact of chemical hypoxia on hUC-MSC viability was assessed using various CoCl\u003csub\u003e2\u003c/sub\u003e concentrations (0, 10, 50, 100, 200, and 400 \u0026micro;mol/L) over 24, 48, and 72 h. In general, the inhibition rate of hUC-MSCs increased in a concentration- and time-dependent manner. Treatment with 10 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e exerted no inhibitory effect; rather, negative inhibition rates at 48 and 72 h indicated a slight promotion of cell proliferation at this low dosage. After 24 h of exposure, concentrations up to 200 \u0026micro;mol/L did not significantly impair cell viability. Notably, 100 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e treatment for 24 h showed the strongest capacity to enhance cell viability without cytotoxicity. Consequently, 100 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e for 24 h was identified as the optimal condition for hypoxic preconditioning, providing a standardized experimental basis for further functional studies (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eValidation of the CoCl2-Induced Hypoxia Model\u003c/h2\u003e \u003cp\u003eTo validate the hypoxia model in hUC-MSCs, we examined HIF-1α expression at both protein and mRNA levels under chemical hypoxia (CoCl₂) and physical hypoxia (low oxygen). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, CoCl₂ treatment dose-dependently increased HIF-1α protein expression, with a significant elevation observed in the 200 \u0026micro;mol/L group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Consistently, HIF-1α mRNA expression was upregulated in a concentration-dependent manner, starting from 50 \u0026micro;mol/L CoCl₂ (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and reaching a highly significant level at 100 and 200 \u0026micro;mol/L (both \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). For physical hypoxia, hUC-MSCs were exposed to 1% and 3% O₂. Western blot analysis revealed that HIF-1α protein was stabilized in a time-dependent manner under 1% and 3% O₂, with significant increases at 48 h (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, respectively, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Similarly, qPCR results showed that HIF-1α mRNA expression was significantly upregulated at 48 h under 3% O₂ (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These data confirm that both CoCl₂ and low oxygen effectively induce HIF-1α expression, successfully establishing the hypoxia model in hUC-MSCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eHypoxic Preconditioning Enhances the Paracrine Potential of hUC-MSCs\u003c/h2\u003e \u003cp\u003eTo determine the effects of hypoxic stimulation on the paracrine profile of hUC-MSCs, we quantified the concentrations of VEGF, HGF, NGF, and KGF. Compared to the normoxic control (0 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e), 50 and 100 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e significantly increased VEGF secretion (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), though this effect was not maintained at 200 \u0026micro;mol/L. Conversely, NGF and KGF levels were robustly elevated across all tested CoCl\u003csub\u003e2\u003c/sub\u003e concentrations (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), while HGF showed a clear concentration-dependent increase (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAt the transcriptional level, CoCl\u003csub\u003e2\u003c/sub\u003e treatment consistently upregulated the mRNA expression of all four growth factors, confirming that chemical hypoxia promotes their synthesis and secretion (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Parallel findings were observed under physical hypoxia, where 3% O\u003csub\u003e2\u003c/sub\u003e stimulation for 48 h significantly enhanced the expression of VEGF, NGF, KGF, and HGF. These data collectively suggest that both chemical and physical hypoxic preconditioning effectively bolster the secretome and paracrine function of hUC-MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eHypoxic Preconditioning Enhances the Anti-apoptotic Capacity of hUC-MSCs\u003c/h2\u003e \u003cp\u003eTo investigate the anti-apoptotic effects of chemical hypoxia, we analyzed the expression of key apoptosis-related and survival-signaling proteins. Western blot analysis revealed that compared to the control group (0 \u0026micro;mol/L), the levels of cleaved caspase-3, total AKT, and phosphorylated AKT (p-AKT) were significantly increased in the 50, 100, and 200 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e groups (all \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Furthermore, the anti-apoptotic protein Bcl-2 was markedly upregulated following 100 \u0026micro;mol/L (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and 200 \u0026micro;mol/L (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) CoCl\u003csub\u003e2\u003c/sub\u003e treatment, although the 50 \u0026micro;mol/L group showed no significant difference (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn contrast, physical hypoxia (1% and 3% O\u003csub\u003e2\u003c/sub\u003e) led to a significant decrease in the expression of the pro-apoptotic protein cleaved caspase-3, alongside a concomitant increase in Bcl-2 levels and the activation of the PI3K/AKT pathway at both 24 and 48 h (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results suggest that physical hypoxic preconditioning enhances the anti-apoptotic survival of hUC-MSCs, with the 3% O\u003csub\u003e2\u003c/sub\u003e for 48 h condition yielding the most significant improvement (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC\u0026ndash;D). Correspondingly, RT-qPCR results confirmed the upregulation of PI3K, AKT, and Bcl-2 mRNA, while Caspase3 mRNA was significantly downregulated under these hypoxic conditions. Collectively, these data substantiate that physical hypoxia effectively bolsters the anti-apoptotic potential of hUC-MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eHypoxic Preconditioning Enhances the Multi-lineage Differentiation Potential of hUC-MSCs\u003c/h2\u003e \u003cp\u003eTo evaluate the impact of hypoxia on stemness, hUC-MSCs were subjected to osteogenic and adipogenic induction. Alizarin Red S staining revealed that compared to the control group, cells treated with 50 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e exhibited