Impact of Aerobic Exercise on Cardiac Inflammatory Cytokines, Apoptotic Pathways, and Myocardial Preservation in a Rat Model of Type 2 Diabetes Mellitus

Impact of Aerobic Exercise on Cardiac Inflammatory Cytokines, Apoptotic Pathways, and Myocardial Preservation in a Rat Model of Type 2 Diabetes Mellitus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of Aerobic Exercise on Cardiac Inflammatory Cytokines, Apoptotic Pathways, and Myocardial Preservation in a Rat Model of Type 2 Diabetes Mellitus Alireza Rashidpour¹, Elaheh Piralaiy², Badrkhan Rashwan Ismael¹, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5951336/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Type 2 diabetes mellitus (T2DM) is associated with an increased risk of cardiovascular complications, partially mediated by chronic inflammation and myocardial injury. This study aimed to investigate the Aerobic Exercise Reduces Cardiac Inflammation and Apoptosis in Diabetic Rats. Methods A total of 20 male Wistar rats (average weight: 240 ± 28 g) were randomly divided into four groups: diabetic exercise (Dia + Exe), healthy exercise (Heal + Exe), diabetic control (Dia + Con), and healthy control (Heal + Con). The Dia + Exe and Dia + Con groups were fed a diet consisting of 60% high-fat food for a specified duration before receiving intratracheal injections of streptozotocin to induce diabetes. The Dia + Exe and Heal + Exe groups underwent aerobic exercise on a treadmill at speeds ranging from 5 to 24 meters per minute for eight weeks. Levels of TNF-α and IL-6 were measured using ELISA, while caspase-3 activity was assessed via real-time PCR. Results Compared to the Heal + Con group, the diabetic control group (Dia + Con) displayed a notable elevation in TNF-α, IL-6, and caspase-3 levels (P ≤ 0.05), indicative of heightened inflammation and apoptosis. Conversely, the diabetic exercise group (Dia + Exe) that underwent aerobic exercise demonstrated a reduction in TNF-α, IL-6, and caspase-3 levels compared to the Dia + Con group (P ≤ 0.05). Conclusion The results of this study demonstrated that aerobic exercise could reduce inflammatory markers such as TNF-α, IL-6, and caspase-3, particularly in cardiac tissue. These findings underscore the potential of aerobic exercise as a non-pharmacological strategy to mitigate cardiac complications in diabetic patients. Aerobic exercise myocardial apoptosis type 2 diabetic rats TNF-α IL-6 caspase-3 Figures Figure 1 Figure 2 Figure 3 Introduction Diabetes mellitus is characterized by hyperglycemia resulting from defects in insulin action or production ( 1 ). Approximately 90 to 95 per cent of diabetes mellitus cases are classified as type 2 diabetes mellitus (T2DM), making it the most common form ( 2 ). One of the major complications associated with diabetes is diabetic cardiomyopathy (DCM). The increasing prevalence of type 2 diabetes worldwide has become a significant public health concern ( 3 ). Chronic inflammation is a common complication of type 2 diabetes that plays a crucial role in the development and progression of diabetic cardiomyopathy ( 4 ). Inflammatory cytokines such as TNF-α and IL-6 have been implicated in diabetic cardiomyopathy through various pathways. TNF-α is a pro-inflammatory cytokine produced by several cell types, including adipocytes, macrophages, and cardiomyocytes ( 5 ). Additionally, TNF-α is a pro-inflammatory cytokine that controls several inflammatory signaling pathways, including insulin resistance and apoptosis ( 6 ). In T2DM, elevated levels of TNF-α are associated with insulin resistance, endothelial dysfunction, and cardiac remodeling. TNF-α can induce cardiomyocyte apoptosis, increase myocardial fibrosis, and contribute to contractile dysfunction ( 5 ) In T2DM, elevated levels of IL-6 are associated with insulin resistance, endothelial dysfunction, and vascular cardiac complications ( 6 ). IL-6 can induce cardiac hypertrophy, strengthen myocardial fibrosis, and contribute to impaired contractile function ( 7 ). IL-6 binds to its cellular receptors (IL-6R) and activates the JAK/STAT signaling pathway, regulating gene expression in inflammation, cardiac hypertrophy, fibrosis, and cell death ( 8 ). Moreover, IL-6 increases the production of reactive oxygen species (ROS) and reduces antioxidant activity. ROS can damage DNA, proteins, and lipids, leading to inflammation, cellular dysfunction, and cell death ( 9 ). It has been reported that nuclear factor kappa B (NF-κB) is critical in cardiac toxicity resulting from prolonged inflammatory responses. This process is mediated by activating pro-inflammatory cytokines such as interleukin (IL)-6 and TNF-α, ultimately triggering apoptotic cascades ( 10 ). Insulin resistance has been identified as a factor that disrupts the blood flow and oxygen supply to the heart muscle, thereby activating the caspase-3 enzyme in cardiomyocytes. ( 11 ). This enzyme belongs to the homocysteine family and plays a pre-apoptotic role during myocardial stress and heart cell death ( 12 ). Apoptosis is a natural process where damaged or old cells are replaced with new ones. Abnormal cell death in the heart is a key factor in various heart diseases and normal physiological processes ( 13 ). It should be mentioned that apoptosis can lead to reduction of contractile tissue, compensatory hypertrophy of cardiac cells and compensatory fibrosis ( 14 ). Caspase-3, as an executive caspase, acts downstream of the cell death signal and activates other caspases ( 15 ). Caspase-3 activity indicates irreversible cell apoptosis ( 16 ). Studies show a significant relationship between diabetes and increased levels of cell apoptosis in various organs, including the heart. Diabetic patients experience prominent levels of cell death due to increased oxidative stress. This is responsible for the activation of effective caspases. In addition, high glucose levels, by causing oxidative stress, lead to the activation caspase-3 in heart tissue ( 17 ). Previous studies show that aerobic exercise reduces inflammatory factors in humans and animals. Regular aerobic exercise may improve cardiovascular health in diabetics by modulating cytokines like TNF-α and IL-6. ( 18 , 19 ). While diverse types of exercise have been studied, aerobic exercise seems to have the most consistent positive effects Although previous studies have shown the benefits of aerobic exercise in managing type 2 diabetes, few have investigated its direct effects on cardiac inflammation and apoptosis in diabetic models. This study seeks to address this gap by focusing on myocardial-specific responses on health markers, including reduced insulin resistance and lower levels of inflammatory markers, although there is high heterogeneity among studies ( 20 ). Mechanistically, aerobic exercise may reduce oxidative stress, improve mitochondrial function, and modulate apoptotic signaling pathways, thereby protecting against myocardial apoptosis. Its anti-inflammatory effects, including reducing TNF-α and IL-6 levels, may further contribute to this protective role ( 21 ). Studies have shown that aerobic exercise can improve glycemic control and cardiovascular health, potentially reducing the risk of diabetic cardiomyopathy ( 22 ). In addition, diabetes is associated with increased apoptosis of heart muscle cells (myocardium), which forms the basis of cardiovascular damage ( 23 ). This process of programmed cell death, through the activation of components of the apoptotic pathway and increased activity of caspases, leads to the death of heart muscle cells and eventually heart failure and other complications in diabetic patients ( 24 ). Recent research on the effects of exercise training with different intensities and volumes demonstrated the potential of this non-pharmacological intervention in protecting the heart from damage caused by diabetes. Evidence suggests that exercise training can exert its protective effects by reducing apoptosis levels, including through mechanisms such as reducing oxidative stress and inflammation and improving mitochondrial function ( 13 ). Studies indicate that aerobic exercise can improve metabolic dysfunctions in diabetic models, particularly in reducing cardiac inflammation and apoptosis, although the specific mechanisms involved are not fully understood ( 25 ). For instance, research has shown that diabetic rats have significantly elevated inflammatory markers and apoptosis indicators, like caspase three, compared to healthy controls. Aerobic exercise has been found to lower inflammation and apoptosis in these diabetic models, with studies reporting that moderate and high-intensity exercise could alleviate oxidative stress and apoptosis in cardiomyocytes ( 26 ). While these findings are promising, more research is needed to fully understand the relationship between aerobic exercise, diabetes, and cardiac health, particularly regarding the role of caspases and other apoptotic markers. Some studies, such as those by Mirdar et al. ( 27 ), have shown that certain types of exercise training may increase apoptosis in some contexts, highlighting the complexity of this relationship. Previous studies have shown the benefits of aerobic exercise on metabolic parameters in diabetic models, but its direct impact on cardiac tissue remains underexplored, with many studies focusing on blood serum markers instead of myocardium changes. Understanding how aerobic exercise influences inflammatory markers and apoptotic pathways in heart tissue is crucial for clarifying its protective effects against diabetes-related heart damage. The duration and intensity of these effects are not well-documented, and different exercise protocols may have varying impacts. Therefore, this study aimed to investigate the effect of regular aerobic exercise on inflammation and modulates apoptotic pathways in the heart tissue of type 2 diabetic rats. Methods Study design In the present study, we used an animal model in a four-group to assess the protective effects of aerobic exercise (five days a week, grade 15% for 10–60 minutes and speed of 24–33 m/min) on cardiac inflammation and apoptosis in a type 2 diabetic rat model. All protocol designs and surgical procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals. The Research Ethics Committee at the University of Tabriz, Iran (ethical code: IR.TABRIZU.REC.1402.022) approved the animal experimentation study. The study involved thirty-two male Wistar rats (eight-week-old male Wistar rats) obtained from the animal laboratory of the Faculty of Veterinary Medicine, University of Tabriz. The rats were selected as the experimental model due to their physiological similarities to humans regarding metabolic processes and the response to diabetes. The rats were approximately eight weeks old, weighed 240 grams, and were kept under natural conditions without fasting prior to the commencement of the study. All experiments were conducted in the same laboratory setting to ensure consistency and reliability. The rats were housed in a dedicated animal laboratory for a period of two weeks to facilitate their adaptation to the pristine environment, reduce the effect of stress, and control any physiological changes that may have occurred. Rats were randomly divided into four groups (n = 28), including diabetic exercise (Dia + Exe), healthy exercise (Heal + exe), diabetic control (Dia + Con), and healthy control (Heal + Con). The rats were divided housed in polyethylene cages under controlled environmental conditions (20–22°C, 12:12 light-dark cycle, 55–65% humidity). During the two-week adaptation period, the rats (except for the Heal + Con and Dia + Con) were subjected to a seven-day familiarization program on a treadmill. Induction of diabetes Diabetes in rats was induced using a high-fat diet and a low-dose STZ injection in a 0.1 M sodium citrate buffer.were used. The injection site was disinfected with alcohol before administering STZ. This method was chosen as it is a well-established and widely accepted model for inducing diabetes in rats, and it was performed according to the guidelines for animal research ethics. Fasting blood glucose (mg/dL) and body weight were measured before the injection, ensuring the animals' health was monitored throughout the process ( 28 ). After the STZ injection, the rats were housed in a chamber and provided with food and water. Seventy-two hours post-injection, fasting blood glucose (mg/dL) was measured from the tail vein using a glucometer. Rats with over 300 mg/dL of blood glucose were considered diabetic and eligible for further study ( 29 ). The rats were weighed using a digital scale (SDS 3031) with a capacity of thirty units and a 5 g minimum threshold. Weighing was done at the start and end of the observation period. Water was provided in 500 mL bottles that were changed and refilled daily( 28 ). The diabetic group received a standard commercial diet containing 20% protein, 20% carbohydrate, and 60% fat (D12492, Research Diets). In contrast, the healthy group received a normal chow diet consisting of corn, corn starch, corn gluten, calcium carbonate, dicalcium phosphate, and vitamin and mineral premix. Table 1 Composition of Standard Rat Diet Pellets per 100 g Diet Composition Protein (%) Carbohydrate (%) Fat (%) Fat (kcal%) Calories (Kcal/g) Normal Diet 23 50.3 5.1 - 3.1 High-Fat Diet 45% 24 41 54 45 4.8 High-Fat Diet 60% 24 26 35 60 5.2 *Note. * This table shows the macronutrient composition and caloric content of the normal diet and the two high-fat diets used in the study. The high-fat diets contained 45% and 60% of calories from fat, respectively, with the remaining calories coming from protein and carbohydrates Exercise protocol The exercise intervention was conducted using a motorized treadmill equipped with an electrical shock-plate motivational system. The 8-week protocol comprised five weekly sessions with progressive overload implementation. During Week 1, subjects exercised at 5–10 m/min for 10–15 minutes, advancing to 10–14 m/min for 20 minutes in Week 2. Exercise intensity increased to 14–18 m/min for 30 minutes in Week 3 and 18–24 m/min for 40 minutes in Week 4. For the remaining four weeks (Weeks 5–8), subjectsmaintained exercise at 18–24 m/min for 60 minutes. The treadmill incline remained constant at 10% throughout the study, with a 2-minute rest interval implemented mid-session. Control subjects were placed on the stationary treadmill for time-matched periods without exercise ( 30 ). (Table 2 ). Table 2 Aerobic Exercise Protocol with Progressive Overload Week Speed (m/min) Duration (min) Incline (%) 1 5–10 10–15 10 2 10–14 20 10 3 14–18 30 10 4 18–24 40 10 5–6 18–24 60 10 7–8 18–24 60 10 *Note. * This protocol demonstrates progressive overload by increasing speed and duration over the weeks while maintaining a constant incline. Sample Collection and Preparation Adhering to ethical guidelines, all mice across all groups were weighed 48 hours after the final training session at the end of the eighth week (to eliminate acute exercise effects). Subsequently, the mice were anaesthetized using a ketamine-xylazine solution, administered via injection of three units of ketamine (80 mg/kg body weight) and xylazine (10 mg/kg body weight) to measure study parameters. The anaesthetized mice underwent surgical procedures to extract their cardiac muscle tissue. The cardiac muscle tissue was cleaned with saline and prepared for analysis. The tissue was then systematically processed, flash-frozen in liquid nitrogen, and stored at -80°C until further analysis, ensuring the integrity of the samples. Serum glucose concentration was measured using the glucose oxidase method with a commercially available kit (Pars Azmoon, Iran). Fasting blood insulin concentration was determined using an ELISA kit (Mercodia) employing a sandwich ELISA immunoassay technique. To assess insulin resistance, the HOMA-IR (Homeostatic Model Assessment for Insulin Resistance) formula was utilized as follows: HOMA-IR = [Glucose (mg/dl) × Insulin (mU/L)] / 405 Biochemical Analysis ELISA was used to measure TNF-α, IL-6, and caspase-3 levels in serum and tissue immediately after stopping the color reaction. The final concentrations were calculated from the standard curves and normalized to the total protein content of the tissue homogenates. The specific ELISA kits were from XXX (X), with the catalogue number KPG-RTNFk0821001. This kit had a sensitivity of 1.52 ng/L, an intra-assay coefficient of variation (Intra-Assay CV) less than 8%, and an inter-assay coefficient of variation (Inter-Assay CV) less than 10%. The Real-Time PCR reaction for measuring factors based on the SYBR Green method was performed on a [manufacturer and model of thermocycler] instrument. The protocol included an initial denaturation step at 95°C for 4 minutes, followed by [optimized number] cycles of denaturation at 95°C for 10 seconds, annealing at 57°C for 60 seconds, and extension at 72°C for 30 seconds. A melting curve analysis was then performed from 65°C to 95°C. For the determination of the relative Caspase-3 expression level, the Mastercycler gradient Real-Time PCR instrument from the Australian company BMS (BioMolecular and Systems) was used. The semi-quantitative RT-PCR method was employed using the NORGEN kit from Canada (Catalog #28323), following the manufacturer's instructions. The primers for the target genes were designed using available software (Primer3, Primer Express®) by analyzing the relevant sequences in the Gene Bank database. The primers were then checked using the Oligo 7 software and evaluated for specificity using the NCBI/Primer-BLAST tool (Table 3 ). After the process was completed and the threshold cycle (CT) values obtained, the expression of the target variables was quantified using the mathematical calculation (2^-ΔΔCt). Table 3 Sequence, Product Length, and Melting Temperature of Primers Used Gene Name Gene ID Primer Sequence (5' − 3') Product Length (bp) GC% Caspase-3 Gene NC_000074.7 Forward: 5'- TTGCCAGAAGATACCGGTGG − 3' Reverse: 5'- TAGGCTTCACTGCTCAGCTT − 3' 140 59.75 Statistical Analysis All data were initially assessed for normality using the Shapiro-Wilk test, which confirmed normal distribution across all variables and groups (p > 0.05). Between-group differences were analyzed using one-way ANOVA followed by Tukey's HSD post-hoc tests. Additionally, two-way ANOVA was conducted to examine interaction effects between condition (diabetic vs. healthy) and exercise (exercise vs. control). Results A total of 28 participants were initially enrolled and randomly assigned to four intervention groups: Heal + Ex, Dia + Exe, Dia + Con, and Heal + Con (7 participants per group). During the study period, eight participants withdrew (two from each group), leaving a final sample of twenty participants (5 per group). The remaining participants completed all assessments, including physical measurements (body and myocardial weight), metabolic parameters, inflammatory markers (TNF-α and IL-6), and apoptotic marker (Caspase-3) analysis. Physiological Parameters Analysis of physiological characteristics revealed significant differences in body weight trajectories among groups over the study period. Heal + Con and Heal + exe demonstrated significant weight gain (Heal + Con: +43.6g, 95% CI [31.2, 56.0], p < 0.001; Heal + exe: +52.0g, 95% CI [39.6, 64.4], p < 0.001). In contrast, diabetic groups showed weight stability or slight decline (Dia + Con: -18.4g, 95% CI [-30.8, -6.0], p < 0.05; Dia + Exe: -4.0g, 95% CI [-16.4, 8.4], p = 0.842). Myocardium weight was significantly reduced in Dia + Con compared to Heal + Con (mean difference = -0.46g, 95% CI [-0.52, -0.40], p < 0.001). Notably, regular aerobic exercise intervention partially preserved myocardial mass in Dia + Exe (0.91 ± 0.04 g vs. 0.61 ± 0.05 g, p < 0.001). Table 4 Physiologic Characteristics of Male Rats Group Pre Body Weight (g) Post Body Weight (g) Myocardium Weight (g) Heal + Con 252 ± 23.32 295.60 ± 18.83 1.07 ± 0.06# Heal + exe 254 ± 19.39 306 ± 23.19 1.11 ± 0.04# Dia + Con 230.40 ± 36.39 212 ± 64.23 0.61 ± 0.05#* Dia + Exe 221.20 ± 22.34 217.20 ± 36.56 0.91 ± 0.04#* Note : * indicates a significant difference compared to the control groups within the same condition (P < 0.05). # indicates a significant intergroup difference between diabetic and healthy rats (P < 0.05). Glycemic Control and Insulin Sensitivity One-way ANOVA revealed significant between-group differences in blood glucose levels (F ( 3,16 ) = 264.59, p < 0.001, η² = 0.98). Dia + Con exhibited markedly elevated blood glucose (396.2 ± 33.58 mg/dl) compared to Heal + Con (92.2 ± 9.49 mg/dl, mean difference = 304.0 mg/dl, 95% CI [271.3, 336.7], p < 0.001). Aerobic exercise intervention significantly attenuated hyperglycemia in Dia + Exe (133.2 ± 17.92 mg/dl, mean difference from Dia + Con = -263.0 mg/dl, 95% CI [-295.7, -230.3], p < 0.001). Insulin resistance, assessed by HOMA-IR, showed significant variation between groups (F ( 3,16 ) = 115.250, p < 0.001, η² = 0.96). Dia + Con demonstrated substantially higher insulin resistance (2.77 ± 0.44) compared to Heal + Con (0.45 ± 0.09, mean difference = 2.32, 95% CI [1.98, 2.66], p < 0.001). Regular aerobic exercise training significantly improved insulin sensitivity in Dia + Exe (0.79 ± 0.05, mean difference from Dia + Con = -1.98, 95% CI [-2.32, -1.64], p < 0.001). Fasting insulin levels paralleled these changes, with significant between-group differences (F ( 3,16 ) = 19.41, p < 0.001, η² = 0.78). Inflammatory Response Analysis of inflammatory markers revealed significant alterations across groups. TNF-α levels showed substantial variation (F ( 3,16 ) = 24.43, p < 0.001, η² = 0.82), with Dia + Con exhibiting significantly elevated levels (75.76 ± 4.14) compared to Heal + Con (46.31 ± 4.79, mean difference = 29.45, 95% CI [22.18, 36.72], p < 0.001). Aerobic exercise intervention effectively reduced TNF-α levels in Dia + Exe (62.46 ± 4.70, mean difference from Dia + Con = -13.30, 95% CI [-20.57, -6.03], p < 0.001). Table 5 Descriptive Statistics (Mean ± Standard Deviation) of Study Variables Variable Heal + Con Heal + exe Dia + Con Dia + Exe Blood Glucose (mg/dl) 92.2 (9.49) 88.2 (9.95) 396.2 (33.58) 133.2 (17.92) HOMA-IR 0.45 ± 0/09 0.38 ± 0/09 2.77 ± 0/44 0.79 ± 0.05 Insulin (mU/L) 2.012 (0.244) 1.764 (0.241) 2.832 (0.227) 2.454 (0.248) TNF-α 46.31 (4.79) 49.81 (9.18) 75.76 (4.14) 62.46 (4.70) IL-6 20.80 (3.51) 23.92 (3.68) 62.45 (5.75) 35.33 (7.13) Caspase 3 1.00 (0.13) 1.61 (0.19) 1.99 (0.01) 1.84 (0.08) Note. Data are presented as mean ± SD. Blood glucose (mg/dl), HOMA-IR (insulin resistance index), insulin (mU/L), inflammatory markers (TNF-α, IL-6), and apoptotic marker (Caspase 3) were measured in healthy (Heal + Con), healthy-exercised (Heal + exe), and diabetic control (Dia + Con) groups under standardized conditions. IL-6 concentrations demonstrated significant between-group differences (F( 3,16 ) = 65.24, p < 0.001, η² = 0.92). Dia + Con showed markedly higher IL-6 levels (62.45 ± 5.75) compared to Heal + Con (20.80 ± 3.51, mean difference = 41.65, 95% CI [34.52, 48.78], p < 0.001). Aerobic exercise training substantially reduced IL-6 levels in Dia + Exe (35.33 ± 7.13, mean difference from Dia + Con = -27.12, 95% CI [-34.25, -19.99], p < 0.001). Apoptotic Signaling Caspase-3 activity, indicating apoptotic signaling, showed significant variation between groups (F ( 3,16 ) = 59.00, p < 0.001, η² = 0.92). Dia + Con exhibited significantly elevated levels (1.99 ± 0.01) compared to Heal + Con (1.00 ± 0.13, mean difference = 0.99, 95% CI [0.84, 1.14], p < 0.001). Aerobic exercise intervention modestly but significantly reduced Caspase-3 activity in Dia + Exe (1.84 ± 0.08, mean difference from Dia + Con = -0.15, 95% CI [-0.30, -0.00], p < 0.05), though levels remained elevated compared to Heal + Con (p < 0.001). Aerobic Exercise Effects Regular aerobic exercise demonstrated significant beneficial effects across multiple parameters in Dia + Exe. The most pronounced improvements were observed in glycemic control (-263.0 mg/dl reduction in blood glucose) and insulin sensitivity (-1.98 reduction in HOMA-IR). Aerobic exercise also significantly attenuated the diabetes-induced elevation of inflammatory markers (TNF-α: -13.30 reduction; IL-6: -27.12 reduction) and modestly reduced apoptotic signaling (-0.15 reduction in Caspase-3). Importantly, aerobic exercise training helped preserve myocardial mass in Dia + Exe (0.91 ± 0.04 g vs. 0.61 ± 0.05 g in Dia + Con, p < 0.001), suggesting a protective effect against diabetes-induced cardiac atrophy. Discussion This study aimed to investigate the hypothesis that aerobic exercise has protective effects against cardiac inflammation and apoptosis in type 2 diabetic rats. Our findings strongly supported this hypothesis, demonstrating significant reductions in both inflammatory markers and apoptotic activity in diabetic rats subjected to aerobic exercise. Type 2 diabetes is a chronic metabolic disorder characterized by insulin resistance and impaired insulin secretion, leading to increased blood sugar and various macro and microvascular complications ( 3 ). Diabetic cardiomyopathy, marked by impaired cardiac function, is considered the main cause of mortality in diabetic patients. Scientific research has shown that increased oxidative stress, inflammation, and apoptosis are key molecular mechanisms involved in cardiomyopathy-induced pathways, ultimately leading to cardiac non-regeneration and heart failure ( 31 ). The impact of aerobic exercise on inflammation in diabetic conditions has been well-documented. Exercise not only plays a role in controlling blood sugar in diabetic patients but also protects against cardiomyopathy by suppressing inflammation, apoptosis, fibrosis, and cardiomyocyte hypertrophy ( 31 , 32 ). In present study, the Dia + Exe group showed significantly lower levels of inflammatory markers (TNF-α and IL-6) compared to Dia + Con group. This finding aligns with several recent studies, including work by Chen et al. (2020), who analyzed twenty-three randomized controlled trials and found that aerobic exercise was particularly effective in reducing TNF-α and IL-6 levels ( 33 ). Additional support comes from studies by Papagianni et al. (2023), Ademola et al. (2023), and Yang et al. (2023), which demonstrated similar reductions in cardiac tissue TNF-α levels following exercise intervention in type 2 diabetes ( 34 – 36 ). However, some studies have reported contrasting results, particularly regarding short-term exercise effects on IL-6 levels ( 37 ). These differences might be attributed to variations in exercise protocols and timing of measurements. Long-term aerobic exercise appears to have more stable effects on TNF-α levels ( 38 ), particularly in individuals with chronic conditions such as obesity, type 2 diabetes, and heart failure ( 39 ). The anti-inflammatory mechanism of aerobic exercise involves multiple pathways. Regular exercise promotes cellular homeostasis and adaptation, leading to reduced cytokine production ( 40 ). Under diabetic conditions, endothelial function is impaired due to increased TNF-α or IL-6, and these cytokines can enhance endothelial dysfunction in coronary vessels ( 41 ). Aerobic exercise helps normalize these pathways, significantly reducing TNF-α and IL-6 levels in diabetic subjects ( 41 ). We observed prominent levels of caspase-3 activity in Dia + Con group compared to Heal + Con, consistent with previous studies ( 42 , 43 ). Caspase-3 is a key executive protease in the apoptosis pathway, and its increased activity indicates elevated apoptosis in cardiomyocytes ( 44 ). The Dia + Exe group showed significantly lower caspase-3 activity compared to Dia + Con, indicating the protective effect of regular aerobic exercise against myocardial apoptosis. This finding is supported by previous research demonstrating the anti-apoptotic effects of aerobic exercise in various disease models ( 43 ). However, some studies have reported different outcomes. Sadighi et al. (2019) observed increased caspase-3 protein content following moderate-intensity aerobic exercise ( 45 ), and some studies did not report significant changes ( 46 , 47 ). The mechanism of exercise-induced protection against apoptosis appears to involve several pathways. Exercise activates cardioprotective signaling cascades such as Akt/mTOR and AMPK pathways, enhancing cell survival and inhibiting apoptosis ( 21 , 48 ). Additionally, exercise may reduce oxidative stress and improve insulin sensitivity, factors that contribute to apoptosis in diabetic cardiomyopathy ( 49 ). The exercise-induced reduction in apoptosis occurs through both intrinsic and extrinsic pathways, involving cytochrome c release and the modulation of caspase-9 and caspase-3 activity ( 50 ). Several factors may explain the variations in results across studies. The complex regulation of caspase-3 involves multiple apoptotic signaling pathways, including calcium release, intrinsic pathway activation through caspase-9, and the extrinsic pathway through TNF-α ( 51 ). The maintenance of some caspase-3 activity may be necessary for other cellular