Determination of the Expression Levels of Hym, AmNrx1, and CYP9Q3 Genes in the Anatolian Honey Bee (Apis mellifera anatoliaca) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Case Report Determination of the Expression Levels of Hym, AmNrx1, and CYP9Q3 Genes in the Anatolian Honey Bee (Apis mellifera anatoliaca) Dilek Kabakcı, Ümit Karataş, Rahşan Ivgin Tunca, Murat Çankaya, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3884178/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The Varroa destructor poses a significant threat to honey bees, leading to substantial yield losses and colony declines. Defence behaviour (such as grooming behavior: auto and allogrooming) in honey bees serves as a crucial mechanism against Varroa infestations, but the many genes responsible for this behavior remain unidentified. This study focuses on the expression levels of hymenoptaecin (Hym), neurexin-1 (AmNrx1) , and CYP9Q3 which could be associated with defence behavior, in Muğla honey bee ecotype ( Apis mellifera anatoliaca ) colonies subjected to a against Varroa selection program. Using the qPCR method, researchers analyzed worker bees from 23 control groups and 23 colonies under the selection program. The results revealed a remarkable increase in the expression levels of Hym, AmNrx1 , and CYP9Q3 genes in the selected group, with respective fold changes of 2.9, 2.95, and 3.26 compared to the control group (p < 0.01). This finding suggests that selection against Varroa infestations induces alterations in gene expression linked to behaviour related to exposure of Varroa in honey bees. These outcomes propose the potential use of Hym, AmNrx1 , and CYP9Q3 genes in preselection for future Varroa-resistant programs in honey bees. The genes used in the study that may be related to this behavior are supported by other studies in the future, they may help create an initial population with advanced defence behaviours (such as autogrooming and allogrooming). Honey bee Breeding Grooming behavior Hym AmNrx1 CYP9Q3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Pollination plays a vital role in sustaining ecosystems, where insects, especially bees, are crucial contributors to this essential process. Bees are essential for efficient agricultural production and the survival of numerous plant species within the ecosystem (Ollerton et al. 2011 ; Rader et al. 2014 ; Klein et al. 2007 ). Pollinator insects are responsible for pollinating 70% of agricultural plants globally (Klein et al. 2007 ; Chaplin-Kramer et al. 2014). In Turkey, honey bee breeding is extensively carried out, and the country is home to approximately 20% of the world's honey bee subspecies. Anatolia, specifically, harbors five distinct honey bee subspecies ( Apis mellifera caucasica, Apis mellifera anatoliaca, Apis mellifera meda, Apis mellifera syriaca, Apis mellifera carnica ) and their breed (Ruttner, 1988 ; Kandemir et al. 2000 ; Kence et al. 2009 ; Oskay et al. 2019 ; Yıldız and Karabağ, 2022 ). These breeds have adapted to different regions and environmental conditions, resulting in varying morphological, behavioral, and yield characteristics (Stankus 2008 ; Guzman-Novoa et al. 2010 ; Le Conte et al. 2010 ). The Anatolian honey bee ( A.m. anatoliaca ), a prevalent honey bee breed, inhabits Western and Central Anatolia. Renowned for robust reproductive capabilities, it exhibits remarkable adaptability to extreme climatic conditions and limited nectar availability in its environment. Additionally, it is reported to possess resistance against diseases. (Rutner, 1988; Tunca Ivgin, 2009). Muğla honey bee ( A. m. anatoliaca ) is one of the ecotypes commonly found in Anatolia. The ecotype of this breed was registered by the Ministry of Agriculture and Forestry by amending the Communiqué on the Registration of Domestic Animal Breeds and Lines on 02.02.2022 ( https://www.resmigazete.gov.tr/eskiler/2022/02/20220202-3.htm ). Honeybee parasites and pathogens pose a significant threat to the sustainability of honeybees on earth, contributing to substantial bee losses. Among these challenges, the ectoparasitic Varroa destructor stands out as a major problem jeopardizing the health of honey bees. (Stankus 2008 ; Guzman-Novoa et al. 2010 ; Le Conte et al. 2010 ). Even relatively mite infestations can cause serious harm to honey bees of different genotypes (De Jong 1997 ; Bowen-Walker and Gunn, 2003; Büchler et al. 2014; Reyes-Quintana et al. 2019 ). It has even been reported that even relatively low mite infestation can seriously damage bees of different genotypes (De Jong, 1997 ; Bowen-Walker and Gunn, 2003; Büchler et al. 2014; Reyes-Quintana et al., 2019 ). In instances of Varroa infestation, there is a documented reduction in the duration and lifespan of both pupa and adult honey bee individuals. Moreover, the male honey bees experience decreased sperm production, and the presence of Varroa, carrying specific honey bee virus types, ultimately results in colony losses. (Ball, 1985 ; Schneider, 1987 ; Ball, 1988 ; Glinski and Jarosz, 1992 ; Buchler 1994 ; Fries 1994 ; Wilkinson and Smith, 2002 ). In the contemporary context, discussing an apiary without addressing Varroa is nearly impossible. Despite its widespread prevalence worldwide, a fully effective and sustainable method to combat this mite has yet to be developed. (Mert et al. 2007; Ayan 2017). Developing effective and sustainable methods against Varroa has been challenging, and long-term acarisid use has led to mite resistance. Hence, creating resistant honey bee lines against this ectoparasite has become essential (Sammataro & Avitabile, 2011 ; Dietemann et al. 2012 ; Spivak & Danka, 2021 ). Two bee behavioral traits, grooming, and Varroa sensitive hygiene (VSH), play a role in limiting the development of Varroa in colonies. Grooming behavior involves cleaning the bees' bodies, collecting pollen, and removing mites (Dettner and Liepert, 1994 ; Rath 1999 ; Guzmán-Novoa, 2001; Ozaki et al. 2005 ; Rinderer et al. 2010 ; Arechavaleta Velasco and Seid and Brown, 2009 ; Zhukovskaya et al. 2013 ). Varroa sensitive hygiene (VSH), on the other hand, refers to the bees' ability to detect and remove Varroa-parazite offspring (Ibrahim and Spivak, 2006; Harbo and Harris, 2009 ). Various selection programs have been implemented to create Varroa-resistant honey bee lines, ensuring colony continuity and productivity even in the presence of the mite (Harris and Harbo, 1999 , 2005 , 2009 ; Rinderer et al. 2001 ; 2010 ; Spivak and Reuter, 2001 ; Navajas et al. 2008 ; Le Conte et al. 2007 ; 2010 ; Buchler et al. 2010 ; Genersch et al. 2010 ; Moritz et al. 2010 ;). Recent studies have focused on genes Hym and CYP9Q3 , which appear to control the immune system in honey bees and their response to Varroa infestations in terms of gene expression levels (Yang and Cox-Foster, 2005; Navajas et al. 2008 ; Dainat et al. 2012 ; Hamiduzzaman et al. 2012 ; Hamiduzzaman et al. 2017 ). Likewise, detoxification genes such as CYP9Q3 have shown altered expression levels in honey bees exposed to different chemicals and displaying hygienic behavior (Mao et al. 2011 ; Boutin et al. 2015 ). Although CYP9Q3 expression has not been specifically evaluated in response to grooming behavior against Varroa mites, studies suggest that its expression is high in bees exhibiting intense grooming against Varroa (Hamiduzzaman et al. 2017 ). Another candidate gene, AmNrx1 , has been linked to honey bee grooming behavior and self-grooming behavior (Arechavaleta-Velasco et al. 2012 ; Etherton et al. 2009 ). Hamiduzzaman et al. ( 2017 ) examined its potential effect on grooming behavior and with strong grooming behavior had higher AmNrx1 expression than bees displaying mild grooming behavior and not displaying grooming behavior Researchers have explored the potential effects of AmNrx1 on grooming behavior and its possible use as a marker for creating Varroa-resistant lines (Morfin et al. 2020 ; Yıldız and Karabağ, 2022 ). QTL mapping was conducted to identify candidate genes for grooming behavior against Varroa in honey bees, revealing 27 genes, including atlastin, ataxin-3, and neuroxin-1, with potential neurodevelopmental and behavioral impacts on chromosome 5. The neural gene neuroxin-1 ( AmNrx1 ) was found to be mainly expressed in the central nervous system and the mushroom body of the brain, important organs for higher-order processing and learning in bees (Heisenberg 1998 ; Szyska et al. 2008 ; Arechavaleta-Velasco et al. 2012 ; ). Based on all these perspectives, the expression levels of hymenoptaecin, neurexin-1 and CYP9Q3 , three genes assumed to be associated with defensive behavior in honeybees, were examined against Varroa mites in selected colonies in the study. The aim of this study is to determine whether and to what extent these genes show any changes in their expression levels in identified populations exposed to varroa. Materials and method Honey bee material The Muğla honey bee (Apis mellifera anatoliaca) ecotype, housed in the Muğla Beekeepers' Association, was used as the primary material in this study. A total of 15 worker bees were collected from each of the 23 colonies selected for control groups in which no specific study was conducted, and 23 colonies where selection studies against Varroa were carried out as part of project number TAGEM / 15 / AR-GE / 19. To assess the Varroa mite infestation levels in the selection (4th generation) and control colonies, the powdered sugar method was employed. The exposure to Varroa test and sample collection: To assess defence behavior under exposure to Varroa test at the individual level, 15 worker bees from both the selected and control groups were placed in queen cages and transferred to the artificial insemination laboratory of Muğla Beekeepers' Association. A modified version of the method described by Aumeier (2001) was used to conduct the grooming test in the laboratory. To trigger the activation of genes associated with defense behavior, a closed plastic box measuring 15x15 cm housed 15 worker bees from each colony. Varroa mites, equivalent in number to the total worker bees present, were introduced into the box. The samples were then left undisturbed for 3 minutes, allowing ample time for the activation of genes linked to defense behavior. Five samples actively attempting to remove Varroa were randomly selected. Subsequently, the worker bee samples were rendered hygienic by passing them through distilled water. Under hygienic conditions, small incisions were made on the thoraxes of the worker bees using a scalpel. The thorax samples were then collected in Eppendorf tubes, and to preserve the RNA integrity, Biological Industries RNA Save solution (Biological Industries, Israel) was added to the tubes. The tubes with the thorax samples were stored at +4 °C for 4 hours and then transferred to a long-term storage temperature of -80 °C until further analysis. Ethics Committee Aproval: As non cepholopad invertabrates honey bee not subject to animal ethic approval at Republic of Turkey ( based on the ‘ Regulation on the Welfare and protection of Animal Used for Exsperimental and Other Scientific Purpose’ published in the official Gazette dated December 13.2011 and numbered 28141). Molecular analysis Primer design: The design of primer sets was carried out using the programs Primer3Plus and Primer-BLAST, utilizing the NCBI (National Center for Biotechnology Information) database for the genes Hym, AmNrx1, and CYP9Q3, which are considered to be associated with defence behavior. The primers used for reverse transcription quantitative polymerase chain reaction (RT-qPCR) are listed in Table 1. Table 1. Primers used for RT-qPCR *Reference gene Gene name Primer sequence (5′–3′) Accession N. Band size References Hym F: TCTCTTCTGTGCCGTTGCAT R: CACCATAGGCGTCTCCTGTC NM_001011615.1 209 Newly designed AmNrx1 F: GCGATTGTGACATGACCAGC R: ATAGTCGTCGCTCGAAGCAG NM_001145740.1 209 Newly designed CYP9Q3 F: TGCACGACGTGATAGATCGG R: GAGCATGTTCCTGTGCTCCT XM_006562300.3 242 Newly designed Gapdh* F: