Integrative Morphological and Molecular Insights into Rhynchostegium celebicum (Brachytheciaceae), a moss from the Eastern Himalaya

Integrative Morphological and Molecular Insights into Rhynchostegium celebicum (Brachytheciaceae), a moss from the Eastern Himalaya | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Integrative Morphological and Molecular Insights into Rhynchostegium celebicum (Brachytheciaceae), a moss from the Eastern Himalaya Ritwika Bera, Pritha De Paul, Jayashree Dutta, Mousumi Poddar Sarkar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8194045/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This study provides a detailed morphological, ultrastructural, and phylogenetic analysis of the moss Rhynchostegium celebicum (Brachytheciaceae), from Darjeeling Hills, a key region within the Eastern Himalayan biodiversity hotspot. Scanning Electron Microscopy (SEM) was the first to document the sporophytic ultrastructure, revealing fine papillose spores and distinct ornamentation on the peristome teeth, indicating differential hygroscopic roles. Molecular phylogenetic analysis employing the plastid rbcL sequence strongly supported a monophyletic Rhynchostegium clade and showed a close relationship between R. celebicum and R. megapolitanum . This study substantiates the identity and phylogenetic placement of the species, providing essential insights into the biogeographic distribution and evolutionary relationships within Rhynchostegium in the region. Bryophyta Darjeeling Hills Rhynchostegium celebicum SEM rbcL Molecular Phylogeny Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Darjeeling, situated in the northern part of West Bengal, lies within the Eastern Himalayan biodiversity hotspot and is recognized as one of India’s richest repositories of flora and fauna. This region has notably abundant unique and endemic plant species, including bryophytes, owing to its distinctive climatic conditions [ 1 ]. Several new taxa have been reported over the past few decades, primarily based on their morphological architecture [ 2 – 7 ]. Globally, approximately 221 species of Rhynchostegium Schimper have been documented ( www.worldfloraonline.org ). These species belong to the family Brachytheciaceae and constitute one of the three largest genera in this family [ 8 ]. Among these, 140 species are accepted ( https://www.bryonames.org/ ), with only 11 species reported in India [ 3 ]. Among mosses, the family Brachytheciaceae is the second-largest pleurocarpous group in India, comprising 84 species belonging to 10 genera [ 3 ]. The genus Rhynchostegium Schimper is widespread in the Himalayan region [ 9 , 10 ]. The introduction of new species and the presence of existing species in novel locations are common occurrences within this genus [ 11 , 12 ]. One of its species, Rhynchostegium celebicum (Sande Lac.) A. Jaeger, is broadly distributed in tropical to subtropical, often mountainous or forested regions across Southeast Asia and the Pacific Islands, including various phytogeographic zones of the Indian subcontinent [ 2 , 13 , 14 , 15 ], and has recently been added to the flora of the Darjeeling Hills [ 9 ]. It is morphologically characterized by ovate to lanceolate, acuminate, and serrulate leaves on both stems and branches, a weak costa, smooth setae, and a long-rostrate operculum [ 16 , 17 ], which typically form small to large, loose tufts or extensive mats. This species was first collected from the Darjeeling Hills in April 2017 during an ongoing project on the moss flora of Darjeeling Hills, and was recollected from the same locality in June 2024. This repeated occurrence suggests that the species may be well-acclimated to this region. The present study provides a comprehensive morphological illustration of sporophytic structures using scanning electron microscopy (SEM) and detailed measurements. To confirm its taxonomic placement, molecular phylogenetic analysis was conducted using rbcL sequence data. The chloroplast gene rbcL is highly conserved yet exhibits sufficient variation to discriminate among closely related taxa at the species and genus levels [ 18 ]. Its relatively slow evolutionary rate also makes it valuable for resolving relationships at higher taxonomic ranks, such as families and orders, thereby providing a stable framework for phylogenetic inference [ 19 ]. The phylogeny of Rhynchostegium has been investigated using a combination of three DNA sequence regions: nuclear ITS1-5.8S-ITS2 and plastid trnL-F and trnD-T [ 20 ]. Notably, phylogeny based on the plastidial rbcL was conducted for the first time in this genus. Future studies incorporating additional markers are necessary to elucidate the complex phylogeny of Brachytheciaceae. Here, we provide an extended morphological description of R. celebicum , supplemented with illustrations, molecular data, and ecological observations of the Darjeeling Hills. The broad biogeographic significance of this species has also been discussed. Materials and methods Collection of specimens Moss specimens were collected from wild using detailed field records, including precise habitat descriptions and ecological details of the collection site. The distribution map of the moss samples was generated using QGIS version 3.44.3 Solothurn (Figs. 1 ). The specimens were carefully dried, preserved, and deposited in the Lloyd Botanical Garden in Darjeeling, West Bengal, India. Species identification was carried out through extensive examination of morphological and anatomical features, comparing these observations with descriptions in the “Mosses of Eastern India and Adjacent Regions” [ 2 ] and “Taxonomy of Indian Mosses” [ 21 ]. Rhynchostegium celebicum was documented in 2017 at Bhutia Busty, Darjeeling Hills, (N27°03'19.19", E088°15'38.02”, 1989 m) growing with liverworts on moist soil over rock. The humid, undisturbed foothill habitat supports rich bryophyte diversity. The species was again collected from the same site in 2024 (N27°03'19.44", E088°15'37.71”, 2002 m), this time also occurring epiphytically on Alnus nepalensis . Both collections (Supplementary Fig. a,b) have been deposited in the Lloyd Botanical Garden Herbarium, Darjeeling. Morphological Studies The morphological characteristics of the moss specimens were analyzed using a stereomicroscopy (Stereomaster-Plus, Dewinter, India), binocular light microscopy (Excel, Dewinter, India), and scanning electron microscopy (EVO 10, Zeiss, Germany). To prepare specimens for microscopy, moss samples were rehydrated in double-distilled water for 10–15 min to facilitate the rapid hydration and removal of surface debris. For the SEM analysis, the specimens were dehydrated using a graded ethanol series (60%, 70%, 80%, 90%, and absolute ethanol), mounted on aluminium stubs with carbon tape, and sputter-coated with gold-palladium for 120 s using an SC7620 Mini Sputter Coater/Glow Discharge System (Quorum Technologies). High-resolution photomicrographs were obtained at an acceleration voltage of 30 eV. Quantitative analyses included measurements of leaf length, width, leaf cell dimensions, peristome teeth features, and spore diameter, recorded using an ocular micrometer calibrated against a stage micrometer and analyzed using ImageJ software [ 22 ]. DNA Extraction, Amplification, and Phylogenetic Analysis Genomic DNA was extracted, amplified by PCR, and sequenced according to the method outlined by Bera [ 23 ]. PCR amplification was performed using primers rbcL a-F (ATGTCACCACAAACAGAGACTAAAGC; [ 24 ] and rbcL a-R (GTAAAATCAAGTCCACCRCG; [ 25 ]. The sequences were aligned using MEGA11 [ 26 ]. For phylogenetic analysis, rbcL sequences from other members of the Brachytheciaceae family, available in GenBank, were used to construct a phylogenetic tree. The tree was generated using the maximum parsimony (MP) method with 1000 bootstrap replicates in Mega11 software, utilizing the Tree-Bisection-Regrafting (TBR) algorithm [ 27 ]. Hypnum plumaeforme (AB accession 029384.1) and Entodon rubicundus (AB accession 029386.1), from the Hypnaceae family, were selected as outgroups for tree rooting. Taxonomic Treatment Basionym Hypnum celebicum Sande Lac., Bryol. Jav. 2: 159. 258. 1866. Etymology The specific epithet, celebicum, refers to ‘Celebes (Sulawesi)’ in Latin, the county name of the type locality. Range Borneo, Cambodia, Hawaii, India, Java, Myanmar, New Caledonia, New Guinea, Philippines, Sulawesi, Sumatra, Taiwan, Thailand, Vietnam. Distribution in India Eastern Himalaya: Assam, Darjeeling; Meghalaya: Khasi Hills, and Arunachal Pradesh. Western Himalayas: Uttarakhand; Western Ghats: Tamil Nadu Ecology and Distribution In April 2017, Rhynchostegium celebicum was identified in association with liverworts on the thin, moist soil layer covering rocks in Bhutia Busty, located in the Darjeeling Hills (N27°03'19.19", E088°15'38.02”, 1989 m). This region, a remote part of the Himalayan foothills, is rich in ferns and bryophytes owing to its moist conditions and limited human activity, with steep slopes contributing to the lush environment. In 2024, the same species was collected from the same locality (N27°03'19.44", E088°15'37.71”, 2002 m), which grows epiphytically on the bark of Alnus nepalensis . These species were found growing on both rock surfaces and tree trunk specimens (Supplementary figures a and b) from both collections were submitted to the Lloyd Botanical Garden Herbarium, Darjeeling (Accession no LB014433 for 2017 and LB014686 for 2024). Morphological & ultrastructural details The plants were creeping, approximately ± 5 cm in length, with pinnate or bipinnate branches reaching up to 2 cm in length (Figs. 2 a and 2 b). They are yellowish-green to light-green, glossy, and form tufts. The leaves are erecto-patent, spreading, and have an ovate to acuminate shape, measuring 1.29 ± 0.11 