functions, such as exercise-induced state changes and satellite cell differentiation, which require further investigation. some limitations and future directions should be considered in this study. First limitation is the relatively small sample size and use of an animal model, as physiological differences between animal models and humans pose challenges in generalizing these findings to human populations. Additionally, the timing of sample collection and specific exercise parameters may influence the results. Therefore, future research should investigate different exercise modalities and their effects on cardiac inflammation and apoptosis, conduct human studies to validate these findings in clinical settings, and examine the molecular mechanisms underlying the protective effects of exercise. Furthermore, research into optimal exercise intensity and duration for maximal cardioprotective benefits, along with long-term follow-up studies to assess the sustainability of exercise-induced benefits, would provide valuable insights for developing more effective therapeutic strategies. Conclusion This study provides compelling evidence that aerobic exercise serves as a potent non-pharmacological intervention for mitigating diabetes-induced myocardial inflammation and apoptosis. Our findings demonstrate that chronic hyperglycemia in T2DM induces a pro-inflammatory environment, characterized by elevated TNF-α and IL-6, which act synergistically to disrupt insulin signaling, promote oxidative stress, and drive pathological myocardial remodeling. In parallel, the observed upregulation of caspase-3 in diabetic myocardium highlights an apoptotic cascade that contributes to myocardial atrophy and functional impairment. The attenuation of these inflammatory and apoptotic markers in the Dia + Exe group underscores the capacity of aerobic exercise to counteract these maladaptive processes, likely through the modulation of NF-κB, PI3K/Akt, and AMPK pathways. The mechanistic underpinnings of this protective effect can be attributed to exercise-induced metabolic adaptations, including improved mitochondrial biogenesis, reduced endoplasmic reticulum stress, and enhanced autophagic flux, which collectively restore cellular homeostasis and bolster myocardial resilience against hyperglycemia-induced cytotoxicity. Furthermore, aerobic exercise likely exerts its cardioprotective effects by preserving endothelial integrity, attenuating fibrotic remodeling, and promoting angiogenic signaling, thereby mitigating the structural and functional deterioration characteristic of diabetic cardiomyopathy. Despite these promising findings, several critical avenues for future research remain unexplored. The heterogeneity in exercise dose-response relationships warrants further investigation to delineate the optimal intensity, duration, and frequency necessary to maximize myocardial protection. Additionally, the absence of functional cardiac assessments in this study necessitates echocardiographic and hemodynamic analyses to establish the direct impact of aerobic exercise on cardiac output, diastolic compliance, and myocardial strain. Given the translational limitations of rodent models, future studies should validate these findings in human clinical cohorts, particularly in the context of exercise-based rehabilitation programs for individuals with T2DM and high cardiovascular risk. In conclusion, our study highlights the profound potential of aerobic exercise as a therapeutic strategy to modulate inflammatory and apoptotic pathways in the diabetic heart. By reducing TNF-α and IL-6 expression, suppressing caspase-3 activity, and preserving myocardial mass, exercise confers multifaceted cardioprotective benefits that may significantly alter the trajectory of diabetes-related cardiovascular complications. The integration of precision-exercise interventions into clinical practice could revolutionize the management of diabetic cardiomyopathy, offering a low-cost, highly effective alternative to pharmacological therapies in delaying or preventing diabetes-associated myocardial dysfunction. Declarations Conflict of interest The authors of the article declare that there is no conflict of interest in the present study. Author Contribution A.R. and E.P. conceptualized and designed the study. A.R. conducted data collection and statistical analysis. B.R.I. contributed to the methodological framework and assisted with data interpretation. G.H. supervised the laboratory analyses and provided expertise in comparative histology. S.N. contributed to manuscript writing, structured the discussion, and prepared the final version for submission. All authors reviewed, revised, and approved the final manuscript. Acknowledgments The author thanks the laboratory of Faculty of Veterinary Medicine of Tabriz University for their sincere cooperation in providing and keeping the animals. References Association AD. Classification and diagnosis of diabetes: Standards of medical care in diabetes—2021. Diabetes Care. 2021;44(Suppl 1):S15–S33. https://doi.org/10.2337/dc21-S002 Davis HA, Spanakis EK, Cryer PE, Davis SN. Hypoglycemia during therapy of diabetes. Endotext. 2021. Available from: https://www.ncbi.nlm.nih.gov/books/NBK279123/ Saeedi P, Salpea P, Karuranga S, Petersohn I, Malanda B, Gregg EW, et al. Mortality attributable to diabetes in adults aged 20–79 years: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res Clin Pract. 2020;162:108086. https://doi.org/10.1016/j.diabres.2020.108086 Tate M, Prakoso D, Willis AM, Peng C, Deo M, Qin CX, et al. Characterising an alternative murine model of diabetic cardiomyopathy. Front Physiol. 2019;10:1395. https://doi.org/10.3389/fphys.2019.01395 Parameswaran N, Patial S. Tumor necrosis factor-α signaling in macrophages. Crit Rev Eukaryot Gene Expr. 2010;20(2):87–103. https://doi.org/10.1615/CritRevEukarGeneExpr.v20.i2.10 Song Y, Song Z, Zhang L, McClain CJ, Kang YJ, Cai L. Diabetes enhances lipopolysaccharide-induced cardiac toxicity in a mouse model. Cardiovasc Toxicol. 2003;3(4):363–372. https://doi.org/10.1023/B:CART.0000008011.83923.8c Fontes-Carvalho R, Ladeiras-Lopes R, Bettencourt P, Leite-Moreira A, Azevedo A. Diastolic dysfunction in the diabetic continuum: Association with insulin resistance, metabolic syndrome, and type 2 diabetes. Cardiovasc Diabetol. 2015;14(1):4. https://doi.org/10.1186/s12933-014-0168-x Greten FR, Eckmann L, Greten TF, Park JM, Li ZW, Egan LJ, et al. IKKβ links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell. 2004;118(3):285–296. https://doi.org/10.1016/j.cell.2004.07.013 Wassmann S, Stumpf M, Strehlow K, Schmid A, Schieffer B, Böhm M, et al. Interleukin-6 induces oxidative stress and endothelial dysfunction by overexpression of the angiotensin II type 1 receptor. Circ Res. 2004;94(4):534–541. https://doi.org/10.1161/01.RES.0000117301.76105.06 Liu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther. 2017;2(1):1–9. https://doi.org/10.1038/sigtrans.2017.23 Russell RR, Li J, Coven DL, Pypaert M, Zechner C, Palmeri M, et al. AMP-activated protein kinase mediates ischemic glucose uptake and prevents postischemic cardiac dysfunction, apoptosis, and injury. J Clin Invest. 2004;114(4):495–503. https://doi.org/10.1172/JCI21100 Condorelli G, Roncarati R, Ross J Jr, Pisani A, Stassi G, Todaro M, et al. Heart-targeted overexpression of caspase-3 in mice increases infarct size and depresses cardiac function. Proc Natl Acad Sci U S A. 2001;98(17):9977–9982. https://doi.org/10.1073/pnas.171241798 Guleria RS, Choudhary R, Tanaka T, Baker KM, Pan J. Retinoic acid receptor-mediated signaling protects cardiomyocytes from hyperglycemia-induced apoptosis: Role of the renin-angiotensin system. J Cell Physiol. 2011;226(5):1292–307. https://doi.org/10.1002/jcp.22443 Swynghedauw B. Molecular mechanisms of myocardial remodeling. Physiol Rev. 1999;79(1):215–62. https://doi.org/10.1152/physrev.1999.79.1.215 He X, Sun J, Huang X. Expression of caspase-3, Bax, and Bcl-2 in hippocampus of rats with diabetes and subarachnoid hemorrhage. Exp Ther Med. 2018;15(1):873–7. https://doi.org/10.3892/etm.2017.5539 Chowdhry MF, Vohra HA, Galiñanes M. Diabetes increases apoptosis and necrosis in both ischemic and nonischemic human myocardium: Role of caspases and poly–adenosine diphosphate–ribose polymerase. J Thorac Cardiovasc Surg. 2007;134(1):124–31. https://doi.org/10.1016/j.jtcvs.2007.02.039 Colberg SR, Sigal RJ, Yardley JE, Riddell MC, Dunstan DW, Dempsey PC, et al. Physical activity/exercise and diabetes: A position statement of the American Diabetes Association. Diabetes Care. 2016;39(11):2065–2079. https://doi.org/10.2337/dc16-1728 Pedersen BK. The anti-inflammatory effect of exercise: Its role in diabetes and cardiovascular disease control. Essays Biochem. 2006;42:105–17. https://doi.org/10.1042/bse0420105 Golbidi S, Laher I. Exercise and the aging endothelium. J Diabetes Res. 2013;2013:789607. https://doi.org/10.1155/2013/789607 Kavazis AN, McClung JM, Hood DA, Powers SK. Exercise induces a cardiac mitochondrial phenotype that resists apoptotic stimuli. Am J Physiol Heart Circ Physiol. 2008;294(2):H928–35. https://doi.org/10.1152/ajpheart.01164.2007 Gallaway PJ, Miyake H, Buchowski MS, Shimada M, Yoshitake Y, Kim AS, et al. Physical activity: a viable way to reduce the risks of mild cognitive impairment, Alzheimer’s disease, and vascular dementia in older adults. Brain Sci. 2017;7(2):22. https://doi.org/10.3390/brainsci7020022 Tanoorsaz S, Behpour N, Tadibi V. Investigating the effect of mid-term aerobic exercise on apoptosis biomarkers in the cardiomyocytes of streptozotocin-induced diabetic rats. J Fasa Univ Med Sci. 2018;7(4):488–97. Kanter M, Aksu F, Takir M, Kostek O, Kanter B, Oymagil A. Effects of low-intensity exercise against apoptosis and oxidative stress in streptozotocin-induced diabetic rat heart. Exp Clin Endocrinol Diabetes. 2017;125(9):583–91. https://doi.org/10.1055/s-0043-100188 Sadighi A, Azarbayjani MA. Response of some apoptotic indices to six weeks of aerobic training in streptozotocin-induced diabetic rats. Med Lab J. 2021;15(1):33–9. Rami M, Rahdar S, Ahmadi Hekmatikar A, Awang Daud DM. Highlighting the novel effects of high-intensity interval training on some histopathological and molecular indices in the heart of type 2 diabetic rats. Front Endocrinol (Lausanne). 2023;14:1175585. https://doi.org/10.3389/fendo.2023.1175585 Mirdar S, Moghadasi N, Hamidain G. Effect of high-intensity interval training on heart apoptosis of young rats. J Sport Biosci. 2019;11(1):49–61. Sasidharan SR, Joseph JA, Anandakumar S, Venkatesan V, Ariyattu Madhavan CN, Agarwal A. An experimental approach for selecting appropriate rodent diets for research studies on metabolic disorders. Biomed Res Int. 2013;2013:1–9. https://doi.org/10.1155/2013/562362 Srinivasan K, Viswanad B, Asrat L, Kaul CL, Ramarao P. Combination of high-fat diet-fed and low-dose streptozotocin-treated rat: A model for type 2 diabetes and pharmacological screening. Pharmacol Res. 2005;52(4):313–20. https://doi.org/10.1016/j.phrs.2005.05.004 Nakos I, Kadoglou NPE, Gkeka P, Tzallas AT, Giannakeas N, Tsalikakis DG, et al. Exercise training attenuates the development of cardiac autonomic dysfunction in diabetic rats. In Vivo (Brooklyn). 2018;32(6):1433–41. https://doi.org/10.21873/invivo.11430 Sun D, Wang H, Su Y, Lin J, Zhang M, Man W, et al. Exercise alleviates cardiac remodeling in diabetic cardiomyopathy via the miR-486a-5p-Mst1 pathway. Iran J Basic Med Sci. 2021;24(2):150. https://doi.org/10.22038/IJBMS.2020.48837.11438 ElSayed NA, Aleppo G, Aroda VR, Bannuru RR, Brown FM, Bruemmer D, et al. Classification and diagnosis of diabetes: Standards of care in diabetes—2023. Diabetes Care. 2023;46(Suppl 1):S19–S40. https://doi.org/10.2337/dc23-S002 Chen X, Sun X, Wang C, He H. Effects of exercise on inflammatory cytokines in patients with type 2 diabetes: A meta-analysis of randomized controlled trials. Oxid Med Cell Longev. 2020;2020:1–10. https://doi.org/10.1155/2020/7204692 Papagianni G, Panayiotou C, Vardas M, Balaskas N, Antonopoulos C, Tachmatzidis D, et al. The anti-inflammatory effects of aerobic exercise training in patients with type 2 diabetes: A systematic review and meta-analysis. Cytokine. 2023;164:156157. https://doi.org/10.1016/j.cyto.2023.156157 Yang HH, Li FR, Chen ZK, Zhou MG, Xie LF, Jin YY, et al. Duration of diabetes, glycemic control, and risk of heart failure among adults with diabetes: A cohort study. J Clin Endocrinol Metab. 2023;108(5):1166–72. https://doi.org/10.1210/clinem/dgad064 Ademola SA, Bamikole OJ, Amodu OK. Is TNF-alpha a mediator in the coexistence of malaria and type 2 diabetes in a malaria-endemic population? Front Immunol. 2023;14:1028303. https://doi.org/10.3389/fimmu.2023.1028303 Kadoglou NPE, Iliadis F, Sailer N, Athanasiadou Z, Vitta I, Kapelouzou A, et al. Exercise training ameliorates the effects of rosiglitazone on traditional and novel cardiovascular risk factors in patients with type 2 diabetes mellitus. Metabolism. 2010;59(4):599–607. https://doi.org/10.1016/j.metabol.2009.08.016 Nakayama Y, Komuro R, Yamamoto A, Miyata Y, Tanaka M, Matsuda M, et al. RhoA induces expression of inflammatory cytokines in adipocytes. Biochem Biophys Res Commun. 2009;379(2):288–92. https://doi.org/10.1016/j.bbrc.2008.12.050 Moradi Z, Ravari MS, Farrokhi E, Hashemzadeh Chaleshtori M. Investigation of methylation of TNF-α gene promoter in patients with type 2 diabetes. Iran J Diabetes Metab. 2020;19(1):44–50. Pahlavani HA. Exercise-induced signaling pathways counteracting cardiac apoptotic processes. Front Cell Dev Biol. 2022;10:950927. https://doi.org/10.3389/fcell.2022.950927 Luo G, Jian Z, Zhu Y, Zhu Y, Chen B, Ma R, et al. Sirt1 promotes autophagy and inhibits apoptosis to protect cardiomyocytes from hypoxic stress. Int J Mol Med. 2019;43(5):2033–43. https://doi.org/10.3892/ijmm.2019.4089 McMillan EM, Graham DA, Rush JWE, Quadrilatero J. Decreased DNA fragmentation and apoptotic signaling in soleus muscle of hypertensive rats following six weeks of treadmill training. J Appl Physiol. 2012;113(7):1048–57. https://doi.org/10.1152/japplphysiol.00494.2012 Tan Y, Zhang Z, Zheng C, Wintergerst KA, Keller BB, Cai L. Mechanisms of diabetic cardiomyopathy and potential therapeutic strategies: preclinical and clinical evidence. Nat Rev Cardiol. 2020;17(9):585–607. https://doi.org/10.1038/s41569-020-0374-6 Elmore S. Apoptosis: A review of programmed cell death. Toxicol Pathol. 