CATGGATGGCGGTGGGAAG R: TGTCCGTTGCATCGACGTTA XM_006566197.3 232 Newly designed RNA purification : To individually purify the RNA from each sample (5 samples per coloni) stored at -80°C without allowing them to dissolve, the samples were first homogenized in a mortar with liquid nitrogen to prevent RNA degradation. The mortar and pestle were thoroughly cleaned with a laboratory detergent, DeconTM ContradTM NF Liquid Detergent (Fisher Scientific, USA), to prevent cross-contamination between samples. After homogenization, the samples were treated with 80% ethanol and Thermo UltraPureTM DEPC-Treated Water (Thermo Scientific, USA) for additional purification steps. Following pre-homogenization, each sample was weighed to approximately 100 mg, and the total RNA purification process was initiated using the Qiagen QIAshredder homogenization kit (Product code: 79656) (Qiagen, USA). The RNA was then extracted using the TRIzol method and further purified using the Qiagen RNeasy kit (Product code: 74106) (Valencia, USA). Finally, the concentration and purity of the purified RNA were determined using the Take3 module of the BioTek EPOCH microplate reader. cDNA Synthesis and RT-qPCR: To perform cDNA synthesis, all purified RNA samples were converted into complementary DNA (cDNA) using the Qiagen RT2 First Strand Kit (Product code: 3330404) (Valencia, USA). For RT-qPCR amplifications, the Qiagen Rotor-Gene Q 6Plex Real-Time PCR instrument was used with the Bio-Rad iTaq Universal SYBR method. Each qPCR reaction was set up in a 96-well plate and consisted of RNase-free water (PCR-grade), 10 μL iTaq Universal SYBR Green Supermix (2x), 0.2 μL of each gene-specific primer (forward and reverse), and 0.5 μL of cDNA template, making a final volume of 20 μL. The qPCR cycling protocol included an initial denaturation at 95 °C for 2 minutes, followed by 45 cycles of denaturation at 94 °C for 15 seconds, annealing at 57-60 °C for 30 seconds (annealing temperature may vary depending on the specific gene being amplified), and extension at 72 °C for 30 seconds. During the RT-qPCR process, the instrument monitored the fluorescence emission from the SYBR Green dye, allowing quantification of the gene-specific cDNA levels in each sample. The cycling protocol facilitated multiple rounds of DNA amplification, enabling accurate measurement of gene expression levels in the honey bee samples. Statistical analysis Gene expression levels were assessed using the 2 –ΔΔCT method as described by Livak and Schmittgen (Livak and Schmittgen, 2001). Secondary normalization was performed by comparing the expression levels of each gene with the expression levels of the gene GAPDH within the same organism. Prior to the statistical evaluation of qPCR data for the genes Hym, CYP9Q3, and AmNrx1, the Kolmogorov-Smirnov normal distribution test was conducted to determine if the data followed a normal distribution. The results indicated that the data for all three genes exhibited a normal distribution (p>0.05). To compare the expression levels of the three genes between the selected and control groups, the independent samples t-test, a parametric test, was employed (p<0.01). Graphs and figures depicting the results were generated using OriginPro 2022 demo version. Results The gene expression levels of Hym, CYP9Q3, and AmNrx1 were evaluated through statistical analysis. Following the experimental procedure, an independent samples t-test, a parametric test, was performed to compare the gene expression levels of the selected group with those of the control group (Table 2). The results of the t-test revealed a statistically significant difference in the expression levels of all three genes between the selected and control groups (p < 0. 01). Table 2 representss the gene expression measurements and frequencies of Hym, CYP9Q3, and AmNrx1 based on the study results. The data demonstrated that the expression levels of these genes were significantly higher in the selected group compared to the control group (p < 0.01). Table 2. Gene Expression Levels of the Selected and Control Groups for the Hym, CYP9Q3, and AmNrx1 Gene Regions Genes Groups N Mean ± Std. dev Hym Selected 23 2.90 ± 0.32 ** Control 23 0.59 ± 0.14 ** CYP9Q3 Selected 23 2.95 ± 0.49 ** Control 23 0.62 ± 0.29 ** AmNrx1 Selected 23 3.26 ± 0.58 ** Control 23 0.83 ± 0.29 ** ** There is a statistical difference at the p<00.1 significance level in terms of the Hym, CYP9Q3, and AmNrx1 gene expressions between the selected and control groups. The mean gene expression levels of Hym, CYP9Q3, and AmNrx1 are graphically represented, clearly illustrating that individuals in the selected group exhibited higher gene expression levels than those in the control group (Fig. 1). Specifically, the Hym gene, associated with bees' immune system, showed an increase of 2.90 ± 0.32 times in the selected group, indicating the development of grooming behavior in colonies where selection studies were conducted. Conversely, the expression level of Hym was down-regulated in the control group (0.59 ± 0.14) (Fig. 2). Regarding the AmNrx1 gene, known to control grooming behavior in insects, a significant increase was observed in the selected group compared to the control group (Fig. 3). The current study further investigated the expression level of the AmNrx1 gene in colonies that developed against to Varroa. The results showed that the mean expression level of the gene AmNrx1 in the selected group was 3.26 ± 0.58 times higher on average. This finding suggests that the increased expression level of the AmNrx1 gene in the selected group supports the argument that this gene can improves cognitive skills and contributes to learned grooming behavior under the exposure to mites. Similarly, the mean expression level of the CYP9Q3 gene region was found to be higher in the selected group compared to the control group (Figure 4). The study identified a progression in the genes responsible for grooming behavior in the colonies. Insects displayed certain physical activities, such as hygienic behavior, when exposed to various chemicals, leading to changes in the gene CYP9Q3 . The expression data analysis revealed that the gene CYP9Q3 was more active in the selected group with a mean expression level of 2.95 ± 0.49 times. A significant increase in the expression level was observed when comparing the selected and control groups (0.62 ± 0.29), (Fig. 4). Overall, these results provide valuable insights into the role of Hym, AmNrx1 , and CYP9Q3 genes in grooming behavior of honey bees and their response to Varroa mite infestation. The higher gene expression levels in the selected group support the notion of improved cognitive skills and learned grooming behavior, highlighting the potential for the use of these candidate genes in selection programs against Varroa in honey bee colonies. Discussions The results of this study provide valuable insights into the genetic basis of grooming behavior in honey bees ( Apis mellifera L.) and its potential association with resistance or tolerance to the Varroa mite. Honey bee populations exhibit various behavioral profiles in response to diseases and parasites, indicating the presence of natural selection-driven traits that contribute to their survival (Fries et al. 2006 ; Le Conte et al. 2007 ; Seeley 2007 ; Yıldız and Karabağ, 2022 ). With the global spread of Varroa, research efforts to develop colonies with resistance or tolerance to this parasite have increased in different countries (Rosenkranz et al. 2010 ). Grooming behavior plays a significant role in controlling Varroa mites in honey bee colonies and has become a subject of intense research (Moosbeckhofer 1992 ; Aumeier 2001 ; Mondragón et al. 2005 ; Guzman-Novoa et al. 2012 ; Hamiduzzaman et al. 2017 ; Yıldız and Karabağ, 2022 ). Grooming behavior involves the cleaning of the body surface and sensory organs and is related to the insect's ability to detect mechanical or chemical stimuli from its environment. Sensory recognition of the Varroa mite triggers behavioral and immune responses (Roode and Lefevre, 2012; Zhukovskaya et al. 2013 ). While differences in grooming behavior have been observed among honey bee breeds and genotypes, the underlying genetic mechanisms have not been fully elucidated (Moretto et al. 1993 ; Guzman-Novoa et al. 2012 ; Rinderer et al. 2013 ; Morfin et al. 2020 ). In this study, the genes Hym, AmNrx1 , and CYP9Q3 , known to be closely associated with grooming behavior, were investigated in the Apis mellifera anatoliaca ecotype. The gene Hymenoptaecin is involved in the honey bee's immune system, and its expression level was found to be significantly higher in the selected colonies. This finding suggests that the selected colonies may have stimulated their grooming and immune responses due to exposure to extra Varroa mites. The expression of the neural gene AmNrx1 , known to influence learning and behavioral traits in honey bees, was also significantly higher in the selected colonies. This supports the argument that AmNrx1 plays a role in improving cognitive skills and grooming behavior. The gene CYP9Q3 , associated with detoxification, showed a significant increase in expression level in the selected colonies. This indicates that the selected colonies might have activated detoxification genes as a response to the Varroa mite exposure. The higher expression levels of Hym, AmNrx1 , and CYP9Q3 genes in the selected colonies are promising indicators of improved grooming behavior and potential resistance to Varroa mite infestation. Several previous studies have also explored the role of these genes in grooming behavior. For instance, Hamiduzzaman et al. ( 2017 ) reported higher expression levels of the AmNrx1 gene in bees removing Varroa mites, and Morfin et al. ( 2020 ) found higher AmNrx1 gene expression in mite-biter bees. Similarly, Corona et al., ( 2019 ) observed increased expression of the Hym gene in field bees, and Haas and Neuren (2021) found significant CYP9Q 3 gene expression in honey bees exposed to pesticides. These findings further support the potential significance of Hym, AmNrx1 , an d CYP9Q3 genes in grooming behavior and against Varroa mite infestation. Overall, this study could be presented important findings regarding the genetic basis of grooming behavior and against the varroa infestation in honey bees. By using specific primers for Anatolian honey bees, the research opens the possibility of pre-selecting colonies displaying high grooming behavior before initiating selection programs. The findings may also contribute to future studies aimed at understanding the genetic progress in selection programs conducted in Turkey. However, further research is needed to explore the underlying mechanisms and long-term effects of the high expression levels of these candidate genes in selected colonies. Molecular techniques can play a crucial role in advancing honey bee selection programs and improving colony resistance to Varroa mite infestation. Declarations Acknowledgment : We would like to express our gratitude to the Ministry of Agriculture, General Directorate of Agricultural Research and Policies for the financial support provided to projects numbered TAGEM /15/AR-GE/ 19 and TAGEM/HAYSÜD/Ü/18/A4/P5/330. The part of study was presented at the APIMONDIA CONGRESS held between 24-28 August 2022. We also thank to Mugla Beekeeping Association. Disclosure statement The authors declare no conflict of interest. Consent for publication: All authors have seen and approved the final version of the manuscript being submitted. They warrant that the article is the authors’ original work, has not received prior publication, and is not under consideration for publication elsewhere. Data availability: All data generated or analyzed during this study are included in this manuscript. Author Contribution The experimental designers of the study were DK, RIT, GA. Those who carried out the laboratory studies were MK, ÜK, DK, MÇ.Statistical analysis was done by KK,RIT. Created and wrote the Case report : DK, RIT, KK. References