mm in length and 0.35 ± 0.04 mm in width (Fig. 3 a). Leaf margins were denticulated from the middle to the apex. The cells at the base of the leaves measure 37.79 ± 1.49 x 5.27 ± 0.51 µm, smooth, while the upper cells are 33.85 ± 7.14 x 6.23 ± 1.12 µm. The costa is single, covering approximately two-thirds of the leaf (Supplementary figure c), and measures 0.71 ± 0.10 mm in length and 0.03 ± 0.01 mm in width on average. The laminal cells were thick-walled and lax. The apical single terminal cell was 37.12 ± 2.65 x 6.55 ± 1.16 µm, while the median and upper laminal cells were linear and sub-rectangular, measuring 40.05 ± 6.63 x 6.25 ± 0.87 µm. The lower laminal cells are rectangular to quadrate, measuring 40.32 ± 7.25 x 6.14 ± 1.22 µm (Supplementary figure f). The seta is erect and smooth (Fig. 2 c), measuring 1.87 ± 0.15 mm in length. The capsule is cylindrical, horizontal (Fig. 2 e) and measures 2.23 ± 0.24 mm in height and 0.73 ± 0.09 mm in width. The operculum is conical with a long rostrum, measuring 1.14 mm in length, and the calyptra is 2.69 ± 0.09 x 0.36 ± 0.02 mm (Fig. 2 d). The peristome was diplolepidous (Fig. 2 f, 4 a, 4 b and 4 c). The spores were yellowish-green. The leaf base exhibited distinctly corrugated, wavy patterns, with epidermal cells arranged in pronounced, parallel undulations (Fig. 3 b). The leaf cells were elongated, narrowly elliptical to convex in shape, and interconnected by bifurcated cell wall ends (Fig. 3 c and 3 d). The leaf apex was elongated and pointed (Fig. 3 e, 3 f, and Supplementary figure d), bearing clear serrations along the margins (Fig. 3 g, 3 h and Supplementary figure e). The upper laminal and marginal cells appear to be comparatively more contracted. The leaf surface was smooth and lacked papillae. The exostome was measured at 256.67 ± 33.55 µm in length and 45.68 ± 3.33 µm in width (figures a-c). The dorsal region of the exostomes is characterized by robust, regularly spaced transverse stripes (5.10 ± 1.12 µm) arranged in parallel, with papillae-like ornamentation present between the stripes (Fig. 4 e). The ventral surface of the exostome was narrowly flattened, smooth, and lamellated, with ridges (figure d). The endostome was well-developed, being slightly longer but narrower than the exostome, measuring 361.27 ± 37.85 µm in length and 35.08 ± 2.34 µm in width (figures a-c). The dorsal region of the endostomes is characterized by faint ridges that are more widely spaced (13.10 ± 3.11 µm) compared to those of the exostome. Additionally, the surface was embellished with irregular papillae, imparting a rough, spiny texture (Figs. 4 g and 4 h). Smooth, thin-walled cells were located in the basal region of the ventral position of the endostome (Fig. 4 f). The operculum was conical to hat-shaped, with a broad basal portion (641.05 ± 68.96 µm) tapering into a slender, stalk-like apex (1145.54 ± 42.62 µm) (Fig. 5 a). The surface appeared relatively smooth compared with that of the teeth, although fine reticulate ornamentation was occasionally restricted to the basal region (Fig. 5 a). Spores were predominantly spherical to sub-spherical (roundness index: 0.9 ± 0.02), with a mean diameter of 21.71 ± 0.93 µm. Their surfaces were covered with numerous, evenly distributed, small, rounded papillae (0.9 ± 0.02 µm in diameter), imparting a finely papillose texture (Fig. 5 b). Phylogenetic Relationships of Rhynchostegium and Related Genera Phylogenetic reconstruction demonstrated that all examined Rhynchostegium species—including R. celebicum, R. megapolitanum, R. riparioides, and R. pallidifolium formed a strongly supported monophyletic clade. Within this lineage, R. celebicum (Accession no PP663260.1) showed a particularly close relationship with R. megapolitanum (Accession no OZ207752.1), which is a rare bryophyte found in Europe and North America. The semi-submerged Platyhypnidium riparioides (synonym: R. riparioides , accession number AB029385.1) was nested within this clade (Fig. 6 ). Interestingly, the entire Rhynchostegium clade was recovered as a sister group to Palamocladium leskeoides (LC accession 744569.1). At a broader level, the phylogeny revealed a large and diverse assemblage of Brachythecium species, together with allied genera, such as Sciuro-hypnum, Pseudokinbergia, Helicodontium, Myuroclada, Homalothecium, and Eurhynchium. Discussion Leaf morphology, particularly the smooth surface of the leaves, distinguishes Rhynchostegium from other genera such as Brachythecium , Homalothecium , and Eurhynchium , which are characterized by plicate leaves [ 28 ]. Furthermore, Rhynchostegium exhibited significant similarities to Eurhynchium , except for differences in plant colouration and the terminal cells of the costa. Specifically, in Rhynchostegium , plants are whitish in colour, and the terminal cell of the costa lacks a spine, whereas in Eurhynchium , it is green and possesses a spine. The leaf length of the studied species was slightly shorter than that reported by Saha et al. [ 9 ]. This discrepancy may be attributed to a conflict between parent and offspring dynamics and the morphology of gametophytes and sporophytes [ 29 ]. Nevertheless, it remains unclear whether this reduction is a consequence of the nutritional dependence of sporophytes on gametophytes. Because the ultrastructural details have been documented for the first time, they may be comparable to those of other species. Microscopic leaf morphology contrasted significantly with the features reported by Robinson, although the species were from different families [ 33 ]. The spore diameter and shape in R. celebicum were slightly different from those observed in E. praelongum (approximately 12µm; subglobose) [ 23 ]. Additionally, large spores (> 20µm) have been identified in various epiphytic lineages [ 30 , 31 ]. The ultrastructural characteristics of the peristome are similar to those of Hypopterygium fauriei and Aulacomnium heterostichum , although these taxa are not closely related [ 32 , 33 ]. The plates and ridges present on exostomes play crucial roles in determining both the direction and extent of hygroscopic movement [ 32 , 34 ]. In contrast, endostomes, that lack distinct ridges are unlikely to participate in this movement. In the present study, plastid rbcL gene analysis was performed to provide additional support for the identification of the Eastern Himalayan specimen. However, nuclear data are often required for complete resolution in Brachytheciaceae. Huttunen & Ignatov successfully resolved the complex relationships within the Rhynchostegium clade using the ITS region, which has a higher substitution rate, crucial for resolving recent divergence [ 20 , 35 ]. In this study phylogenetic analysis suggested a close relationship between R. megapolitanum and R. celebicum , likely because of their shared gametophytic morphology (loosely branched shoots with erect, smooth setae) and ecological plasticity. Their capacity for habitat expansion may also be enhanced by environmental drivers such as climate change and nitrogen deposition [ 36 , 37 ]. However, both species were placed in a separate clade within the phylogenetic tree based on nuclear ribosomal ITS1-5.8S-ITS2 sequence data [ 12 ]. The affinity between R. riparioides and P. leskeoides further corroborates the phylogenetic placement of Rhynchostegium as proposed by Ignatov and Huttunen [ 38 ], which is likely attributable to similarities in their gametophytic structures. However, studies of aquatic species (e.g., Platyhypnidium ) have revealed multiple independent evolutionary shifts from terrestrial to aquatic habitats, resulting in geographically defined clades of aquatic species [ 20 , 39 ]. Consequently, morphological similarities among aquatic species are often homoplastic and driven by adaptation to similar ecological pressures rather than shared ancestry. In 2010, Huttunen and Ignatov observed that the Asiatic species R. celebicum and R. javanicum possessed distinct tandem repeats within the plastid trnT-E spacer region [ 20 ]. This finding underscores the potential of utilizing specific molecular signatures to trace the biogeographic history of Rhynchostegium in the Asian tropics. The phylogenetic framework further suggests complex relationships between Rhynchostegium and Brachythecium within Brachytheciaceae, with the latter appearing to be polyphyletic or paraphyletic. Despite this, Brachythecium remains morphologically distinct, characterized by a rough seta, conical to shortly beaked operculum, elongate-ovoid capsule, and variable costa that may reach the leaf apex. Although Rhynchostegium is recovered as a separate lineage, the dispersed position of Brachythecium across the tree indicates a complicated evolutionary history that warrants further investigation combining molecular and morphological evidence. Moreover, molecular markers can be used to elucidate species-specific characteristics. Declarations Acknowledgement The second author is grateful to the Science and Engineering Research Board, Govt. of India, for funding a project on Climate change and providing her fellowship. The authors also extend their gratitude to the HOD, Department of Life Sciences, Presidency University, Kolkata, for providing infrastructural facilities to carry out this research. We appreciate the access to scientific resources facilitated by the Information and Library Network and the e-Library Consortium through the Department of Life Sciences, Presidency University. The authors also convey their sincere thanks to Officer-in-Charge, Lloyd Botanic Garden, Darjeeling, for extending his kind help in the issuance of the accession number. Funding This work was supported by the Science and Engineering Research Board (SERB), Govt. of India (GoI), under research grant number: SCP/2022/000716 dated 18.07.2023 (Special Call Project