granular calcified aggregates, while the 100 \u0026micro;mol/L group showed significantly more mature calcified nodules (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Regarding adipogenesis, Oil Red O staining identified an increased number of lipid-rich cells in the 50 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e group, with high-magnification imaging revealing characteristic bead-like chains of lipid droplets. The 100 \u0026micro;mol/L group displayed even greater adipocyte abundance with intense red staining and high refractivity (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Quantitative analysis confirmed a concentration-dependent increase in OD540 values; while the 50 \u0026micro;mol/L group showed only a marginal increase (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), the 100 \u0026micro;mol/L group exhibited a highly significant elevation (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAt the transcriptional level, mRNA expression of osteogenic markers (RUNX2 and Osterix) and adipogenic markers (PPARγ and C/EBPα) was significantly upregulated in the 200 \u0026micro;mol/L CoCl\u003csub\u003e2\u003c/sub\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Similarly, physical hypoxia (3% O\u003csub\u003e2\u003c/sub\u003e for 48 h) significantly bolstered the expression of these lineage-specific genes compared to the normoxic control (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). These results collectively indicate that both chemical and physical hypoxic preconditioning enhance the multi-lineage differentiation potential of hUC-MSCs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eLentiviral Transduction and Labeling Efficiency Optimization\u003c/h2\u003e \u003cp\u003eTo achieve optimal fluorescence labeling, we evaluated the transduction efficiency of the GFP-tagged lentiviral vector in hUC-MSCs. With a fixed seeding density of 2 \u0026times; 10⁵ cells per well in six-well plates, the highest efficiency was observed following the addition of 10 \u0026micro;L of viral stock. Considering the viral titer of 10⁸ TU/mL, the multiplicity of infection (MOI) was determined to be 5. Using this optimized MOI, a large scale of hUC-MSCs was successfully transduced with the GFP-labeled lentiviral vector, providing stable and highly visible cellular markers for the subsequent animal studies (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eHypoxic Preconditioning Promotes the Pulmonary Homing of hUC-MSCs in ALI Mice\u003c/h2\u003e \u003cp\u003eTo evaluate the biodistribution of hUC-MSCs \u003cem\u003ein vivo\u003c/em\u003e, we monitored GFP-labeled cells using an IVIS. No fluorescence was detected in the blank group. In the control group, only a minimal fluorescence signal was observed in the lungs, whereas the LPS-induced ALI group exhibited a dense accumulation of hUC-MSCs, characterized by an intense fluorescence signal. These results indicate that hUC-MSCs preferentially migrate to injured lung regions, a key step in their targeted therapeutic action (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFurther comparison revealed that while normoxic hUC-MSCs successfully reached the damaged lungs, hypoxic preconditioning significantly amplified this effect. Specifically, mice receiving either CoCl2-pretreated or hypoxic incubator-pretreated hUC-MSCs showed substantially stronger pulmonary fluorescence signals than those receiving normoxic cells. These findings collectively substantiate that hypoxic preconditioning enhances the directional migration and pulmonary recruitment of hUC-MSCs, potentially improving their regenerative efficacy in the treatment of ALI (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eHistological Distribution and Temporal Survival of hUC-MSCs\u003c/h2\u003e \u003cp\u003eImmunofluorescence analysis of lung tissues was performed to validate the recruitment of hUC-MSCs at the microscopic level. Consistent with the IVIS findings, a significantly higher density of GFP-positive cells was observed in the lungs of the hypoxic-preconditioned groups (both chemical and physical) compared to the normoxic and control groups. These cells were predominantly localized within the alveolar spaces and interstitial tissues of the damaged lungs.\u003c/p\u003e \u003cp\u003eTemporal biodistribution analysis revealed that hUC-MSCs initially distributed to multiple systemic organs, including the liver, spleen, kidneys, and heart within 2 h of injection. The total pulmonary cell count and fluorescence intensity reached a peak at 24 h before gradually declining. Notably, hypoxic preconditioning significantly improved the long-term persistence of the cells; by Day 7, obvious green fluorescence was still discernible in the hypoxic-preconditioned groups, whereas signals in the normoxic group had largely dissipated. These results collectively demonstrate that hypoxic preconditioning bolsters the homing efficiency, survival, and retention time of hUC-MSCs in the context of ALI (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA\u0026ndash;B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe pathogenesis of acute lung injury (ALI) is multifaceted, involving a complex cascade of pathological events such as the excessive secretion of pro-inflammatory cytokines, activation of the NLRP3 inflammasome, extensive cell apoptosis, and the catastrophic disruption of the pulmonary endothelial-epithelial barrier. These mechanisms synergistically exacerbate lung tissue damage, frequently progressing to acute respiratory distress syndrome (ARDS), which remains associated with high clinical mortality rates (Chacko et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Given the constraints of current therapeutic interventions, the exploration of novel regenerative strategies is imperative. Human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) have emerged as a prominent research focus in ALI therapy due to their superior biological properties, including abundant accessibility, multi-lineage differentiation potential, and low immunogenicity (Lee et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, the precise mechanisms through which hypoxic preconditioning bolsters the therapeutic efficacy of hUC-MSCs in ALI require further elucidation. In the present study, we systematically investigated the effects of hypoxia on hUC-MSCs across multiple dimensions, including cellular morphology, viability, hypoxic marker expression, paracrine profiling, anti-apoptotic signaling, and multi-lineage differentiation potential. These findings provide a robust cytological basis and highlight the enhanced therapeutic potential of hypoxia-preconditioned hUC-MSCs for the repair of lung injury.