Anonim (2022) https://www.resmigazete.gov.tr/eskiler/2022/02/20220202-3.htm. Arechavaleta-Velasco EM, Alcala-Escamilla K, Robles-Rios C, Tsuruda JM, Hunt JM (2012) Fine-Scale Linkage Mapping Reveals a Small Set of Candidate Genes Influencing Honey Bee Grooming Behavior in Response to Varroa Mites. PLoS ONE 7(11): e47269. doi:10.1371/journal.pone.0047269 Arechavaleta – Velasco M, Guzman – Nova E (2001) Relative effect of four characteristics that restrain the population growth of the mite Varroa destructor in honey bee (Apis mellifera) colonies. Apidologie, 32(2): 157-174. https://doi.org/10.1051/apido:2001121 Aumeier P (2001) Bioassay for grooming effectiveness towards Varroa destructor mites in Africanized and Carniolan honeybees. Apidologie 32(1): 81-90. https://doi.org/10.1051/apido:2001113 Ball BV (1988) The impact of secondary infections in honey-bee colonies infested with the parasitic mite Varroa jacobsoni. See Ref, 1: 457–61 Ball BV (1985) Acute paralysis virus isolates from honeybee colonies infested with Varroa jacobsoni. Journal Apiculture Research24: 115–119. https://doi.org/10.1080/00218839.1985.11100658 Boutin S, Alburaki M, Mercier PL, Giovenazzo P. Derome N (2015) Differential gene expression between hygienic and non-hygienic honeybee (Apis mellifera L.) hives. BMC Genomics, 16:500. doi 10.1186/s12864-015-1714-y Bowen – Walker PL, Gunn A (2003) The effect of the ectoparasitic mite, Varroa destructor on adult worker honeybee (Apis mellifera) emergence weights, water, protein, carbohydrate, and lipid levels. Entomologia Experimentalis et Applicata, 101(3), 207-217. https://doi.org/10.1046/j.1570-7458.2001.00905.x Buchler R, Berg S, Le Conte Y (2010) Breeding for resistance to Varroa destructor in Europe. Apidologie 41:393–408. DOI: 10.1051/apido/2010011 Buchler R (1994) Varroa tolerance in honey bees — occurrence, characters and breeding. Bee World, 75:54–70. https://doi.org/10.1080/0005772X.1994.11099201. Chaplin – Kramer R, Dombeck E, Gerber J, Knuth K, Muller DN, Muller M, Ziv G, Klein AM (2014) Global malnutrition overlaps with pollinator-dependent micronutrient production. Proceedings of The Royal Society, Biological Sciences, 281:20141799, http://dx.doi.org/10.1098/rspb.2014.1799 Corona M, Branchiccela B, Madella S, Chen B, Evans J (2019) Decoupling the effects of nutrition, age and behavioral caste 2on honey bee physiology and immunity, ioRxiv preprint doi: https://doi.org/10.1101/667931 Dainat B, Evans JD, Chen YP, Gauthier L, Neumann P (2012) Predictive markers of honey bee colony collapse. PLoS One 7:e32151, https://doi.org/10.1371/journal.pone.0032151 De Jong D (1997) Varroa and other parasites of brood. In: Pests, Predators and Diseases of Honey Bees (Morse, R.A., ed.). 3rd edn. A.I. Root Co., Medina, OH, USA, 231-279 Dettner K, Liepert C (1994) Chemical mimicry and camouflage. Ann. Rev. Entomol. 39:129-154. Dietemann V, Pflugfelder J, Charriere JD, Chejanovsky N, Dainat B, De Miranda J, Delaplane K, Dillier FX, Fuck S, Gallmann P, Gauthier L, İmdorf A, Koeniger N, Kralj J, Meikle W, Pettis J, Rosenkranz P, Sammataro D, Smith D, Yanez O, Neuman P (2012) Varroa destructor: research avenues towards sustainable control. Journal of Apicultural Research 51(1): 125-132 . DOI 10.3896/IBRA.1.51.1.15 Etherton M R, Blaiss CA, Powell C M, Südhof T C (2009) Mouse neurexin-1α deletion causes correlated electrophysiological and behavioral changes consistent with cognitive impairments. PNAS, 106 (42):17998- 18003. https://doi.org/10.1073/pnas.0910297106. Fries I, Imdorf A, Rosenkranz P (2006) Survival of mite infested ( Varroa destructor ) honey bee (Apis mellifera) colonies in a Nordic climate. Apidologie, 37 (5): 564-570 . Fries I (1994) Control strategies and reinvasion of Varroa jacobsoni: a model approach. In New perspectives on varroa. Edited by A. Matheson. International Bee Research Association, Cardiff, UK. 35–37.f Genersch E, Von der Ohe W, Kaatz H, Schroeder A, Otten C, Büchler R, Berg S, Ritter W, Mühlen W, Gisder S, Meixner M, Liebig G, Rosenkranz P (2010) The German bee monitoring project: a long term study to understand periodically high winter losses of honey bee colonies. Apidologie 41: 332–352. DOI: 10.1051/apido/2010014 Glinski Z, Jarosz J (1992) Varroa jacobsoni as a carrier of bacterial infections to a recipient bee host . Apidologie, 23: 25– 31. doi:10.1051/apido:19920103 Guzman-Novoa E, Emsen B, Unger C, Espinosa-Montaño LG, Petukhova T (2012) Genotypic variability and relationships between mite infestation levels, mite damage, grooming intensity, and removal of Varroa destructor mites in selected strains of worker honey bees ( Apis mellifera L ). Journal of Invertebrate Pathology 110:314–320. https://doi.org/10.1016/j.jip.2012.03.020 Guzman-Novoa E, Eccles L, Calvete Y, Mcgowan J, Kelly P G, Correa-Benítez A (2010) Varroa destructor is the main culprit for the death and reduced populations of overwintered honey bee ( Apis mellifera ) colonies in Ontario, Canada. Apidologie, 41 (4): 443-450. DOI: 10.1051/apido/2009076 Haas J, Nauen R (2021) Pesticide risk assessment at the molecular level using honey bee cytochrome P450 enzymes: A complementary approach. Environment International 147: 106372. https://doi.org/10.1016/j.envint.2020.106372 Hamiduzzaman MM, Emsen B, Hunt G J, Subramanyam S, Williams CE, Tsuruda JM, Guzman-Novoa E (2017) Differential gene expression associated with honey bee grooming behavior in response to Varroa Mites. Behav. Genet. 47 (3):335- 344 Hamiduzzaman MM, Sinia A, Guzman-Novoa E, Goodwin PH (2012) Entomopathogenic fungi as potential biocontrol agents of the ecto-parasitic mite, Varroa destructor, and their effect on the immune response of honey bees (Apis mellifera L.). Journal of Invertebr Pathology, 111:237–243 Harbo JR, Harris JW (2009) Responses to Varroa by honey bees with different levels of Varroa Sensitive Hygiene. Journal of Apicultural Research and Bee World 48(3): 156-161. DOI 10.3896/IBRA.1.48.3.02 Harbo JR, Harris J W (2005) Suppressed mite reproduction explained by the behaviour of adult bees. Journal of Apicultural Research 44: 21-23 Harbo JR, Harris JW (1999) Selecting honey bees for resistance to Varroa jacobsoni. Apidologie 30: 183-196. DOI: 10.1051/apido:19990208 Heisenberg M (1998) What do the mushroom bodies do for insects? Learn Mem 5: 1–10. İbrahim A, Spiavak M (2006) The relationship between hygienic behavior and suppression of mite reproduction as honey bee (Apis mellifera) mechanisms of resistance to Varroa destructor. Apidologie, 37: 31-40. https://doi.org/10.1051/apido:2005052 Ivgin Tunca R (2009). Determination and comparison of genetic variation in honeybee (Apis mellifera L.) populations of turkey by random amplified polymorphic DNA (RAPD) and microsatellite analyses / Türkiye balarısı (Apis mellifera L.) populasyonlarının rastgele çoğaltılmış polimorfik DNA(RAPD) ve mikrosatelit analizleri ile genetik çeşitliliğinin belirlenmesi ve karşılaştırılması. Orta Doğu Teknik Üniversitesi Fen Bilimleri Enstitüsü Doktora Tezi. Ankara. Kandemir İ, Kence M, Kence A (2000) Genetic and morphometric variation in honey bee (Apis mellifera L.) populations in Turkey. Apidologie, 31: 343-356 Klein AM, Vaissiere BE, Cane HJ, Dewenter IS, Cunningham AS, Kremen C, Tscharntke T, (2007) Importance of pollinators in changing landscapes for world crops. Proc. R. Soc. B. 274: 303–313. doi:10.1098/rspb.2006.3721 Kence M, Farhoud H J, Tunca IR (2009) Morphometric and genetic variability of honey bee (Apis mellifera L.) populations from northern Iran. Journal of apicultural research , 48(4): 247-255. DOI: 10.3896/IBRA.1.48.4.04 Le Conte Y, Ellis M, Ritter W (2010) Varroa mites and honey bee health: can Varroa explain part of the colony losses? Apidologie, 41 (3):353-363. DOI: 10.1051/apido/2010017. Le Conte Y, De Vaublanc G, Crauser D, Jeanne F, Rousselle JC, Becard JM (2007) Honey bee colonies that have survived Varroa destructor. Apidologie 38, 566–572. https://doi.org/10.1051/apido:2007040 Mao w, Schuler MA, Berenbaum M R (2011) CYP9Q-mediated detoxification of acaricides in the honey bee (Apis mellifera). Proc. Natl. Acad. Sci. U.S.A. 108:12657–12662 Moosbeckhofer R (1992) Observations on the occurrence of damaged Varroa mites in natural mite fall of Apis mellifera carnica colonies. Apidologie, 23: 523–531 Mondragón L, Spivak M, Vandame R (2005) A multifactorial study of the resistance of Africanized and hybrid honeybee Apis mellifera to the mite Varroa destructor over one year in Mexico. Apidologie 36: 345–358 Moretto G, Gonçalves LS, De Jong D (1993) Heritability of Africanized and European honey bee defensive behavior against the mite Varroa jacobsoni. Brazilian Journal of Genetics, 16 (1): 71-77 Morfin N, Espinosa L, Montano E, Guzman—Nova E (2020) A direct assay to assess self-grooming behavior in honey bees (Apis mellifera L.). Apidologie 51:892–897. DOI: 10.1007/s13592-020-00769-y Moritz RF, De Miranda J, Fries I, Le Conte Y, Neumann P, Paxton RJ (2010) Research strategies to improve honeybee health in Europe. Apidologie, 41:227–242. DOI: 10.1051/apido/2010010 Navajas M, Migeon A, Alaux C, Martin-Magniette ML, Robinson GE, Evans JD, Cros-Arteil S, Crauser D, Le Conte Y (2008) Differential gene expression of the honey bee Apis mellifera associated with Varroa destructor infection. BMC Genomics, 9:301 doi:10.1186/1471-2164-9-301 Ollerton J, Winfree R, Tarrant S (2011) How many flowering plants are pollinated by animals? Oikos, 120: 321–326. doi: 10.1111/j.1600-0706.2010.18644.x Oskay D, Kükrer M, Kence A (2019) Muğla Bal Arısında (Apis mellifera anatoliaca) Amerikan Yavru Çürüklüğü Hastalığına Karşı Direnç Geliştirilmesi, Arıcılık Araştırma Dergisi / Journal of Apiculture Research, 11(1): 8-20. Ozaki M, Wada-Katsumata A, Fujikawa K, Iwasaki M, Yokohari F, Satoji Y, Nisimura T, Yamaoka R (2005) Ant nestmate and non-nestmate discrimination by a chemosensory sensillum. Science, 309: 311-314, DOI: 10.1126/science.1105244 Rader R, Bartomeus I, Tylianakis JM, Laliberté E (2014) The winners and losers of land use intensification: Pollinator community disassembly is non-random and alters functional diversity. Divers Distrib 20 (8):908–917. https://doi.org/10.1111/ddi.12221 Rath W (1999) Co-Adaptation of Apis cerana Fabr and Varroa jacobsoni Oud . Apidologie, 30: 97 - 110. https://doi.org/10.1051/apido:19990202 Reyes-Quintana M, Espinosa-Montaño LG, Prieto-Merlos D, Koleoglu G, Petukhova T, Correa-Benítez A, Guzman-Novoa E (2019) Impact of Varroa destructor and deformed wing virus on emergence, cellular immunity, wing integrity and survivorship of Africanized honey bees in Mexico. Journal Invertebrate Pathology, 164: 43-48. https://doi.org/10.1016/j.jip.2019.04.009 Roode CJ, Lefeve T (2012) Behavioral Immunity in Insects. İnsects, 3(3), 789-820; https://doi.org/10.3390/insects3030789 Rosenkranz P, Aumeier P, Ziegelmann B (2010) Biology and control of Varroa destructor. Journal of Invertebrate Pathology, 103 (1): 96-119 Rinderer TE, De Guzman L, Frake M (2013) Associations of Parameters Related to the Fall of Varroa destructor (Mesostigmata: Varroidae) in Russian and Italian Honey Bee (Hymenoptera: Apidae) Colonies. Apıculture And Socıal Insects, 106:2. https://doi.org/10.1603/EC12427 Rinderer ET, Harris JW, Hunt GJ, De Guzman LI (2010) Breeding for resistance to Varroa destructor in North America. Apidologie , 41:409-424. https://doi.org/10.1051/apido/2010015 Rinderer T, Guzman L, Delatte GT, Stelzer J, Lancaster VA, Kuznetsov L, Beaman L, Watts R, Harris WJ (2001) Resistance to the parasitic mite Varroa destructor in honey bees from far-eastern Russia. Apidologie, 32:381- 394. https://doi.org/10.1051/apido:2001138 Ruttner F (1988) Biogeography and Taxonomy of Honeybees. Springer-Verlag, Berlin, Heidelberg and New York. http://dx.doi.org/10.1007/978-3-642-72649-1 Sammataro D, Avitabile A, (2011) The Beekeeper's Handbook, published by Comstock Publishing Associates, ISBN 10: 0801476941 / ISBN 13: 9780801476945 Seeley TD (2007) Honey bees of the Arnot Forest: a population of feral colonies persisting with Varroa destructor