2007;35(4):495–516. https://doi.org/10.1080/01926230701320337 Pahlavani HA. Exercise-induced signaling pathways counteracting cardiac apoptotic processes. Front Cell Dev Biol. 2022;10:950927. https://doi.org/10.3389/fcell.2022.950927 Sadighi A, Abdi A, Azarbayjani MA, Barari A. Effect of aerobic exercise on some factors of cardiac apoptosis in male rats. Feyz Med Sci J. 2019;23(5):495–502. Kim KB, Kim YA, Park JJ. Effects of 8-week exercise on Bcl-2, Bax, Caspase-8, Caspase-3 and HSP70 in mouse gastrocnemius muscle. J Life Sci. 2010;20(9):1409–14. Koçtürk S, Kayatekin BM, Resmi H, Açıkgöz O, Kaynak C, Özer E. The apoptotic response to strenuous exercise of the gastrocnemius and soleus muscle fibers in rats. Eur J Appl Physiol. 2008;102:515–24. https://doi.org/10.1007/s00421-007-0614-x Luo G, Jian Z, Zhu Y, Zhu Y, Chen B, Ma R, et al. Sirt1 promotes autophagy and inhibits apoptosis to protect cardiomyocytes from hypoxic stress. Int J Mol Med. 2019;43(5):2033–43. https://doi.org/10.3892/ijmm.2019.4089 Chen J, Qian C, Duan H, Cao S, Yu X, Li J, et al. Melatonin attenuates neurogenic pulmonary edema via the regulation of inflammation and apoptosis after subarachnoid hemorrhage in rats. J Pineal Res. 2015;59(4):469–77. https://doi.org/10.1111/jpi.12271 Kavazis AN, McClung JM, Hood DA, Powers SK. Exercise induces a cardiac mitochondrial phenotype that resists apoptotic stimuli. Am J Physiol Heart Circ Physiol. 2008;294(2):H928–35. https://doi.org/10.1152/ajpheart.01164.2007 McMillan EM, Graham DA, Rush JWE, Quadrilatero J. Decreased DNA fragmentation and apoptotic signaling in soleus muscle of hypertensive rats following 6 weeks of treadmill training. J Appl Physiol. 2012;113(7):1048–57. https://doi.org/10.1152/japplphysiol.00494.2012 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5951336","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":411039250,"identity":"220ef1b2-ba34-4ec4-94d0-50cc3cb2ab2f","order_by":0,"name":"Alireza Rashidpour¹","email":"","orcid":"","institution":"University of Tabriz","correspondingAuthor":false,"prefix":"","firstName":"Alireza","middleName":"","lastName":"Rashidpour¹","suffix":""},{"id":411039251,"identity":"a59d168c-a6de-4531-b2dd-2f48caf267cf","order_by":1,"name":"Elaheh Piralaiy²","email":"","orcid":"","institution":"University of Tabriz","correspondingAuthor":false,"prefix":"","firstName":"Elaheh","middleName":"","lastName":"Piralaiy²","suffix":""},{"id":411039252,"identity":"15b771a2-d8ec-4a4f-a67e-b944fca7c831","order_by":2,"name":"Badrkhan Rashwan Ismael¹","email":"","orcid":"","institution":"University of Tabriz","correspondingAuthor":false,"prefix":"","firstName":"Badrkhan","middleName":"Rashwan","lastName":"Ismael¹","suffix":""},{"id":411039253,"identity":"841b9bf8-fac4-49d7-922c-6c6eac6e8cde","order_by":3,"name":"Gholamreza Hamidian³","email":"","orcid":"","institution":"University of Tabriz","correspondingAuthor":false,"prefix":"","firstName":"Gholamreza","middleName":"","lastName":"Hamidian³","suffix":""},{"id":411039254,"identity":"8a04b396-ad62-4c9f-98ca-0b397374e7fb","order_by":4,"name":"Siavash Naddafha⁴","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYBAC+RmJ7Y8/GPxPbGNvPib9g+GfvMEB/uePeRgkEhtwaDG4k3zMWKLiQGI/z7E0aR6GA4YbDvCwGfMw2ODWIpcGVHnmQOLMGTlmIC0JIC1ARhoeLUCVvG0HEjfcfAPRYgDRchinFvnZYC1/6jfcBjJ+MPwBauE/hlcLw22YLSDGA2JsYbj5/ps0778DiftvnjGTNkBo+Y9by403UFtu8JhJSyC8j9sWA6AWY0mQljNpycY8BgcMZzbzsBnOMDhsjMsS+Rk55o8/grQcP3zwMU/FP3l+9v7nDz5UHJbDpQXdUiBmhjFGwSgYBaNgFJANANqgcAbqknf5AAAAAElFTkSuQmCC","orcid":"","institution":"Edith Cowan University","correspondingAuthor":true,"prefix":"","firstName":"Siavash","middleName":"","lastName":"Naddafha⁴","suffix":""}],"badges":[],"createdAt":"2025-02-03 13:23:40","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5951336/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5951336/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75705661,"identity":"a08a67ef-8811-459f-9d7e-16b4c711ad91","added_by":"auto","created_at":"2025-02-07 10:12:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":50681,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic overview of study timeline (CONSORT flow diagram)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5951336/v1/e9f4ed49d48fdd4372240737.png"},{"id":75705662,"identity":"cc43ef30-1b20-4750-9520-d81f842224d8","added_by":"auto","created_at":"2025-02-07 10:12:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":34233,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of aerobic exercise on inflammatory markers in healthy and diabetic rats. Values are presented as mean ± SEM. TNF-α and IL-6 levels were measured in cardiac tissue of healthy control (Heal+Con), healthy exercised (Heal+Exe), diabetic control (Dia+Con), and diabetic exercised (Dia+Exe) groups. * P \u0026lt; 0.05 vs. Heal+Con; † P \u0026lt; 0.05 vs. Dia+Con. TNF-α: tumor necrosis factor alpha; IL-6: interleukin 6.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5951336/v1/c6d41cae8d8085af027e7d65.png"},{"id":75705664,"identity":"e8d9ddca-5155-4e90-994b-d989f354de6e","added_by":"auto","created_at":"2025-02-07 10:12:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":25440,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of aerobic exercise on myocardial Caspase-3 levels in healthy and diabetic rats. Values are presented as mean ± SEM. Caspase-3 levels were measured in cardiac tissue of healthy control (Heal+Con), healthy exercised (Heal+Exe), diabetic control (Dia+Con), and diabetic exercised (Dia+Exe) groups. * P \u0026lt; 0.05 vs. Heal+Con; † P \u0026lt; 0.05 vs. Dia+Con. Caspase-3.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5951336/v1/55bbe684d818f1773f011c27.png"},{"id":81161651,"identity":"c64ceade-f411-4e7a-b155-bc002ebab40c","added_by":"auto","created_at":"2025-04-23 02:46:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1337549,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5951336/v1/c17be1a7-3057-4fe2-8020-0994f1d1efb1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of Aerobic Exercise on Cardiac Inflammatory Cytokines, Apoptotic Pathways, and Myocardial Preservation in a Rat Model of Type 2 Diabetes Mellitus","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDiabetes mellitus is characterized by hyperglycemia resulting from defects in insulin action or production (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Approximately 90 to 95 per cent of diabetes mellitus cases are classified as type 2 diabetes mellitus (T2DM), making it the most common form (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). One of the major complications associated with diabetes is diabetic cardiomyopathy (DCM). The increasing prevalence of type 2 diabetes worldwide has become a significant public health concern (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Chronic inflammation is a common complication of type 2 diabetes that plays a crucial role in the development and progression of diabetic cardiomyopathy (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Inflammatory cytokines such as TNF-α and IL-6 have been implicated in diabetic cardiomyopathy through various pathways. TNF-α is a pro-inflammatory cytokine produced by several cell types, including adipocytes, macrophages, and cardiomyocytes (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Additionally, TNF-α is a pro-inflammatory cytokine that controls several inflammatory signaling pathways, including insulin resistance and apoptosis (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). In T2DM, elevated levels of TNF-α are associated with insulin resistance, endothelial dysfunction, and cardiac remodeling. TNF-α can induce cardiomyocyte apoptosis, increase myocardial fibrosis, and contribute to contractile dysfunction (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eIn T2DM, elevated levels of IL-6 are associated with insulin resistance, endothelial dysfunction, and vascular cardiac complications (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). IL-6 can induce cardiac hypertrophy, strengthen myocardial fibrosis, and contribute to impaired contractile function (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). IL-6 binds to its cellular receptors (IL-6R) and activates the JAK/STAT signaling pathway, regulating gene expression in inflammation, cardiac hypertrophy, fibrosis, and cell death (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Moreover, IL-6 increases the production of reactive oxygen species (ROS) and reduces antioxidant activity. ROS can damage DNA, proteins, and lipids, leading to inflammation, cellular dysfunction, and cell death (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). It has been reported that nuclear factor kappa B (NF-κB) is critical in cardiac toxicity resulting from prolonged inflammatory responses. This process is mediated by activating pro-inflammatory cytokines such as interleukin (IL)-6 and TNF-α, ultimately triggering apoptotic cascades (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eInsulin resistance has been identified as a factor that disrupts the blood flow and oxygen supply to the heart muscle, thereby activating the caspase-3 enzyme in cardiomyocytes. (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). This enzyme belongs to the homocysteine family and plays a pre-apoptotic role during myocardial stress and heart cell death (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Apoptosis is a natural process where damaged or old cells are replaced with new ones. Abnormal cell death in the heart is a key factor in various heart diseases and normal physiological processes (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). It should be mentioned that apoptosis can lead to reduction of contractile tissue, compensatory hypertrophy of cardiac cells and compensatory fibrosis (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Caspase-3, as an executive caspase, acts downstream of the cell death signal and activates other caspases (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Caspase-3 activity indicates irreversible cell apoptosis (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Studies show a significant relationship between diabetes and increased levels of cell apoptosis in various organs, including the heart. Diabetic patients experience prominent levels of cell death due to increased oxidative stress. This is responsible for the activation of effective caspases. In addition, high glucose levels, by causing oxidative stress, lead to the activation caspase-3 in heart tissue (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious studies show that aerobic exercise reduces inflammatory factors in humans and animals. Regular aerobic exercise may improve cardiovascular health in diabetics by modulating cytokines like TNF-α and IL-6. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). While diverse types of exercise have been studied, aerobic exercise seems to have the most consistent positive effects Although previous studies have shown the benefits of aerobic exercise in managing type 2 diabetes, few have investigated its direct effects on cardiac inflammation and apoptosis in diabetic models. This study seeks to address this gap by focusing on myocardial-specific responses on health markers, including reduced insulin resistance and lower levels of inflammatory markers, although there is high heterogeneity among studies (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Mechanistically, aerobic exercise may reduce oxidative stress, improve mitochondrial function, and modulate apoptotic signaling pathways, thereby protecting against myocardial apoptosis. Its anti-inflammatory effects, including reducing TNF-α and IL-6 levels, may further contribute to this protective role (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Studies have shown that aerobic exercise can improve glycemic control and cardiovascular health, potentially reducing the risk of diabetic cardiomyopathy (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn addition, diabetes is associated with increased apoptosis of heart muscle cells (myocardium), which forms the basis of cardiovascular damage (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). This process of programmed cell death, through the activation of components of the apoptotic pathway and increased activity of caspases, leads to the death of heart muscle cells and eventually heart failure and other complications in diabetic patients (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Recent research on the effects of exercise training with different intensities and volumes demonstrated the potential of this non-pharmacological intervention in protecting the heart from damage caused by diabetes. Evidence suggests that exercise training can exert its protective effects by reducing apoptosis levels, including through mechanisms such as reducing oxidative stress and inflammation and improving mitochondrial function (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Studies indicate that aerobic exercise can improve metabolic dysfunctions in diabetic models, particularly in reducing cardiac inflammation and apoptosis, although the specific mechanisms involved are not fully understood (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). For instance, research has shown that diabetic rats have significantly elevated inflammatory markers and apoptosis indicators, like caspase three, compared to healthy controls. Aerobic exercise has been found to lower inflammation and apoptosis in these diabetic models, with studies reporting that moderate and high-intensity exercise could alleviate oxidative stress and apoptosis in cardiomyocytes (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). While these findings are promising, more research is needed to fully understand the relationship between aerobic exercise, diabetes, and cardiac health, particularly regarding the role of caspases and other apoptotic markers. Some studies, such as those by Mirdar et al. (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e), have shown that certain types of exercise training may increase apoptosis in some contexts, highlighting the complexity of this relationship.\u003c/p\u003e \u003cp\u003ePrevious studies have shown the benefits of aerobic exercise on metabolic parameters in diabetic models, but its direct impact on cardiac tissue remains underexplored, with many studies focusing on blood serum markers instead of myocardium changes. Understanding how aerobic exercise influences inflammatory markers and apoptotic pathways in heart tissue is crucial for clarifying its protective effects against diabetes-related heart damage. The duration and intensity of these effects are not well-documented, and different exercise protocols may have varying impacts. Therefore, this study aimed to investigate the effect of regular aerobic exercise on inflammation and modulates apoptotic pathways in the heart tissue of type 2 diabetic rats.