\u003c/p\u003e \u003cp\u003eIn this study, we established a chemical hypoxia model in hUC-MSCs using CoCl2, confirmed by the significant upregulation of HIF-1α at both the protein and gene levels. CoCl\u003csub\u003e2\u003c/sub\u003e is a well-established hypoxia-mimetic agent that stabilizes HIF-1α, thereby initiating a broad adaptive response (Mu\u0026ntilde;oz-S\u0026aacute;nchez and Ch\u0026aacute;nez‐C\u0026aacute;rdenas, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Our findings demonstrate that hypoxic stimulation significantly bolsters the hUC-MSC secretome, specifically increasing the levels of VEGF, NGF, KGF, and HGF. Interestingly, the secretion of VEGF, NGF, and KGF followed a bell-shaped distribution, peaking at moderate CoCl\u003csub\u003e2\u003c/sub\u003e concentrations before declining at 200 \u0026micro;mol/L, which likely reflects a transition from adaptive signaling to dose-dependent cytotoxicity. Crucially, hypoxic preconditioning activated the pro-survival PI3K/AKT signaling pathway in hUC-MSCs. The observed increase in the expression of PI3K, AKT, and phosphorylated AKT (p-AKT), coupled with the upregulation of the anti-apoptotic protein Bcl-2 and the concomitant inhibition of cleaved-caspase-3, suggests that hypoxia shifts the cellular rheostat toward survival and away from programmed cell death. This molecular reconfiguration effectively bolstered the proliferative capacity of hUC-MSCs while suppressing apoptosis. Furthermore, the enhanced osteogenic and adipogenic differentiation potential observed following CoCl₂ treatment indicates that hypoxic priming preserves, and potentially augments, hUC-MSC stemness. The upregulation of lineage-specific markers confirms that chemical hypoxia promotes the functional maturation and improves the multi-lineage differentiation capacity of these mesenchymal stem cells, which is vital for their regenerative efficacy upon transplantation into damaged lung tissues (Zhang et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The significant upregulation of lineage-specific transcription factors\u0026mdash;RUNX2 and Osterix for osteogenesis, and PPARγ and C/EBPα for adipogenesis\u0026mdash;substantiates that CoCl₂ preconditioning effectively augments the multi-lineage differentiation potential of hUC-MSCs. These findings align with recent evidence suggesting that hypoxia-mimetic agents can maintain or even enhance the stemness and plasticity of mesenchymal stem cells (Andrietti et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Karadeniz et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Kim et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zhu et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). It is noteworthy, however, that the optimal CoCl₂ concentrations for enhancing paracrine secretion, anti-apoptotic signaling, and multi-lineage differentiation were not strictly uniform. Nevertheless, 100 \u0026micro;mol/L CoCl₂ for 24 h emerged as the most effective parameter for comprehensive cellular \"priming,\" balancing functional enhancement with minimal cytotoxicity. Consistent with the effects of chemical hypoxia, physical hypoxia (3% O₂ for 48 h) also significantly bolstered the therapeutic profile of hUC-MSCs. Taken together, these results underscore that both chemical and physical hypoxic preconditioning serve as potent strategies to enhance the functional robustness of hUC-MSCs, highlighting the pivotal role of hypoxic priming in optimizing stem cell performance prior to therapeutic application.\u003c/p\u003e \u003cp\u003eVEGF is a pivotal cytokine that stimulates the proliferation of vascular endothelial cells and comprises four primary isoforms: VEGF-A, -B, -C, and -D (K\u0026uuml;nnapuu et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). It plays an essential role in promoting the angiogenesis of vascular endothelial cells, maintaining endothelial differentiation, and modulating the permeability of microvessels. However, the functional specializations of these isoforms vary significantly (Lee et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Sidharta et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Previous studies have established that MSCs bolster the expression of epithelial tight junction-associated genes through a VEGF-dependent mechanism (Yang et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Yang et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Further evidence by Tunstead et al. demonstrated that MSCs activated by serum from patients with hyperinflammatory ARDS exhibit superior therapeutic potential in ALI models. These activated MSCs not only suppress the release of pro-inflammatory cytokines (e.g., IL-6, TNF-α) but also significantly reinforce lung epithelial barrier function, mitigate pulmonary permeability, and improve overall outcomes through VEGF-dependent signaling (Tunstead et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). HGF is a pleiotropic growth factor, that mainly acts on epithelial and endothelial cells, playing an important regulatory role in cell division, proliferation, differentiation, survival, immunomodulation, and tissue remodeling (He et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In terms of cytoprotection, HGF protects epithelial and endothelial cells and attenuates lung injury primarily by activating the HGF/c-Met-mediated PI3K/Akt signaling pathway (Bi et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Ito et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The anti-inflammatory properties of HGF have been validated in various models: HGF gene overexpression significantly reduced TNF-α and IL-6 levels in bleomycin-induced lung injury (Watanabe et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), while HGF treatment effectively alleviated inflammatory responses in allergic airway models (Ito et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Additionally, VEGF and HGF exhibit synergistic effects in maintaining endothelial barrier function (Fan et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2025\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNGF is a