in the northeastern United States. Apidologie, 38 (1):19-29 Seid MA, Brown VB (2009) A New Host Association of Commoptera solenopsidis (Diptera: Phoridae) with the Ant Pheidole dentata (Hymenoptera: Formicidae) and Behavioral Observations. Florida Entomologist 92 (2):309-313. https://doi.org/10.1653/024.092.0215 Schneider P (1987) The influence of the parasitic mite Varroa jacoboni Oud. on the organ development and longevity of their host Apis mellifera L. Rheinischen Friedrich WilhelmsUniversitat, Bonn, Germany Spivak M, Danka RG (2021) Perspectives on hygienic behavior in Apis mellifera and other social insects. Apidologie 52: 1–16. DOI: 10.1007/s13592-020-00784-z Spivak M, Reuter G S (2001) Resistance to American foulbrood disease by honey bee colonies Apis mellifera bred for hygienic behavior. Apidologie, 32: 555 – 565. https://doi.org/10.1051/apido:2001103 Stankus T (2008) A review and bibliography of the literature of honey bee Colony Collapse Disorder: a poorly understood epidemic that clearly threatens the successful pollination of billions of dollars of crops in America. J Agr Food Inform 9:115–143. https://doi.org/10.1080/10496500802173939 Szyska P, Galkin A, Menzel R (2008)Associative and non-associative plasticity in Kenyon cells of the honeybee mushroom body. Front Syst Neurosci 2: 3. doi: 10.3389/neuro.06.003.2008 Wilkinson D, Smith GC (2002) Modeling the Efficiency of Sampling and Trapping Varroa destructor in the Drone Brood of Honey bees (Apis mellifera). Apicultural Research. Yang X, Cox – Foster DL (2005) Impact of an ectoparasite on the immunity and pathology of an invertebrate: Evidence for host immunosuppression and viral amplification. PNAS, 102: 21. www.pnas.orgcgidoi10.1073pnas.0501860102 Yıldız Bİ, Karabağ K (2022) Quantitation of neuroxin-1, ataxin-3 and atlastin genes related to grooming behavior in five races of honey bee, Apis mellifera L., 1758 (Hymenoptera: Apidae), in Turkey. Türk. Entomoloji dergisi . 46 (1): 03-11 Zhukovskaya M, Yanagawa A, Forschler BT (2013) Grooming behavior as a mechanism of insect disease defense. Insects 4:60 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3884178","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Case Report","associatedPublications":[],"authors":[{"id":268653116,"identity":"2cdf022b-4a8c-420f-bbbd-68dba808f5a1","order_by":0,"name":"Dilek Kabakcı","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABE0lEQVRIie3RsUrDQBjA8S8EvixfkzXhwLzCBccOeZUvCHEJEhCKQ4eCcC6lc/oYvsHJQbJoX0CQQtcOBaEIYjF10MEkdnS4/3Acx/244w7AZvuPaQQXgAG9maOPC/7XMp5CSIP+2dyO9BeBkE8kvsbstZzmsR9t1qacvqToPWnYTQykQneSSKMRVV0kSuTSVPV1puiKnWplgHzuJFJ7M0F4wyhYGkJmhEK6I9WSnpu15PadDi2Jmp2hA6cYbKX7MUiwFiNVMIYkzUixo8L2FGeARAbz8XKRJ4qK0iwXnKlwKx/mq0uix54Xa9T5c7m/iOO75n5T7jkNgiJZv03GZ968mxw/5fdcw8BP9nKbzWazffcJYOFWbUVvAFgAAAAASUVORK5CYII=","orcid":"","institution":"Muş Alparslan University","correspondingAuthor":true,"prefix":"","firstName":"Dilek","middleName":"","lastName":"Kabakcı","suffix":""},{"id":268653117,"identity":"92eb4017-5f3b-4a98-940a-0cb5835cfa5d","order_by":1,"name":"Ümit Karataş","email":"","orcid":"","institution":"Apiculture Research Enstitüde","correspondingAuthor":false,"prefix":"","firstName":"Ümit","middleName":"","lastName":"Karataş","suffix":""},{"id":268653118,"identity":"59f11d8e-1a64-4b38-a569-9944f02ee0fe","order_by":2,"name":"Rahşan Ivgin Tunca","email":"","orcid":"","institution":"Muğla Sıtkı Koçman Üniversity,","correspondingAuthor":false,"prefix":"","firstName":"Rahşan","middleName":"Ivgin","lastName":"Tunca","suffix":""},{"id":268653119,"identity":"6f2e15aa-3639-4afd-8db6-88b77c84c958","order_by":3,"name":"Murat Çankaya","email":"","orcid":"","institution":"Sakarya University","correspondingAuthor":false,"prefix":"","firstName":"Murat","middleName":"","lastName":"Çankaya","suffix":""},{"id":268653120,"identity":"0b4e7407-8b6b-4a7e-90d4-64a42b311d37","order_by":4,"name":"Kemal Karabağ","email":"","orcid":"","institution":"Akdeniz University","correspondingAuthor":false,"prefix":"","firstName":"Kemal","middleName":"","lastName":"Karabağ","suffix":""},{"id":268653121,"identity":"55617445-1336-4ad4-b584-bfd814aa9b82","order_by":5,"name":"Gökhan Akdeniz","email":"","orcid":"","institution":"Ege Tarımsal Araştırma Enstitüsü","correspondingAuthor":false,"prefix":"","firstName":"Gökhan","middleName":"","lastName":"Akdeniz","suffix":""},{"id":268653122,"identity":"d002b47c-c0ba-4aff-8819-3482cd38bd58","order_by":6,"name":"Mehmet Kuzucu","email":"","orcid":"","institution":"Erzincan Binali Yıldırım Üniversity","correspondingAuthor":false,"prefix":"","firstName":"Mehmet","middleName":"","lastName":"Kuzucu","suffix":""}],"badges":[],"createdAt":"2024-01-21 08:59:04","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3884178/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3884178/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50122242,"identity":"8399f231-749e-4b41-a2e0-459fac55efe8","added_by":"auto","created_at":"2024-01-24 19:57:19","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1557097,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe mean of the gene expression levels of the selected and control groups for \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHym\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCYP9Q3\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAmNrx1\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3884178/v1/7232963be0b39046f109acaa.jpeg"},{"id":50122741,"identity":"26be94cb-f7f5-40e5-aa66-85985f980fa5","added_by":"auto","created_at":"2024-01-24 20:05:19","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":102154,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression levels of the control and selected groups for the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ehym\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003egene region\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3884178/v1/6b04a7db8d52a8361e187b22.png"},{"id":50122240,"identity":"ce98e948-ecfd-4810-b87a-966889d3dab7","added_by":"auto","created_at":"2024-01-24 19:57:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":137920,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression levels of the control and selected groups for the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAmNrx1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene region\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3884178/v1/a98e2e0b02a61145e4f741d6.png"},{"id":50122243,"identity":"29db7908-ed87-4934-b30e-f75e50c48b75","added_by":"auto","created_at":"2024-01-24 19:57:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":137865,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene expression levels of the control and selected groups for the CYP9Q3 gene region\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3884178/v1/1a31d271bc9299b84b5b17ac.png"},{"id":50793576,"identity":"ec3af84d-8254-4bd8-a5da-1a203ec25477","added_by":"auto","created_at":"2024-02-07 11:22:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2715940,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3884178/v1/bccd3801-d682-4a7a-913a-2f8c5d4715b7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Determination of the Expression Levels of Hym, AmNrx1, and CYP9Q3 Genes in the Anatolian Honey Bee (Apis mellifera anatoliaca)","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePollination plays a vital role in sustaining ecosystems, where insects, especially bees, are crucial contributors to this essential process. Bees are essential for efficient agricultural production and the survival of numerous plant species within the ecosystem (Ollerton et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Rader et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Klein et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Pollinator insects are responsible for pollinating 70% of agricultural plants globally (Klein et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Chaplin-Kramer et al. 2014). In Turkey, honey bee breeding is extensively carried out, and the country is home to approximately 20% of the world's honey bee subspecies. Anatolia, specifically, harbors five distinct honey bee subspecies (\u003cem\u003eApis mellifera caucasica, Apis mellifera anatoliaca, Apis mellifera meda, Apis mellifera syriaca, Apis mellifera carnica\u003c/em\u003e) and their breed (Ruttner, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e1988\u003c/span\u003e; Kandemir et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Kence et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Oskay et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yıldız and Karabağ, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). These breeds have adapted to different regions and environmental conditions, resulting in varying morphological, behavioral, and yield characteristics (Stankus \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Guzman-Novoa et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Le Conte et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The Anatolian honey bee (\u003cem\u003eA.m. anatoliaca\u003c/em\u003e), a prevalent honey bee breed, inhabits Western and Central Anatolia. Renowned for robust reproductive capabilities, it exhibits remarkable adaptability to extreme climatic conditions and limited nectar availability in its environment. Additionally, it is reported to possess resistance against diseases. (Rutner, 1988; Tunca Ivgin, 2009). Muğla honey bee (\u003cem\u003eA. m. anatoliaca\u003c/em\u003e) is one of the ecotypes commonly found in Anatolia. The ecotype of this breed was registered by the Ministry of Agriculture and Forestry by amending the Communiqu\u0026eacute; on the Registration of Domestic Animal Breeds and Lines on 02.02.2022 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.resmigazete.gov.tr/eskiler/2022/02/20220202-3.htm\u003c/span\u003e\u003cspan address=\"https://www.resmigazete.gov.tr/eskiler/2022/02/20220202-3.htm\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHoneybee parasites and pathogens pose a significant threat to the sustainability of honeybees on earth, contributing to substantial bee losses. Among these challenges, the ectoparasitic \u003cem\u003eVarroa destructor\u003c/em\u003e stands out as a major problem jeopardizing the health of honey bees. (Stankus \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Guzman-Novoa et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Le Conte et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Even relatively mite infestations can cause serious harm to honey bees of different genotypes (De Jong \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Bowen-Walker and Gunn, 2003; B\u0026uuml;chler et al. 2014; Reyes-Quintana et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). It has even been reported that even relatively low mite infestation can seriously damage bees of different genotypes (De Jong, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Bowen-Walker and Gunn, 2003; B\u0026uuml;chler et al. 2014; Reyes-Quintana et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In instances of Varroa infestation, there is a documented reduction in the duration and lifespan of both pupa and adult honey bee individuals. Moreover, the male honey bees experience decreased sperm production, and the presence of Varroa, carrying specific honey bee virus types, ultimately results in colony losses. (Ball, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1985\u003c/span\u003e; Schneider, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e1987\u003c/span\u003e; Ball, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1988\u003c/span\u003e; Glinski and Jarosz, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Buchler \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Fries \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Wilkinson and Smith, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2002\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the contemporary context, discussing an apiary