on Climate change). Department of Biotechnology, GoI, under research grant number BT/INF/SP45088/2022 dated 17.02.2022 for Instrumental facilities and the Council of Scientific and Industrial Research (CSIR) under research grant number: 09/028(0992)/2017-EMR-I dated 04.05.2017 for fellowship of the first author. Ethics declaration: The collection of plant/plant parts used in our study were complied with the local or national guidelines. Plants were collected from wild and were used for only academic purposes and not for any commercial utilization. The relevant permission for collection of this moss specimen was taken from forest authority. Consent to Participate declaration: not applicable Consent to Publish declaration: not applicable Competing interests: No potential conflict of interest was reported by the author(s). Data availability statement Plant Specimens were deposited in the Lloyd Botanical Garden Herbarium, Darjeeling (Accession no LB014433 for 2017 and LB014686 for 2024). The datasets generated and/or analysed during the current study are available in the GenBank repository, Accession number: rbcL = PP663260.1(Holotype; https://www.ncbi.nlm.nih.gov/nuccore/PP663260.1/). References Varma JK. Biodiversity Hotspots of the Eastern Himalayas. Environ Sci Q. 2024;15(2):105–20. Gangulee HC. Mosses of Eastern India and adjacent regions: A monograph, Fascicle 1–8. Calcutta, India: Books and Allied Limited; 1969–1980. Lal J. A checklist of Indian mosses. Dehra Dun: Bishen Singh Mahendra Pal Singh; 2005. pp. 120–1. Daniels A, Kariyappa K. On the circumscription of the moss Rhynchostegium hookeri (Brachytheciaceae). Acta Bot Hung. 2013;55(3–4):5. 10.1556/abot.55.2013.3-4.5 . Saha P, Aziz MN, Maity D. New records of mosses from Darjeeling District, West Bengal. Indian J For. 2017;40:83–94. 10.54207/bsmps1000-2017-XY9A86 . Saha P, Aziz MN, Maity D. Addition of two species of Sematophyllaceae to the moss flora of West Bengal. J Botan Soc Bengal. 2020;74(2):119–23. Bera R, Biswas-Raha A, Paine AK, Datta J, Poddar-Sarkar M, et al. Bartramidula roylei (Hook. f.) Bruch & Schimp.: An addition to the moss diversity of Darjeeling hills. J Botan Soc Bengal. 2022;76(1):44–8. Bruch P, Schimper WP, Gümbel WT. Bryologia Europaea 5, fasc. 49–51. Stuttgart: E. Schweizerbart; 1852. Vohra JN. New Taxa of Hypnobryales (Musci) from the Himalayas. Nelumbo. 2024;22(1–4):115–25. https://doi.org/10.20324/nelumbo/v22/1980/75410 . Saha P, Aziz MN, Maity D. Addition of two species of Rhynchostegium BSG (Bryophyta, Musci) to the moss flora of West Bengal, India. J Bombay Nat Hist Soc 2021;118. Vončina G, Stebel A. The moss Rhynchostegium rotundifolium (Brachytheciaceae) new to Poland. Herzogia. 2019;32(2):503–7. Larraín JB, Huttunen S, Ignatova E, Ignatov M, et al. Rhynchostegium occultum (Brachytheciaceae), a new species from relict forests of central Chile. Phytotaxa. 2020;453(3):199–217. Barukial J. A study of moss diversity in Assam valley wet evergreen forests. 2011. 10.13140/RG.2.2.25618.58560 Suleiman M, Masundang DP, Akiyama H. The mosses of Crocker Range Park, Malaysian Borneo. PhytoKeys. 2017;88:71–107. 10.3897/phytokeys.88.14674 . Sande lacoste CM Van der. Musci frondosi. In: Miquel FAWM, editor. Prolusio florae japonicae. Ann. Mus. Lugd.-Bat. 1866–1867;2:292–300; 3:209. Buck WR. Pleurocarpous mosses of the West Indies. Mem N Y Bot Gard. 1998;82:1–400. Gradstein SR, Churchill SP, Sallazar-allen N. Guide to the bryophytes of Tropical America. Mem N Y Bot Gard. 2001;86:1–577. Chase MW, Soltis DE, Olmstead RG, Morgan D, Les LH, et al. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL . Ann Missouri Bot Gard. 1993;80:528–80. Gitzendanner MA, Soltis PS, Wong GKS, Ruhfel BR, et al. Plastid phylogenomic analysis of green plants: a billion years of evolutionary history. Amer J Bot. 2018;105(3):291–301. Huttunen S, Ignatov M. Evolution and taxonomy of aquatic species in the genus Rhynchostegium (Brachytheciaceae, Bryophyta). Taxon. 2010;59. https://doi.org/10.1002/tax.593010 . Chopra RS. Introduction to taxonomy of Indian mosses. New Delhi, India: CSIR Publication; 1975. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9(7):671–5. Bera R. Phylogenetic analysis of mosses from Darjeeling hills on the basis of lipidomics, metabolomics and DNA barcoding [PhD Thesis]. Kolkata: University of Calcutta; 2023. Levin RA, Wagner WL, Hoch PC, Nepokroeff M, Pires JC, et al. Family-level relationships of Onagraceae based on chloroplast rbcL and ndhF data. Amer J Bot. 2003;90:107–15. Kress WJ, Erickson DL, Jones FA, Swenson NG et al. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proc. Natl. Acad. Sci. U.S.A. 2009;106:18621–18626. Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38(7):3022–7. Nei M, Kumar S. Molecular evolution and phylogenetics. Oxford University Press; 2000. Ignatov MS. Bryophyte flora of Altai Mountains. VIII Brachytheciaceae Arctoa. 1998;7:85–152. Noroozi M, Budke JM. Gametophyte and sporophyte morphology are phylogenetically correlated in mosses, indicating coadaptation and parent–offspring conflict. New Phytol. 2025;246(5):2295–306. 10.1111/nph.70117 . Hedenäs L. Environmental factors affecting character states in pleurocarpous mosses. Bryologist. 2001;104:72–91. Huttunen S, Ignatov MS, Müller K, Quandt D. Phylogeny and evolution of epiphytism in the three moss families: Meteoriaceae, Brachytheciaceae, and Lembophyllaceae. In: Goffinet B, Hollowell V, Magill R, editors. Molecular systematics of bryophytes. Monographs in Systematic Botany from the Missouri Botanical Garden 98. St. Louis: Missouri Botanical Garden; 2004. pp. 328–61. Wu Y, Wu Q, Zhang Z, Wang Z. Microscopic and submicroscopic exploration of diplolepideae peristome structures in hygroscopic movement. BMC Plant Biol. 2024;24(1):710. Robinson H. Scanning electron microscope studies on moss leaves and peristomes. Bryologist. 1971;74(4):473–83. Schnepf E, Stein U, Deichgräber G. Structure, function, and development of the peristome of the moss, Rhacopilum tomentosum , with special reference to the problem of microfibril orientation by microtubules. Protoplasma. 1978;97(2):221–40. White TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols: A guide to methods and applications. Academic; 1990. pp. 315–22. Zechmeister HG, Moser D, Milasowszky N. Spatial distribution patterns of Rhynchostegium megapolitanum at the landscape scale—an expanding species? Appl Veg Sci. 2007;10(1):111–20. 10.1111/j.1654-109X.2007.tb00509.x . Johnsen I. Rhynchostegium megapolitanum (Web. et Mohr) B.S.G.—A rare bryophyte in dune ecosystems of Zealand, Denmark. Amer. J. Plant Sci. 2014;5:1378–1383. https://doi.ogr/10.4236/ajps.2014.59152 Ignatov MS, Huttunen S. Brachytheciaceae (Bryophyta)—a family of sibling genera. Arctoa. 2002;11(1):245–96. 10.15298/arctoa.11.20 . Hedenäs L, Quandt D. The Evolutionary Diversity of Mosses—Taxonomic Heterogeneity and its Ecological Drivers. J Syst Evol. 2018;56(5):450–77. Additional Declarations No competing interests reported. Supplementary Files Supplementary.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8194045","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":572976860,"identity":"f07506cd-b370-47ee-a5ae-eb9c6a1d4d82","order_by":0,"name":"Ritwika Bera","email":"","orcid":"","institution":"Rajendra University","correspondingAuthor":false,"prefix":"","firstName":"Ritwika","middleName":"","lastName":"Bera","suffix":""},{"id":572976861,"identity":"c2878416-a87c-4614-9106-3fbca39c8b21","order_by":1,"name":"Pritha De Paul","email":"","orcid":"","institution":"Presidency University","correspondingAuthor":false,"prefix":"","firstName":"Pritha","middleName":"","lastName":"De Paul","suffix":""},{"id":572976864,"identity":"2d253b41-96b3-4b69-a8e0-90d244f125b0","order_by":2,"name":"Jayashree Dutta","email":"","orcid":"","institution":"Presidency University","correspondingAuthor":false,"prefix":"","firstName":"Jayashree","middleName":"","lastName":"Dutta","suffix":""},{"id":572976870,"identity":"c56a541a-156c-494c-a90a-1562a893f818","order_by":3,"name":"Mousumi Poddar Sarkar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYPACCRDBDGLIgVgHHpCgxcIYrCWBSKtAWioSG0BMfFp023uMP/PmWOTJt599bPBzj0T6/LDDD4G22MnpNmDXYnbmjJk07zaJYoMz6caJPc8kcjfeTjMAakk2NjuAQ8uNHDNmoJbEDQxpzAd4DgC1zE4AaTmQuA23FqDDgFrm9z9jPvjngES64ez0D4S0GIAclthwI405GWhLgrx0DgFbzhwrk5wL8suNZ8zGMgckDDdI5xQcSDDA45fjzZs/vN1Wlyffn8Ys+eZAnbz87PTNHz5U2Mnh0gIDCXCWAVilAX7lqFrkGwirHgWjYBSMgpEFAL3UYRIrYuQ/AAAAAElFTkSuQmCC","orcid":"","institution":"Presidency University","correspondingAuthor":true,"prefix":"","firstName":"Mousumi","middleName":"Poddar","lastName":"Sarkar","suffix":""}],"badges":[],"createdAt":"2025-11-24 13:38:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8194045/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8194045/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100367134,"identity":"1d09a7fb-7774-41a4-8f28-d96c62d9a058","added_by":"auto","created_at":"2026-01-16 07:56:47","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":206104,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/8662230b42d73398ac04ed3c.jpg"},{"id":100368430,"identity":"37ca9749-9a1c-4fd3-ae03-61c81c645bb3","added_by":"auto","created_at":"2026-01-16 07:57:57","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":45373,"visible":true,"origin":"","legend":"","description":"","filename":"Revisedmanuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/26b1ce97a57faebdd6ce40c4.docx"},{"id":100368429,"identity":"6446185b-c893-4bc6-a25f-0f1d1e8d23ec","added_by":"auto","created_at":"2026-01-16 07:57:57","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":271311,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/b1464668f4c9d12569d6b884.jpg"},{"id":100367778,"identity":"41d0cfb1-574f-4246-a66b-11746a7b565f","added_by":"auto","created_at":"2026-01-16 