A Novel Rapid Visual Detection of Toxoplasma Gondii by Combining Recombinase Polymerase Amplification and Lateral Flow Dipstick Coupled With CRISPR-Cas13a Fluorescence Assay

A Novel Rapid Visual Detection of Toxoplasma Gondii by Combining Recombinase Polymerase Amplification and Lateral Flow Dipstick Coupled With CRISPR-Cas13a Fluorescence Assay | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research A Novel Rapid Visual Detection of Toxoplasma Gondii by Combining Recombinase Polymerase Amplification and Lateral Flow Dipstick Coupled With CRISPR-Cas13a Fluorescence Assay Jinhong Zhao, Yuanyuan Li, Qiqi Xue, Zhiwei Zhu, Minghui Zou, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-823211/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Toxoplasmosis caused by infecting with Toxplasma gondii is a kind of parasitic disease that prevalent all over the world and does great harm to pregnant women and newborns. Effective, rapid and accurate diagnosis T. gondii is urgently needed to prevent and treatment the toxoplasmosis. The purpose of this study was to develop a rapid visual detection assay using recombinase aided amplification (RAA) and lateral flow dipstick (LFD) coupled with CRISPR-Cas13a fluorescence, henceforth RAA-Cas13a-LFD, for detection of T. gondii . Methods: Targeting 529bp gene of T. gondii , the primers and probes for RAA-Cas13a-LFD assay were designed and screened. The reaction time of RAA-LFD - Cas13a assay was optimized, as well as the sensitivity and specificity was further validated. Finally, the diagnostic performance of T. gondii was evaluated using the RAA-Cas13a-LFD assay for clinical blood samples. Results: The RAA-Cas13a-LFD assay was performed in an incubator block at 37℃ within 2h, and the amplicons were visible through LFD for naked eye visualization. The detection limit of the developed RAA-Cas13a-LFD assay was 1×10 -6 ng/μL with high specificity for T. gondii . Compared with qPCR assay, there was a consistent positive rate among the clinical blood samples. Conclusion: In this study, A rapid and visual RAA-Cas13a-LFD assay was developed. It requires no sophisticated equipment and shows promise for on-site surveillance of T. gondii . Parasitology Toxplasma gondii recombinase aided amplification lateral-flow dipstick CRISPR-Cas13a Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background Toxoplasma gondii is an obligate intracellular protozoan parasite that causes toxoplasmosis and threatens warm blooded animal and human health worldwide [ 1 ]. It is estimated that more than 30% of the global population is reportedly seropositive with T. gondii , although the infection rates vary significantly by geographical region [ 2 ]. A recent analysis reported antibody positive rates of 8.20 and 8.60% for T. gondii in the general population and pregnant women across China, respectively [ 3 ]. People with normal immune function may not have typical symptoms and show recessive infection after infection with T. gondii , but pregnant women infected with T. gondii can lead to premature delivery, abortion, teratosis, stillbirth, etc., and newborn is regularly accompanied by serious eye diseases [ 1 , 4 ]. For humans with weakened immune function or immunodeficiency, such as AIDS patients, organ transplant recipients, tumor patients, etc., infection with T. gondii can cause extreme encephalitis and even death [ 5 , 6 ]. Therefore, effective, rapid and accurate diagnosis is needed to improve development of treatment approaches, enhance prognosis and control dissemination. At present, the testing targets for Toxoplasmosis consist of the pathogenic methods, immunological techniques and molecular biological methods [ 7 , 8 ]. Above all, direct pathogenic diagnosis of T. gondii involves the detection of tachyzoites or tissue cysts by direct microscopy or isolation in cell culture. However, pathologic tissue examination or strain isolation are mostly used for diagnosis of animal infection, less frequently for that of human toxoplasmosis [ 1 ]. Currently, nucleic acid and specific antibody assays of T. gondii are the most commonly used techniques in clinical settings [ 9 ]. Particularly, the serum IgM/IgG antibody test has been widely used as a primary screening method for toxoplasmosis infection. However, the sensitivity and specificity of this method are not very high, and it is easy to produce false positive. In recent years, PCR, nested PCR, and real-time PCR (qPCR) assays have become essential tools for the molecular diagnosis of T. gondii . These PCR-based amplification techniques have revealed good sensitivity and specificity, and qPCR with probe hybridization reported to be the most sensitive assay [ 10 ]. Nevertheless, widespread clinical application of these techniques has been limited by several factors, including the need for sophisticated instruments, complicated operation and well trained personnel. To date, several new molecular biological methods that require a uniform incubation temperature have been described, which significantly reduce the reaction time and complexity of nucleic acid amplifications. These isothermal nucleic acid amplification methods, such as the loop-mediated isothermal amplification (LAMP), require only a heating block can maintain a constant temperature rather than an expensive thermocycler [ 11 ]. However, the LAMP method is prone to aerosol pollution and the result becomes a false positive. Recombinase aid amplification (RAA) is a new technology for nucleic acid amplification, and it works using four enzymes (UvsX, UvsY, SSB, and polymerase) at a constant temperature [ 12 ]. The RAA requires only a simple thermostatic device (constant temperature 37–42°C) and a short reaction time (30 min) [ 13 ]. DNA amplification can be detected by agarose electrophoresis (AGE), real-time fluorescence methods and lateral flow dipstick (LFD) [ 14 ], which have subsequently improved the sensitivity and specificity of the RAA assay. Among these optimizations, the LFD method is easy to use and its results easily interpretable. It can be used to detect proteins and nucleic acids [ 15 ]. Up to now, RAA-LFD has been applied for detection of microbes, such as Newcastle disease virus [ 16 ], dengue virus [ 13 ], avian infectious laryngotracheitis virus [ 17 ], Novel Coronavirus [ 18 ], even to identify the genetic sex of Cynoglossus semilaevis [ 14 ]. CRISPR-Cas systems are widely used for genome editing, in recent years, the trans-cleavage activity of Cas proteins has been discovered [ 19 , 20 ]. Detection methods based on CRISPR-Cas, which is now also considered a next-generation pathogen detection method, have become established [ 21 , 22 ]. DNA endonuclease targeted CRISPR trans-reporter and one-hour low-cost multipurpose highly efficient system can detect DNA sequences with high sensitivity and well specificity using CRISPR-Cas13a [ 23 ]. Methods such as SHERLOCK (specific high-sensitivity enzymatic reporter unlocking), which typically use target amplification followed by CRISPR-mediated nucleic acid detection have been used to detect SARS-CoV-2 [ 24 ]. During toxoplasmosis diagnosis, a series of nucleic acid amplification assays, targeting B1 gene or 529bp repeat sequences, internal transcriptional spacer sequences (ITS-1), as well as 18S rDNA sequences, have been established. While the 529bp repeat sequences showed better sensitivity and specificity for the diagnosis of toxoplasmosis [ 25 ]. According to literature available, there is no RAA amplification and LFD detection coupled with CRISPR-Cas13a fluorescence assay was been used for the diagnose of toxoplasmosis. In this study, we targeted the 529bp repeated element of T. gondii and designed the crRNA probe with the Cas13a-based detection system in combination with RAA and LFD methodology for easy visualization. Furthermore, we validated the established RAA-Cas13a-LFD assay by detecting T. gondii in genomic DNA extracted from clinical blood samples. Materials And Methods Strains and Clinical samples T. gondii tachyzoites (RH strain), preserved at our laboratory, were aseptically cultured in vitro, by serial passages in Vero cells, as previously described [ 26 ]. A total of 267 blood samples from patients clinically at the First Affiliated Hospital of Wannan Medical College were collected between December 2018 to November 2020. The blood samples were divided in two aliquots and placed in the anticoagulant tubes (containing 10µL 0.5µmol /L EDTA) and non-anticoagulant tubes, respectively. The blood in the non-anticoagulant tubes was centrifuged and the serum was aseptically separated for serology with electrochemiluminescence (ECL) assay (Roche, Switzerland). Blood from anticoagulant tubes is used to extract genomic DNA. DNA extraction A DNeasy Blood & Tissue Kit (Tiangen Biotech Beijing Co., Ltd., China) was used, to extract genomic DNA from blood samples under the the manufacturer’s instructions. All these DNA samples were stored at -20℃ until subsequent analysis. Due to the suspected low amount of circulating DNA in these blood samples whose status infection was unknown, each sample was divided into three parts and repeated eluted in order to improve DNA yield and detection rate. Each repliate was then tested