foundational member of the neurotrophin family, primarily recognized for its pivotal role in nerve injury repair (Rocco et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zha et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). As research has progressed, its biological repertoire has been found to encompass the regulation of MSCs. Multiple studies indicate that NGF exerts significant modulatory effects on MSCs. For instance, treatment with 100 ng/mL NGF has been shown to maximize the neurogenic differentiation potential of hUC-MSCs (Jahan et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Mechanistically, NGF binds to its high-affinity receptor, TrkA, expressed on the plasma membrane. Following ligand binding, the NGF/TrkA complex is internalized to trigger the recruitment of key pro-differentiation and pro-survival signaling molecules. These intracellular cascades predominantly involve the PI3K/Akt and Ras/MAPK signaling axes (Zha et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), which collectively promote neuronal survival and lineage commitment. Similarly, in bone marrow-derived MSCs (BMSCs), NGF supplementation effectively bolsters cell viability and attenuates diketone-induced apoptosis in vitro. These findings suggest that NGF can enhance the regenerative efficacy of MSCs post-transplantation by bolstering their resistance to pro-apoptotic stimuli in the injured microenvironment (Bai et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Furthermore, evidence suggests that NGF promotes the proliferation of bone marrow-derived MSCs (BMSCs) by activating the PI3K/Akt signaling pathway, thereby stimulating Akt phosphorylation and cellular expansion (Gharibi et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Notably, these pro-proliferative effects can be abolished by specific PI3K inhibitors. Regarding the regulation of apoptosis, Bad\u0026mdash;a downstream effector of Akt\u0026mdash;is modulated by Akt-mediated phosphorylation. The dephosphorylated (active) form of Bad facilitates the activation of Caspase-3, the terminal executioner of the apoptotic cascade (Kamada et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Previous experiments have demonstrated that NGF treatment significantly attenuates the apoptotic rate and Caspase-3 activity in BMSCs, a cytoprotective effect that is completely abrogated by Akt inhibitors (Kim et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Collectively, these data imply that the anti-apoptotic influence of NGF on MSCs is mediated primarily through the Akt/Bad signaling axis (Wang et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Consistently, the present study observed a reduction in Caspase-3 activity and a marked upregulation of Bcl-2 expression under hypoxic preconditioning (both chemical and physical), indicating a robust enhancement of the anti-apoptotic capacity in hUC-MSCs. Nevertheless, whether the hypoxia-induced upregulation of NGF directly orchestrates this anti-apoptotic response in hUC-MSCs via the Akt/Bad signaling axis remains a compelling subject for future investigation.\u003c/p\u003e \u003cp\u003eKGF is a soluble basic protein, also designated as FGF-7, is a heparin-binding protein. Secreted primarily by cells of mesenchymal origin, KGF selectively stimulates the proliferation, differentiation, and migration of epithelial cells, playing a pivotal role in the alveolar epithelial repair following injury (Shyamsundar et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Yu et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Alveolar type II (AT2) cells are essential for pulmonary surfactant production and alveolar regeneration, serving as a critical determinant of survival in ALI/ARDS patients (Fan et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Research has demonstrated that MSC-derived KGF modulates the expression of the epithelial sodium channel (ENaC)\u0026mdash;the rate-limiting factor in alveolar fluid clearance\u0026mdash;via the Gab1/ERK/NF-κB signaling axis, thereby alleviating LPS-induced ALI (Xin et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In our study, CoCl₂ treatment significantly elevated KGF levels in the hUC-MSC supernatant, suggesting that chemical hypoxia enhances the secretome\u0026rsquo;s capacity to support alveolar epithelial restoration (Yang et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Collectively, these findings indicate that the coordinated upregulation of VEGF, NGF, KGF, and HGF following hypoxic preconditioning is intrinsically linked to the enhanced cytoprotective effects of hUC-MSCs. This multifaceted paracrine response likely mitigates lung injury by attenuating inflammation and bolstering anti-apoptotic resilience, offering a promising therapeutic strategy for the management of ALI/ARDS.\u003c/p\u003e \u003cp\u003eFinally, this study investigated the biological mechanisms underlying two hypoxic preconditioning methods (CoCl₂ and hypoxic incubator) for hUC-MSCs through a seamless integration of in vitro cellular experiments and a mouse model of ALI. The findings revealed that both CoCl₂ and hypoxic incubators effectively induce a robust hypoxic response in hUC-MSCs. The optimal parameters for CoCl₂ treatment were identified as 100 \u0026micro;mol/L for 24 h, whereas 3% O₂ for 48 h was ideal for the hypoxic incubator. After hypoxic preconditioning, hUC-MSCs demonstrated significantly enhanced anti-apoptotic resilience and augmented multi-lineage differentiation potential, as well as improved migration and targeted homing to lung injury sites, ultimately resulting in markedly extended \u003cem\u003ein vivo\u003c/em\u003e persistence. Recent evidence has shown that enhancing the expression of homing-related factors (e.g., SDF-1, ICAM-1, CXCL5, and IGF-1) through external stimuli like pulsed-focused ultrasound (pFUS) significantly improves hUC-MSC recruitment and survival, thereby optimizing ARDS outcomes (Wang et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Building upon these findings, we hypothesize that the enhanced directional homing and sustained survival of hypoxia-preconditioned hUC-MSCs \u003cem\u003ein vivo\u003c/em\u003e serve as fundamental prerequisites and functional safeguards for their superior therapeutic efficacy in lung repair.