without addressing Varroa is nearly impossible. Despite its widespread prevalence worldwide, a fully effective and sustainable method to combat this mite has yet to be developed. (Mert et al. 2007; Ayan 2017). Developing effective and sustainable methods against Varroa has been challenging, and long-term acarisid use has led to mite resistance. Hence, creating resistant honey bee lines against this ectoparasite has become essential (Sammataro \u0026amp; Avitabile, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Dietemann et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Spivak \u0026amp; Danka, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Two bee behavioral traits, grooming, and Varroa sensitive hygiene (VSH), play a role in limiting the development of Varroa in colonies. Grooming behavior involves cleaning the bees' bodies, collecting pollen, and removing mites (Dettner and Liepert, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Rath \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Guzm\u0026aacute;n-Novoa, 2001; Ozaki et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Rinderer et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Arechavaleta Velasco and Seid and Brown, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Zhukovskaya et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Varroa sensitive hygiene (VSH), on the other hand, refers to the bees' ability to detect and remove Varroa-parazite offspring (Ibrahim and Spivak, 2006; Harbo and Harris, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Various selection programs have been implemented to create Varroa-resistant honey bee lines, ensuring colony continuity and productivity even in the presence of the mite (Harris and Harbo, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1999\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Rinderer et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Spivak and Reuter, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Navajas et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Le Conte et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Buchler et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Genersch et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Moritz et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2010\u003c/span\u003e;).\u003c/p\u003e \u003cp\u003eRecent studies have focused on genes \u003cem\u003eHym\u003c/em\u003e and \u003cem\u003eCYP9Q3\u003c/em\u003e, which appear to control the immune system in honey bees and their response to Varroa infestations in terms of gene expression levels (Yang and Cox-Foster, 2005; Navajas et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Dainat et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Hamiduzzaman et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Hamiduzzaman et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Likewise, detoxification genes such as \u003cem\u003eCYP9Q3\u003c/em\u003e have shown altered expression levels in honey bees exposed to different chemicals and displaying hygienic behavior (Mao et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Boutin et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Although \u003cem\u003eCYP9Q3\u003c/em\u003e expression has not been specifically evaluated in response to grooming behavior against Varroa mites, studies suggest that its expression is high in bees exhibiting intense grooming against Varroa (Hamiduzzaman et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Another candidate gene, \u003cem\u003eAmNrx1\u003c/em\u003e, has been linked to honey bee grooming behavior and self-grooming behavior (Arechavaleta-Velasco et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Etherton et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Hamiduzzaman et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) examined its potential effect on grooming behavior and with strong grooming behavior had higher \u003cem\u003eAmNrx1\u003c/em\u003e expression than bees displaying mild grooming behavior and not displaying grooming behavior Researchers have explored the potential effects of AmNrx1 on grooming behavior and its possible use as a marker for creating Varroa-resistant lines (Morfin et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Yıldız and Karabağ, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). QTL mapping was conducted to identify candidate genes for grooming behavior against Varroa in honey bees, revealing 27 genes, including atlastin, ataxin-3, and neuroxin-1, with potential neurodevelopmental and behavioral impacts on chromosome 5. The neural gene neuroxin-1 (\u003cem\u003eAmNrx1\u003c/em\u003e) was found to be mainly expressed in the central nervous system and the mushroom body of the brain, important organs for higher-order processing and learning in bees (Heisenberg \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Szyska et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Arechavaleta-Velasco et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; ).\u003c/p\u003e \u003cp\u003eBased on all these perspectives, the expression levels of \u003cem\u003ehymenoptaecin, neurexin-1\u003c/em\u003e and \u003cem\u003eCYP9Q3\u003c/em\u003e, three genes assumed to be associated with defensive behavior in honeybees, were examined against Varroa mites in selected colonies in the study. The aim of this study is to determine whether and to what extent these genes show any changes in their expression levels in identified populations exposed to varroa.\u003c/p\u003e"},{"header":"Materials and method","content":"\u003cp\u003e\u003cstrong\u003eHoney bee material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Muğla honey bee (Apis mellifera anatoliaca) ecotype, housed in the Muğla Beekeepers\u0026apos; Association, was used as the primary material in this study. A total of 15 worker bees were collected from each of the 23 colonies selected for control groups in which no specific study was conducted, and 23 colonies where selection studies against Varroa were carried out as part of project number TAGEM / 15 / AR-GE / 19. To assess the Varroa mite infestation levels in the selection (4th generation) and control colonies, the powdered sugar method was employed.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe exposure to Varroa test and sample collection:\u003c/strong\u003e To assess defence behavior under exposure to Varroa test at the individual level, 15 worker bees from both the selected and control groups were placed in queen cages and transferred to the artificial insemination laboratory of Muğla Beekeepers\u0026apos; Association. A modified version of the method described by Aumeier (2001) was used to conduct the grooming test in the laboratory. To trigger the activation of genes associated with defense behavior, a closed plastic box measuring 15x15 cm housed 15 worker bees from each colony. Varroa mites, equivalent in number to the total worker bees present, were introduced into the box. The samples were then left undisturbed for 3 minutes, allowing ample time for the activation of genes linked to defense behavior. Five samples actively attempting to remove Varroa were randomly selected. Subsequently, the worker bee samples were rendered hygienic by passing them through distilled water.\u0026nbsp;Under hygienic conditions, small incisions were made on the thoraxes of the worker bees using a scalpel. The thorax samples were then collected in Eppendorf tubes, and to preserve the RNA integrity, Biological\u0026nbsp;Industries RNA Save solution (Biological Industries, Israel) was added to the tubes. The tubes with the thorax samples were stored at +4 \u0026deg;C for 4 hours and then transferred to a long-term storage temperature of -80 \u0026deg;C until further analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Committee Aproval:\u0026nbsp;\u003c/strong\u003eAs non cepholopad invertabrates honey bee not subject to animal ethic approval at Republic of Turkey ( based on the \u0026lsquo; Regulation on the Welfare and protection of Animal Used for Exsperimental and Other Scientific Purpose\u0026rsquo; published in the official Gazette dated December 13.2011 and numbered 28141).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer design:\u003c/strong\u003e The design of primer sets was carried out using the programs Primer3Plus and Primer-BLAST, utilizing the NCBI (National Center for Biotechnology Information) database for the genes Hym, AmNrx1,\u0026nbsp;and\u0026nbsp;CYP9Q3, which are considered to be associated with defence behavior. The primers used for reverse transcription quantitative polymerase chain reaction (RT-qPCR) are listed in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp; \u0026nbsp;Table 1. Primers used for RT-qPCR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;*Reference gene\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"95%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.23711340206186%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession N.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.24742268041237%\"\u003e\n \u003cp\u003e\u003cstrong\u003eBand size\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.463917525773196%\"\u003e\n \u003cp\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHym\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.23711340206186%\"\u003e\n \u003cp\u003eF: TCTCTTCTGTGCCGTTGCAT\u003c/p\u003e\n \u003cp\u003eR: CACCATAGGCGTCTCCTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\"\u003e\n \u003cp\u003eNM_001011615.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.24742268041237%\"\u003e\n \u003cp\u003e209\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.463917525773196%\"\u003e\n \u003cp\u003eNewly designed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmNrx1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.23711340206186%\"\u003e\n \u003cp\u003eF: GCGATTGTGACATGACCAGC\u003c/p\u003e\n \u003cp\u003eR: ATAGTCGTCGCTCGAAGCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\"\u003e\n \u003cp\u003eNM_001145740.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.24742268041237%\"\u003e\n \u003cp\u003e209\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.463917525773196%\"\u003e\n \u003cp\u003eNewly designed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCYP9Q3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.23711340206186%\"\u003e\n \u003cp\u003eF: TGCACGACGTGATAGATCGG\u003c/p\u003e\n \u003cp\u003eR: GAGCATGTTCCTGTGCTCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\"\u003e\n \u003cp\u003eXM_006562300.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.24742268041237%\"\u003e\n \u003cp\u003e242\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.463917525773196%\"\u003e\n \u003cp\u003eNewly designed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.371134020618557%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGapdh*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.23711340206186%\"\u003e\n \u003cp\u003eF: CATGGATGGCGGTGGGAAG\u003c/p\u003e\n \u003cp\u003eR: TGTCCGTTGCATCGACGTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\"\u003e\n \u003cp\u003eXM_006566197.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.24742268041237%\"\u003e\n \u003cp\u003e232\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.463917525773196%\"\u003e\n \u003cp\u003eNewly designed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eRNA purification\u003c/strong\u003e: To individually purify the RNA from each sample (5 samples per coloni) stored at -80\u0026deg;C without allowing them to dissolve, the samples were first homogenized in a mortar with liquid nitrogen to prevent RNA degradation. The mortar and pestle were thoroughly cleaned with a laboratory detergent, DeconTM ContradTM NF Liquid Detergent (Fisher Scientific, USA), to prevent cross-contamination between samples. After homogenization, the samples were treated with 80% ethanol and Thermo UltraPureTM DEPC-Treated Water (Thermo Scientific, USA) for additional purification steps. Following pre-homogenization, each sample was weighed to approximately 100 mg, and the total RNA purification process was initiated using the Qiagen QIAshredder homogenization kit (Product code: 79656) (Qiagen, USA). The RNA was then extracted using the TRIzol method and further purified using the Qiagen RNeasy kit (Product code: 74106) (Valencia, USA). Finally, the concentration and purity of the purified RNA were determined using the Take3 module of the BioTek EPOCH microplate reader.