and a positive result for any of the sections indicated that the sample was positive. Construction of standard recombinant plasmids Previous studies have reported the 529bp repeated element (GenBank AF146527) as the potential optimal targets for T. gondii [ 27 ]. The 529bp repeated element is a recently discovered target gene, with up to 300 copies, which offers more sensitivity and specificity during detection [ 27 ]. PCR products of T. gondii 529bp fragment were amplified in the positive tachyzoites of T. gondii , and electrophoresed, excised, purified, and cloned into the pMD™19-T vector (Takara). The positive clones were sequenced directionally (ABI 3730). The positive recombinant plasmids of T. gondii are kept in our laboratory (Wannan Medical College, China). It is the recombinant plasmids used as standard nucleic acids were quantified with a NanoDrop ND1000 spectrophotometer. Then the recombinant plasmids were prepared with a dilution range 1 ng/µL-1×10 − 9 ng/µL as a standard control and stored at -20℃ until needed. Design of primer and crRNA probe Since success of RAA amplification depends on designing the ideal primers for target the gene, we employed the online primer designing software and designed 5 pairs of specific oligonucleotide primers targeting the 529bp repeated element of T. gondii . The primers annealing temperature are 54–67℃ with the length about 30-35bp, and the amplicon size is (100-300bp) (Table 1 ). Specific crRNA probes were designed target the specific primer sequence fragment (Table 1 ). The DNA probes were prepared into RNA by in vitro transcription, according to the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, America). There should be paid to the 5' end accessory T7 RNA polymerase promoter sequence during probe design. The transcript (crRNA probe) was purified using RNAXP magnetic beads and the concentration of the product was determined by Qbuit nucleic acid concentration detector (Thermo, America). All primers were synthesized by TsingKe Biotech (Beijing TsingKe Biotechnology, Beijing, China). Table 1 Primer sequence for RAA-Cas13a-LFD assay. Primer Sequence(5'to3') Amplicon sizes (bp) Description TOX-F1 ACTACAGACGCGATGCCGCTCCTCC 283 Candidates for RAA primers that were screened in this study. TOX-F1/TOX-R1 pair was used for follow-up experiment experiments TOX-R1 TGTCTCCCTCGCCCTCTTCTCCACT TOX-F2 ACACCGGAATGCGATCCAGACGAGA 126 TOX-R2 GTCCAAGCCTCCGACTCTGTCTCCC TOX-F3 ATATCAGGACTGTAGATGAAGGCGAGGGT 176 TOX-R3 CGTCTCGTCTGGATCGCATTCCGGTGTCT TOX-F4 TAGATGAAGGCGAGGGTGAGGATGAGGGG 121 TOX-R4 CTCCAGGAAAAGCAGCCAAGCCGGAAACA TOX-F5 AAGATGTTTCCGGCTTGGCTGCTTTTCCTG 162 TOX-R5 CCGACTCTGTCTCCCTCGCCCTCTTCTCCA T7 promoter GAAATTAATACGACTCACTATAGGG Promote the transcription of amplified DNA to RNA in vitro transcription. Probe1 CGUCUCGUCUGGAUCGCAUUCCGGUGUC Expected sequences of guide RNA obtained from in vitro transcription. Probe1 was used for follow-up experiment experiments. Probe-2-5-a UUCUCUCCGCCAUCACCACGAGGAAAGC Probe-2-5-b CAAUUCUCUCCGCCAUCACCACGAGGAA Probe-3-4-a CUCCGACUCUCGUCGCUUCCCAACCACG Probe-3-4-b CCGACUCUCGUCGCUUCCCAACCACGCC Lateral flow reporter FAM/mArArUrGrGrCmAmArArUrGrGrCmA/Bio Trans cleavage reporter for Cas13a Establishment of RAA assay The basic RAA reactions were achieved by the Basic RAA kits (Anhui Microanaly Genetech, Hefei, China). The reaction buffer was premixed according to the following formula: 25µL of rehydration buffer, upstream primers (10µmol/L) 2µL, downstream primers (10µmol/L) 2µL, 25×SYBR Green Ⅰ 1µL, recombinant plasmids (1ng/µL) 2µL, MgOAc solution (280nmol/L) 2.5µL, and 17.5µL of nuclease-free water. The aforementioned reaction tube was put into fluorescent quantitative PCR instrument to amplify for 40min at 37℃. The amplified products were analyzed Qsep100 biological analyzer (BIOptic, Taiwan) by collecting the fluorescence. Establishment of RAA- Cas13a -LFD assay Here, targeted detection was used gene editing technology based on nucleic acid amplification and Cas13a-mediated collateral cleavage of a reporter RNA, allowing for real-time detection of the target. The 529bp target gene of T. gondii was amplified by RAA, T7 RNA polymerase transcription of amplified DNA to RNA and detection of target RNA by Cas13a collateral RNA cleavage mediated release of reporter signal. The fluorescence reporter signal can be detected by LFD, LFD is an endpoint assay, with lateral flow strips exposed to the reaction mixture post incubation (Fig. 1 ). The RAA-Cas13a-LFD reaction formula was as the following: LwCas13a nuclease (45nmol/L) (Anhui Microanaly Genetech, Hefei, China)), Lateral flow reporter molecule (125nmol/L) (Integrated DNA Technologies, Iowa, USA), RNase inhibitor (1µL) (New England Biolabs, America), ATP (1mM), GTP (1mM), UTP (1mM), CTP (1mM) and T7 polymerase (0.6µL) were mixed to the total system 8µL. Then, 1µL crRNA probe (30ng/µL) and 1µL of RAA products were added into 8µL of aforementioned mixture and mixed thoroughly. It is recommended to incubation at 37℃ for 40 minutes. Add 20µL diluent buffer to the 10µL of the reaction and mix well. The lateral-flow dipsticks were insert into the mixture for 3–5 minutes. and results were recorded until the positive control line was visualized. Results explanation of RAA-Cas13a-LFD assay Cas13a detection was adapted for lateral flow detection (LFD), with an important alteration: the Lateral flow reporter was replaced with FAM-ssRNA-Biotin reporter (FB reporter) [ 28 , 29 ]. Without trans cleavage, the FB reporter will remain intact and its biotinylated end can be captured by streptavidin at the control line. Anti-FAM antibody conjugated to gold nanoparticles can then bind the exposed FAM moiety, resulting in the color deposit on the control line. It was negative if only control line (red band) appeared, indicating that there is not the amplification fragment of the target gene in the sample (Fig. 2 ). On the other hand, if the FB reporter has undergone trans cleavage by Cas13a, a portion of reporter molecules will contain biotin, but not FAM. As a result, fewer FAM ends will be present at the control line, and a higher amount of antibody-conjugated gold nanoparticles will be able to travel further to deposit on the test line. It was positive when test line and control line both appeared or only test line red band appears, indicating that the target gene of T. gondii to be detected in the sample. Evaluation of RAA-Cas13a-LFD specificity and sensitivity In order to determine the analytical specificity of the RAA-Cas13a-LFD assay developed in this study, the nucleic acids of human blood, Ascaris lumbricoides , Digramma interrupta , Entamoeba coli , Fasciola gigantica , Plasmodium vivax , Schistosoma japonicum , Taenia solium and Trichinella spiralis were used as templates for the RAA reactions. The sensitivity of the RAA-Cas13a-LFD assay was assessed using 10-fold serial dilutions of the recombinant plasmids ranging from 1 ng/µL-1×10 − 9 ng/µL. All experiments were carried out in duplicate, and the recombinant plasmid was the positive control and ddH 2 O was the negative control. Different RAA products were directly analyzed by lateral-flow dipsticks. To verify the analytical specificity and sensitivity of the RAA-Cas13a-LFD assay developed in this study, a real-time PCR (qPCR) also performed using the forward primer, reverse primer, and probe primer target the the same 529bp gene. The sequence of forward primer, reverse primer, and probe primer are AGACGAGACGACGCTTTCC, GCATCTGGATTCCTCTCCTACC, and CGTCCAAGCCTCCGACTCTGTCTC, respectivly. qPCR reactions were performed in 20 µL reaction volumes, comprising 10µL 2×Master Mix (Roche, Switzerland), 10µM of each forward and reverse primers, 10µM of probe primer, and 2µL of the template. Amplification was performed as follows: initial denaturation at 95℃ for 30s; followed by 40 cycles of denaturation at 95℃ for 10 s, primer annealing at 60℃ for 30s; dissociation at 95℃ for 15s, 60℃ for 60s, and 95℃ for 15s. The products of qPCR were visualized according to amplification curve generated by the LightCycler 96 qPCR instrument (Roche, Switzerland). Application of the RAA-Cas13a-LFD assay for clinical samples We tested the established RAA-Cas13a-LFD method for detection of T. gondii in blood samples collected from patients of Clinical Laboratory. A total of 267 blood samples were simultaneously tested with serology ECL assay, qPCR and the RAA-Cas13a-LFD assay for detection of T. gondii . To evaluate the validity of establishment RAA-Cas13a-LFD assay, blood samples were all to amplify the 529 gene for detection of T. gondii by qPCR assay. Results Optimization of RAA primers There are five pairs of primers were designed for 529bp gene region in accordance with the requirements of RAA nucleic acid amplification (Table 1 ). After the products were amplified by RAA nucleic acid amplification at 37 ℃ for 40 minutes, they were screened by fluorescence detection and capillary electrophoresis. According to the primers melting curves (Fig. 3 ), the primer pairs of 1 and 3 have a single high peak, and there is no nonspecific amplification. The size of amplified product fragment of primer pair 1 and 3 are about 283 bp and 176 bp, respectively, they are consistent with the expected