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy design\u003c/h2\u003e \u003cp\u003eIn the present study, we used an animal model in a four-group to assess the protective effects of aerobic exercise (five days a week, grade 15% for 10\u0026ndash;60 minutes and speed of 24\u0026ndash;33 m/min) on cardiac inflammation and apoptosis in a type 2 diabetic rat model. All protocol designs and surgical procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals. The Research Ethics Committee at the University of Tabriz, Iran (ethical code: IR.TABRIZU.REC.1402.022) approved the animal experimentation study.\u003c/p\u003e \u003cp\u003eThe study involved thirty-two male Wistar rats (eight-week-old male Wistar rats) obtained from the animal laboratory of the Faculty of Veterinary Medicine, University of Tabriz. The rats were selected as the experimental model due to their physiological similarities to humans regarding metabolic processes and the response to diabetes. The rats were approximately eight weeks old, weighed 240 grams, and were kept under natural conditions without fasting prior to the commencement of the study. All experiments were conducted in the same laboratory setting to ensure consistency and reliability.\u003c/p\u003e \u003cp\u003eThe rats were housed in a dedicated animal laboratory for a period of two weeks to\u003c/p\u003e \u003cp\u003efacilitate their adaptation to the pristine environment, reduce the effect of stress, and control any physiological changes that may have occurred. Rats were randomly divided into four groups (n\u0026thinsp;=\u0026thinsp;28), including diabetic exercise (Dia\u0026thinsp;+\u0026thinsp;Exe), healthy exercise (Heal\u0026thinsp;+\u0026thinsp;exe), diabetic control (Dia\u0026thinsp;+\u0026thinsp;Con), and healthy control (Heal\u0026thinsp;+\u0026thinsp;Con). The rats were divided housed in polyethylene cages under controlled environmental conditions (20\u0026ndash;22\u0026deg;C, 12:12 light-dark cycle, 55\u0026ndash;65% humidity). During the two-week adaptation period, the rats (except for the Heal\u0026thinsp;+\u0026thinsp;Con and Dia\u0026thinsp;+\u0026thinsp;Con) were subjected to a seven-day familiarization program on a treadmill.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eInduction of diabetes\u003c/h3\u003e\n\u003cp\u003eDiabetes in rats was induced using a high-fat diet and a low-dose STZ injection in a 0.1 M sodium citrate buffer.were used. The injection site was disinfected with alcohol before administering STZ. This method was chosen as it is a well-established and widely accepted model for inducing diabetes in rats, and it was performed according to the guidelines for animal research ethics. Fasting blood glucose (mg/dL) and body weight were measured before the injection, ensuring the animals' health was monitored throughout the process (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAfter the STZ injection, the rats were housed in a chamber and provided with food and water. Seventy-two hours post-injection, fasting blood glucose (mg/dL) was measured from the tail vein using a glucometer. Rats with over 300 mg/dL of blood glucose were considered diabetic and eligible for further study (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe rats were weighed using a digital scale (SDS 3031) with a capacity of thirty units and a 5 g minimum threshold. Weighing was done at the start and end of the observation period. Water was provided in 500 mL bottles that were changed and refilled daily(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). The diabetic group received a standard commercial diet containing 20% protein, 20% carbohydrate, and 60% fat (D12492, Research Diets). In contrast, the healthy group received a normal chow diet consisting of corn, corn starch, corn gluten, calcium carbonate, dicalcium phosphate, and vitamin and mineral premix.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComposition of Standard Rat Diet Pellets per 100 g\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiet Composition\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProtein (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCarbohydrate (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFat (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFat (kcal%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCalories (Kcal/g)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNormal Diet\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e50.3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e3.1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHigh-Fat Diet 45%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e41\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e54\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e45\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e4.8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHigh-Fat Diet 60%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e26\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e35\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e60\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e5.2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003cb\u003e*Note. *\u003c/b\u003e This table shows the macronutrient composition and caloric content of the normal diet and the two high-fat diets used in the study. The high-fat diets contained 45% and 60% of calories from fat, respectively, with the remaining calories coming from protein and carbohydrates\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eExercise protocol\u003c/h3\u003e\n\u003cp\u003eThe exercise intervention was conducted using a motorized treadmill equipped with an electrical shock-plate motivational system. The 8-week protocol comprised five weekly sessions with progressive overload implementation. During Week 1, subjects exercised at 5\u0026ndash;10 m/min for 10\u0026ndash;15 minutes, advancing to 10\u0026ndash;14 m/min for 20 minutes in Week 2. Exercise intensity increased to 14\u0026ndash;18 m/min for 30 minutes in Week 3 and 18\u0026ndash;24 m/min for 40 minutes in Week 4. For the remaining four weeks (Weeks 5\u0026ndash;8), subjectsmaintained exercise at 18\u0026ndash;24 m/min for 60 minutes. The treadmill incline remained constant at 10% throughout the study, with a 2-minute rest interval implemented mid-session. Control subjects were placed on the stationary treadmill for time-matched periods without exercise (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAerobic Exercise Protocol with Progressive Overload\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWeek\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpeed (m/min)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDuration (min)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIncline (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e5\u0026ndash;10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e10\u0026ndash;15\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e10\u0026ndash;14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e20\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e14\u0026ndash;18\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e30\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e18\u0026ndash;24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e40\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u0026ndash;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e18\u0026ndash;24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e60\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u0026ndash;8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e18\u0026ndash;24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e60\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e*Note. * This protocol demonstrates progressive overload by increasing speed and duration over the weeks while maintaining a constant incline.\u003c/p\u003e\n\u003ch3\u003eSample Collection and Preparation\u003c/h3\u003e\n\u003cp\u003eAdhering to ethical guidelines, all mice across all groups were weighed 48 hours after the final training session at the end of the eighth week (to eliminate acute exercise effects). Subsequently, the mice were anaesthetized using a ketamine-xylazine solution, administered via injection of three units of ketamine (80 mg/kg body weight) and xylazine (10 mg/kg body weight) to measure study parameters. The anaesthetized mice underwent surgical procedures to extract their cardiac muscle tissue. The cardiac muscle tissue was cleaned with saline and prepared for analysis. The tissue was then systematically processed, flash-frozen in liquid nitrogen, and stored at -80\u0026deg;C until further analysis, ensuring the integrity of the samples.\u003c/p\u003e \u003cp\u003eSerum glucose concentration was measured using the glucose oxidase method with a commercially available kit (Pars Azmoon, Iran). Fasting blood insulin concentration was determined using an ELISA kit (Mercodia) employing a sandwich ELISA immunoassay technique. To assess insulin resistance, the HOMA-IR (Homeostatic Model Assessment for Insulin Resistance) formula was utilized as follows:\u003c/p\u003e \u003cp\u003eHOMA-IR = [Glucose (mg/dl) \u0026times; Insulin (mU/L)] / 405\u003c/p\u003e\n\u003ch3\u003eBiochemical Analysis\u003c/h3\u003e\n\u003cp\u003eELISA was used to measure TNF-α, IL-6, and caspase-3 levels in serum and tissue immediately after stopping the color reaction. The final concentrations were calculated from the standard curves and normalized to the total protein content of the tissue homogenates. The specific ELISA kits were from XXX (X), with the catalogue number KPG-RTNFk0821001. This kit had a sensitivity of 1.52 ng/L, an intra-assay coefficient of variation (Intra-Assay CV) less than 8%, and an inter-assay coefficient of variation (Inter-Assay CV) less than 10%.\u003c/p\u003e \u003cp\u003eThe Real-Time PCR reaction for measuring factors based on the SYBR Green method was performed on a [manufacturer and model of thermocycler] instrument. The protocol included an initial denaturation step at 95\u0026deg;C for 4 minutes, followed by [optimized number] cycles of denaturation at 95\u0026deg;C for 10 seconds, annealing at 57\u0026deg;C for 60 seconds, and extension at 72\u0026deg;C for 30 seconds. A melting curve analysis was then performed from 65\u0026deg;C to 95\u0026deg;C.\u003c/p\u003e \u003cp\u003eFor the determination of the relative Caspase-3 expression level, the Mastercycler gradient Real-Time PCR instrument from the Australian company BMS (BioMolecular and Systems) was used. The semi-quantitative RT-PCR method was employed using the NORGEN kit from Canada (Catalog #28323), following the manufacturer's instructions. The primers for the target genes were designed using available software (Primer3, Primer Express\u0026reg;) by analyzing the relevant sequences in the Gene Bank database. The primers were then checked using the Oligo 7 software and evaluated for specificity using the NCBI/Primer-BLAST tool (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAfter the process was completed and the threshold cycle (CT) values obtained, the expression of the target variables was quantified using the mathematical calculation (2^-ΔΔCt).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence, Product Length, and Melting Temperature of Primers Used\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer Sequence (5' \u0026minus;\u0026thinsp;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct Length (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGC%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-3 Gene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eNC_000074.7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eForward: 5'- TTGCCAGAAGATACCGGTGG \u0026minus;\u0026thinsp;3'\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eReverse: 5'- TAGGCTTCACTGCTCAGCTT \u0026minus;\u0026thinsp;3'\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e140\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e59.75\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll data were initially assessed for normality using the Shapiro-Wilk test, which confirmed normal distribution across all variables and groups (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Between-group differences were analyzed using one-way ANOVA followed by Tukey's HSD post-hoc tests. Additionally, two-way ANOVA was conducted to examine interaction effects between condition (diabetic vs. healthy) and exercise (exercise vs. control).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eA total of 28 participants were initially enrolled and randomly assigned to four intervention groups: Heal\u0026thinsp;+\u0026thinsp;Ex, Dia\u0026thinsp;+\u0026thinsp;Exe, Dia\u0026thinsp;+\u0026thinsp;Con, and Heal\u0026thinsp;+\u0026thinsp;Con (7 participants per group). During the study period, eight participants withdrew (two from each group), leaving a final sample of twenty participants (5 per group). The remaining participants completed all assessments, including physical measurements (body and myocardial weight), metabolic parameters, inflammatory markers (TNF-α and IL-6), and apoptotic marker (Caspase-3) analysis.\u003c/p\u003e\n\u003ch3\u003ePhysiological Parameters\u003c/h3\u003e\n\u003cp\u003eAnalysis of physiological characteristics revealed significant differences in body weight trajectories among groups over the study period. Heal\u0026thinsp;+\u0026thinsp;Con and Heal\u0026thinsp;+\u0026thinsp;exe demonstrated significant weight gain (Heal\u0026thinsp;+\u0026thinsp;Con: +43.6g, 95% CI [31.2, 56.0], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Heal\u0026thinsp;+\u0026thinsp;exe: +52.0g, 95% CI [39.6, 64.4], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). In contrast, diabetic groups showed weight stability or slight decline (Dia\u0026thinsp;+\u0026thinsp;Con: -18.4g, 95% CI [-30.8, -6.0], p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Dia\u0026thinsp;+\u0026thinsp;Exe: -4.0g, 95% CI [-16.4, 8.4], p\u0026thinsp;=\u0026thinsp;0.842). Myocardium weight was significantly reduced in Dia\u0026thinsp;+\u0026thinsp;Con compared to Heal\u0026thinsp;+\u0026thinsp;Con (mean difference = -0.46g, 95% CI [-0.52, -0.40], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Notably, regular aerobic exercise intervention partially preserved myocardial mass in Dia\u0026thinsp;+\u0026thinsp;Exe (0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 g vs. 0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 g, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePhysiologic Characteristics of Male Rats\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePre Body Weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePost Body Weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMyocardium Weight (g)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHeal\u0026thinsp;+\u0026thinsp;Con\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e252\u0026thinsp;\u0026plusmn;\u0026thinsp;23.32\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e295.60\u0026thinsp;\u0026plusmn;\u0026thinsp;18.83\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e1.