07:57:17","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":193652,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/f4c95565452939c46ac5606d.jpg"},{"id":100366641,"identity":"19689a39-ac42-4072-838a-6317e1be48f8","added_by":"auto","created_at":"2026-01-16 07:56:25","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":203065,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/7d0fb176bc4cc4cb85820fa0.jpg"},{"id":100367401,"identity":"06efe871-8418-4003-b199-6a555231fae7","added_by":"auto","created_at":"2026-01-16 07:57:02","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97441,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/0ada6107cb8fae8fb20d589b.jpg"},{"id":100367164,"identity":"69ef506e-07eb-4821-b6a9-7df0765075a9","added_by":"auto","created_at":"2026-01-16 07:56:48","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":162193,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/ac0aec278d857a8ea96ec8c8.jpg"},{"id":100366883,"identity":"393ac8d9-3d0d-4f1c-ab58-7d869a0533cb","added_by":"auto","created_at":"2026-01-16 07:56:36","extension":"json","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6072,"visible":true,"origin":"","legend":"","description":"","filename":"bdb5ca51a4c2460fb53dd671e70b02b7.json","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/6b20c4f3e4d5236e1823e506.json"},{"id":100367332,"identity":"af1533e6-b02b-4e66-a1e6-b89131b02f34","added_by":"auto","created_at":"2026-01-16 07:56:58","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":186748,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/f3e303281314f1013739922b.docx"},{"id":100139766,"identity":"89ebd6f5-65d9-44eb-8b4a-09011833fc64","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83738,"visible":true,"origin":"","legend":"","description":"","filename":"bdb5ca51a4c2460fb53dd671e70b02b71enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/a1f942f3954464e6955c2ed6.xml"},{"id":100368138,"identity":"87e8d215-4571-4627-9a2c-7d84a516f896","added_by":"auto","created_at":"2026-01-16 07:57:38","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":206104,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/6a57d7738a47bc70c079838f.jpg"},{"id":100367357,"identity":"3b02630f-e0e2-468b-8f4e-fb83521a74b5","added_by":"auto","created_at":"2026-01-16 07:57:01","extension":"jpg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":271311,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/d2a2dabe2a3def379c0828ae.jpg"},{"id":100139769,"identity":"838d1eb9-690e-42fa-bfe1-3a48a5349a02","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"jpg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":193652,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/6159577b240125e0c6f0fb9f.jpg"},{"id":100366621,"identity":"2cf1947d-eb16-4a7c-9c88-596a22751c34","added_by":"auto","created_at":"2026-01-16 07:56:24","extension":"jpg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":203065,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/02ef749d2ff8f33c8cb792e6.jpg"},{"id":100139757,"identity":"eff9e2ea-b0d6-41c5-abe3-8228b4442ea7","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"jpg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97441,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/edcbc6718ca2ba3f7926b403.jpg"},{"id":100366839,"identity":"66243f5e-64ac-40a0-9d8f-b0593abc625c","added_by":"auto","created_at":"2026-01-16 07:56:35","extension":"jpg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":162193,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/91369734ab7928295c066b82.jpg"},{"id":100139767,"identity":"7e488110-1f12-4f34-98b2-c42f8ad5e767","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176421,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/886039972010fc415b29d8a6.png"},{"id":100139762,"identity":"90af555e-1215-450c-a805-473d48d04980","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":226862,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/4118a6ead2ad5ecdf786cd70.png"},{"id":100139768,"identity":"9b140d46-da0f-4e89-8afc-02cc2fe5ee4c","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101672,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/71a921f3ec5775c7845cfa44.png"},{"id":100366732,"identity":"a203f1e5-f167-43ac-8569-fb97a8a79a17","added_by":"auto","created_at":"2026-01-16 07:56:30","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100922,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/9b68407df55f1a89c3a7ea7d.png"},{"id":100139761,"identity":"710102aa-abcf-4423-a110-f7b74769f647","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":68484,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/a48fef45ef26a6af30d69452.png"},{"id":100139765,"identity":"299aa49f-0747-47ec-9a89-7e362f0b8c1f","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":64433,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/b3211501d96618c6d4b6fd11.png"},{"id":100139764,"identity":"d916d69d-2932-4dff-8d49-c709067edeb2","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"xml","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82767,"visible":true,"origin":"","legend":"","description":"","filename":"bdb5ca51a4c2460fb53dd671e70b02b71structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/e87907a68e103d640dc95c0a.xml"},{"id":100139763,"identity":"a7ad9166-a874-444d-9e1c-a12740f20b27","added_by":"auto","created_at":"2026-01-13 11:20:20","extension":"html","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":94227,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/6e9f6d2f6bed72a734410588.html"},{"id":100139742,"identity":"2368c1d9-2b9a-48b5-94a7-2510b99a2222","added_by":"auto","created_at":"2026-01-13 11:20:18","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":206104,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution map of \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e \u003cstrong\u003ea-d\u003c/strong\u003e. Distribution map prepared using \u003cem\u003eQGIS\u003c/em\u003e software (version 3.44.3 Solothurn), \u003cstrong\u003ee.\u003c/strong\u003e Zoomed-in view of the distribution area generated using Garmin BaseCamp.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/550c465831496bc473882cfb.jpg"},{"id":100367035,"identity":"fbda257e-06da-4785-813f-a8c7b154c2c9","added_by":"auto","created_at":"2026-01-16 07:56:44","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":271311,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological features of \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ea \u003c/strong\u003eand\u003cstrong\u003e b.\u003c/strong\u003eGametophytic plant body with pinnate or bipinnate branching pattern ,\u003cstrong\u003ec.\u003c/strong\u003eSeta with smooth surface arising from main branch of gametophyte, \u003cstrong\u003ed. \u003c/strong\u003eCalyptra,\u003cstrong\u003ee\u003c/strong\u003e. Capsule, \u003cstrong\u003ef\u003c/strong\u003e. Peristome.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/e23b5c50317df301d3523452.jpg"},{"id":100366343,"identity":"18e707f5-ac3b-4802-a3b2-184a82f70409","added_by":"auto","created_at":"2026-01-16 07:56:14","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":193652,"visible":true,"origin":"","legend":"\u003cp\u003eScanning electron micrographs of \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e leaf surfaces showing ultrastructural details. \u003cstrong\u003ea\u003c/strong\u003e.Whole leaf, \u003cstrong\u003eb\u003c/strong\u003e. Basal lamina region\u003cstrong\u003e, c \u003c/strong\u003eand\u003cstrong\u003e d.\u003c/strong\u003e Narrow elongated leaf cells interconnected by bifurcated cell wall ends,\u003cstrong\u003ee \u003c/strong\u003eand\u003cstrong\u003e f.\u003c/strong\u003e Leaf apex with an acute to acuminate tip,\u003cstrong\u003eg \u003c/strong\u003eand \u003cstrong\u003eh\u003c/strong\u003e.Leaf margin showing dentation.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/9c196824ad65859488984c54.jpg"},{"id":100366350,"identity":"11415ab9-5d5f-4688-abd2-9afe6f19eb53","added_by":"auto","created_at":"2026-01-16 07:56:14","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":203065,"visible":true,"origin":"","legend":"\u003cp\u003eScanning electron micrographs of \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e capsule showing peristome teeth.\u003cstrong\u003e a.\u003c/strong\u003e dorsal surface of the exostome and \u003cstrong\u003eb.\u003c/strong\u003e ventral surface of the endostome, \u003cstrong\u003ec\u003c/strong\u003e. Peristome with exostome and endostome, \u003cstrong\u003ed. \u003c/strong\u003eventral surface of exostome\u003cstrong\u003e e.\u003c/strong\u003e Dorsal view of exostome with spiral striations, ornamentations with horizontal ridges, \u003cstrong\u003ef\u003c/strong\u003e. Ventral view of endostome showing cellular details, \u003cstrong\u003eg \u003c/strong\u003eand \u003cstrong\u003eh. \u003c/strong\u003edorsal view of\u003cstrong\u003e \u003c/strong\u003eendostome with papillae and spiny texture.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/3f69c2d944bae17aa5ffe933.jpg"},{"id":100367783,"identity":"6575ea7b-da5b-4511-87b0-0df0f0011b14","added_by":"auto","created_at":"2026-01-16 07:57:17","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":97441,"visible":true,"origin":"","legend":"\u003cp\u003eScanning electron micrographs of \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e operculum and spore. \u003cstrong\u003ea.\u003c/strong\u003eOperculum showing broad base and narrow apical region,\u003cstrong\u003eb\u003c/strong\u003e. Spore with spherical morphology and surface ornamentation.