target fragment; Furthermore more, the total amount of products of primer pair 1 and 3 are relatively high (Fig. 4 a and 4 c, Table 2 ). The primer pairs of 2 and 5 have many impurity peaks in the melting curve, resulting in nonspecific amplification and have a low total amount of amplified products (Fig. 3 , Fig. 4 b and 4 e, Table 2 ). Although the primer dissolution curve of primer 4 is a single peak, and there are no nonspecific amplification. While the total amount of product is low, indicating poor amplification efficiency (Fig. 3 , Fig. 4 d, Table 2 ). In brief, based on the results of the melting curve and the peak of the amplified product, the amplification efficiency of primer pairs of 1 and 3 is relative better. Hence, the primer pairs of 1 and 3 were used in the follow up probe optimizing test. Table 2 Amplification products of 5 pairs of primers by Qsep100 bioanalyzer test Primer pair Size of main peak (bp) Total amount of target product(ng) Total amount of nonspecific amplification products(ng) Target product ratio(%) Primer pair 1 283 990 0 100 Primer pair 2 126 72 90 44 Primer pair 3 176 560 0 100 Primer pair 4 121 150 0 100 Primer pair 5 162 160 164 49 Optimization of crRNA probe primers After the positive plasmid is amplified by RAA isothermally, fluorescence method is used to optimize the combination of primer and probe. The amplification efficiency of the primer-probe combination was evaluated by the fluorescence amplification curve. According to the fluorescence amplification curve (Fig. 5 a), the fluorescence value of positive plasmid group based on the Primer1 + Probe1 combination has a significant difference in compared with the negative control (NTC) group, indicating that the detection result is positive and the amplification efficiency is well; while there are significant amplification based on the Primer1 + Probe3-4-a and Primer3 + Probe3-4-a combination and the consistency is poor (Fig. 5 b); similar results, the amplification curve of the Primer1 + Probe3-4-b has poor consistency, and the fluorescence value of Primer3 + Probe3-4-b has no significant difference compared with the NTC group, the amplification efficiency is extremely lower (Fig. 5 c). In summary, the Primer1 + Probe1 combination has the best amplification efficiency, which was used in the subsequent RAA-Cas13a-LFD experiments. Optimization of the RAA-Cas13a-LFD assay conditions The preferred time for the RAA-Cas13a-LFD reaction were evaluated. First, RAA basic reactions were carried out at 37 ℃ for 40 minutes in a heating block. Results of the amplification showed that the target DNA could be successfully amplified. A body temperature of 37 ℃ was chosen as the optimal RAA-Cas13a-LFD temperature. Take the plasmids with concentrations of 1×10 − 5 ng/µL, 1×10 − 6 ng/µL and 1×10 − 7 ng/µL as templates; the amplification times are 20min, 30min and 40min for the reaction. The results showed that when the RAA-Cas13a-LFD reaction was amplified for 20 minutes, the detection limit of plasmid concentrations was 1×10 − 5 ng/µL, and when the RAA-Cas13a-LFD reaction was amplified for 30 minutes and 40 minutes, the detection limit of plasmid concentrations was 1×10 − 6 ng/µL (Fig. 6 ). The detection limit of amplification yielded did not change with the increase of time from 30min to 40min, so 30 minutes was chosen as the RAA-Cas13a-LFD reaction time in this study. Sensitivity of the established RAA-Cas13a-LFD assay The sensitivity of the RAA-Cas13a-LFD assay was determined by using serial 10-fold dilutions of a positive control template (positive recombinant plasmid of T. gondii ). These dilutions ranged were from 1 ng/µL to 1×10 − 9 ng/µL, with ddH 2 O included as a negative control. The amplified reaction was performed for 30min, and the lowest detection concentration of RAA-Cas13a-LFD method was determined. As shown in Fig. 7 a, there were the corresponding visible test lines when the concentration of recombinant plasmids was > 1×10 − 6 ng/µL. We also performed a qPCR as described before. It can be seen that the minimum detection limit of the qPCR is 1×10 − 8 ng/µL (Fig. 7 B). The results indicated that the limit of RAA-Cas13a-LFD assay for T. gondii is slightly less sensitive compared with qPCR in the level of detection limit. Specificity of the established RAA-Cas13a-LFD assay We tested specificity of RAA-Cas13a-LFD and qPCR methods using genomic DNA samples from human blood, Ascaris lumbricoides , Digramma interrupta , Entamoeba coli , Fasciola gigantica , Plasmodium vivax , Schistosoma japonicum , Taenia solium and Trichinella spiralis . The T. gondii positive plasmid was used as a positive control, and ddH 2 O was used as a negative control. Only T. gondii positive plasmids showed amplification using both methods, and produced visible test bands (RAA-Cas13a-LFD) and amplification curves (qPCR). While the other DNA templates showed no signals (Fig. 8 ), demonstrating that the established RAA-Cas13a-LFD method has good specificity. Clinical performance of the established RAA-Cas13a-LFD assay To evaluate the clinical performance of the T. gondii RAA-Cas13a-LFD assay, a total of 267 clinical blood samples (137 males and 130 females) were collected from patients of Laboratory Medicine and tested using ECL, qPCR and the established RAA-Cas13a-LFD methods, respectively. The results showed that the positive rates of T. gondii in the blood samples are various in different methods (Table 3 ). Higher positive rates were detected by RAA-Cas13a-LFD (1.50%, 4/267) than by ECL-IgM (1.12%, 3/267). Compared with qPCR, there was a consistent positive rate between qPCR and RAA-Cas13a-LFD assays (Fig. 9 , Table 3 ). Indicating that the established RAA-Cas13a-LFD assay offers excellent performance for detecting T. gondii as the same as qPCR in clinical setting. Table 3 Comparation of ECL, qPCR and RAA-Cas13a-LFD assay for detection of T. gondii in blood samples Test methods Blood samples (n = 267) positive negative ECL IgG 34 (12.73%) 233 (87.27%) IgM 3 (1.12%) 264 (98.88%) qPCR 4 (1.50%) 263 (98.50%) RAA-Cas13a-LFD 4 (1.50%) 263 (98.50%) Discussion Thus far, several nucleic acid-based detection platforms have been developed for T. gondii , including traditional PCR, nested PCR, qPCR and LAMP coupled with LFD. Although these methods offer good sensitivity, they are limited by various constraints such as susceptibility to false positives and lack of compatibility with point-of-need applications [ 7 ]. LAMP is characterized by a streamlined protocol and exemplary detection limit of 1 copy of T. gondii DNA per reaction, but spurious amplification can occasionally arise and is prone to aerosol pollution [ 5 ]. RAA-LFD is to perform isothermal amplification of the target gene or specimen by the RAA method and then combine with LFD technology, LFD is a technology that finally realizes the visual analysis of amplified products. This technology does not require expensive equipment, can quickly and effectively amplify the target fragment under constant temperature conditions, and the result of the reaction can be judged by the naked eye. Whereas RAA alone was not sensitive enough to detect low levels of target [ 23 ]. In multiple Cas family members, including Cas13, Cas12 and Cas14 effector, cutting the target nucleic acid can trigger the cleavage of irrelevant single-strand DNA (ssDNA) or single-strand RNA (ssRNA). This collateral cleavage has been exploited for nucleic acid detection [ 30 – 32 ]. CRISPR-Cas13a (formerly C2c2), a Type VI Class 2 CRISPR-Cas effector, is a single-component enzyme targeting single-stranded RNA with a guide RNA. Binding with a complementary ssRNA will activate its targeting and general ssRNase activity [ 19 , 23 ], the latter responsible for collateral ssRNA cleavage. In the specific high-sensitivity enzymatic reporter unlocking (SHERLOCK) platform, quenched fluorophore is added to the collateral substrate, Cas13a system cleaves a nucleic acid reporter and generates a detectable signal, thus enabling target RNA detection [ 28 ]. The fluorescence signal is monitored using the spectroscopy reader, such as LDF. The CRISPR-Cas13a system has been employed for nucleic acid detection of a variety of pathogens, including SARS-CoV-2, Zika virus, dengue virus, among others [ 23 ]. Therefore, for nucleic acid detection of T. gondii in this study, a RAA is used to amplify target DNA, which is then transcribed by T7 RNA polymerase promoter into RNA for subsequent LwCas13a detection, then the fluorescence signal is monitored by LFD observation with naked eyes. A new type of RAA-LFD combined Cas13a detection method for T. gondii based on 529 bp gene was successfully established. It had no cross-reactivity with other parasites and could consistently detect 1×10 − 6 ng/µL of DNA per reaction. The established RAA-Cas13a-LFD assay can complete the amplification reaction at a constant temperature of 37℃ for less than 2 hours for naked eye visualization. With the detection limit of 1×10 − 6 ng/µL per reaction, the sensitivity of RAA-Cas13a-LFD assay is slightly less sensitive than qPCR, which could explain the disagreement between two approaches at the lowest target concentration of T. gondii [ 33 ]. In addition, qPCR and RAA-Cas13a-LFD