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ecDNA Synthesis and RT-qPCR:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo perform cDNA synthesis, all purified RNA samples were converted into complementary DNA (cDNA) using the Qiagen RT2 First Strand Kit (Product code: 3330404) (Valencia, USA). For RT-qPCR amplifications, the Qiagen Rotor-Gene Q 6Plex Real-Time PCR instrument was used with the Bio-Rad iTaq Universal SYBR method. Each qPCR reaction was set up in a 96-well plate and consisted of RNase-free water (PCR-grade), 10 \u0026mu;L iTaq Universal SYBR Green Supermix (2x), 0.2 \u0026mu;L of each gene-specific primer (forward and reverse), and 0.5 \u0026mu;L of cDNA template, making a final volume of 20 \u0026mu;L. The qPCR cycling protocol included an initial denaturation at 95 \u0026deg;C for 2 minutes, followed by 45 cycles of denaturation at 94 \u0026deg;C for 15 seconds, annealing at 57-60 \u0026deg;C for 30 seconds (annealing temperature may vary depending on the specific gene being amplified), and extension at 72 \u0026deg;C for 30 seconds. During the RT-qPCR process, the instrument monitored the fluorescence emission from the SYBR Green dye, allowing quantification of the gene-specific cDNA levels in each sample. The cycling protocol facilitated multiple rounds of DNA amplification, enabling accurate measurement of gene expression levels in the honey bee samples.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGene expression levels were assessed using the 2\u003csup\u003e\u0026ndash;\u0026Delta;\u0026Delta;CT\u003c/sup\u003e method as described by Livak and Schmittgen (Livak and Schmittgen, 2001). Secondary normalization was performed by comparing the expression levels of each gene with the expression levels of the gene GAPDH within the same organism. Prior to the statistical evaluation of qPCR data for the genes Hym, CYP9Q3, and AmNrx1, the Kolmogorov-Smirnov normal distribution test was conducted to determine if the data followed a normal distribution. The results indicated that the data for all three genes exhibited a normal distribution (p\u0026gt;0.05). To compare the expression levels of the three genes between the selected and control groups, the independent samples t-test, a parametric test, was employed (p\u0026lt;0.01). Graphs and figures depicting the results were generated using OriginPro 2022 demo version.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eThe gene expression levels of \u003cem\u003eHym, CYP9Q3,\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;AmNrx1\u003c/em\u003e were evaluated through statistical analysis. Following the experimental procedure, an independent samples t-test, a parametric test, was performed to compare the gene expression levels of the selected group with those of the control group (Table 2). The results of the t-test revealed a statistically significant difference in the expression levels of all three genes between the selected and control groups (p \u0026lt; 0. 01). Table 2 representss the gene expression measurements and frequencies of \u003cem\u003eHym, CYP9Q3,\u0026nbsp;\u003c/em\u003eand \u003cem\u003eAmNrx1\u003c/em\u003e based on the study results. The data demonstrated that the expression levels of these genes were significantly higher in the selected group compared to the control group (p \u0026lt; 0.01).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Gene Expression Levels of the Selected and Control Groups for the Hym, CYP9Q3, and AmNrx1 Gene Regions\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.521008403361346%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.865546218487395%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.100840336134453%\"\u003e\n \u003cp\u003e\u003cstrong\u003eN\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.51260504201681%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMean \u0026plusmn; Std. dev\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.521008403361346%\" rowspan=\"2\"\u003e\n \u003cp\u003eHym\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.865546218487395%\"\u003e\n \u003cp\u003eSelected\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.100840336134453%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.51260504201681%\"\u003e\n \u003cp\u003e2.90 \u0026plusmn; 0.32\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.802603036876356%\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.61822125813449%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.579175704989154%\"\u003e\n \u003cp\u003e0.59 \u0026plusmn; 0.14\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.521008403361346%\" rowspan=\"2\"\u003e\n \u003cp\u003eCYP9Q3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.865546218487395%\"\u003e\n \u003cp\u003eSelected\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.100840336134453%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.51260504201681%\"\u003e\n \u003cp\u003e2.95 \u0026plusmn; 0.49\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.802603036876356%\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.61822125813449%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.579175704989154%\"\u003e\n \u003cp\u003e0.62 \u0026plusmn; 0.29\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.521008403361346%\" rowspan=\"2\"\u003e\n \u003cp\u003eAmNrx1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.865546218487395%\"\u003e\n \u003cp\u003eSelected\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.100840336134453%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.51260504201681%\"\u003e\n \u003cp\u003e3.26 \u0026plusmn; 0.58\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.802603036876356%\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.61822125813449%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"53.579175704989154%\"\u003e\n \u003cp\u003e0.83 \u0026plusmn; 0.29\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e** There is a statistical difference at the p\u0026lt;00.1\u0026nbsp;significance level in terms of the Hym, CYP9Q3, and AmNrx1 gene expressions between the selected and control groups.\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mean gene expression levels of Hym, CYP9Q3, and AmNrx1 are graphically represented, clearly illustrating that individuals in the selected group exhibited higher gene expression levels than those in the control group (Fig. 1).\u003c/p\u003e\n\u003cp\u003eSpecifically, the \u003cem\u003eHym\u003c/em\u003e gene, associated with bees\u0026apos; immune system, showed an increase of 2.90 \u0026plusmn; 0.32 times in the selected group, indicating the development of grooming behavior in colonies where selection studies were conducted. Conversely, the expression level of \u003cem\u003eHym\u003c/em\u003e was down-regulated in the control group (0.59 \u0026plusmn; 0.14) (Fig. 2).\u003c/p\u003e\n\u003cp\u003eRegarding the \u003cem\u003eAmNrx1\u003c/em\u003e gene, known to control grooming behavior in insects, a significant increase was observed in the selected group compared to the control group (Fig. 3).\u003c/p\u003e\n\u003cp\u003eThe current study further investigated the expression level of the \u003cem\u003eAmNrx1\u0026nbsp;\u003c/em\u003egene in colonies that developed against to Varroa. The results showed that the mean expression level of the gene \u003cem\u003eAmNrx1\u003c/em\u003e in the selected group was 3.26 \u0026plusmn; 0.58 times higher on average. This finding suggests that the increased expression level of the \u003cem\u003eAmNrx1\u003c/em\u003e gene in the selected group supports the argument that this gene can improves cognitive skills and contributes to learned grooming behavior under the exposure to mites.\u003c/p\u003e\n\u003cp\u003eSimilarly, the mean expression level of the \u003cem\u003eCYP9Q3\u003c/em\u003e gene region was found to be higher in the selected group compared to the control group (Figure 4). The study identified a progression in the genes responsible for grooming behavior in the colonies. Insects displayed certain physical activities, such as hygienic behavior, when exposed to various chemicals, leading to changes in the gene \u003cem\u003eCYP9Q3\u003c/em\u003e. The expression data analysis revealed that the gene \u003cem\u003eCYP9Q3\u003c/em\u003e was more active in the selected group with a mean expression level of 2.95 \u0026plusmn; 0.49 times. A significant increase in the expression level was observed when comparing the selected and control groups (0.62 \u0026plusmn; 0.29), (Fig. 4).\u003c/p\u003e\n\u003cp\u003eOverall, these results provide valuable insights into the role of \u003cem\u003eHym, AmNrx1\u003c/em\u003e, and \u003cem\u003eCYP9Q3\u003c/em\u003e genes in grooming behavior of honey bees and their response to Varroa mite infestation. The higher gene expression levels in the selected group support the notion of improved cognitive skills and learned grooming behavior, highlighting the potential for the use of these candidate genes in selection programs against Varroa in honey bee colonies.\u003c/p\u003e"},{"header":"Discussions","content":"\u003cp\u003eThe results of this study provide valuable insights into the genetic basis of grooming behavior in honey bees (\u003cem\u003eApis mellifera\u003c/em\u003e L.) and its potential association with resistance or tolerance to the Varroa mite. Honey bee populations exhibit various behavioral profiles in response to diseases and parasites, indicating the presence of natural selection-driven traits that contribute to their survival (Fries et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Le Conte et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Seeley \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Yıldız and Karabağ, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). With the global spread of Varroa, research efforts to develop colonies with resistance or tolerance to this parasite have increased in different countries (Rosenkranz et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Grooming behavior plays a significant role in controlling Varroa mites in honey bee colonies and has become a subject of intense research (Moosbeckhofer \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Aumeier \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Mondrag\u0026oacute;n et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Guzman-Novoa et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Hamiduzzaman et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Yıldız and Karabağ, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Grooming behavior involves the cleaning of the body surface and sensory organs and is related to the insect's ability to detect mechanical or chemical stimuli from its environment. Sensory recognition of the Varroa mite triggers behavioral and immune responses (Roode and Lefevre, 2012; Zhukovskaya et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). While differences in grooming behavior have been observed among honey bee breeds and genotypes, the underlying genetic mechanisms have not been fully elucidated (Moretto et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Guzman-Novoa et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Rinderer et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Morfin et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, the genes \u003cem\u003eHym, AmNrx1\u003c/em\u003e, and \u003cem\u003eCYP9Q3\u003c/em\u003e, known to be closely associated with grooming behavior, were investigated in the \u003cem\u003eApis mellifera anatoliaca\u003c/em\u003e ecotype. The gene Hymenoptaecin is involved in the honey bee's immune system, and its expression level was found to be significantly higher in the selected colonies. This finding suggests that the selected colonies may have stimulated their grooming and immune responses due to exposure to extra Varroa mites. The expression of the neural gene \u003cem\u003eAmNrx1\u003c/em\u003e, known to influence learning and behavioral traits in honey bees, was also significantly higher in the selected colonies. This supports the argument that \u003cem\u003eAmNrx1\u003c/em\u003e plays a role in improving cognitive skills and grooming behavior.