\u003c/p\u003e \u003cp\u003eIn summary, CoCl₂-mediated chemical hypoxia demonstrated comparable, or in certain parameters superior, stimulatory effects compared to physical hypoxia, while offering the practical advantages of shorter processing intervals and greater procedural simplicity. These results highlight its potential as a robust and efficient alternative for establishing hUC-MSC hypoxic preconditioning protocols. Future research should be directed toward further elucidating the molecular underpinnings of CoCl₂-preconditioned hUC-MSCs in LPS-induced ALI models and identifying the specific downstream signaling pathways involved. Such investigations will provide essential theoretical foundations and experimental evidence to refine and advance hypoxia-preconditioned MSC-based strategies for the clinical management of acute lung injury.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by the science and technology incubation program (2023YJY-09) and the science and technology talent support program (2023JY-19 and 2023JY-45) of Shaanxi Provincial People\u0026apos;s Hospital.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Disclosure Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declared no potential conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLin Shen and Yujuan Wang: Conceptualization, Writing - original draft. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availablity Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAndrietti ALP, Durgam SS, Naumann B, Stewart M. Basal and inducible Osterix expression reflect equine mesenchymal progenitor cell osteogenic capacity. Front Veterinary Sci. 2023;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fvets.2023.1125893\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2023.1125893\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai Q, Zou M, Zhang J, Tian Y, Wu F, Gao B, Piao F. NGF mediates protection of mesenchymal stem cells-conditioned medium against 2,5-hexanedione-induced apoptosis of VSC4.1 cells via Akt/Bad pathway. Mol Cell Biochem. 2020;469:53\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11010-020-03727-5\u003c/span\u003e\u003cspan address=\"10.1007/s11010-020-03727-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakowitz M, Bruns B, McCunn M. Acute lung injury and the acute respiratory distress syndrome in the injured patient. Scand J Trauma Resusc Emerg Med. 2012;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1757-7241-20-54\u003c/span\u003e\u003cspan address=\"10.1186/1757-7241-20-54\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBi J, Li Y, Lu L, Yin T, Mao S, Zhang R, He J, Ni X, Wang K, Bi J. Luteolin attenuates inflammation and apoptosis in LPS-induced ALI mice by activating the HGF/c-Met pathway. Front Pharmacol. 2025;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2025.1641486\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2025.1641486\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChacko B, Peter JV, Tharyan P, John G, Jeyaseelan L. 2015. Pressure-controlled versus volume-controlled ventilation for acute respiratory failure due to acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Cochrane Database of Systematic Reviews. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/14651858.CD008807.pub2\u003c/span\u003e\u003cspan address=\"10.1002/14651858.CD008807.pub2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChiara Giacomini FD. 2025. MSC Manufacture. Advances in Experimental Medicine and Biology 1486, 217\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/DOI: 10.1007/978-3-031-97297-3_17\u003c/span\u003e\u003cspan address=\"DOI: 10.1007/978-3-031-97297-3_17\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing D-C, Chang Y-H, Shyu W-C, Lin S-Z. Human Umbilical Cord Mesenchymal Stem Cells: A New Era for Stem Cell Therapy. Cell Transplant. 2015;24:339\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3727/096368915x686841\u003c/span\u003e\u003cspan address=\"10.3727/096368915x686841\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan Y, Moser J, Jongman RM, Borghuis T, Vonk JM, Timens W, van Meurs M, Pillay J, Burgess JK. Compositional changes of the lung extracellular matrix in acute respiratory distress syndrome. Am J Physiology-Cell Physiol. 2025;328:C1279\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpcell.01007.2024\u003c/span\u003e\u003cspan address=\"10.1152/ajpcell.01007.2024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu X, Liu G, Halim A, Ju Y, Luo Q, Song G. 2019. Mesenchymal Stem Cell Migration and Tissue Repair. Cells 8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells8080784\u003c/span\u003e\u003cspan address=\"10.3390/cells8080784\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFukatsu M, Ohkawara H, Wang X, Alkebsi L, Furukawa M, Mori H, Fukami M, Fukami S-i, Sano T, Takahashi H, Harada-Shirado K, Kimura S, Sugimoto K, Ogawa K, Ikezoe T. The suppressive effects of Mer inhibition on inflammatory responses in the pathogenesis of LPS-induced ALI/ARDS. Sci Signal. 2022;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/scisignal.abd2533\u003c/span\u003e\u003cspan address=\"10.1126/scisignal.abd2533\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGharibi B, Ghuman MS, Hughes FJ. Akt- and Erk‐mediated regulation of proliferation and differentiation during PDGFRβ‐induced MSC self‐renewal. J Cell Mol Med. 2012;16:2789\u0026ndash;801. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1582-4934.2012.01602.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1582-4934.2012.01602.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan KH, Kim AK, Kim MH, Kim DH, Go HN, Kim DI. Enhancement of angiogenic effects by hypoxia-preconditioned human umbilical cord‐derived mesenchymal stem cells in a mouse model of hindlimb ischemia. Cell Biol Int. 2015;40:27\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/cbin.10519\u003c/span\u003e\u003cspan address=\"10.1002/cbin.10519\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHao C, You J, Qiu H, Zhou O, Liu J, Zou W, Yang K, Fu Z, Zou L. Hypoxic preconditioning improves the survival and pro-angiogenic capacity of transplanted human umbilical cord mesenchymal stem cells via HIF-1α signaling in a rat model of bronchopulmonary dysplasia. Biochem Biophys Res Commun. 