are suitable for different environmental and laboratory conditions to detection of T. gondii . These advantages combined render RAA-Cas13a-LFD a strong option for routine surveillance in resource-limited settings. Nonetheless, RAA-LFD combined Cas13a assay developed in this work should still be sensitive enough to permit timely detection of T. gondii among the clinical samples; the positive rate of RAA-Cas13a-LFD was consistent with that of qPCR among the clinical samples. It was found that qPCR and RAA-Cas13a-LFD methods were all detected 4 positive cases of 267 clinical samples, while ELISA method (IgM + ) only detected 3 cases of positive specimens. The assay established in this study indicated that the sensitivity of RAA-Cas13a-LFD method is higher than conventional ECL detection. Through the T. gondii can be detected from the clinical blood samples within 2h by naked eye observation under a constant temperature heating block in this study, but it is on the premise of the genome DNA from the blood sample has been extracted. The effective acquisition of nucleic acid detection is the basis of simple and fast RAA-Cas13a-LFD assay in the current study. Therefore, further development is needed especially for simply DNA acquisition techniques from blood sample. A rapid and sensitive RAA assay to detect Bordetella pertussis using the DNA obtained by boiling clinical samples of respiratory secretions has been reported [ 34 ]. Additionally, compared with traditional PCR technology, CRISPR/ Cas13-based nucleic acid detection technology has higher sensitivity, better specificity, and does not require expensive equipment and professional operators [ 35 ]. While compared with qPCR in this study, the detection limit of blood-extracted T. gondii DNA RAA-Cas13a-LFD assay should be fully determined through screening of primer and probe combination, to achieve a more similar sensitivity to qPCR. Conclusions In conclusion, the developed RAA-LFD combined Cas13a assay has high specificity and sensitivity, and is visual, rapid and reliable for T. gondii detection. A heating instrument cannot be procured; it may even be possible to exploit body heat for incubation in this establishment assay. Furthermore, the assay could be adapted into an LFD format that does not demand any visualization instrument to achieve visual detection of T. gondii . It has the advantages of simple operation, fast response, high sensitivity, good specificity, and visualization of reaction results. It is very suitable for on-site testing and has a good prospect in clinical applications. Declarations Acknowledgements The authors would like to thank Dr. Xiaoning Li for guidance and support in collecting the blood samples from Clinical Laboratory and his special enthusiasm with this study. Authors’ contributions JZ and FF conceived and designed the experiments; JZ, FF, QX, ZZ and MZ performed the work and acquired the data. JZ and YL wrote the manuscript. QX provided methodological input, and contributed to writing the manuscript. All authors read and approved the final manuscript. Funding This work was supported by grants of Academic Aid Program for top-notch talents in provincial universities (gxbjZD2020071), Key Program in the Youth Elite Support Plan in Universities of Anhui Province (gxyqZD2016171) and Anhui Province Key Laboratory of active biological macro-molecules. Availability of data and materials All data generated or analyzed during this study are included in this published article Ethics approval and consent to participate All aspects of the study were performed in accordance with national ethics regulations and approved by the Medical Ethics Committee of Wannan Medical College. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Xue Y, Kong Q, Ding H, Xie C, Zheng B, Zhuo X, Ding J, Tong Q, Lou D, Lu S et al : A novel loop-mediated isothermal amplification-lateral-flow-dipstick (LAMP-LFD) device for rapid detection of Toxoplasma gondii in the blood of stray cats and dogs . Parasite 2021, 28 :41. Thangarajah P, Hajissa K, Wong WK, Abdullah MA, Ismail N, Mohamed Z: Usefulness of paired samples for the Serodiagnosis of toxoplasmosis infection in a tertiary teaching Hospital in Malaysia . BMC infectious diseases 2019, 19 (1):202. Ji-Long S, Li Y: [Prevalence and fundamental researches of prevention and treatment of toxoplasmosis in China: an overview] . Zhongguo xue xi chong bing fang zhi za zhi = Chinese journal of schistosomiasis control 2019, 31 (1):71-76. Clough B, Frickel EM: The Toxoplasma Parasitophorous Vacuole: An Evolving Host-Parasite Frontier . Trends in parasitology 2017, 33 (6):473-488. Zhao XY, Ewald SE: The molecular biology and immune control of chronic Toxoplasma gondii infection . The Journal of clinical investigation 2020, 130 (7):3370-3380. Lima TS, Lodoen MB: Mechanisms of Human Innate Immune Evasion by Toxoplasma gondii . Frontiers in cellular and infection microbiology 2019, 9 :103. Li R, Ma Y, Li J, Zhou P, Zheng F, Liu Q, Gao W: Application of Toxoplasma gondii GRA15 peptides in diagnosis and serotyping . Microbial pathogenesis 2020, 143 :104168. Zhang K, Lin G, Han Y, Li J: Serological diagnosis of toxoplasmosis and standardization . Clinica chimica acta; international journal of clinical chemistry 2016, 461 :83-89. Hegazy MK, Awad SI, Saleh NE, Hegazy MM: Loop mediated isothermal amplification (LAMP) of Toxoplasma DNA from dried blood spots . Experimental parasitology 2020, 211 :107869. Rostami A, Karanis P, Fallahi S: Advances in serological, imaging techniques and molecular diagnosis of Toxoplasma gondii infection . Infection 2018, 46 (3):303-315. Kolm C, Martzy R, Fuhrer M, Mach RL, Krska R, Baumgartner S, Farnleitner AH, Reischer GH: Detection of a microbial source tracking marker by isothermal helicase-dependent amplification and a nucleic acid lateral-flow strip test . Scientific reports 2019, 9 (1):393. Zhang X, Guo L, Ma R, Cong L, Wu Z, Wei Y, Xue S, Zheng W, Tang S: Rapid detection of Salmonella with Recombinase Aided Amplification . Journal of microbiological methods 2017, 139 :202-204. Xiong Y, Luo Y, Li H, Wu W, Ruan X, Mu X: Rapid visual detection of dengue virus by combining reverse transcription recombinase-aided amplification with lateral-flow dipstick assay . International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 2020, 95 :406-412. Zhao N, Jia L, Che J, He X, Zhang B: Novel molecular marker for RAA-LFD visual detection of Cynoglossus semilaevis sex . Animal reproduction science 2021, 226 :106713. Li Y, Yu Z, Jiao S, Liu Y, Ni H, Wang Y: Development of a recombinase-aided amplification assay for rapid and sensitive detection of porcine circovirus 3 . Journal of virological methods 2020, 282 :113904. Wang W, Wang C, Bai Y, Zhang P, Yao S, Liu J, Zhang T: Establishment of reverse transcription recombinase-aided amplification-lateral-flow dipstick and real-time fluorescence-based reverse transcription recombinase-aided amplification methods for detection of the Newcastle disease virus in chickens . Poultry science 2020, 99 (7):3393-3401. Wang W, Wang C, Zhang Z, Zhang P, Zhai X, Li X, Zhang T: Recombinase-aided amplification-lateral flow dipstick assay-a specific and sensitive method for visual detection of avian infectious laryngotracheitis virus . Poultry science 2021, 100 (3):100895. Zheng YZ, Chen JT, Li J, Wu XJ, Wen JZ, Liu XZ, Lin LY, Liang XY, Huang HY, Zha GC et al : Reverse Transcription Recombinase-Aided Amplification Assay With Lateral Flow Dipstick Assay for Rapid Detection of 2019 Novel Coronavirus . Frontiers in cellular and infection microbiology 2021, 11 :613304. Abudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DB, Shmakov S, Makarova KS, Semenova E, Minakhin L et al : C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector . Science 2016, 353 (6299):aaf5573. Broeders M, Herrero-Hernandez P, Ernst MPT, van der Ploeg AT, Pijnappel W: Sharpening the Molecular Scissors: Advances in Gene-Editing Technology . iScience 2020, 23 (1):100789. Zhu CS, Liu CY, Qiu XY, Xie SS, Li WY, Zhu L, Zhu LY: Novel nucleic acid detection strategies based on CRISPR-Cas systems: From construction to application . Biotechnology and bioengineering 2020, 117 (7):2279-2294. Wang X, Shang X, Huang X: Next-generation pathogen diagnosis with CRISPR/Cas-based detection methods . Emerging microbes & infections 2020, 9 (1):1682-1691. Gootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, Verdine V, Donghia N, Daringer NM, Freije CA et al : Nucleic acid detection with CRISPR-Cas13a/C2c2 . Science 2017, 356 (6336):438-442. Joung J, Ladha A, Saito M, Kim NG, Woolley AE, Segel M, Barretto RPJ, Ranu A, Macrae RK, Faure G et al : Detection of SARS-CoV-2 with SHERLOCK One-Pot Testing . The New England journal of medicine 2020, 383 (15):1492-1494. Soltani Tehrani B, Mirzajani E, Fallahi S, Manouchehri Naeini K, Mahmoudi MR, Safari Kavishahi M, Eskandari V, Zebardast N: Challenging TaqMan probe-based real-time PCR and loop-mediated isothermal amplification (LAMP): the two sensitive molecular techniques for the detection of toxoplasmosis, a potentially dangerous opportunistic infection in immunocompromised patients . Archives of microbiology 2020, 202 (7):1881-1888. Kong QM, Lu SH, Tong QB, Lou D, Chen R, Zheng B, Kumagai T, Wen LY, Ohta N, Zhou XN: Loop-mediated isothermal amplification (LAMP): early detection of Toxoplasma gondii infection in mice . Parasites & vectors 2012, 5 :2. Homan WL, Vercammen M, De Braekeleer J, Verschueren H: Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR . International journal for parasitology 2000, 30 (1):69-75. Gootenberg JS, Abudayyeh OO, Kellner MJ, Joung J, Collins JJ, Zhang F: Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6 . Science 2018, 360 (6387):439-444. Sullivan TJ, Dhar AK, Cruz-Flores R, Bodnar AG: Rapid, CRISPR-Based, Field-Deployable Detection Of White Spot Syndrome Virus In Shrimp . Scientific reports 2019, 9 (1):19702. Chen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, Doudna JA: CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity . Science 2018, 360 (6387):436-439. Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP, Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA: Programmed DNA destruction by miniature CRISPR-Cas14 enzymes . Science 2018, 362 (6416):839-842. Li L, Li S, Wu N, Wu J, Wang G, Zhao G, Wang J: HOLMESv2: A CRISPR-Cas12b-Assisted Platform for Nucleic Acid Detection and DNA Methylation Quantitation . ACS synthetic biology 2019, 8 (10):2228-2237. Kanitchinda S, Srisala J, Suebsing R, Prachumwat A, Chaijarasphong T: CRISPR-Cas fluorescent cleavage assay coupled with recombinase polymerase amplification for sensitive and specific detection of Enterocytozoon hepatopenaei . Biotechnology reports 2020, 27 :e00485. Zhang RQ, Li GX, Li XN, Shen XX, Gao Y, Wang L, Fan T, Duan QX, Wang YK, Wang J et al : A rapid and sensitive recombinase aided amplification assay incorporating competitive internal control to detect Bordetella pertussis using the DNA obtained by boiling . International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 2019, 86 :108-113. Broughton JP, Deng X, Yu G, Fasching CL, Servellita V, Singh J, Miao X, Streithorst JA, Granados A, Sotomayor-Gonzalez A et al : CRISPR-Cas12-based detection of SARS-CoV-2 . Nature biotechnology 2020, 38 (7):870-874. Supplementary Files GraphicalAbstract.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-823211","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":47379792,"identity":"c55ba818-5e1b-4a3f-9eaf-384256801add","order_by":0,"name":"Jinhong Zhao","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jinhong","middleName":"","lastName":"Zhao","suffix":""},{"id":47379793,"identity":"a17a0726-b844-4c54-9750-c11f7d5b63bd","order_by":1,"name":"Yuanyuan Li","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuanyuan","middleName":"","lastName":"Li","suffix":""},{"id":47379794,"identity":"2c409008-b4b5-4dd7-88ba-7bbc86d2f02c","order_by":2,"name":"Qiqi Xue","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiqi","middleName":"","lastName":"Xue","suffix":""},{"id":47379795,"identity":"f7e0e844-9641-47c4-8005-221083abc932","order_by":3,"name":"Zhiwei Zhu","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhiwei","middleName":"","lastName":"Zhu","suffix":""},{"id":47379796,"identity":"2a357688-a7a2-444f-8c39-f811062b4d9f","order_by":4,"name":"Minghui Zou","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Minghui","middleName":"","lastName":"Zou","suffix":""},{"id":47379797,"identity":"e07851f9-aa94-4d97-9235-59381db41344","order_by":5,"name":"Fang Fang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAt0lEQVRIiWNgGAWjYBACeWb2gw8//vvHzE+0FsP2nmRjCbYD7JINROs5c8BMgIftAL/BAWJ1MM5ISGOQ4LkjbXw8eQPDj4pthLWwSyQee1Ag8czY7MyzAsaeM7eJsiXdQMKAOdnsRo4BM2MbEVoYbiSYSfAkMNdvnkG0FqD3JXgOHGY2kCBWCziQJRvSmCWAfjlIlF8gUdlgw8zfnrzxwY8KYhyGAAnERw1CC6k6RsEoGAWjYIQAAGZpPcLijYIvAAAAAElFTkSuQmCC","orcid":"","institution":"Wannan Medical College","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Fang","suffix":""}],"badges":[],"createdAt":"2021-08-18 07:10:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-823211/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-823211/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":12721230,"identity":"e94a4bb3-01f1-4de9-9bf3-0169b2f3de83","added_by":"auto","created_at":"2021-08-24 16:28:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":95707,"visible":true,"origin":"","legend":"Schematic of T. gondii detection with RAA-Cas13a-LFD assay. \nSteps include: amplification of target DNA with RAA; T7 RNA polymerase transcription of amplified DNA to RNA; target recognition the target RNA with Cas13a-crRNA, collateral cleavage of fluorophore-quencher reporter (i.e. lateral flow reporter) and release fluorophore signal; visualization of the unleashed fluorescence signal by lateral flow dipstick. ","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/5bb530b52add77d5a73990ad.png"},{"id":12721232,"identity":"8cdc2a8b-89e2-4fe8-9e83-be574e759ed2","added_by":"auto","created_at":"2021-08-24 16:28:19","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":625779,"visible":true,"origin":"","legend":"Results explanation of RAA-Cas13a-LFD assay.","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/cd2262fcd35133bff7d6d7b9.jpg"},{"id":12721233,"identity":"a265b82c-f713-40cf-967f-2a5ad9ef1ac1","added_by":"auto","created_at":"2021-08-24 16:28:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":19647,"visible":true,"origin":"","legend":"The melting curves of 5 pairs of primers.","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/4526911a3ff7408b9b3b0782.png"},{"id":12721231,"identity":"2d13bb2c-d635-4770-8de7-7eae9a589782","added_by":"auto","created_at":"2021-08-24 16:28:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":191373,"visible":true,"origin":"","legend":"The peaks of amplified products of 5 pairs of primers. a Primer pair 1. b Primer pair 2. c Primer pair 3. d Primer pair 4. e Primer pair 5. LM and UM represent for Marker, the abscissa represents the band size of the amplified product, the ordinate represents the relative peak value, and the peak area represents the total product.","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/c308a2a0dd42787f6c418937.png"},{"id":12721234,"identity":"ce317987-3acd-493d-ba80-06c816d264e9","added_by":"auto","created_at":"2021-08-24 16:28:19","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":424672,"visible":true,"origin":"","legend":"Fluorescence amplification curve of primer and probe combination. a The fluorescence amplification curve of Primer1+Probe1 combination, the fluorescence value of amplification is very high in the positive plasmid control of T. gondii for three repeats. b The fluorescence amplification curve of Primer1+ Probe3-4-a and Primer3+ Probe3-4-a, there are no significant amplification, and the consistency is poor for three repeats. c The fluorescence amplification curve of Primer1+ Probe3-4-b and Primer3+ Probe3-4-b, there are no significant amplification, and the amplification consistency of Primer1+ Probe3-4-b is poor for three repeats. Abbreviations: PP, positive plasmid control; NTC, negative control.","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/ee089ca60aebe86fae403e80.png"},{"id":12721236,"identity":"b2a3cbda-50bb-4cae-a4ae-2e8ec455f317","added_by":"auto","created_at":"2021-08-24 16:28:19","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5111528,"visible":true,"origin":"","legend":"Optimization result of RAA-Cas13a-LFD amplification time. Strips: 1. 1×10-5 ng/μL; 2. 1×10-6 ng/μL; 3. 1×10-7 ng/μL; NTC, negative control (ddH2O). ","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/72842b7ba3f2609c88232c55.png"},{"id":12721238,"identity":"3ec32797-1703-4cd8-ab29-ab9af2f35590","added_by":"auto","created_at":"2021-08-24 16:28:19","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":4143675,"visible":true,"origin":"","legend":"The sensitivity of RAA-Cas13a-LFD and qPCR detection methods for T. gondii. a Visual inspection of RAA-Cas13a-LFD. b Curves for qPCR. Strip and curves: 1-10: plasmid copy number diluted to 1 ng/μL - 1×10-9 ng/μL, respectively; NTC, negative control (ddH2O).","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/07fca3ad388de16b0f33fa69.png"},{"id":12722380,"identity":"01785a45-7a2f-456c-a827-fd25b33cc62d","added_by":"auto","created_at":"2021-08-24 16:31:19","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2685868,"visible":true,"origin":"","legend":"The specificity of RAA-LFD and qPCR detection methods for T. gondii.\na Visual inspection of RAA-Cas13a-LFD. b Curves for qPCR. Strip and curves: 1. Human blood; 2. Ascaris lumbricoides; 3. Digramma interrupta; 4. Entamoeba coli; 5. Fasciola gigantica; 6. Plasmodium vivax; 7. Schistosoma japonicum; 8. Taenia solium; 9. Trichinella spiralis; Abbreviations: PP, Positive plasmid of T. gondii; NTC, negative control (ddH2O)","description":"","filename":"Fig.8.png","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/2a88cb8d977bf35df90f5055.png"},{"id":12722381,"identity":"d808fe51-9713-4a80-bcbc-2541d3c4fbb7","added_by":"auto","created_at":"2021-08-24 16:31:19","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1752334,"visible":true,"origin":"","legend":"Detection of blood samples of RAA-Cas13a-LFD and qPCR methods for T. gondii.