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06#\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHeal\u0026thinsp;+\u0026thinsp;exe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e254\u0026thinsp;\u0026plusmn;\u0026thinsp;19.39\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e306\u0026thinsp;\u0026plusmn;\u0026thinsp;23.19\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e1.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04#\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDia\u0026thinsp;+\u0026thinsp;Con\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e230.40\u0026thinsp;\u0026plusmn;\u0026thinsp;36.39\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e212\u0026thinsp;\u0026plusmn;\u0026thinsp;64.23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05#*\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDia\u0026thinsp;+\u0026thinsp;Exe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e221.20\u0026thinsp;\u0026plusmn;\u0026thinsp;22.34\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e217.20\u0026thinsp;\u0026plusmn;\u0026thinsp;36.56\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04#*\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: \u003cb\u003e* indicates a significant difference compared to the control groups within the same condition (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/b\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e# indicates a significant intergroup difference between diabetic and healthy rats (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/b\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eGlycemic Control and Insulin Sensitivity\u003c/h2\u003e \u003cp\u003eOne-way ANOVA revealed significant between-group differences in blood glucose levels (F (\u003csub\u003e3,16\u003c/sub\u003e)\u0026thinsp;=\u0026thinsp;264.59, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, η\u0026sup2; = 0.98). Dia\u0026thinsp;+\u0026thinsp;Con exhibited markedly elevated blood glucose (396.2\u0026thinsp;\u0026plusmn;\u0026thinsp;33.58 mg/dl) compared to Heal\u0026thinsp;+\u0026thinsp;Con (92.2\u0026thinsp;\u0026plusmn;\u0026thinsp;9.49 mg/dl, mean difference\u0026thinsp;=\u0026thinsp;304.0 mg/dl, 95% CI [271.3, 336.7], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Aerobic exercise intervention significantly attenuated hyperglycemia in Dia\u0026thinsp;+\u0026thinsp;Exe (133.2\u0026thinsp;\u0026plusmn;\u0026thinsp;17.92 mg/dl, mean difference from Dia\u0026thinsp;+\u0026thinsp;Con = -263.0 mg/dl, 95% CI [-295.7, -230.3], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003eInsulin resistance, assessed by HOMA-IR, showed significant variation between groups (F (\u003csub\u003e3,16\u003c/sub\u003e)\u0026thinsp;=\u0026thinsp;115.250, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, η\u0026sup2; = 0.96). Dia\u0026thinsp;+\u0026thinsp;Con demonstrated substantially higher insulin resistance (2.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44) compared to Heal\u0026thinsp;+\u0026thinsp;Con (0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09, mean difference\u0026thinsp;=\u0026thinsp;2.32, 95% CI [1.98, 2.66], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Regular aerobic exercise training significantly improved insulin sensitivity in Dia\u0026thinsp;+\u0026thinsp;Exe (0.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05, mean difference from Dia\u0026thinsp;+\u0026thinsp;Con = -1.98, 95% CI [-2.32, -1.64], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Fasting insulin levels paralleled these changes, with significant between-group differences (F (\u003csub\u003e3,16\u003c/sub\u003e)\u0026thinsp;=\u0026thinsp;19.41, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, η\u0026sup2; = 0.78).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eInflammatory Response\u003c/h2\u003e \u003cp\u003eAnalysis of inflammatory markers revealed significant alterations across groups. TNF-α levels showed substantial variation (F (\u003csub\u003e3,16\u003c/sub\u003e)\u0026thinsp;=\u0026thinsp;24.43, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, η\u0026sup2; = 0.82), with Dia\u0026thinsp;+\u0026thinsp;Con exhibiting significantly elevated levels (75.76\u0026thinsp;\u0026plusmn;\u0026thinsp;4.14) compared to Heal\u0026thinsp;+\u0026thinsp;Con (46.31\u0026thinsp;\u0026plusmn;\u0026thinsp;4.79, mean difference\u0026thinsp;=\u0026thinsp;29.45, 95% CI [22.18, 36.72], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Aerobic exercise intervention effectively reduced TNF-α levels in Dia\u0026thinsp;+\u0026thinsp;Exe (62.46\u0026thinsp;\u0026plusmn;\u0026thinsp;4.70, mean difference from Dia\u0026thinsp;+\u0026thinsp;Con = -13.30, 95% CI [-20.57, -6.03], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDescriptive Statistics (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;Standard Deviation) of Study Variables\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariable\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHeal\u0026thinsp;+\u0026thinsp;Con\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHeal\u0026thinsp;+\u0026thinsp;exe\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDia\u0026thinsp;+\u0026thinsp;Con\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDia\u0026thinsp;+\u0026thinsp;Exe\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBlood Glucose (mg/dl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e92.2 (9.49)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e88.2 (9.95)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e396.2 (33.58)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e133.2 (17.92)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOMA-IR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0/09\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e0.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0/09\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e2.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0/44\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInsulin (mU/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e2.012 (0.244)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e1.764 (0.241)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e2.832 (0.227)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e2.454 (0.248)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e46.31 (4.79)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e49.81 (9.18)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e75.76 (4.14)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e62.46 (4.70)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e20.80 (3.51)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e23.92 (3.68)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e62.45 (5.75)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e35.33 (7.13)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1.00 (0.13)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e1.61 (0.19)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e1.99 (0.01)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e1.84 (0.08)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003cb\u003eNote.\u003c/b\u003e \u003cb\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Blood glucose (mg/dl), HOMA-IR (insulin resistance index), insulin (mU/L), inflammatory markers (TNF-α, IL-6), and apoptotic marker (Caspase 3) were measured in healthy (Heal\u0026thinsp;+\u0026thinsp;Con), healthy-exercised (Heal\u0026thinsp;+\u0026thinsp;exe), and diabetic control (Dia\u0026thinsp;+\u0026thinsp;Con) groups under standardized conditions.\u003c/b\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eIL-6 concentrations demonstrated significant between-group differences (F(\u003csub\u003e3,16\u003c/sub\u003e)\u0026thinsp;=\u0026thinsp;65.24, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, η\u0026sup2; = 0.92). Dia\u0026thinsp;+\u0026thinsp;Con showed markedly higher IL-6 levels (62.45\u0026thinsp;\u0026plusmn;\u0026thinsp;5.75) compared to Heal\u0026thinsp;+\u0026thinsp;Con (20.80\u0026thinsp;\u0026plusmn;\u0026thinsp;3.51, mean difference\u0026thinsp;=\u0026thinsp;41.65, 95% CI [34.52, 48.78], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Aerobic exercise training substantially reduced IL-6 levels in Dia\u0026thinsp;+\u0026thinsp;Exe (35.33\u0026thinsp;\u0026plusmn;\u0026thinsp;7.13, mean difference from Dia\u0026thinsp;+\u0026thinsp;Con = -27.12, 95% CI [-34.25, -19.99], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eApoptotic Signaling\u003c/h2\u003e \u003cp\u003eCaspase-3 activity, indicating apoptotic signaling, showed significant variation between groups (F (\u003csub\u003e3,16\u003c/sub\u003e)\u0026thinsp;=\u0026thinsp;59.00, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, η\u0026sup2; = 0.92). Dia\u0026thinsp;+\u0026thinsp;Con exhibited significantly elevated levels (1.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01) compared to Heal\u0026thinsp;+\u0026thinsp;Con (1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13, mean difference\u0026thinsp;=\u0026thinsp;0.99, 95% CI [0.84, 1.14], p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Aerobic exercise intervention modestly but significantly reduced Caspase-3 activity in Dia\u0026thinsp;+\u0026thinsp;Exe (1.84\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08, mean difference from Dia\u0026thinsp;+\u0026thinsp;Con = -0.15, 95% CI [-0.30, -0.00], p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), though levels remained elevated compared to Heal\u0026thinsp;+\u0026thinsp;Con (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAerobic Exercise Effects\u003c/h2\u003e \u003cp\u003eRegular aerobic exercise demonstrated significant beneficial effects across multiple parameters in Dia\u0026thinsp;+\u0026thinsp;Exe. The most pronounced improvements were observed in glycemic control (-263.0 mg/dl reduction in blood glucose) and insulin sensitivity (-1.98 reduction in HOMA-IR). Aerobic exercise also significantly attenuated the diabetes-induced elevation of inflammatory markers (TNF-α: -13.30 reduction; IL-6: -27.12 reduction) and modestly reduced apoptotic signaling (-0.15 reduction in Caspase-3). Importantly, aerobic exercise training helped preserve myocardial mass in Dia\u0026thinsp;+\u0026thinsp;Exe (0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 g vs. 0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 g in Dia\u0026thinsp;+\u0026thinsp;Con, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), suggesting a protective effect against diabetes-induced cardiac atrophy.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study aimed to investigate the hypothesis that aerobic exercise has protective effects against cardiac inflammation and apoptosis in type 2 diabetic rats. Our findings strongly supported this hypothesis, demonstrating significant reductions in both inflammatory markers and apoptotic activity in diabetic rats subjected to aerobic exercise.\u003c/p\u003e \u003cp\u003eType 2 diabetes is a chronic metabolic disorder characterized by insulin resistance and impaired insulin secretion, leading to increased blood sugar and various macro and microvascular complications (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Diabetic cardiomyopathy, marked by impaired cardiac function, is considered the main cause of mortality in diabetic patients. Scientific research has shown that increased oxidative stress, inflammation, and apoptosis are key molecular mechanisms involved in cardiomyopathy-induced pathways, ultimately leading to cardiac non-regeneration and heart failure (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe impact of aerobic exercise on inflammation in diabetic conditions has been well-documented. Exercise not only plays a role in controlling blood sugar in diabetic patients but also protects against cardiomyopathy by suppressing inflammation, apoptosis, fibrosis, and cardiomyocyte hypertrophy (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). In present study, the Dia\u0026thinsp;+\u0026thinsp;Exe group showed significantly lower levels of inflammatory markers (TNF-α and IL-6) compared to Dia\u0026thinsp;+\u0026thinsp;Con group. This finding aligns with several recent studies, including work by Chen et al. (2020), who analyzed twenty-three randomized controlled trials and found that aerobic exercise was particularly effective in reducing TNF-α and IL-6 levels (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Additional support comes from studies by Papagianni et al. (2023), Ademola et al. (2023), and Yang et al. (2023), which demonstrated similar reductions in cardiac tissue TNF-α levels following exercise intervention in type 2 diabetes (\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHowever, some studies have reported contrasting results, particularly regarding short-term exercise effects on IL-6 levels (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). These differences might be attributed to variations in exercise protocols and timing of measurements. Long-term aerobic exercise appears to have more stable effects on TNF-α levels (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e), particularly in individuals with chronic conditions such as obesity, type 2 diabetes, and heart failure (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe anti-inflammatory mechanism of aerobic exercise involves multiple pathways. Regular exercise promotes cellular homeostasis and adaptation, leading to reduced cytokine production (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Under diabetic conditions, endothelial function is impaired due to increased TNF-α or IL-6, and these cytokines can enhance