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/2b92876798e84a28d8fdef64.jpg"},{"id":100367608,"identity":"6fd8e451-3ed6-47f2-8b68-efed2e5c67b6","added_by":"auto","created_at":"2026-01-16 07:57:09","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":162193,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree based on maximum parsimony on the plastid \u003cem\u003erbcL \u003c/em\u003egene. Bootstrap values (≥50%) are given above the branches. \u003cem\u003eHypnum plumaeforme\u003c/em\u003e (AB accession 029384.1) and \u003cem\u003eEntodon rubicundus\u003c/em\u003e (AB accession 029386.1) from the Hypnaceae family were selected as outgroups for tree rooting.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/477a4a315171802e188c0b41.jpg"},{"id":105896074,"identity":"2ecf5332-59f1-454b-b031-d4a9421e87a9","added_by":"auto","created_at":"2026-04-01 08:43:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1797198,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/562db68c-11a7-46f8-926d-4ddb7324326b.pdf"},{"id":100367387,"identity":"03f39171-233b-474f-99bf-8c7728f20873","added_by":"auto","created_at":"2026-01-16 07:57:02","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":186748,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-8194045/v1/59da1206a8da939fbfc6098c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Integrative Morphological and Molecular Insights into Rhynchostegium celebicum (Brachytheciaceae), a moss from the Eastern Himalaya","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDarjeeling, situated in the northern part of West Bengal, lies within the Eastern Himalayan biodiversity hotspot and is recognized as one of India\u0026rsquo;s richest repositories of flora and fauna. This region has notably abundant unique and endemic plant species, including bryophytes, owing to its distinctive climatic conditions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Several new taxa have been reported over the past few decades, primarily based on their morphological architecture [\u003cspan additionalcitationids=\"CR3 CR4 CR5 CR6\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGlobally, approximately 221 species of \u003cem\u003eRhynchostegium\u003c/em\u003e Schimper have been documented (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.worldfloraonline.org\u003c/span\u003e\u003cspan address=\"http://www.worldfloraonline.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e ). These species belong to the family Brachytheciaceae and constitute one of the three largest genera in this family [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Among these, 140 species are accepted (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.bryonames.org/\u003c/span\u003e\u003cspan address=\"https://www.bryonames.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), with only 11 species reported in India [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Among mosses, the family Brachytheciaceae is the second-largest pleurocarpous group in India, comprising 84 species belonging to 10 genera [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The genus \u003cem\u003eRhynchostegium\u003c/em\u003e Schimper is widespread in the Himalayan region [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The introduction of new species and the presence of existing species in novel locations are common occurrences within this genus [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. One of its species, \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e (Sande Lac.) A. Jaeger, is broadly distributed in tropical to subtropical, often mountainous or forested regions across Southeast Asia and the Pacific Islands, including various phytogeographic zones of the Indian subcontinent [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and has recently been added to the flora of the Darjeeling Hills [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. It is morphologically characterized by ovate to lanceolate, acuminate, and serrulate leaves on both stems and branches, a weak costa, smooth setae, and a long-rostrate operculum [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], which typically form small to large, loose tufts or extensive mats.\u003c/p\u003e \u003cp\u003eThis species was first collected from the Darjeeling Hills in April 2017 during an ongoing project on the moss flora of Darjeeling Hills, and was recollected from the same locality in June 2024. This repeated occurrence suggests that the species may be well-acclimated to this region. The present study provides a comprehensive morphological illustration of sporophytic structures using scanning electron microscopy (SEM) and detailed measurements.\u003c/p\u003e \u003cp\u003eTo confirm its taxonomic placement, molecular phylogenetic analysis was conducted using \u003cem\u003erbcL\u003c/em\u003e sequence data. The chloroplast gene \u003cem\u003erbcL\u003c/em\u003e is highly conserved yet exhibits sufficient variation to discriminate among closely related taxa at the species and genus levels [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Its relatively slow evolutionary rate also makes it valuable for resolving relationships at higher taxonomic ranks, such as families and orders, thereby providing a stable framework for phylogenetic inference [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The phylogeny of \u003cem\u003eRhynchostegium\u003c/em\u003e has been investigated using a combination of three DNA sequence regions: nuclear ITS1-5.8S-ITS2 and plastid \u003cem\u003etrnL-F\u003c/em\u003e and \u003cem\u003etrnD-T\u003c/em\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Notably, phylogeny based on the plastidial \u003cem\u003erbcL\u003c/em\u003e was conducted for the first time in this genus. Future studies incorporating additional markers are necessary to elucidate the complex phylogeny of Brachytheciaceae.\u003c/p\u003e \u003cp\u003eHere, we provide an extended morphological description of \u003cem\u003eR. celebicum\u003c/em\u003e, supplemented with illustrations, molecular data, and ecological observations of the Darjeeling Hills. The broad biogeographic significance of this species has also been discussed.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCollection of specimens\u003c/h2\u003e \u003cp\u003eMoss specimens were collected from wild using detailed field records, including precise habitat descriptions and ecological details of the collection site. The distribution map of the moss samples was generated using \u003cem\u003eQGIS\u003c/em\u003e version 3.44.3 Solothurn (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The specimens were carefully dried, preserved, and deposited in the Lloyd Botanical Garden in Darjeeling, West Bengal, India. Species identification was carried out through extensive examination of morphological and anatomical features, comparing these observations with descriptions in the \u0026ldquo;Mosses of Eastern India and Adjacent Regions\u0026rdquo; [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] and \u0026ldquo;Taxonomy of Indian Mosses\u0026rdquo; [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e was documented in 2017 at Bhutia Busty, Darjeeling Hills, (N27\u0026deg;03'19.19\", E088\u0026deg;15'38.02\u0026rdquo;, 1989 m) growing with liverworts on moist soil over rock. The humid, undisturbed foothill habitat supports rich bryophyte diversity. The species was again collected from the same site in 2024 (N27\u0026deg;03'19.44\", E088\u0026deg;15'37.71\u0026rdquo;, 2002 m), this time also occurring epiphytically on \u003cem\u003eAlnus nepalensis\u003c/em\u003e. Both collections (Supplementary Fig. a,b) have been deposited in the Lloyd Botanical Garden Herbarium, Darjeeling.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMorphological Studies\u003c/h3\u003e\n\u003cp\u003eThe morphological characteristics of the moss specimens were analyzed using a stereomicroscopy (Stereomaster-Plus, Dewinter, India), binocular light microscopy (Excel, Dewinter, India), and scanning electron microscopy (EVO 10, Zeiss, Germany). To prepare specimens for microscopy, moss samples were rehydrated in double-distilled water for 10\u0026ndash;15 min to facilitate the rapid hydration and removal of surface debris. For the SEM analysis, the specimens were dehydrated using a graded ethanol series (60%, 70%, 80%, 90%, and absolute ethanol), mounted on aluminium stubs with carbon tape, and sputter-coated with gold-palladium for 120 s using an SC7620 Mini Sputter Coater/Glow Discharge System (Quorum Technologies). High-resolution photomicrographs were obtained at an acceleration voltage of 30 eV. Quantitative analyses included measurements of leaf length, width, leaf cell dimensions, peristome teeth features, and spore diameter, recorded using an ocular micrometer calibrated against a stage micrometer and analyzed using ImageJ software [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eDNA Extraction, Amplification, and Phylogenetic Analysis\u003c/h3\u003e\n\u003cp\u003eGenomic DNA was extracted, amplified by PCR, and sequenced according to the method outlined by Bera [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. PCR amplification was performed using primers \u003cem\u003erbcL\u003c/em\u003ea-F (ATGTCACCACAAACAGAGACTAAAGC; [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] and \u003cem\u003erbcL\u003c/em\u003ea-R (GTAAAATCAAGTCCACCRCG; [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The sequences were aligned using MEGA11 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. For phylogenetic analysis, \u003cem\u003erbcL\u003c/em\u003e sequences from other members of the Brachytheciaceae family, available in GenBank, were used to construct a phylogenetic tree. The tree was generated using the maximum parsimony (MP) method with 1000 bootstrap replicates in Mega11 software, utilizing the Tree-Bisection-Regrafting (TBR) algorithm [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. \u003cem\u003eHypnum plumaeforme\u003c/em\u003e (AB accession 029384.1) and \u003cem\u003eEntodon rubicundus\u003c/em\u003e (AB accession 029386.1), from the Hypnaceae family, were selected as outgroups for tree rooting.