\na Visual inspection of RAA-Cas13a-LFD. b Curves for qPCR. Strip and curves: 1-4: positive sample; 5-8: negative samples; Abbreviations: PP, Positive plasmid of T. gondii; NTC, negative control (ddH2O)","description":"","filename":"Fig.9.png","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/69392d5f348b9430c7e8b9d2.png"},{"id":15674763,"identity":"2f558759-fa45-458f-927b-b928df36fcb8","added_by":"auto","created_at":"2021-11-18 14:24:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6676420,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/4c920076-85d2-4541-8787-6e3ad11b4e21.pdf"},{"id":12721235,"identity":"cb8a86ed-d65f-4745-9bcf-bd3ab737a209","added_by":"auto","created_at":"2021-08-24 16:28:19","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":344000,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-823211/v1/4ec2a5efab55ca36f66cec6a.tif"}],"financialInterests":"","formattedTitle":"\u003cp\u003eA Novel Rapid Visual Detection of \u003cem\u003eToxoplasma Gondii \u003c/em\u003eby Combining Recombinase Polymerase Amplification and Lateral Flow Dipstick Coupled With CRISPR-Cas13a Fluorescence Assay\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003e \u003cem\u003eToxoplasma gondii\u003c/em\u003e is an obligate intracellular protozoan parasite that causes toxoplasmosis and threatens warm blooded animal and human health worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is estimated that more than 30% of the global population is reportedly seropositive with \u003cem\u003eT. gondii\u003c/em\u003e, although the infection rates vary significantly by geographical region [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. A recent analysis reported antibody positive rates of 8.20 and 8.60% for \u003cem\u003eT. gondii\u003c/em\u003e in the general population and pregnant women across China, respectively [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. People with normal immune function may not have typical symptoms and show recessive infection after infection with \u003cem\u003eT. gondii\u003c/em\u003e, but pregnant women infected with \u003cem\u003eT. gondii\u003c/em\u003e can lead to premature delivery, abortion, teratosis, stillbirth, etc., and newborn is regularly accompanied by serious eye diseases [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. For humans with weakened immune function or immunodeficiency, such as AIDS patients, organ transplant recipients, tumor patients, etc., infection with \u003cem\u003eT. gondii\u003c/em\u003e can cause extreme encephalitis and even death [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Therefore, effective, rapid and accurate diagnosis is needed to improve development of treatment approaches, enhance prognosis and control dissemination.\u003c/p\u003e \u003cp\u003eAt present, the testing targets for Toxoplasmosis consist of the pathogenic methods, immunological techniques and molecular biological methods [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Above all, direct pathogenic diagnosis of \u003cem\u003eT. gondii\u003c/em\u003e involves the detection of tachyzoites or tissue cysts by direct microscopy or isolation in cell culture. However, pathologic tissue examination or strain isolation are mostly used for diagnosis of animal infection, less frequently for that of human toxoplasmosis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Currently, nucleic acid and specific antibody assays of \u003cem\u003eT. gondii\u003c/em\u003e are the most commonly used techniques in clinical settings [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Particularly, the serum IgM/IgG antibody test has been widely used as a primary screening method for toxoplasmosis infection. However, the sensitivity and specificity of this method are not very high, and it is easy to produce false positive. In recent years, PCR, nested PCR, and real-time PCR (qPCR) assays have become essential tools for the molecular diagnosis of \u003cem\u003eT. gondii\u003c/em\u003e. These PCR-based amplification techniques have revealed good sensitivity and specificity, and qPCR with probe hybridization reported to be the most sensitive assay [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Nevertheless, widespread clinical application of these techniques has been limited by several factors, including the need for sophisticated instruments, complicated operation and well trained personnel.\u003c/p\u003e \u003cp\u003eTo date, several new molecular biological methods that require a uniform incubation temperature have been described, which significantly reduce the reaction time and complexity of nucleic acid amplifications. These isothermal nucleic acid amplification methods, such as the loop-mediated isothermal amplification (LAMP), require only a heating block can maintain a constant temperature rather than an expensive thermocycler [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, the LAMP method is prone to aerosol pollution and the result becomes a false positive. Recombinase aid amplification (RAA) is a new technology for nucleic acid amplification, and it works using four enzymes (UvsX, UvsY, SSB, and polymerase) at a constant temperature [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The RAA requires only a simple thermostatic device (constant temperature 37\u0026ndash;42\u0026deg;C) and a short reaction time (30 min) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. DNA amplification can be detected by agarose electrophoresis (AGE), real-time fluorescence methods and lateral flow dipstick (LFD) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], which have subsequently improved the sensitivity and specificity of the RAA assay. Among these optimizations, the LFD method is easy to use and its results easily interpretable. It can be used to detect proteins and nucleic acids [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Up to now, RAA-LFD has been applied for detection of microbes, such as Newcastle disease virus [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], dengue virus [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], avian infectious laryngotracheitis virus [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], Novel Coronavirus [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], even to identify the genetic sex of \u003cem\u003eCynoglossus semilaevis\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. CRISPR-Cas systems are widely used for genome editing, in recent years, the trans-cleavage activity of Cas proteins has been discovered [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Detection methods based on CRISPR-Cas, which is now also considered a next-generation pathogen detection method, have become established [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. DNA endonuclease targeted CRISPR trans-reporter and one-hour low-cost multipurpose highly efficient system can detect DNA sequences with high sensitivity and well specificity using CRISPR-Cas13a [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Methods such as SHERLOCK (specific high-sensitivity enzymatic reporter unlocking), which typically use target amplification followed by CRISPR-mediated nucleic acid detection have been used to detect SARS-CoV-2 [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDuring toxoplasmosis diagnosis, a series of nucleic acid amplification assays, targeting B1 gene or 529bp repeat sequences, internal transcriptional spacer sequences (ITS-1), as well as 18S rDNA sequences, have been established. While the 529bp repeat sequences showed better sensitivity and specificity for the diagnosis of toxoplasmosis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. According to literature available, there is no RAA amplification and LFD detection coupled with CRISPR-Cas13a fluorescence assay was been used for the diagnose of toxoplasmosis. In this study, we targeted the 529bp repeated element of \u003cem\u003eT. gondii\u003c/em\u003e and designed the crRNA probe with the Cas13a-based detection system in combination with RAA and LFD methodology for easy visualization. Furthermore, we validated the established RAA-Cas13a-LFD assay by detecting \u003cem\u003eT. gondii\u003c/em\u003e in genomic DNA extracted from clinical blood samples.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003cp\u003e\u003cstrong\u003eStrains and Clinical samples\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eT. gondii\u003c/em\u003e tachyzoites (RH strain), preserved at our laboratory, were aseptically cultured in vitro, by serial passages in Vero cells, as previously described [\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e]. A total of 267 blood samples from patients clinically at the First Affiliated Hospital of Wannan Medical College were collected between December 2018 to November 2020. The blood samples were divided in two aliquots and placed in the anticoagulant tubes (containing 10\u0026micro;L 0.5\u0026micro;mol /L EDTA) and non-anticoagulant tubes, respectively. The blood in the non-anticoagulant tubes was centrifuged and the serum was aseptically separated for serology with electrochemiluminescence (ECL) assay (Roche, Switzerland). Blood from anticoagulant tubes is used to extract genomic DNA.