2022;605:111\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2022.03.044\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2022.03.044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Guo X, Lan T, Xia J, Wang J, Li B, Peng C, Chen Y, Hu X, Meng Z. Human umbilical cord-derived mesenchymal stem cells improve the function of liver in rats with acute-on-chronic liver failure via downregulating Notch and Stat1/Stat3 signaling. Stem Cell Res Ther. 2021;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-021-02468-6\u003c/span\u003e\u003cspan address=\"10.1186/s13287-021-02468-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Q-M, Zhuo Y-Q, Duan Z-X, Long Y-l, Wang J-N, Zhang Z-h, Fan S-Y, Huang Y-M, Deng K-Y, Xin H-B. Long-term hypoxic atmosphere enhances the stemness, immunoregulatory functions, and therapeutic application of human umbilical cord mesenchymal stem cells. Bone Joint Res. 2024;13:763\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1302/2046-3758.1312.Bjr-2024-0136.R2\u003c/span\u003e\u003cspan address=\"10.1302/2046-3758.1312.Bjr-2024-0136.R2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Z, Liu H, Zhang X, Wen G, Zhu C, Zhao Y, Niu W, Qin Y, Chen H, Bai C, Liu G. Transcriptomic analysis of lung tissues after hUC-MSCs and FTY720 treatment of lipopolysaccharide-induced acute lung injury in mouse models. Int Immunopharmacol. 2018;63:26\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.intimp.2018.06.036\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2018.06.036\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIto W, Kanehiro A, Matsumoto K, Hirano A, Ono K, Maruyama H, Kataoka M, Nakamura T, Gelfand EW, Tanimoto M. Hepatocyte Growth Factor Attenuates Airway Hyperresponsiveness, Inflammation, and Remodeling. Am J Respir Cell Mol Biol. 2005;32:268\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1165/rcmb.2004-0058OC\u003c/span\u003e\u003cspan address=\"10.1165/rcmb.2004-0058OC\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIto Y, Correll K, Schiel JA, Finigan JH, Prekeris R, Mason RJ. Lung fibroblasts accelerate wound closure in human alveolar epithelial cells through hepatocyte growth factor/c-Met signaling. Am J Physiology-Lung Cell Mol Physiol. 2014;307:L94\u0026ndash;105. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajplung.00233.2013\u003c/span\u003e\u003cspan address=\"10.1152/ajplung.00233.2013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJahan S, Kumar D, Kumar A, Rajpurohit CS, Singh S, Srivastava A, Pandey A, Pant AB. Neurotrophic factor mediated neuronal differentiation of human cord blood mesenchymal stem cells and their applicability to assess the developmental neurotoxicity. Biochem Biophys Res Commun. 2017;482:961\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2016.11.140\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2016.11.140\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamada H, Nito C, Endo H, Chan PH. Bad as a Converging Signaling Molecule between Survival PI3-K/Akt and Death JNK in Neurons after Transient Focal Cerebral Ischemia in Rats. J Cereb Blood Flow Metabolism. 2007;27:521\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.jcbfm.9600367\u003c/span\u003e\u003cspan address=\"10.1038/sj.jcbfm.9600367\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaradeniz F, Oh JH, Jo HJ, Yang J, Lee H, Seo Y, Kong C-S. Dracunculin Inhibits Adipogenesis in Human Bone Marrow-Derived Mesenchymal Stromal Cells by Activating AMPK and Wnt/β-Catenin Signaling. Int J Mol Sci. 2022;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms23020653\u003c/span\u003e\u003cspan address=\"10.3390/ijms23020653\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim H-Y, Jang H-J, Muthamil S, Shin UC, Lyu J-H, Kim S-W, Go Y, Park S-H, Lee HG, Park JH. Novel insights into regulators and functional modulators of adipogenesis. Biomed Pharmacother. 2024;177. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2024.117073\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2024.117073\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim H, Choi H, Lee SK, Longnecker RM. Epstein-Barr Virus MicroRNA miR-BART20-5p Suppresses Lytic Induction by Inhibiting BAD -Mediated caspase-3-Dependent Apoptosis. J Virol. 2016;90:1359\u0026ndash;68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/jvi.02794-15\u003c/span\u003e\u003cspan address=\"10.1128/jvi.02794-15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026uuml;nnapuu J, Bokharaie H, Jeltsch M. 2021. Proteolytic Cleavages in the VEGF Family: Generating Diversity among Angiogenic VEGFs, Essential for the Activation of Lymphangiogenic VEGFs. Biology 10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biology10020167\u003c/span\u003e\u003cspan address=\"10.3390/biology10020167\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee C, Kim M-J, Kumar A, Lee H-W, Yang Y, Kim Y. Vascular endothelial growth factor signaling in health and disease: from molecular mechanisms to therapeutic perspectives. Signal Transduct Target Therapy. 2025;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41392-025-02249-0\u003c/span\u003e\u003cspan address=\"10.1038/s41392-025-02249-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee JH, Park J, Lee JW. Therapeutic use of mesenchymal stem cell\u0026ndash;derived extracellular vesicles in acute lung injury. Transfusion. 2018;59:876\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/trf.14838\u003c/span\u003e\u003cspan address=\"10.1111/trf.14838\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi R, Zhang H, Zhang J, Ji Y, Liu W, Liu W, Wang M, Lv C, Song X, Li H, Li M. hucMSCs Treatment Ameliorated Pulmonary Fibrosis via Downregulating the circFOXP1-HuR-EZH2/STAT1/FOXK1 Autophagic Axis. Stem Cells. 2023;41:928\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/stmcls/sxad053\u003c/span\u003e\u003cspan address=\"10.1093/stmcls/sxad053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Shi X, Yang L, Mou Y, Li Y, Dang R, Li C. 2017. Hypoxia promotes the skewed differentiation of umbilical cord mesenchymal stem cells toward type II alveolar epithelial cells by regulating microRNA-145. Gene 630, 68\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.gene.2017.08.006\u003c/span\u003e\u003cspan address=\"10.1016/j.gene.2017.08.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Zhang JY, Tian Y-M, Guo H, Zhang Y. Beneficial Effects of Hypoxic Preconditioning on Human Umbilical Cord Mesenchymal Stem Cells. Chin J Physiol. 