\u003c/p\u003e\n\u003ch3\u003eTaxonomic Treatment\u003c/h3\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eBasionym\u003c/h2\u003e \u003cp\u003e \u003cem\u003eHypnum celebicum\u003c/em\u003e Sande Lac., Bryol. Jav. 2: 159. 258. 1866.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEtymology\u003c/h2\u003e \u003cp\u003eThe specific epithet, celebicum, refers to \u0026lsquo;Celebes (Sulawesi)\u0026rsquo; in Latin, the county name of the type locality.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRange\u003c/h3\u003e\n\u003cp\u003eBorneo, Cambodia, Hawaii, India, Java, Myanmar, New Caledonia, New Guinea, Philippines, Sulawesi, Sumatra, Taiwan, Thailand, Vietnam.\u003c/p\u003e\n\u003ch3\u003eDistribution in India\u003c/h3\u003e\n\u003cp\u003eEastern Himalaya: Assam, Darjeeling; Meghalaya: Khasi Hills, and Arunachal Pradesh. Western Himalayas: Uttarakhand; Western Ghats: Tamil Nadu\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eEcology and Distribution\u003c/h2\u003e \u003cp\u003eIn April 2017, \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e was identified in association with liverworts on the thin, moist soil layer covering rocks in Bhutia Busty, located in the Darjeeling Hills (N27\u0026deg;03'19.19\", E088\u0026deg;15'38.02\u0026rdquo;, 1989 m). This region, a remote part of the Himalayan foothills, is rich in ferns and bryophytes owing to its moist conditions and limited human activity, with steep slopes contributing to the lush environment. In 2024, the same species was collected from the same locality (N27\u0026deg;03'19.44\", E088\u0026deg;15'37.71\u0026rdquo;, 2002 m), which grows epiphytically on the bark of \u003cem\u003eAlnus nepalensis\u003c/em\u003e. These species were found growing on both rock surfaces and tree trunk specimens (Supplementary figures a and b) from both collections were submitted to the Lloyd Botanical Garden Herbarium, Darjeeling (Accession no LB014433 for 2017 and LB014686 for 2024).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMorphological \u0026amp; ultrastructural details\u003c/h2\u003e \u003cp\u003eThe plants were creeping, approximately\u0026thinsp;\u0026plusmn;\u0026thinsp;5 cm in length, with pinnate or bipinnate branches reaching up to 2 cm in length (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). They are yellowish-green to light-green, glossy, and form tufts. The leaves are erecto-patent, spreading, and have an ovate to acuminate shape, measuring 1.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 mm in length and 0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 mm in width (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Leaf margins were denticulated from the middle to the apex. The cells at the base of the leaves measure 37.79\u0026thinsp;\u0026plusmn;\u0026thinsp;1.49 x 5.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.51 \u0026micro;m, smooth, while the upper cells are 33.85\u0026thinsp;\u0026plusmn;\u0026thinsp;7.14 x 6.23\u0026thinsp;\u0026plusmn;\u0026thinsp;1.12 \u0026micro;m. The costa is single, covering approximately two-thirds of the leaf (Supplementary figure c), and measures 0.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10 mm in length and 0.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 mm in width on average. The laminal cells were thick-walled and lax. The apical single terminal cell was 37.12\u0026thinsp;\u0026plusmn;\u0026thinsp;2.65 x 6.55\u0026thinsp;\u0026plusmn;\u0026thinsp;1.16 \u0026micro;m, while the median and upper laminal cells were linear and sub-rectangular, measuring 40.05\u0026thinsp;\u0026plusmn;\u0026thinsp;6.63 x 6.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.87 \u0026micro;m. The lower laminal cells are rectangular to quadrate, measuring 40.32\u0026thinsp;\u0026plusmn;\u0026thinsp;7.25 x 6.14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.22 \u0026micro;m (Supplementary figure f). The seta is erect and smooth (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec), measuring 1.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15 mm in length. The capsule is cylindrical, horizontal (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee) and measures 2.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24 mm in height and 0.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09 mm in width. The operculum is conical with a long rostrum, measuring 1.14 mm in length, and the calyptra is 2.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09 x 0.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02 mm (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). The peristome was diplolepidous (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). The spores were yellowish-green.\u003c/p\u003e \u003cp\u003eThe leaf base exhibited distinctly corrugated, wavy patterns, with epidermal cells arranged in pronounced, parallel undulations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). The leaf cells were elongated, narrowly elliptical to convex in shape, and interconnected by bifurcated cell wall ends (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). The leaf apex was elongated and pointed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef, and Supplementary figure d), bearing clear serrations along the margins (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh and Supplementary figure e). The upper laminal and marginal cells appear to be comparatively more contracted. The leaf surface was smooth and lacked papillae.\u003c/p\u003e \u003cp\u003eThe exostome was measured at 256.67\u0026thinsp;\u0026plusmn;\u0026thinsp;33.55 \u0026micro;m in length and 45.68\u0026thinsp;\u0026plusmn;\u0026thinsp;3.33 \u0026micro;m in width (figures a-c). The dorsal region of the exostomes is characterized by robust, regularly spaced transverse stripes (5.10\u0026thinsp;\u0026plusmn;\u0026thinsp;1.12 \u0026micro;m) arranged in parallel, with papillae-like ornamentation present between the stripes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). The ventral surface of the exostome was narrowly flattened, smooth, and lamellated, with ridges (figure d). The endostome was well-developed, being slightly longer but narrower than the exostome, measuring 361.27\u0026thinsp;\u0026plusmn;\u0026thinsp;37.85 \u0026micro;m in length and 35.08\u0026thinsp;\u0026plusmn;\u0026thinsp;2.34 \u0026micro;m in width (figures a-c). The dorsal region of the endostomes is characterized by faint ridges that are more widely spaced (13.10\u0026thinsp;\u0026plusmn;\u0026thinsp;3.11 \u0026micro;m) compared to those of the exostome. Additionally, the surface was embellished with irregular papillae, imparting a rough, spiny texture (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eh). Smooth, thin-walled cells were located in the basal region of the ventral position of the endostome (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003eThe operculum was conical to hat-shaped, with a broad basal portion (641.05\u0026thinsp;\u0026plusmn;\u0026thinsp;68.96 \u0026micro;m) tapering into a slender, stalk-like apex (1145.54\u0026thinsp;\u0026plusmn;\u0026thinsp;42.62 \u0026micro;m) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). The surface appeared relatively smooth compared with that of the teeth, although fine reticulate ornamentation was occasionally restricted to the basal region (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Spores were predominantly spherical to sub-spherical (roundness index: 0.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02), with a mean diameter of 21.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.93 \u0026micro;m. Their surfaces were covered with numerous, evenly distributed, small, rounded papillae (0.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02 \u0026micro;m in diameter), imparting a finely papillose texture (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic Relationships of Rhynchostegium and Related Genera\u003c/h2\u003e \u003cp\u003ePhylogenetic reconstruction demonstrated that all examined \u003cem\u003eRhynchostegium\u003c/em\u003e species\u0026mdash;including \u003cem\u003eR. celebicum, R. megapolitanum, R. riparioides, and R. pallidifolium\u003c/em\u003e formed a strongly supported monophyletic clade. Within this lineage, \u003cem\u003eR. celebicum\u003c/em\u003e (Accession no PP663260.1) showed a particularly close relationship with \u003cem\u003eR. megapolitanum\u003c/em\u003e (Accession no OZ207752.1), which is a rare bryophyte found in Europe and North America.\u003c/p\u003e \u003cp\u003eThe semi-submerged \u003cem\u003ePlatyhypnidium riparioides\u003c/em\u003e (synonym: \u003cem\u003eR. riparioides\u003c/em\u003e, accession number AB029385.1) was nested within this clade (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Interestingly, the entire \u003cem\u003eRhynchostegium\u003c/em\u003e clade was recovered as a sister group to \u003cem\u003ePalamocladium leskeoides\u003c/em\u003e (LC accession 744569.1). At a broader level, the phylogeny revealed a large and diverse assemblage of \u003cem\u003eBrachythecium\u003c/em\u003e species, together with allied genera, such as \u003cem\u003eSciuro-hypnum, Pseudokinbergia, Helicodontium, Myuroclada, Homalothecium, and Eurhynchium.