\u003c/p\u003e \u003cp\u003eThe gene \u003cem\u003eCYP9Q3\u003c/em\u003e, associated with detoxification, showed a significant increase in expression level in the selected colonies. This indicates that the selected colonies might have activated detoxification genes as a response to the Varroa mite exposure. The higher expression levels of \u003cem\u003eHym, AmNrx1\u003c/em\u003e, and \u003cem\u003eCYP9Q3\u003c/em\u003e genes in the selected colonies are promising indicators of improved grooming behavior and potential resistance to Varroa mite infestation.\u003c/p\u003e \u003cp\u003eSeveral previous studies have also explored the role of these genes in grooming behavior. For instance, Hamiduzzaman et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) reported higher expression levels of the \u003cem\u003eAmNrx1\u003c/em\u003e gene in bees removing Varroa mites, and Morfin et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) found higher \u003cem\u003eAmNrx1\u003c/em\u003e gene expression in mite-biter bees. Similarly, Corona et al., (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) observed increased expression of the Hym gene in field bees, and Haas and Neuren (2021) found significant \u003cem\u003eCYP9Q\u003c/em\u003e3 gene expression in honey bees exposed to pesticides. These findings further support the potential significance of \u003cem\u003eHym, AmNrx1\u003c/em\u003e, an\u003cem\u003ed CYP9Q3\u003c/em\u003e genes in grooming behavior and against Varroa mite infestation.\u003c/p\u003e \u003cp\u003eOverall, this study could be presented important findings regarding the genetic basis of grooming behavior and against the varroa infestation in honey bees. By using specific primers for Anatolian honey bees, the research opens the possibility of pre-selecting colonies displaying high grooming behavior before initiating selection programs. The findings may also contribute to future studies aimed at understanding the genetic progress in selection programs conducted in Turkey. However, further research is needed to explore the underlying mechanisms and long-term effects of the high expression levels of these candidate genes in selected colonies. Molecular techniques can play a crucial role in advancing honey bee selection programs and improving colony resistance to Varroa mite infestation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eWe would like to express our gratitude to the Ministry of Agriculture, General Directorate of Agricultural Research and Policies for the financial support provided to projects numbered TAGEM /15/AR-GE/ 19 and TAGEM/HAYS\u0026Uuml;D/\u0026Uuml;/18/A4/P5/330.\u0026nbsp;The part of study was presented at the APIMONDIA CONGRESS held between 24-28 August 2022. We also thank to Mugla Beekeeping Association.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eAll authors have seen and approved the final version of the manuscript being submitted. They warrant that the article is the authors\u0026rsquo; original work, has not received prior publication, and is not under consideration for publication elsewhere.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability:\u0026nbsp;\u003c/strong\u003eAll data generated or analyzed during this study are included in this manuscript.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eThe experimental designers of the study were DK, RIT, GA. Those who carried out the laboratory studies were MK, \u0026Uuml;K, DK, M\u0026Ccedil;.Statistical analysis was done by KK,RIT. Created and wrote the Case report : DK, RIT, KK.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAnonim (2022) https://www.resmigazete.gov.tr/eskiler/2022/02/20220202-3.htm.\u003c/li\u003e\n\u003cli\u003eArechavaleta-Velasco EM, Alcala-Escamilla K, Robles-Rios C, Tsuruda JM, Hunt JM (2012) Fine-Scale Linkage Mapping Reveals a Small Set of Candidate Genes Influencing Honey Bee Grooming Behavior in Response to Varroa Mites. PLoS ONE 7(11): e47269. doi:10.1371/journal.pone.0047269\u003c/li\u003e\n\u003cli\u003eArechavaleta \u0026ndash; Velasco M, Guzman \u0026ndash; Nova E (2001) Relative effect of four characteristics that restrain the population growth of the mite Varroa destructor in honey bee (Apis mellifera) colonies. Apidologie, 32(2): 157-174. https://doi.org/10.1051/apido:2001121\u003c/li\u003e\n\u003cli\u003eAumeier P (2001) Bioassay for grooming effectiveness towards Varroa destructor mites in Africanized and Carniolan honeybees. Apidologie 32(1): 81-90. https://doi.org/10.1051/apido:2001113\u003c/li\u003e\n\u003cli\u003eBall BV (1988) The impact of secondary infections in honey-bee colonies infested with the parasitic mite Varroa jacobsoni. See Ref, 1: 457\u0026ndash;61\u003c/li\u003e\n\u003cli\u003eBall BV (1985) Acute paralysis virus isolates from honeybee colonies infested with Varroa jacobsoni. Journal Apiculture Research24: 115\u0026ndash;119. https://doi.org/10.1080/00218839.1985.11100658\u003c/li\u003e\n\u003cli\u003eBoutin S, Alburaki M, Mercier PL, Giovenazzo P. Derome N (2015) Differential gene expression between hygienic and non-hygienic honeybee (Apis mellifera L.) hives. BMC Genomics, 16:500. doi 10.1186/s12864-015-1714-y\u003c/li\u003e\n\u003cli\u003eBowen \u0026ndash; Walker PL, Gunn A (2003) The effect of the ectoparasitic mite, Varroa destructor on adult worker honeybee (Apis mellifera) emergence weights, water, protein, carbohydrate, and lipid levels. Entomologia Experimentalis et Applicata, 101(3), 207-217. https://doi.org/10.1046/j.1570-7458.2001.00905.x\u003c/li\u003e\n\u003cli\u003eBuchler R, Berg S, Le Conte Y (2010) Breeding for resistance to Varroa destructor in Europe. Apidologie 41:393\u0026ndash;408. DOI: 10.1051/apido/2010011\u003c/li\u003e\n\u003cli\u003eBuchler R (1994) Varroa tolerance in honey bees \u0026mdash; occurrence, characters and breeding. Bee World, 75:54\u0026ndash;70. https://doi.org/10.1080/0005772X.1994.11099201.\u003c/li\u003e\n\u003cli\u003eChaplin \u0026ndash; Kramer R, Dombeck E, Gerber J, Knuth K, Muller DN, Muller M, Ziv G, Klein AM (2014) Global malnutrition overlaps with pollinator-dependent micronutrient production. Proceedings of The Royal Society, Biological Sciences, 281:20141799, http://dx.doi.org/10.1098/rspb.2014.1799\u003c/li\u003e\n\u003cli\u003eCorona M, Branchiccela B, Madella S, Chen B, Evans J (2019) Decoupling the effects of nutrition, age and behavioral caste 2on honey bee physiology and immunity, ioRxiv preprint doi: https://doi.org/10.1101/667931\u003c/li\u003e\n\u003cli\u003eDainat B, Evans JD, Chen YP, Gauthier L, Neumann P (2012) Predictive markers of honey bee colony collapse. PLoS One 7:e32151, https://doi.org/10.1371/journal.pone.0032151 \u003c/li\u003e\n\u003cli\u003eDe Jong D (1997) Varroa and other parasites of brood. In: Pests, Predators and Diseases of Honey Bees (Morse, R.A., ed.). 3rd edn. A.I. Root Co., Medina, OH, USA, 231-279\u003c/li\u003e\n\u003cli\u003eDettner K, Liepert C (1994) Chemical mimicry and camouflage. Ann. Rev. Entomol. 39:129-154.\u003c/li\u003e\n\u003cli\u003eDietemann V, Pflugfelder J, Charriere JD, Chejanovsky N, Dainat B, De Miranda J, Delaplane K, Dillier FX, Fuck S, Gallmann P, Gauthier L, İmdorf A, Koeniger N, Kralj J, Meikle W, Pettis J, Rosenkranz P, Sammataro D, Smith D, Yanez O, Neuman P (2012) Varroa destructor: research avenues towards sustainable control.\u003cem\u003e \u003c/em\u003eJournal of Apicultural Research 51(1): 125-132\u003cem\u003e.\u003c/em\u003e DOI 10.3896/IBRA.1.51.1.15\u003c/li\u003e\n\u003cli\u003eEtherton M R, Blaiss CA, Powell C M, S\u0026uuml;dhof T C (2009) Mouse neurexin-1\u0026alpha; deletion causes correlated electrophysiological and behavioral changes consistent with cognitive impairments. PNAS, 106 (42):17998- 18003. https://doi.org/10.1073/pnas.0910297106.\u003c/li\u003e\n\u003cli\u003eFries I, Imdorf A, Rosenkranz P (2006) Survival of mite infested (\u003cem\u003eVarroa destructor\u003c/em\u003e) honey bee (Apis mellifera) colonies in a Nordic climate. Apidologie, 37 (5): 564-570\u003cstrong\u003e.\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eFries I (1994) Control strategies and reinvasion of Varroa jacobsoni: a model approach. In New perspectives on varroa. Edited by A. Matheson. International Bee Research Association, Cardiff, UK. 35\u0026ndash;37.f\u003c/li\u003e\n\u003cli\u003eGenersch E, Von der Ohe W, Kaatz H, Schroeder A, Otten C, B\u0026uuml;chler R, Berg S, Ritter W, M\u0026uuml;hlen W, Gisder S, Meixner M, Liebig G, Rosenkranz P (2010) The German bee monitoring project: a long term study to understand periodically high winter losses of honey bee colonies. Apidologie 41: 332\u0026ndash;352. DOI: 10.1051/apido/2010014\u003c/li\u003e\n\u003cli\u003eGlinski Z, Jarosz J (1992) Varroa jacobsoni as a carrier of bacterial infections to a recipient bee host\u003cem\u003e. Apidologie,\u003c/em\u003e 23: 25\u0026ndash; 31. doi:10.1051/apido:19920103\u003c/li\u003e\n\u003cli\u003eGuzman-Novoa E, Emsen B, Unger C, Espinosa-Monta\u0026ntilde;o LG, Petukhova T (2012) Genotypic variability and relationships between mite infestation levels, mite damage, grooming intensity, and removal of Varroa destructor mites in selected strains of worker honey bees (\u003cem\u003eApis mellifera L\u003c/em\u003e). Journal of Invertebrate Pathology 110:314\u0026ndash;320. https://doi.org/10.1016/j.jip.2012.03.020\u003c/li\u003e\n\u003cli\u003eGuzman-Novoa E, Eccles L, Calvete Y, Mcgowan J, Kelly P G, Correa-Ben\u0026iacute;tez A (2010) Varroa destructor is the main culprit for the death and reduced populations of overwintered honey bee (\u003cem\u003eApis mellifera\u003c/em\u003e) colonies in Ontario, Canada. Apidologie, 41 (4): 443-450. DOI: 10.1051/apido/2009076\u003c/li\u003e\n\u003cli\u003eHaas J, Nauen R (2021) Pesticide risk assessment at the molecular level using honey bee cytochrome P450 enzymes: A complementary approach. Environment International 147: 106372. https://doi.org/10.1016/j.envint.2020.106372\u003c/li\u003e\n\u003cli\u003eHamiduzzaman MM, Emsen B, Hunt G J, Subramanyam S, Williams CE, Tsuruda JM, Guzman-Novoa E (2017) Differential gene expression associated with honey bee grooming behavior in response to Varroa Mites. Behav. Genet. 47 (3):335- 344\u003c/li\u003e\n\u003cli\u003eHamiduzzaman MM, Sinia A, Guzman-Novoa E, Goodwin PH (2012) Entomopathogenic fungi as potential biocontrol agents of the ecto-parasitic mite, Varroa destructor, and their effect on the immune response of honey bees (Apis mellifera L.). Journal of Invertebr Pathology, 111:237\u0026ndash;243\u003c/li\u003e\n\u003cli\u003eHarbo JR, Harris JW (2009) Responses to Varroa by honey bees with different levels of Varroa Sensitive Hygiene. Journal of Apicultural Research and Bee World 48(3): 156-161. DOI 10.3896/IBRA.1.48.3.02\u003c/li\u003e\n\u003cli\u003eHarbo JR, Harris J W (2005) Suppressed mite reproduction explained by the behaviour of adult bees. Journal of Apicultural Research 44: 21-23\u003c/li\u003e\n\u003cli\u003eHarbo JR, Harris JW (1999) Selecting honey bees for resistance to Varroa jacobsoni. Apidologie 30: 183-196. DOI: 10.1051/apido:19990208\u003c/li\u003e\n\u003cli\u003eHeisenberg M (1998) What do the mushroom bodies do for insects? Learn Mem 5: 1\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eİbrahim A, Spiavak M (2006) The relationship between hygienic behavior and suppression of mite reproduction as honey bee (Apis mellifera) mechanisms of resistance to Varroa destructor. Apidologie, 37: 31-40. https://doi.org/10.1051/apido:2005052\u003c/li\u003e\n\u003cli\u003eIvgin Tunca R (2009). Determination and comparison of genetic variation in honeybee (Apis mellifera L.) populations of turkey by random amplified polymorphic DNA (RAPD) and microsatellite analyses / T\u0026uuml;rkiye balarısı (Apis mellifera L.) populasyonlarının rastgele \u0026ccedil;oğaltılmış polimorfik DNA(RAPD) ve mikrosatelit analizleri ile genetik \u0026ccedil;eşitliliğinin belirlenmesi ve karşılaştırılması. Orta Doğu Teknik \u0026Uuml;niversitesi Fen Bilimleri Enstit\u0026uuml;s\u0026uuml; Doktora Tezi. Ankara.