\u003c/p\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eDNA extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA DNeasy Blood \u0026amp; Tissue Kit (Tiangen Biotech Beijing Co., Ltd., China) was used, to extract genomic DNA from blood samples under the the manufacturer\u0026rsquo;s instructions. All these DNA samples were stored at -20℃ until subsequent analysis. Due to the suspected low amount of circulating DNA in these blood samples whose status infection was unknown, each sample was divided into three parts and repeated eluted in order to improve DNA yield and detection rate. Each repliate was then tested and a positive result for any of the sections indicated that the sample was positive.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of standard recombinant plasmids\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrevious studies have reported the 529bp repeated element (GenBank AF146527) as the potential optimal targets for \u003cem\u003eT. gondii\u003c/em\u003e [\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]. The 529bp repeated element is a recently discovered target gene, with up to 300 copies, which offers more sensitivity and specificity during detection [\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]. PCR products of \u003cem\u003eT. gondii\u003c/em\u003e 529bp fragment were amplified in the positive tachyzoites of \u003cem\u003eT. gondii\u003c/em\u003e, and electrophoresed, excised, purified, and cloned into the pMD\u0026trade;19-T vector (Takara). The positive clones were sequenced directionally (ABI 3730). The positive recombinant plasmids of \u003cem\u003eT. gondii\u003c/em\u003e are kept in our laboratory (Wannan Medical College, China). It is the recombinant plasmids used as standard nucleic acids were quantified with a NanoDrop ND1000 spectrophotometer. Then the recombinant plasmids were prepared with a dilution range 1 ng/\u0026micro;L-1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e ng/\u0026micro;L as a standard control and stored at -20℃ until needed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDesign of primer and crRNA probe\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince success of RAA amplification depends on designing the ideal primers for target the gene, we employed the online primer designing software and designed 5 pairs of specific oligonucleotide primers targeting the 529bp repeated element of \u003cem\u003eT. gondii\u003c/em\u003e. The primers annealing temperature are 54\u0026ndash;67℃ with the length about 30-35bp, and the amplicon size is (100-300bp) (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Specific crRNA probes were designed target the specific primer sequence fragment (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The DNA probes were prepared into RNA by in vitro transcription, according to the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, America). There should be paid to the 5\u0026apos; end accessory T7 RNA polymerase promoter sequence during probe design. The transcript (crRNA probe) was purified using RNAXP magnetic beads and the concentration of the product was determined by Qbuit nucleic acid concentration detector (Thermo, America). All primers were synthesized by TsingKe Biotech (Beijing TsingKe Biotechnology, Beijing, China).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimer sequence for RAA-Cas13a-LFD assay.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence(5\u0026apos;to3\u0026apos;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAmplicon sizes (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDescription\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-F1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACTACAGACGCGATGCCGCTCCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e283\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"10\"\u003e\n \u003cp\u003eCandidates for RAA primers that were screened in\u003c/p\u003e\n \u003cp\u003ethis study. TOX-F1/TOX-R1 pair was used for follow-up experiment experiments\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-R1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGTCTCCCTCGCCCTCTTCTCCACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-F2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACACCGGAATGCGATCCAGACGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e126\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-R2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTCCAAGCCTCCGACTCTGTCTCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-F3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATATCAGGACTGTAGATGAAGGCGAGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e176\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-R3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGTCTCGTCTGGATCGCATTCCGGTGTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-F4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTAGATGAAGGCGAGGGTGAGGATGAGGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e121\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-R4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCCAGGAAAAGCAGCCAAGCCGGAAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-F5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAGATGTTTCCGGCTTGGCTGCTTTTCCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e162\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTOX-R5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCGACTCTGTCTCCCTCGCCCTCTTCTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT7 promoter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAAATTAATACGACTCACTATAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePromote the transcription of amplified DNA to RNA in vitro transcription.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProbe1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGUCUCGUCUGGAUCGCAUUCCGGUGUC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003eExpected sequences of guide RNA obtained from in vitro transcription. Probe1 was used for follow-up experiment experiments.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProbe-2-5-a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUUCUCUCCGCCAUCACCACGAGGAAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProbe-2-5-b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAAUUCUCUCCGCCAUCACCACGAGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProbe-3-4-a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCUCCGACUCUCGUCGCUUCCCAACCACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProbe-3-4-b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCGACUCUCGUCGCUUCCCAACCACGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLateral flow reporter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFAM/mArArUrGrGrCmAmArArUrGrGrCmA/Bio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTrans cleavage reporter for Cas13a\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstablishment of RAA assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe basic RAA reactions were achieved by the Basic RAA kits (Anhui Microanaly Genetech, Hefei, China). The reaction buffer was premixed according to the following formula: 25\u0026micro;L of rehydration buffer, upstream primers (10\u0026micro;mol/L) 2\u0026micro;L, downstream primers (10\u0026micro;mol/L) 2\u0026micro;L, 25\u0026times;SYBR Green Ⅰ 1\u0026micro;L, recombinant plasmids (1ng/\u0026micro;L) 2\u0026micro;L, MgOAc solution (280nmol/L) 2.5\u0026micro;L, and 17.5\u0026micro;L of nuclease-free water. The aforementioned reaction tube was put into fluorescent quantitative PCR instrument to amplify for 40min at 37℃. The amplified products were analyzed Qsep100 biological analyzer (BIOptic, Taiwan) by collecting the fluorescence.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstablishment of RAA-\u003c/strong\u003e\u003cstrong\u003eCas13a\u003c/strong\u003e\u003cstrong\u003e-LFD assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHere, targeted detection was used gene editing technology based on nucleic acid amplification and Cas13a-mediated collateral cleavage of a reporter RNA, allowing for real-time detection of the target. The 529bp target gene of \u003cem\u003eT. gondii\u003c/em\u003e was amplified by RAA, T7 RNA polymerase transcription of amplified DNA to RNA and detection of target RNA by Cas13a collateral RNA cleavage mediated release of reporter signal. The fluorescence reporter signal can be detected by LFD, LFD is an endpoint assay, with lateral flow strips exposed to the reaction mixture post incubation (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe RAA-Cas13a-LFD reaction formula was as the following: LwCas13a nuclease (45nmol/L) (Anhui Microanaly Genetech, Hefei, China)), Lateral flow reporter molecule (125nmol/L) (Integrated DNA Technologies, Iowa, USA), RNase inhibitor (1\u0026micro;L) (New England Biolabs, America), ATP (1mM), GTP (1mM), UTP (1mM), CTP (1mM) and T7 polymerase (0.6\u0026micro;L) were mixed to the total system 8\u0026micro;L. Then, 1\u0026micro;L crRNA probe (30ng/\u0026micro;L) and 1\u0026micro;L of RAA products were added into 8\u0026micro;L of aforementioned mixture and mixed thoroughly. It is recommended to incubation at 37℃ for 40 minutes. Add 20\u0026micro;L diluent buffer to the 10\u0026micro;L of the reaction and mix well. The lateral-flow dipsticks were insert into the mixture for 3\u0026ndash;5 minutes. and results were recorded until the positive control line was visualized.