endothelial dysfunction in coronary vessels (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Aerobic exercise helps normalize these pathways, significantly reducing TNF-α and IL-6 levels in diabetic subjects (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe observed prominent levels of caspase-3 activity in Dia\u0026thinsp;+\u0026thinsp;Con group compared to Heal\u0026thinsp;+\u0026thinsp;Con, consistent with previous studies (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). Caspase-3 is a key executive protease in the apoptosis pathway, and its increased activity indicates elevated apoptosis in cardiomyocytes (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe Dia\u0026thinsp;+\u0026thinsp;Exe group showed significantly lower caspase-3 activity compared to Dia\u0026thinsp;+\u0026thinsp;Con, indicating the protective effect of regular aerobic exercise against myocardial apoptosis. This finding is supported by previous research demonstrating the anti-apoptotic effects of aerobic exercise in various disease models (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). However, some studies have reported different outcomes. Sadighi et al. (2019) observed increased caspase-3 protein content following moderate-intensity aerobic exercise (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), and some studies did not report significant changes (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe mechanism of exercise-induced protection against apoptosis appears to involve several pathways. Exercise activates cardioprotective signaling cascades such as Akt/mTOR and AMPK pathways, enhancing cell survival and inhibiting apoptosis (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). Additionally, exercise may reduce oxidative stress and improve insulin sensitivity, factors that contribute to apoptosis in diabetic cardiomyopathy (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). The exercise-induced reduction in apoptosis occurs through both intrinsic and extrinsic pathways, involving cytochrome c release and the modulation of caspase-9 and caspase-3 activity (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral factors may explain the variations in results across studies. The complex regulation of caspase-3 involves multiple apoptotic signaling pathways, including calcium release, intrinsic pathway activation through caspase-9, and the extrinsic pathway through TNF-α (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). The maintenance of some caspase-3 activity may be necessary for other cellular functions, such as exercise-induced state changes and satellite cell differentiation, which require further investigation.\u003c/p\u003e \u003cp\u003esome limitations and future directions should be considered in this study. First limitation is the relatively small sample size and use of an animal model, as physiological differences between animal models and humans pose challenges in generalizing these findings to human populations. Additionally, the timing of sample collection and specific exercise parameters may influence the results. Therefore, future research should investigate different exercise modalities and their effects on cardiac inflammation and apoptosis, conduct human studies to validate these findings in clinical settings, and examine the molecular mechanisms underlying the protective effects of exercise. Furthermore, research into optimal exercise intensity and duration for maximal cardioprotective benefits, along with long-term follow-up studies to assess the sustainability of exercise-induced benefits, would provide valuable insights for developing more effective therapeutic strategies.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study provides compelling evidence that aerobic exercise serves as a potent non-pharmacological intervention for mitigating diabetes-induced myocardial inflammation and apoptosis. Our findings demonstrate that chronic hyperglycemia in T2DM induces a pro-inflammatory environment, characterized by elevated TNF-α and IL-6, which act synergistically to disrupt insulin signaling, promote oxidative stress, and drive pathological myocardial remodeling. In parallel, the observed upregulation of caspase-3 in diabetic myocardium highlights an apoptotic cascade that contributes to myocardial atrophy and functional impairment. The attenuation of these inflammatory and apoptotic markers in the Dia\u0026thinsp;+\u0026thinsp;Exe group underscores the capacity of aerobic exercise to counteract these maladaptive processes, likely through the modulation of NF-κB, PI3K/Akt, and AMPK pathways.\u003c/p\u003e \u003cp\u003eThe mechanistic underpinnings of this protective effect can be attributed to exercise-induced metabolic adaptations, including improved mitochondrial biogenesis, reduced endoplasmic reticulum stress, and enhanced autophagic flux, which collectively restore cellular homeostasis and bolster myocardial resilience against hyperglycemia-induced cytotoxicity. Furthermore, aerobic exercise likely exerts its cardioprotective effects by preserving endothelial integrity, attenuating fibrotic remodeling, and promoting angiogenic signaling, thereby mitigating the structural and functional deterioration characteristic of diabetic cardiomyopathy.\u003c/p\u003e \u003cp\u003eDespite these promising findings, several critical avenues for future research remain unexplored. The heterogeneity in exercise dose-response relationships warrants further investigation to delineate the optimal intensity, duration, and frequency necessary to maximize myocardial protection. Additionally, the absence of functional cardiac assessments in this study necessitates echocardiographic and hemodynamic analyses to establish the direct impact of aerobic exercise on cardiac output, diastolic compliance, and myocardial strain. Given the translational limitations of rodent models, future studies should validate these findings in human clinical cohorts, particularly in the context of exercise-based rehabilitation programs for individuals with T2DM and high cardiovascular risk.\u003c/p\u003e \u003cp\u003eIn conclusion, our study highlights the profound potential of aerobic exercise as a therapeutic strategy to modulate inflammatory and apoptotic pathways in the diabetic heart. By reducing TNF-α and IL-6 expression, suppressing caspase-3 activity, and preserving myocardial mass, exercise confers multifaceted cardioprotective benefits that may significantly alter the trajectory of diabetes-related cardiovascular complications. The integration of precision-exercise interventions into clinical practice could revolutionize the management of diabetic cardiomyopathy, offering a low-cost, highly effective alternative to pharmacological therapies in delaying or preventing diabetes-associated myocardial dysfunction.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of interest\u003c/h2\u003e \u003cp\u003eThe authors of the article declare that there is no conflict of interest in the present study.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eA.R. and E.P. conceptualized and designed the study. A.R. conducted data collection and statistical analysis. B.R.I. contributed to the methodological framework and assisted with data interpretation. G.H. supervised the laboratory analyses and provided expertise in comparative histology. S.N. contributed to manuscript writing, structured the discussion, and prepared the final version for submission. All authors reviewed, revised, and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThe author thanks the laboratory of Faculty of Veterinary Medicine of Tabriz University for their sincere cooperation in providing and keeping the animals.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAssociation AD. Classification and diagnosis of diabetes: Standards of medical care in diabetes\u0026mdash;2021. Diabetes Care. 2021;44(Suppl 1):S15\u0026ndash;S33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2337/dc21-S002\u003c/span\u003e\u003cspan address=\"10.2337/dc21-S002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavis HA, Spanakis EK, Cryer PE, Davis SN. Hypoglycemia during therapy of diabetes. \u003cem\u003eEndotext.\u003c/em\u003e 2021. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/books/NBK279123/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/books/NBK279123/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaeedi P, Salpea P, Karuranga S, Petersohn I, Malanda B, Gregg EW, et al. Mortality attributable to diabetes in adults aged 20\u0026ndash;79 years: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. \u003cem\u003eDiabetes Res Clin Pract.\u003c/em\u003e 2020;162:108086. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.diabres.2020.108086\u003c/span\u003e\u003cspan address=\"10.1016/j.diabres.2020.108086\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTate M, Prakoso D, Willis AM, Peng C, Deo M, Qin CX, et al. Characterising an alternative murine model of diabetic cardiomyopathy. Front Physiol. 2019;10:1395. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2019.01395\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2019.01395\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParameswaran N, Patial S. Tumor necrosis factor-α signaling in macrophages. Crit Rev Eukaryot Gene Expr. 2010;20(2):87\u0026ndash;103. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1615/CritRevEukarGeneExpr.v20.i2.10\u003c/span\u003e\u003cspan address=\"10.1615/CritRevEukarGeneExpr.v20.i2.10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Y, Song Z, Zhang L, McClain CJ, Kang YJ, Cai L. Diabetes enhances lipopolysaccharide-induced cardiac toxicity in a mouse model. Cardiovasc Toxicol. 2003;3(4):363\u0026ndash;372. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/B:CART.0000008011.83923.8c\u003c/span\u003e\u003cspan address=\"10.1023/B:CART.0000008011.83923.8c\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFontes-Carvalho R, Ladeiras-Lopes R, Bettencourt P, Leite-Moreira A, Azevedo A. Diastolic dysfunction in the diabetic continuum: Association with insulin resistance, metabolic syndrome, and type 2 diabetes. Cardiovasc Diabetol. 2015;14(1):4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12933-014-0168-x\u003c/span\u003e\u003cspan address=\"10.1186/s12933-014-0168-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreten FR, Eckmann L, Greten TF, Park JM, Li ZW, Egan LJ, et al. IKKβ links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell. 2004;118(3):285\u0026ndash;296. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2004.07.013\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2004.07.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWassmann S, Stumpf M, Strehlow K, Schmid A, Schieffer B, B\u0026ouml;hm M, et al. Interleukin-6 induces oxidative stress and endothelial dysfunction by overexpression of the angiotensin II type 1 receptor. Circ Res. 2004;94(4):534\u0026ndash;541. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/01.RES.0000117301.76105.06\u003c/span\u003e\u003cspan address=\"10.1161/01.RES.0000117301.76105.06\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther. 2017;2(1):1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sigtrans.2017.23\u003c/span\u003e\u003cspan address=\"10.1038/sigtrans.2017.23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRussell RR, Li J, Coven DL, Pypaert M, Zechner C, Palmeri M, et al. AMP-activated protein kinase mediates ischemic glucose uptake and prevents postischemic cardiac dysfunction, apoptosis, and injury. J Clin Invest. 2004;114(4):495\u0026ndash;503. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI21100\u003c/span\u003e\u003cspan address=\"10.1172/JCI21100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCondorelli G, Roncarati R, Ross J Jr, Pisani A, Stassi G, Todaro M, et al. Heart-targeted overexpression of caspase-3 in mice increases infarct size and depresses cardiac function. Proc Natl Acad Sci U S A. 2001;98(17):9977\u0026ndash;9982. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.171241798\u003c/span\u003e\u003cspan address=\"10.1073/pnas.171241798\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuleria RS, Choudhary R, Tanaka T, Baker KM, Pan J. Retinoic acid receptor-mediated signaling protects cardiomyocytes from hyperglycemia-induced apoptosis: Role of the renin-angiotensin system. J Cell Physiol. 2011;226(5):1292\u0026ndash;307. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcp.22443\u003c/span\u003e\u003cspan address=\"10.1002/jcp.22443\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSwynghedauw B. Molecular mechanisms of myocardial remodeling. Physiol Rev. 1999;79(1):215\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/physrev.1999.79.1.215\u003c/span\u003e\u003cspan address=\"10.1152/physrev.1999.79.1.215\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe X, Sun J, Huang X. Expression of caspase-3, Bax, and Bcl-2 in hippocampus of rats with diabetes and subarachnoid hemorrhage. Exp Ther Med. 2018;15(1):873\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/etm.2017.5539\u003c/span\u003e\u003cspan address=\"10.3892/etm.2017.5539\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChowdhry MF, Vohra HA, Gali\u0026ntilde;anes M. Diabetes increases apoptosis and necrosis in both ischemic and nonischemic human myocardium: Role of caspases and poly\u0026ndash;adenosine diphosphate\u0026ndash;ribose polymerase. J Thorac Cardiovasc Surg. 2007;134(1):124\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jtcvs.2007.02.039\u003c/span\u003e\u003cspan address=\"10.1016/j.jtcvs.2007.02.039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColberg SR, Sigal RJ, Yardley JE, Riddell MC, Dunstan DW, Dempsey PC, et al. Physical activity/exercise and diabetes: A position statement of the American Diabetes Association. Diabetes Care. 2016;39(11):2065\u0026ndash;2079. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2337/dc16-1728\u003c/span\u003e\u003cspan address=\"10.2337/dc16-1728\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePedersen BK. The anti-inflammatory effect of exercise: Its role in diabetes and cardiovascular disease control. Essays Biochem. 2006;42:105\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/bse0420105\u003c/span\u003e\u003cspan address=\"10.1042/bse0420105\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGolbidi S, Laher I. Exercise and the aging endothelium. J Diabetes Res. 2013;2013:789607. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2013/789607\u003c/span\u003e\u003cspan address=\"10.1155/2013/789607\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKavazis AN, McClung JM, Hood DA, Powers SK. Exercise induces a cardiac mitochondrial phenotype that resists apoptotic stimuli. Am J Physiol Heart Circ Physiol. 2008;294(2):H928\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpheart.01164.2007\u003c/span\u003e\u003cspan address=\"10.1152/ajpheart.01164.2007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallaway PJ, Miyake H, Buchowski MS, Shimada M, Yoshitake Y, Kim AS, et al. Physical activity: a viable way to reduce the risks of mild cognitive impairment, Alzheimer\u0026rsquo;s disease, and vascular dementia in older adults. Brain Sci. 2017;7(2):22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/brainsci7020022\u003c/span\u003e\u003cspan address=\"10.3390/brainsci7020022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanoorsaz S, Behpour N, Tadibi V. Investigating the effect of mid-term aerobic exercise on apoptosis biomarkers in the cardiomyocytes of streptozotocin-induced diabetic rats. J Fasa Univ Med Sci. 2018;7(4):488\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKanter M, Aksu F, Takir M, Kostek O, Kanter B, Oymagil A. Effects of low-intensity exercise against apoptosis and oxidative stress in streptozotocin-induced diabetic rat heart. Exp Clin Endocrinol Diabetes. 2017;125(9):583\u0026ndash;91. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1055/s-0043-100188\u003c/span\u003e\u003cspan address=\"10.1055/s-0043-100188\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSadighi A, Azarbayjani MA. Response of some apoptotic indices to six weeks of aerobic training in streptozotocin-induced diabetic rats. Med Lab J. 2021;15(1):33\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRami M, Rahdar S, Ahmadi Hekmatikar A, Awang Daud DM. Highlighting the novel effects of high-intensity interval training on some histopathological and molecular indices in the heart of type 2 diabetic rats. Front Endocrinol (Lausanne). 2023;14:1175585. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fendo.2023.1175585\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2023.1175585\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMirdar S, Moghadasi N, Hamidain G. Effect of high-intensity interval training on heart apoptosis of young rats. J Sport Biosci. 2019;11(1):49\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSasidharan SR, Joseph JA, Anandakumar S, Venkatesan V, Ariyattu Madhavan CN, Agarwal A. An experimental approach for selecting appropriate rodent diets for research studies on metabolic disorders. Biomed Res Int. 2013;2013:1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2013/562362\u003c/span\u003e\u003cspan address=\"10.1155/2013/562362\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrinivasan K, Viswanad B, Asrat L, Kaul CL, Ramarao P. Combination of high-fat diet-fed and low-dose streptozotocin-treated rat: A model for type 2 diabetes and pharmacological screening. Pharmacol Res. 2005;52(4):313\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phrs.2005.05.004\u003c/span\u003e\u003cspan address=\"10.1016/j.phrs.2005.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakos I, Kadoglou NPE, Gkeka P, Tzallas AT, Giannakeas N, Tsalikakis DG, et al. Exercise training attenuates the development of cardiac autonomic dysfunction in diabetic rats. In Vivo (Brooklyn). 2018;32(6):1433\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21873/invivo.11430\u003c/span\u003e\u003cspan address=\"10.21873/invivo.11430\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun D, Wang H, Su Y, Lin J, Zhang M, Man W, et al. Exercise alleviates cardiac remodeling in diabetic cardiomyopathy via the miR-486a-5p-Mst1 pathway. Iran J Basic Med Sci. 2021;24(2):150. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.22038/IJBMS.2020.48837.11438\u003c/span\u003e\u003cspan address=\"10.22038/IJBMS.2020.48837.11438\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElSayed NA, Aleppo G, Aroda VR, Bannuru RR, Brown FM, Bruemmer D, et al. Classification and diagnosis of diabetes: Standards of care in diabetes\u0026mdash;2023. Diabetes Care. 2023;46(Suppl 1):S19\u0026ndash;S40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2337/dc23-S002\u003c/span\u003e\u003cspan address=\"10.2337/dc23-S002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Sun X, Wang C, He H. Effects of exercise on inflammatory cytokines in patients with type 2 diabetes: A meta-analysis of randomized controlled trials. Oxid Med Cell Longev. 2020;2020:1\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2020/7204692\u003c/span\u003e\u003cspan address=\"10.1155/2020/7204692\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePapagianni G, Panayiotou C, Vardas M, Balaskas N, Antonopoulos C, Tachmatzidis D, et al. The anti-inflammatory effects of aerobic exercise training in patients with type 2 diabetes: A systematic review and meta-analysis. Cytokine. 2023;164:156157. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cyto.2023.156157\u003c/span\u003e\u003cspan address=\"10.1016/j.cyto.2023.156157\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang HH, Li FR, Chen ZK, Zhou MG, Xie LF, Jin YY, et al. Duration of diabetes, glycemic control, and risk of heart failure among adults with diabetes: A cohort study. J Clin Endocrinol Metab. 2023;108(5):1166\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/clinem/dgad064\u003c/span\u003e\u003cspan address=\"10.1210/clinem/dgad064\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdemola SA, Bamikole OJ, Amodu OK. Is TNF-alpha a mediator in the coexistence of malaria and type 2 diabetes in a malaria-endemic population? Front Immunol. 2023;14:1028303. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2023.1028303\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1028303\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKadoglou NPE, Iliadis F, Sailer N, Athanasiadou Z, Vitta I, Kapelouzou A, et al. Exercise training ameliorates the effects of rosiglitazone on traditional and novel cardiovascular risk factors in patients with type 2 diabetes mellitus. Metabolism. 2010;59(4):599\u0026ndash;607. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.metabol.2009.08.016\u003c/span\u003e\u003cspan address=\"10.1016/j.metabol.2009.08.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakayama Y, Komuro R, Yamamoto A, Miyata Y, Tanaka M, Matsuda M, et al. RhoA induces expression of inflammatory cytokines in adipocytes. Biochem Biophys Res Commun. 2009;379(2):288\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2008.12.050\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2008.12.050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoradi Z, Ravari MS, Farrokhi E, Hashemzadeh Chaleshtori M. Investigation of methylation of TNF-α gene promoter in patients with type 2 diabetes. Iran J Diabetes Metab. 2020;19(1):44\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePahlavani HA. Exercise-induced signaling pathways counteracting cardiac apoptotic processes. Front Cell Dev Biol. 2022;10:950927. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcell.2022.950927\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2022.950927\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo G, Jian Z, Zhu Y, Zhu Y, Chen B, Ma R, et al. Sirt1 promotes autophagy and inhibits apoptosis to protect cardiomyocytes from hypoxic stress. Int J Mol Med. 2019;43(5):2033\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/ijmm.2019.4089\u003c/span\u003e\u003cspan address=\"10.3892/ijmm.2019.4089\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcMillan EM, Graham DA, Rush JWE, Quadrilatero J. Decreased DNA fragmentation and apoptotic signaling in soleus muscle of hypertensive rats following six weeks of treadmill training. J Appl Physiol. 2012;113(7):1048\u0026ndash;57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/japplphysiol.00494.2012\u003c/span\u003e\u003cspan address=\"10.1152/japplphysiol.00494.2012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan Y, Zhang Z, Zheng C, Wintergerst KA, Keller BB, Cai L. Mechanisms of diabetic cardiomyopathy and potential therapeutic strategies: preclinical and clinical evidence. Nat Rev Cardiol. 2020;17(9):585\u0026ndash;607. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41569-020-0374-6\u003c/span\u003e\u003cspan address=\"10.1038/s41569-020-0374-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElmore S. Apoptosis: A review of programmed cell death. Toxicol Pathol. 2007;35(4):495\u0026ndash;516. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/01926230701320337\u003c/span\u003e\u003cspan address=\"10.1080/01926230701320337\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePahlavani HA. Exercise-induced signaling pathways counteracting cardiac apoptotic processes. Front Cell Dev Biol. 2022;10:950927. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcell.2022.950927\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2022.950927\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSadighi A, Abdi A, Azarbayjani MA, Barari A. Effect of aerobic exercise on some factors of cardiac apoptosis in male rats. Feyz Med Sci J. 2019;23(5):495\u0026ndash;502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim KB, Kim YA, Park JJ. Effects of 8-week exercise on Bcl-2, Bax, Caspase-8, Caspase-3 and HSP70 in mouse gastrocnemius muscle. J Life Sci. 2010;20(9):1409\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKo\u0026ccedil;t\u0026uuml;rk S, Kayatekin BM, Resmi H, A\u0026ccedil;ıkg\u0026ouml;z O, Kaynak C, \u0026Ouml;zer E. The apoptotic response to strenuous exercise of the gastrocnemius and soleus muscle fibers in rats. Eur J Appl Physiol. 2008;102:515\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00421-007-0614-x\u003c/span\u003e\u003cspan address=\"10.1007/s00421-007-0614-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo G, Jian Z, Zhu Y, Zhu Y, Chen B, Ma R, et al. Sirt1 promotes autophagy and inhibits apoptosis to protect cardiomyocytes from hypoxic stress. Int J Mol Med. 2019;43(5):2033\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/ijmm.2019.4089\u003c/span\u003e\u003cspan address=\"10.3892/ijmm.2019.4089\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Qian C, Duan H, Cao S, Yu X, Li J, et al. Melatonin attenuates neurogenic pulmonary edema via the regulation of inflammation and apoptosis after subarachnoid hemorrhage in rats. J Pineal Res. 2015;59(4):469\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jpi.12271\u003c/span\u003e\u003cspan address=\"10.1111/jpi.12271\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKavazis AN, McClung JM, Hood DA, Powers SK. Exercise induces a cardiac mitochondrial phenotype that resists apoptotic stimuli. Am J Physiol Heart Circ Physiol. 2008;294(2):H928\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpheart.01164.2007\u003c/span\u003e\u003cspan address=\"10.1152/ajpheart.01164.2007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcMillan EM, Graham DA, Rush JWE, Quadrilatero J. Decreased DNA fragmentation and apoptotic signaling in soleus muscle of hypertensive rats following 6 weeks of treadmill training. J Appl Physiol. 2012;113(7):1048\u0026ndash;57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/japplphysiol.00494.2012\u003c/span\u003e\u003cspan address=\"10.1152/japplphysiol.00494.2012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Aerobic exercise, myocardial apoptosis, type 2 diabetic rats, TNF-α, IL-6, caspase-3","lastPublishedDoi":"10.21203/rs.3.rs-5951336/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5951336/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eType 2 diabetes mellitus (T2DM) is associated with an increased risk of cardiovascular complications, partially mediated by chronic inflammation and myocardial injury. This study aimed to investigate the Aerobic Exercise Reduces Cardiac Inflammation and Apoptosis in Diabetic Rats.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eA total of 20 male Wistar rats (average weight: 240\u0026thinsp;\u0026plusmn;\u0026thinsp;28 g) were randomly divided into four groups: diabetic exercise (Dia\u0026thinsp;+\u0026thinsp;Exe), healthy exercise (Heal\u0026thinsp;+\u0026thinsp;Exe), diabetic control (Dia\u0026thinsp;+\u0026thinsp;Con), and healthy control (Heal\u0026thinsp;+\u0026thinsp;Con). The Dia\u0026thinsp;+\u0026thinsp;Exe and Dia\u0026thinsp;+\u0026thinsp;Con groups were fed a diet consisting of 60% high-fat food for a specified duration before receiving intratracheal injections of streptozotocin to induce diabetes. The Dia\u0026thinsp;+\u0026thinsp;Exe and Heal\u0026thinsp;+\u0026thinsp;Exe groups underwent aerobic exercise on a treadmill at speeds ranging from 5 to 24 meters per minute for eight weeks. Levels of TNF-α and IL-6 were measured using ELISA, while caspase-3 activity was assessed via real-time PCR.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eCompared to the Heal\u0026thinsp;+\u0026thinsp;Con group, the diabetic control group (Dia\u0026thinsp;+\u0026thinsp;Con) displayed a notable elevation in TNF-α, IL-6, and caspase-3 levels (P\u0026thinsp;\u0026le;\u0026thinsp;0.05), indicative of heightened inflammation and apoptosis. Conversely, the diabetic exercise group (Dia\u0026thinsp;+\u0026thinsp;Exe) that underwent aerobic exercise demonstrated a reduction in TNF-α, IL-6, and caspase-3 levels compared to the Dia\u0026thinsp;+\u0026thinsp;Con group (P\u0026thinsp;\u0026le;\u0026thinsp;0.05).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe results of this study demonstrated that aerobic exercise could reduce inflammatory markers such as TNF-α, IL-6, and caspase-3, particularly in cardiac tissue. These findings underscore the potential of aerobic exercise as a non-pharmacological strategy to mitigate cardiac complications in diabetic patients.\u003c/p\u003e","manuscriptTitle":"Impact of Aerobic Exercise on Cardiac Inflammatory Cytokines, Apoptotic Pathways, and Myocardial Preservation in a Rat Model of Type 2 Diabetes Mellitus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-07 10:12:43","doi":"10.21203/rs.3.rs-5951336/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cebc518b-c43a-424b-8cd6-9687c8d02bd2","owner":[],"postedDate":"February 7th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-23T02:38:27+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-07 10:12:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5951336","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5951336","identity":"rs-5951336","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}