\u003c/li\u003e\n\u003cli\u003eKandemir İ, Kence M, Kence A (2000) Genetic and morphometric variation in honey bee (Apis mellifera L.) populations in Turkey. Apidologie, 31: 343-356\u003c/li\u003e\n\u003cli\u003eKlein AM, Vaissiere BE, Cane HJ, Dewenter IS, Cunningham AS, Kremen C, Tscharntke T, (2007) Importance of pollinators in changing landscapes for world crops. Proc. R. Soc. B. 274: 303\u0026ndash;313. doi:10.1098/rspb.2006.3721\u003c/li\u003e\n\u003cli\u003eKence M, Farhoud H J, Tunca IR (2009) Morphometric and genetic variability of honey bee (Apis mellifera L.) populations from northern Iran. Journal of apicultural research\u003cem\u003e,\u003c/em\u003e 48(4): 247-255. DOI: 10.3896/IBRA.1.48.4.04\u003c/li\u003e\n\u003cli\u003eLe Conte Y, Ellis M, Ritter W (2010) Varroa mites and honey bee health: can Varroa explain part of the colony losses? Apidologie, 41 (3):353-363. DOI: 10.1051/apido/2010017.\u003c/li\u003e\n\u003cli\u003eLe Conte Y, De Vaublanc G, Crauser D, Jeanne F, Rousselle JC, Becard JM (2007) Honey bee colonies that have survived Varroa destructor. Apidologie 38, 566\u0026ndash;572. https://doi.org/10.1051/apido:2007040 \u003c/li\u003e\n\u003cli\u003eMao w, Schuler MA, Berenbaum M R (2011) CYP9Q-mediated detoxification of acaricides in the honey bee (Apis mellifera). Proc. Natl. Acad. Sci. U.S.A. 108:12657\u0026ndash;12662\u003c/li\u003e\n\u003cli\u003eMoosbeckhofer R (1992) Observations on the occurrence of damaged Varroa mites in natural mite fall of \u003cem\u003eApis mellifera carnica\u003c/em\u003e colonies. Apidologie, 23: 523\u0026ndash;531\u003c/li\u003e\n\u003cli\u003eMondrag\u0026oacute;n L, Spivak M, Vandame R (2005) A multifactorial study of the resistance of Africanized and hybrid honeybee \u003cem\u003eApis mellifera\u003c/em\u003e to the mite \u003cem\u003eVarroa destructor\u003c/em\u003e over one year in Mexico. Apidologie 36: 345\u0026ndash;358\u003c/li\u003e\n\u003cli\u003eMoretto G, Gon\u0026ccedil;alves LS, De Jong D (1993) Heritability of Africanized and European honey bee defensive behavior against the mite Varroa jacobsoni. Brazilian Journal of Genetics, 16 (1): 71-77\u003c/li\u003e\n\u003cli\u003eMorfin N, Espinosa L, Montano E, Guzman\u0026mdash;Nova E (2020) A direct assay to assess self-grooming behavior in honey bees (Apis mellifera L.). Apidologie 51:892\u0026ndash;897. DOI: 10.1007/s13592-020-00769-y\u003c/li\u003e\n\u003cli\u003eMoritz RF, De Miranda J, Fries I, Le Conte Y, Neumann P, Paxton RJ (2010) Research strategies to improve honeybee health in Europe. Apidologie, 41:227\u0026ndash;242. DOI: 10.1051/apido/2010010\u003c/li\u003e\n\u003cli\u003eNavajas M, Migeon A, Alaux C, Martin-Magniette ML, Robinson GE, Evans JD, Cros-Arteil S, Crauser D, Le Conte Y (2008) Differential gene expression of the honey bee Apis mellifera associated with Varroa destructor infection. BMC Genomics, 9:301 doi:10.1186/1471-2164-9-301\u003c/li\u003e\n\u003cli\u003eOllerton J, Winfree R, Tarrant S (2011) How many flowering plants are pollinated by animals? Oikos, 120: 321\u0026ndash;326. doi: 10.1111/j.1600-0706.2010.18644.x\u003c/li\u003e\n\u003cli\u003eOskay D, K\u0026uuml;krer M, Kence A (2019) Muğla Bal Arısında (Apis mellifera anatoliaca) Amerikan Yavru \u0026Ccedil;\u0026uuml;r\u0026uuml;kl\u0026uuml;ğ\u0026uuml; Hastalığına Karşı Diren\u0026ccedil; Geliştirilmesi, Arıcılık Araştırma Dergisi / Journal of Apiculture Research, 11(1): 8-20.\u003c/li\u003e\n\u003cli\u003eOzaki M, Wada-Katsumata A, Fujikawa K, Iwasaki M, Yokohari F, Satoji Y, Nisimura T, Yamaoka R (2005) Ant nestmate and non-nestmate discrimination by a chemosensory sensillum. Science, 309: 311-314, DOI: 10.1126/science.1105244\u003c/li\u003e\n\u003cli\u003eRader R, Bartomeus I, Tylianakis JM, Lalibert\u0026eacute; E (2014) The winners and losers of land use intensification: Pollinator community disassembly is non-random and alters functional diversity. Divers Distrib 20 (8):908\u0026ndash;917. https://doi.org/10.1111/ddi.12221\u003c/li\u003e\n\u003cli\u003eRath W (1999) Co-Adaptation of Apis cerana Fabr and Varroa jacobsoni Oud\u003cem\u003e. Apidologie, \u003c/em\u003e30: 97 - 110. https://doi.org/10.1051/apido:19990202\u003c/li\u003e\n\u003cli\u003eReyes-Quintana M, Espinosa-Monta\u0026ntilde;o LG, Prieto-Merlos D, Koleoglu G, Petukhova T, Correa-Ben\u0026iacute;tez A, Guzman-Novoa E (2019) Impact of Varroa destructor and deformed wing virus on emergence, cellular immunity, wing integrity and survivorship of Africanized honey bees in Mexico. Journal Invertebrate Pathology, 164: 43-48. https://doi.org/10.1016/j.jip.2019.04.009\u003c/li\u003e\n\u003cli\u003eRoode CJ, Lefeve T (2012) Behavioral Immunity in Insects. İnsects, 3(3), 789-820; https://doi.org/10.3390/insects3030789\u003c/li\u003e\n\u003cli\u003eRosenkranz P, Aumeier P, Ziegelmann B (2010) Biology and control of Varroa destructor. Journal of Invertebrate Pathology, 103 (1): 96-119\u003c/li\u003e\n\u003cli\u003eRinderer TE, De Guzman L, Frake M (2013) Associations of Parameters Related to the Fall of Varroa destructor (Mesostigmata: Varroidae) in Russian and Italian Honey Bee (Hymenoptera: Apidae) Colonies. Apıculture And Socıal Insects, 106:2. https://doi.org/10.1603/EC12427\u003c/li\u003e\n\u003cli\u003eRinderer ET, Harris JW, Hunt GJ, De Guzman LI (2010) Breeding for resistance to Varroa destructor in North America. Apidologie\u003cem\u003e,\u003c/em\u003e 41:409-424. https://doi.org/10.1051/apido/2010015\u003c/li\u003e\n\u003cli\u003eRinderer T, Guzman L, Delatte GT, Stelzer J, Lancaster VA, Kuznetsov L, Beaman L, Watts R, Harris WJ (2001) Resistance to the parasitic mite Varroa destructor in honey bees from far-eastern Russia. Apidologie, 32:381- 394. https://doi.org/10.1051/apido:2001138\u003c/li\u003e\n\u003cli\u003eRuttner F (1988) Biogeography and Taxonomy of Honeybees. Springer-Verlag, Berlin, Heidelberg and New York. http://dx.doi.org/10.1007/978-3-642-72649-1\u003c/li\u003e\n\u003cli\u003eSammataro D, Avitabile A, (2011) The Beekeeper\u0026apos;s Handbook, published by Comstock Publishing Associates, ISBN 10: 0801476941 / ISBN 13: 9780801476945\u003c/li\u003e\n\u003cli\u003eSeeley TD (2007) Honey bees of the Arnot Forest: a population of feral colonies persisting with Varroa destructor in the northeastern United States. Apidologie, 38 (1):19-29\u003c/li\u003e\n\u003cli\u003eSeid MA, Brown VB (2009) A New Host Association of Commoptera solenopsidis (Diptera: Phoridae) with the Ant Pheidole dentata (Hymenoptera: Formicidae) and Behavioral Observations. Florida Entomologist 92 (2):309-313. https://doi.org/10.1653/024.092.0215\u003c/li\u003e\n\u003cli\u003eSchneider P (1987) The influence of the parasitic mite Varroa jacoboni Oud. on the organ development and longevity of their host Apis mellifera L. Rheinischen Friedrich WilhelmsUniversitat, Bonn, Germany\u003c/li\u003e\n\u003cli\u003eSpivak M, Danka RG (2021) Perspectives on hygienic behavior in Apis mellifera and other social insects. Apidologie 52: 1\u0026ndash;16. DOI: 10.1007/s13592-020-00784-z\u003c/li\u003e\n\u003cli\u003eSpivak M, Reuter G S (2001) Resistance to American foulbrood disease by honey bee colonies Apis mellifera bred for hygienic behavior. Apidologie, 32: 555 \u0026ndash; 565. https://doi.org/10.1051/apido:2001103\u003c/li\u003e\n\u003cli\u003eStankus T (2008) A review and bibliography of the literature of honey bee Colony Collapse Disorder: a poorly understood epidemic that clearly threatens the successful pollination of billions of dollars of crops in America. J Agr Food Inform 9:115\u0026ndash;143. https://doi.org/10.1080/10496500802173939\u003c/li\u003e\n\u003cli\u003eSzyska P, Galkin A, Menzel R (2008)Associative and non-associative plasticity in Kenyon cells of the honeybee mushroom body. Front Syst Neurosci 2: 3. doi: 10.3389/neuro.06.003.2008\u003c/li\u003e\n\u003cli\u003eWilkinson D, Smith GC (2002) Modeling the Efficiency of Sampling and Trapping Varroa destructor in the Drone Brood of Honey bees (Apis mellifera). Apicultural Research.\u003c/li\u003e\n\u003cli\u003eYang X, Cox \u0026ndash; Foster DL (2005) Impact of an ectoparasite on the immunity and pathology of an invertebrate: Evidence for host immunosuppression and viral amplification. PNAS, 102: 21. www.pnas.orgcgidoi10.1073pnas.0501860102\u003c/li\u003e\n\u003cli\u003eYıldız Bİ, Karabağ K (2022) Quantitation of neuroxin-1, ataxin-3 and atlastin genes related to grooming behavior in five races of honey bee, Apis mellifera L., 1758 (Hymenoptera: Apidae), in Turkey. T\u0026uuml;rk. Entomoloji dergisi\u003cem\u003e.\u003c/em\u003e 46 (1): 03-11\u003c/li\u003e\n\u003cli\u003eZhukovskaya M, Yanagawa A, Forschler BT (2013) Grooming behavior as a mechanism of insect disease defense. Insects 4:60\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Honey bee, Breeding, Grooming behavior, Hym, AmNrx1, CYP9Q3","lastPublishedDoi":"10.21203/rs.3.rs-3884178/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3884178/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe \u003cem\u003eVarroa destructor\u003c/em\u003e poses a significant threat to honey bees, leading to substantial yield losses and colony declines. Defence behaviour (such as grooming behavior: auto and allogrooming) in honey bees serves as a crucial mechanism against Varroa infestations, but the many genes responsible for this behavior remain unidentified. This study focuses on the expression levels of \u003cem\u003ehymenoptaecin (Hym), neurexin-1 (AmNrx1)\u003c/em\u003e, and \u003cem\u003eCYP9Q3\u003c/em\u003e which could be associated with defence behavior, in Muğla honey bee ecotype (\u003cem\u003eApis mellifera anatoliaca\u003c/em\u003e) colonies subjected to a against Varroa selection program. Using the qPCR method, researchers analyzed worker bees from 23 control groups and 23 colonies under the selection program. The results revealed a remarkable increase in the expression levels of \u003cem\u003eHym, AmNrx1\u003c/em\u003e, and \u003cem\u003eCYP9Q3\u003c/em\u003e genes in the selected group, with respective fold changes of 2.9, 2.95, and 3.26 compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). This finding suggests that selection against Varroa infestations induces alterations in gene expression linked to behaviour related to exposure of \u003cem\u003eVarroa\u003c/em\u003e in honey bees. These outcomes propose the potential use of \u003cem\u003eHym, AmNrx1\u003c/em\u003e, and \u003cem\u003eCYP9Q3\u003c/em\u003e genes in preselection for future Varroa-resistant programs in honey bees. The genes used in the study that may be related to this behavior are supported by other studies in the future, they may help create an initial population with advanced defence behaviours (such as autogrooming and allogrooming).\u003c/p\u003e","manuscriptTitle":"Determination of the Expression Levels of Hym, AmNrx1, and CYP9Q3 Genes in the Anatolian Honey Bee (Apis mellifera anatoliaca)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-24 19:57:14","doi":"10.21203/rs.3.rs-3884178/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fbb0276b-815a-4bcd-9d8c-2090d47c6c8d","owner":[],"postedDate":"January 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-07T11:14:37+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-24 19:57:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3884178","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3884178","identity":"rs-3884178","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.