2015;58:343\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/DOI:10.4077/CJP.2015.BAE36910.4077/CJP.2015.BAE369\u003c/span\u003e\u003cspan address=\"DOI:10.4077/CJP.2015.BAE36910.4077/CJP.2015.BAE369\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Dong J, Xu C, Ni Y, Ye Z, Sun Z, Fan H, Chen Y. Acute lung injury: pathogenesis and treatment. J Translational Med. 2025;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12967-025-06994-2\u003c/span\u003e\u003cspan address=\"10.1186/s12967-025-06994-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMu\u0026ntilde;oz-S\u0026aacute;nchez J, Ch\u0026aacute;nez‐C\u0026aacute;rdenas ME. The use of cobalt chloride as a chemical hypoxia model. J Appl Toxicol. 2018;39:556\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jat.3749\u003c/span\u003e\u003cspan address=\"10.1002/jat.3749\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeter JV, John P, Graham PL, Moran JL, George IA, Bersten A. Corticosteroids in the prevention and treatment of acute respiratory distress syndrome (ARDS) in adults: meta-analysis. BMJ. 2008;336:1006\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1136/bmj.39537.939039.BE\u003c/span\u003e\u003cspan address=\"10.1136/bmj.39537.939039.BE\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRocco ML, Soligo M, Manni L, Aloe L. Nerve Growth Factor: Early Studies and Recent Clinical Trials. Curr Neuropharmacol. 2018;16:1455\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/1570159x16666180412092859\u003c/span\u003e\u003cspan address=\"10.2174/1570159x16666180412092859\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosov\u0026aacute; I, Dao M, Capoccia B, Link D, Nolta JA. Hypoxic Preconditioning Results in Increased Motility and Improved Therapeutic Potential of Human Mesenchymal Stem Cells. Stem Cells. 2008;26:2173\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1634/stemcells.2007-1104\u003c/span\u003e\u003cspan address=\"10.1634/stemcells.2007-1104\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShyamsundar M, McAuley DF, Ingram RJ, Gibson DS, O\u0026rsquo;Kane D, McKeown ST, Edwards A, Taggart C, Elborn JS, Calfee CS, Matthay MA, O\u0026rsquo;Kane CM. Keratinocyte Growth Factor Promotes Epithelial Survival and Resolution in a Human Model of Lung Injury. Am J Respir Crit Care Med. 2014;189:1520\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1164/rccm.201310-1892OC\u003c/span\u003e\u003cspan address=\"10.1164/rccm.201310-1892OC\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSidharta VM, Herningtyas EH, Lagonda CA, Fauza D, Kusnadi Y, Susilowati R, Partadiredja G. High VEGF Level is Produced by Human Umbilical Cord- Mesenchymal Stem Cells (hUC-MSCs) in Amino Acid-Rich Medium and under Hypoxia Condition. Indonesian Biomedical J. 2018;10:222\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18585/inabj.v10i3.457\u003c/span\u003e\u003cspan address=\"10.18585/inabj.v10i3.457\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTu C, Wang Z, Xiang E, Zhang Q, Zhang Y, Wu P, Li C, Wu D. 2022. Human Umbilical Cord Mesenchymal Stem Cells Promote Macrophage.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePD-L1 Expression and Attenuate Acute Lung Injury in Mice. Curr Stem Cell Res Therapy 17, 564\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/1574888x17666220127110332\u003c/span\u003e\u003cspan address=\"10.2174/1574888x17666220127110332\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTunstead C, Volkova E, Dunbar H, Hawthorne IJ, Bell A, Crowe L, Masterson JC, Dos Santos CC, McNicholas B, Laffey JG, English K. The ARDS microenvironment enhances MSC-induced repair via VEGF in experimental acute lung inflammation. Mol Ther. 2024;32:3422\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ymthe.2024.08.003\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2024.08.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerma N, Hochhegger B, Mukhopadhyay S, Teixeira e Silva Torres PP, Mohammed T-L. Acute Lung Injury. J Thorac Imaging. 2025;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/rti.0000000000000820\u003c/span\u003e\u003cspan address=\"10.1097/rti.0000000000000820\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang B-Y, Zhang X, Li T-T, Qin W-W, Liu X, Lu K-M, Sun L-X, Han W. Ultrasound assisted homing of human umbilical cord mesenchymal stem cells promotes recovery from acute respiratory distress syndrome. Stem Cell Res Ther. 2025;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-025-04545-6\u003c/span\u003e\u003cspan address=\"10.1186/s13287-025-04545-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Chen R, Zhang C, Inam u l, Piao F, Shi X. NGF protects bone marrow mesenchymal stem cells against 2,5-hexanedione-induced apoptosis in vitro via Akt/Bad signal pathway. Mol Cell Biochem. 2019;457:133\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11010-019-03518-7\u003c/span\u003e\u003cspan address=\"10.1007/s11010-019-03518-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Li H, Li X, Su X, Xiao H, Yang J. Hypoxic Preconditioning of Human Umbilical Cord Mesenchymal Stem Cells Is an Effective Strategy for Treating Acute Lung Injury. Stem Cells Dev. 2021;30:128\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/scd.2020.0174\u003c/span\u003e\u003cspan address=\"10.1089/scd.2020.0174\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWard JPT. 2008. Oxygen sensors in context. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1777, 1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbabio.2007.10.010\u003c/span\u003e\u003cspan address=\"10.1016/j.bbabio.2007.10.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatanabe M, Ebina M, Orson FM, Nakamura A, Kubota K, Koinuma D, Akiyama K-i, Maemondo M, Okouchi S, Tahara M, Matsumoto K, Nakamura T, Nukiwa T. Hepatocyte Growth Factor Gene Transfer to Alveolar Septa for Effective Suppression of Lung Fibrosis. Mol Ther. 2005;12:58\u0026ndash;67. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ymthe.2005.02.019\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2005.02.