\u003c/em\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLeaf morphology, particularly the smooth surface of the leaves, distinguishes \u003cem\u003eRhynchostegium\u003c/em\u003e from other genera such as \u003cem\u003eBrachythecium\u003c/em\u003e, \u003cem\u003eHomalothecium\u003c/em\u003e, and \u003cem\u003eEurhynchium\u003c/em\u003e, which are characterized by plicate leaves [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Furthermore, \u003cem\u003eRhynchostegium\u003c/em\u003e exhibited significant similarities to \u003cem\u003eEurhynchium\u003c/em\u003e, except for differences in plant colouration and the terminal cells of the costa. Specifically, in \u003cem\u003eRhynchostegium\u003c/em\u003e, plants are whitish in colour, and the terminal cell of the costa lacks a spine, whereas in \u003cem\u003eEurhynchium\u003c/em\u003e, it is green and possesses a spine. The leaf length of the studied species was slightly shorter than that reported by Saha et al. [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This discrepancy may be attributed to a conflict between parent and offspring dynamics and the morphology of gametophytes and sporophytes [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Nevertheless, it remains unclear whether this reduction is a consequence of the nutritional dependence of sporophytes on gametophytes.\u003c/p\u003e \u003cp\u003eBecause the ultrastructural details have been documented for the first time, they may be comparable to those of other species. Microscopic leaf morphology contrasted significantly with the features reported by Robinson, although the species were from different families [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The spore diameter and shape in \u003cem\u003eR. celebicum\u003c/em\u003e were slightly different from those observed in \u003cem\u003eE. praelongum\u003c/em\u003e (approximately 12\u0026micro;m; subglobose) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Additionally, large spores (\u0026gt;\u0026thinsp;20\u0026micro;m) have been identified in various epiphytic lineages [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The ultrastructural characteristics of the peristome are similar to those of \u003cem\u003eHypopterygium fauriei\u003c/em\u003e and \u003cem\u003eAulacomnium heterostichum\u003c/em\u003e, although these taxa are not closely related [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The plates and ridges present on exostomes play crucial roles in determining both the direction and extent of hygroscopic movement [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In contrast, endostomes, that lack distinct ridges are unlikely to participate in this movement.\u003c/p\u003e \u003cp\u003eIn the present study, plastid \u003cem\u003erbcL\u003c/em\u003e gene analysis was performed to provide additional support for the identification of the Eastern Himalayan specimen. However, nuclear data are often required for complete resolution in Brachytheciaceae. Huttunen \u0026amp; Ignatov successfully resolved the complex relationships within the \u003cem\u003eRhynchostegium\u003c/em\u003e clade using the ITS region, which has a higher substitution rate, crucial for resolving recent divergence [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In this study phylogenetic analysis suggested a close relationship between \u003cem\u003eR. megapolitanum\u003c/em\u003e and \u003cem\u003eR. celebicum\u003c/em\u003e, likely because of their shared gametophytic morphology (loosely branched shoots with erect, smooth setae) and ecological plasticity. Their capacity for habitat expansion may also be enhanced by environmental drivers such as climate change and nitrogen deposition [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. However, both species were placed in a separate clade within the phylogenetic tree based on nuclear ribosomal ITS1-5.8S-ITS2 sequence data [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The affinity between \u003cem\u003eR. riparioides\u003c/em\u003e and \u003cem\u003eP. leskeoides\u003c/em\u003e further corroborates the phylogenetic placement of \u003cem\u003eRhynchostegium\u003c/em\u003e as proposed by Ignatov and Huttunen [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], which is likely attributable to similarities in their gametophytic structures.\u003c/p\u003e \u003cp\u003eHowever, studies of aquatic species (e.g., \u003cem\u003ePlatyhypnidium\u003c/em\u003e) have revealed multiple independent evolutionary shifts from terrestrial to aquatic habitats, resulting in geographically defined clades of aquatic species [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Consequently, morphological similarities among aquatic species are often homoplastic and driven by adaptation to similar ecological pressures rather than shared ancestry. In 2010, Huttunen and Ignatov observed that the Asiatic species \u003cem\u003eR. celebicum\u003c/em\u003e and \u003cem\u003eR. javanicum\u003c/em\u003e possessed distinct tandem repeats within the plastid \u003cem\u003etrnT-E\u003c/em\u003e spacer region [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. This finding underscores the potential of utilizing specific molecular signatures to trace the biogeographic history of \u003cem\u003eRhynchostegium\u003c/em\u003e in the Asian tropics.\u003c/p\u003e \u003cp\u003eThe phylogenetic framework further suggests complex relationships between \u003cem\u003eRhynchostegium\u003c/em\u003e and \u003cem\u003eBrachythecium\u003c/em\u003e within Brachytheciaceae, with the latter appearing to be polyphyletic or paraphyletic. Despite this, \u003cem\u003eBrachythecium\u003c/em\u003e remains morphologically distinct, characterized by a rough seta, conical to shortly beaked operculum, elongate-ovoid capsule, and variable costa that may reach the leaf apex. Although \u003cem\u003eRhynchostegium\u003c/em\u003e is recovered as a separate lineage, the dispersed position of \u003cem\u003eBrachythecium\u003c/em\u003e across the tree indicates a complicated evolutionary history that warrants further investigation combining molecular and morphological evidence. Moreover, molecular markers can be used to elucidate species-specific characteristics.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe second author is grateful to the Science and Engineering Research Board, Govt. of India, for funding a project on Climate change and providing her fellowship. The authors also extend their gratitude to the HOD, Department of Life Sciences, Presidency University, Kolkata, for providing infrastructural facilities to carry out this research. We appreciate the access to scientific resources facilitated by the Information and Library Network and the e-Library Consortium through the Department of Life Sciences, Presidency University. The authors also convey their sincere thanks to Officer-in-Charge, Lloyd Botanic Garden, Darjeeling, for extending his kind help in the issuance of the accession number.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Science and Engineering Research Board (SERB), Govt. of India (GoI), under research grant number: SCP/2022/000716 dated 18.07.2023 (Special Call Project on Climate change). Department of Biotechnology, GoI, under research grant number BT/INF/SP45088/2022 dated 17.02.2022 for Instrumental facilities and the Council of Scientific and Industrial Research (CSIR) under research grant number: 09/028(0992)/2017-EMR-I dated 04.05.2017 for fellowship of the first author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declaration:\u0026nbsp;\u003c/strong\u003eThe collection of plant/plant parts used in our study were complied with the local or national guidelines.\u0026nbsp;Plants were collected from wild and were used for only academic purposes and not for any commercial utilization. The relevant permission for collection of this moss specimen was taken from forest authority.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate declaration:\u0026nbsp;\u003c/strong\u003enot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish declaration:\u0026nbsp;\u003c/strong\u003enot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e No potential conflict of interest was reported by the author(s).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlant Specimens were deposited in the Lloyd Botanical Garden Herbarium, Darjeeling (Accession no LB014433 for 2017 and LB014686 for 2024). \u0026nbsp;The datasets generated and/or analysed during the current study are available in the GenBank repository, Accession number: \u003cem\u003erbcL\u003c/em\u003e = PP663260.1(Holotype; https://www.ncbi.nlm.nih.gov/nuccore/PP663260.1/).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eVarma JK. Biodiversity Hotspots of the Eastern Himalayas. Environ Sci Q. 2024;15(2):105\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGangulee HC. \u003cem\u003eMosses of Eastern India and adjacent regions: A monograph, Fascicle 1\u0026ndash;8.\u003c/em\u003e Calcutta, India: Books and Allied Limited; 1969\u0026ndash;1980.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLal J. A checklist of Indian mosses. Dehra Dun: Bishen Singh Mahendra Pal Singh; 2005. pp. 120\u0026ndash;1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaniels A, Kariyappa K. On the circumscription of the moss \u003cem\u003eRhynchostegium hookeri\u003c/em\u003e (Brachytheciaceae). Acta Bot Hung. 2013;55(3\u0026ndash;4):5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1556/abot.55.2013.3-4.5\u003c/span\u003e\u003cspan address=\"10.1556/abot.55.2013.3-4.5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaha P, Aziz MN, Maity D. New records of mosses from Darjeeling District, West Bengal. Indian J For. 2017;40:83\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.54207/bsmps1000-2017-XY9A86\u003c/span\u003e\u003cspan address=\"10.54207/bsmps1000-2017-XY9A86\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaha P, Aziz MN, Maity D. Addition of two species of Sematophyllaceae to the moss flora of West Bengal. J Botan Soc Bengal. 2020;74(2):119\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBera R, Biswas-Raha A, Paine AK, Datta J, Poddar-Sarkar M, et al. \u003cem\u003eBartramidula roylei\u003c/em\u003e (Hook. f.) Bruch \u0026amp; Schimp.: An addition to the moss diversity of Darjeeling hills. J Botan Soc Bengal. 