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXin S, Ding Y, Yu T, Fu Y, Cui Y, Nie H. Mesenchymal stem cell-secreted KGF ameliorates acute lung injury via the Gab1/ERK/NF-κB signaling axis. Cell Mol Biol Lett. 2025;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s11658-025-00757-z\u003c/span\u003e\u003cspan address=\"10.1186/s11658-025-00757-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang J-n, Jiang Y-y, Yuan C, Liu Z-g, Liu X-c. Paracrine abilities of adipose-derived mesenchymal stem cells and umbilical cord mesenchymal stem cells under different oxygen concentrations. J Clin Rehabilitative Tissue Eng Res. 2018;22:3322\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/DOI:10.3969/j.issn.2095-4344.0880\u003c/span\u003e\u003cspan address=\"DOI:10.3969/j.issn.2095-4344.0880\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Chen Q-h, Liu A-r, Xu X-p, Han J-b, Qiu H-b. Synergism of MSC-secreted HGF and VEGF in stabilising endothelial barrier function upon lipopolysaccharide stimulation via the Rac1 pathway. Stem Cell Res Ther. 2015;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-015-0257-0\u003c/span\u003e\u003cspan address=\"10.1186/s13287-015-0257-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Hu S, Xu X, Li J, Liu A, Han J, Liu S, Liu L, Qiu H. 2016. The Vascular Endothelial Growth Factors-Expressing Character of Mesenchymal Stem Cells Plays a Positive Role in Treatment of Acute Lung InjuryIn Vivo. Mediators of Inflammation 2016, 1\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2016/2347938\u003c/span\u003e\u003cspan address=\"10.1155/2016/2347938\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYou J, Zhou O, Liu J, Zou W, Zhang L, Tian D, Dai J, Luo Z, Liu E, Fu Z, Zou L. Human Umbilical Cord Mesenchymal Stem Cell-Derived Small Extracellular Vesicles Alleviate Lung Injury in Rat Model of Bronchopulmonary Dysplasia by Affecting Cell Survival and Angiogenesis. Stem Cells Dev. 2020;29:1520\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/scd.2020.0156\u003c/span\u003e\u003cspan address=\"10.1089/scd.2020.0156\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu T, Cui Y, Xin S, Fu Y, Ding Y, Hao L, Nie H. Mesenchymal stem cell conditioned medium alleviates acute lung injury through KGF-mediated regulation of epithelial sodium channels. Biomed Pharmacother. 2023;169. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2023.115896\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2023.115896\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZha K, Yang Y, Tian G, Sun Z, Yang Z, Li X, Sui X, Liu S, Zhao J, Guo Q. Nerve growth factor (NGF) and NGF receptors in mesenchymal stem/stromal cells: Impact on potential therapies. Stem Cells Translational Med. 2021;10:1008\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/sctm.20-0290\u003c/span\u003e\u003cspan address=\"10.1002/sctm.20-0290\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M, Shi X, Wu J, Wang Y, Lin J, Zhao Y, Li H, Ren M, Hu R, Liu F, Deng H. CoCl2 induced hypoxia enhances osteogenesis of rat bone marrow mesenchymal stem cells through cannabinoid receptor 2. Arch Oral Biol. 2019;108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.archoralbio.2019.104525\u003c/span\u003e\u003cspan address=\"10.1016/j.archoralbio.2019.104525\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu S, Chen W, Masson A, Li Y-P. 2024. Cell signaling and transcriptional regulation of osteoblast lineage commitment, differentiation, bone formation, and homeostasis. Cell Discovery 10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41421-024-00689-6\u003c/span\u003e\u003cspan address=\"10.1038/s41421-024-00689-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":false,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Acute lung injury, Hypoxic preconditioning, Human umbilical cord-derived mesenchymal stem cells, Paracrine function, Cell homing","lastPublishedDoi":"10.21203/rs.3.rs-9650125/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9650125/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eIntroduction\u003c/strong\u003e Acute Lung Injury (ALI) is characterized by extensive pulmonary inflammation resulting from various endogenous and exogenous factors, often progressing rapidly to Acute Respiratory Distress Syndrome (ARDS). Human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) have emerged as a promising therapeutic strategy for ALI. Prior studies have shown that hUC-MSCs effectively attenuate ALI in mice, and hypoxic preconditioning further augments these therapeutic effects. However, the specific mechanisms underlying the enhanced efficacy of hypoxic preconditioned hUC-MSCs remain to be elucidated.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e To investigate the impact of hypoxic preconditioning, we employed two hypoxic induction methods: chemical induction via Cobalt chloride (CoCl\u003csub\u003e2\u003c/sub\u003e) and physical hypoxia using a tri-gas incubator. We comprehensively evaluated cell morphology, viability, hypoxic marker expression, paracrine function, anti-apoptotic capacity, and multilineage differentiation potential. Furthermore, we tracked the targeted migration and distribution of hypoxic hUC-MSCs \u003cem\u003ein vivo\u003c/em\u003e using whole-body imaging and immunofluorescence.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e Both CoCl₂ stimulation and physical hypoxia effectively improve the biological functions of hUC-MSCs. Hypoxic preconditioning enhances the anti-apoptotic, paracrine, and multilineage differentiation capacities of hUC-MSCs, and strengthens their homing to damaged lung tissues and in vivo retention in ALI models.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e Chemical and physical hypoxic preconditioning are valid strategies to optimize hUC-MSCs functions. This study provides a solid cytological foundation for the improved therapeutic efficacy of preconditioned hUC-MSCs in ALI treatment.\u003c/p\u003e","manuscriptTitle":"Cytological basis of hypoxic preconditioned hUC-MSCs enhance the effect of treating ALI","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-11 10:58:34","doi":"10.21203/rs.3.rs-9650125/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"66b9e1a0-383d-420b-8df4-7b697b52bc11","owner":[],"postedDate":"May 11th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Rejected","date":"2026-05-18T10:47:23+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-05-14T09:49:02+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-05-14T09:48:42+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Pulmonary Medicine","date":"2026-05-08T07:01:39+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-05-18T10:55:43+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-11 10:58:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9650125","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9650125","identity":"rs-9650125","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.