2022;76(1):44\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruch P, Schimper WP, G\u0026uuml;mbel WT. Bryologia Europaea 5, fasc. 49\u0026ndash;51. Stuttgart: E. Schweizerbart; 1852.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVohra JN. New Taxa of Hypnobryales (Musci) from the Himalayas. Nelumbo. 2024;22(1\u0026ndash;4):115\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.20324/nelumbo/v22/1980/75410\u003c/span\u003e\u003cspan address=\"10.20324/nelumbo/v22/1980/75410\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaha P, Aziz MN, Maity D. Addition of two species of \u003cem\u003eRhynchostegium\u003c/em\u003e BSG (Bryophyta, Musci) to the moss flora of West Bengal, India. J Bombay Nat Hist Soc 2021;118.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVončina G, Stebel A. The moss \u003cem\u003eRhynchostegium rotundifolium\u003c/em\u003e (Brachytheciaceae) new to Poland. Herzogia. 2019;32(2):503\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarra\u0026iacute;n JB, Huttunen S, Ignatova E, Ignatov M, et al. \u003cem\u003eRhynchostegium occultum\u003c/em\u003e (Brachytheciaceae), a new species from relict forests of central Chile. Phytotaxa. 2020;453(3):199\u0026ndash;217.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarukial J. A study of moss diversity in Assam valley wet evergreen forests. 2011. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.13140/RG.2.2.25618.58560\u003c/span\u003e\u003cspan address=\"10.13140/RG.2.2.25618.58560\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuleiman M, Masundang DP, Akiyama H. The mosses of Crocker Range Park, Malaysian Borneo. PhytoKeys. 2017;88:71\u0026ndash;107. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3897/phytokeys.88.14674\u003c/span\u003e\u003cspan address=\"10.3897/phytokeys.88.14674\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSande lacoste CM Van der. Musci frondosi. In: Miquel FAWM, editor. \u003cem\u003eProlusio florae japonicae. Ann. Mus. Lugd.-Bat.\u003c/em\u003e 1866\u0026ndash;1867;2:292\u0026ndash;300; 3:209.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuck WR. Pleurocarpous mosses of the West Indies. Mem N Y Bot Gard. 1998;82:1\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGradstein SR, Churchill SP, Sallazar-allen N. Guide to the bryophytes of Tropical America. Mem N Y Bot Gard. 2001;86:1\u0026ndash;577.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChase MW, Soltis DE, Olmstead RG, Morgan D, Les LH, et al. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene \u003cem\u003erbcL\u003c/em\u003e. Ann Missouri Bot Gard. 1993;80:528\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGitzendanner MA, Soltis PS, Wong GKS, Ruhfel BR, et al. Plastid phylogenomic analysis of green plants: a billion years of evolutionary history. Amer J Bot. 2018;105(3):291\u0026ndash;301.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuttunen S, Ignatov M. Evolution and taxonomy of aquatic species in the genus \u003cem\u003eRhynchostegium\u003c/em\u003e (Brachytheciaceae, Bryophyta). Taxon. 2010;59. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/tax.593010\u003c/span\u003e\u003cspan address=\"10.1002/tax.593010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChopra RS. Introduction to taxonomy of Indian mosses. New Delhi, India: CSIR Publication; 1975.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9(7):671\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBera R. \u003cem\u003ePhylogenetic analysis of mosses from Darjeeling hills on the basis of lipidomics, metabolomics and DNA barcoding\u003c/em\u003e [PhD Thesis]. Kolkata: University of Calcutta; 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevin RA, Wagner WL, Hoch PC, Nepokroeff M, Pires JC, et al. Family-level relationships of Onagraceae based on chloroplast \u003cem\u003erbcL\u003c/em\u003e and \u003cem\u003endhF\u003c/em\u003e data. Amer J Bot. 2003;90:107\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKress WJ, Erickson DL, Jones FA, Swenson NG et al. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A.\u003c/em\u003e 2009;106:18621\u0026ndash;18626.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38(7):3022\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNei M, Kumar S. Molecular evolution and phylogenetics. Oxford University Press; 2000.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIgnatov MS. Bryophyte flora of Altai Mountains. VIII Brachytheciaceae Arctoa. 1998;7:85\u0026ndash;152.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoroozi M, Budke JM. Gametophyte and sporophyte morphology are phylogenetically correlated in mosses, indicating coadaptation and parent\u0026ndash;offspring conflict. New Phytol. 2025;246(5):2295\u0026ndash;306. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nph.70117\u003c/span\u003e\u003cspan address=\"10.1111/nph.70117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeden\u0026auml;s L. Environmental factors affecting character states in pleurocarpous mosses. Bryologist. 2001;104:72\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuttunen S, Ignatov MS, M\u0026uuml;ller K, Quandt D. Phylogeny and evolution of epiphytism in the three moss families: Meteoriaceae, Brachytheciaceae, and Lembophyllaceae. In: Goffinet B, Hollowell V, Magill R, editors. Molecular systematics of bryophytes. Monographs in Systematic Botany from the Missouri Botanical Garden 98. St. Louis: Missouri Botanical Garden; 2004. pp. 328\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Y, Wu Q, Zhang Z, Wang Z. Microscopic and submicroscopic exploration of diplolepideae peristome structures in hygroscopic movement. BMC Plant Biol. 2024;24(1):710.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobinson H. Scanning electron microscope studies on moss leaves and peristomes. Bryologist. 1971;74(4):473\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchnepf E, Stein U, Deichgr\u0026auml;ber G. Structure, function, and development of the peristome of the moss, \u003cem\u003eRhacopilum tomentosum\u003c/em\u003e, with special reference to the problem of microfibril orientation by microtubules. Protoplasma. 1978;97(2):221\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhite TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols: A guide to methods and applications. Academic; 1990. pp. 315\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZechmeister HG, Moser D, Milasowszky N. Spatial distribution patterns of \u003cem\u003eRhynchostegium megapolitanum\u003c/em\u003e at the landscape scale\u0026mdash;an expanding species? Appl Veg Sci. 2007;10(1):111\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1654-109X.2007.tb00509.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1654-109X.2007.tb00509.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnsen I. \u003cem\u003eRhynchostegium megapolitanum\u003c/em\u003e (Web. et Mohr) B.S.G.\u0026mdash;A rare bryophyte in dune ecosystems of Zealand, Denmark. \u003cem\u003eAmer. J. Plant Sci.\u003c/em\u003e 2014;5:1378\u0026ndash;1383. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.ogr/10.4236/ajps.2014.59152\u003c/span\u003e\u003cspan address=\"https://doi.ogr/10.4236/ajps.2014.59152\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIgnatov MS, Huttunen S. Brachytheciaceae (Bryophyta)\u0026mdash;a family of sibling genera. Arctoa. 2002;11(1):245\u0026ndash;96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15298/arctoa.11.20\u003c/span\u003e\u003cspan address=\"10.15298/arctoa.11.20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeden\u0026auml;s L, Quandt D. The Evolutionary Diversity of Mosses\u0026mdash;Taxonomic Heterogeneity and its Ecological Drivers. J Syst Evol. 2018;56(5):450\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Bryophyta, Darjeeling Hills, Rhynchostegium celebicum, SEM, rbcL, Molecular Phylogeny","lastPublishedDoi":"10.21203/rs.3.rs-8194045/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8194045/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study provides a detailed morphological, ultrastructural, and phylogenetic analysis of the moss \u003cem\u003eRhynchostegium celebicum\u003c/em\u003e (Brachytheciaceae), from Darjeeling Hills, a key region within the Eastern Himalayan biodiversity hotspot. Scanning Electron Microscopy (SEM) was the first to document the sporophytic ultrastructure, revealing fine papillose spores and distinct ornamentation on the peristome teeth, indicating differential hygroscopic roles. Molecular phylogenetic analysis employing the plastid \u003cem\u003erbcL\u003c/em\u003e sequence strongly supported a monophyletic \u003cem\u003eRhynchostegium\u003c/em\u003e clade and showed a close relationship between \u003cem\u003eR. celebicum\u003c/em\u003e and \u003cem\u003eR. megapolitanum\u003c/em\u003e. This study substantiates the identity and phylogenetic placement of the species, providing essential insights into the biogeographic distribution and evolutionary relationships within \u003cem\u003eRhynchostegium\u003c/em\u003e in the region.\u003c/p\u003e","manuscriptTitle":"Integrative Morphological and Molecular Insights into Rhynchostegium celebicum (Brachytheciaceae), a moss from the Eastern Himalaya","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-13 11:20:13","doi":"10.21203/rs.3.rs-8194045/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bfb1426d-1f05-4520-8e7e-048b2bb17248","owner":[],"postedDate":"January 13th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-01T08:40:59+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-13 11:20:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8194045","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8194045","identity":"rs-8194045","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}