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults explanation of RAA-Cas13a-LFD assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCas13a detection was adapted for lateral flow detection (LFD), with an important alteration: the Lateral flow reporter was replaced with FAM-ssRNA-Biotin reporter (FB reporter) [\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]. Without trans cleavage, the FB reporter will remain intact and its biotinylated end can be captured by streptavidin at the control line. Anti-FAM antibody conjugated to gold nanoparticles can then bind the exposed FAM moiety, resulting in the color deposit on the control line. It was negative if only control line (red band) appeared, indicating that there is not the amplification fragment of the target gene in the sample (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). On the other hand, if the FB reporter has undergone trans cleavage by Cas13a, a portion of reporter molecules will contain biotin, but not FAM. As a result, fewer FAM ends will be present at the control line, and a higher amount of antibody-conjugated gold nanoparticles will be able to travel further to deposit on the test line. It was positive when test line and control line both appeared or only test line red band appears, indicating that the target gene of \u003cem\u003eT. gondii\u003c/em\u003e to be detected in the sample.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEvaluation of RAA-Cas13a-LFD specificity and sensitivity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to determine the analytical specificity of the RAA-Cas13a-LFD assay developed in this study, the nucleic acids of human blood, \u003cem\u003eAscaris lumbricoides\u003c/em\u003e, \u003cem\u003eDigramma interrupta\u003c/em\u003e, \u003cem\u003eEntamoeba coli\u003c/em\u003e, \u003cem\u003eFasciola gigantica\u003c/em\u003e, \u003cem\u003ePlasmodium vivax\u003c/em\u003e, \u003cem\u003eSchistosoma japonicum\u003c/em\u003e, \u003cem\u003eTaenia solium\u003c/em\u003e and \u003cem\u003eTrichinella spiralis\u003c/em\u003e were used as templates for the RAA reactions. The sensitivity of the RAA-Cas13a-LFD assay was assessed using 10-fold serial dilutions of the recombinant plasmids ranging from 1 ng/\u0026micro;L-1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e ng/\u0026micro;L. All experiments were carried out in duplicate, and the recombinant plasmid was the positive control and ddH\u003csub\u003e2\u003c/sub\u003eO was the negative control. Different RAA products were directly analyzed by lateral-flow dipsticks.\u003c/p\u003e\n\u003cp\u003eTo verify the analytical specificity and sensitivity of the RAA-Cas13a-LFD assay developed in this study, a real-time PCR (qPCR) also performed using the forward primer, reverse primer, and probe primer target the the same 529bp gene. The sequence of forward primer, reverse primer, and probe primer are AGACGAGACGACGCTTTCC, GCATCTGGATTCCTCTCCTACC, and CGTCCAAGCCTCCGACTCTGTCTC, respectivly. qPCR reactions were performed in 20 \u0026micro;L reaction volumes, comprising 10\u0026micro;L 2\u0026times;Master Mix (Roche, Switzerland), 10\u0026micro;M of each forward and reverse primers, 10\u0026micro;M of probe primer, and 2\u0026micro;L of the template. Amplification was performed as follows: initial denaturation at 95℃ for 30s; followed by 40 cycles of denaturation at 95℃ for 10 s, primer annealing at 60℃ for 30s; dissociation at 95℃ for 15s, 60℃ for 60s, and 95℃ for 15s. The products of qPCR were visualized according to amplification curve generated by the LightCycler 96 qPCR instrument (Roche, Switzerland).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eApplication of the RAA-Cas13a-LFD assay for clinical samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe tested the established RAA-Cas13a-LFD method for detection of \u003cem\u003eT. gondii\u003c/em\u003e in blood samples collected from patients of Clinical Laboratory. A total of 267 blood samples were simultaneously tested with serology ECL assay, qPCR and the RAA-Cas13a-LFD assay for detection of \u003cem\u003eT. gondii\u003c/em\u003e. To evaluate the validity of establishment RAA-Cas13a-LFD assay, blood samples were all to amplify the 529 gene for detection of \u003cem\u003eT. gondii\u003c/em\u003e by qPCR assay.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv class=\"Section2\" id=\"Sec13\"\u003e\n \u003cp\u003e\u003cstrong\u003eOptimization of RAA primers\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThere are five pairs of primers were designed for 529bp gene region in accordance with the requirements of RAA nucleic acid amplification (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). After the products were amplified by RAA nucleic acid amplification at 37 ℃ for 40 minutes, they were screened by fluorescence detection and capillary electrophoresis.\u003c/p\u003e\n \u003cp\u003eAccording to the primers melting curves (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e), the primer pairs of 1 and 3 have a single high peak, and there is no nonspecific amplification. The size of amplified product fragment of primer pair 1 and 3 are about 283 bp and 176 bp, respectively, they are consistent with the expected target fragment; Furthermore more, the total amount of products of primer pair 1 and 3 are relatively high (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec, Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The primer pairs of 2 and 5 have many impurity peaks in the melting curve, resulting in nonspecific amplification and have a low total amount of amplified products (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb and \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ee, Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Although the primer dissolution curve of primer 4 is a single peak, and there are no nonspecific amplification. While the total amount of product is low, indicating poor amplification efficiency (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed, Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). In brief, based on the results of the melting curve and the peak of the amplified product, the amplification efficiency of primer pairs of 1 and 3 is relative better. Hence, the primer pairs of 1 and 3 were used in the follow up probe optimizing test.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable border=\"1\" id=\"Tab2\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAmplification products of 5 pairs of primers by Qsep100 bioanalyzer test\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer pair\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSize of main peak (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTotal amount of target product(ng)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTotal amount of nonspecific amplification products(ng)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget product ratio(%)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePrimer pair 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e283\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e990\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePrimer pair 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e90\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e44\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePrimer pair 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e176\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e560\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePrimer pair 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e121\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e150\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePrimer pair 5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e162\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e160\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e164\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e49\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eOptimization of crRNA probe primers\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the positive plasmid is amplified by RAA isothermally, fluorescence method is used to optimize the combination of primer and probe. The amplification efficiency of the primer-probe combination was evaluated by the fluorescence amplification curve. According to the fluorescence amplification curve (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea), the fluorescence value of positive plasmid group based on the Primer1\u0026thinsp;+\u0026thinsp;Probe1 combination has a significant difference in compared with the negative control (NTC) group, indicating that the detection result is positive and the amplification efficiency is well; while there are significant amplification based on the Primer1\u0026thinsp;+\u0026thinsp;Probe3-4-a and Primer3\u0026thinsp;+\u0026thinsp;Probe3-4-a combination and the consistency is poor (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb); similar results, the amplification curve of the Primer1\u0026thinsp;+\u0026thinsp;Probe3-4-b has poor consistency, and the fluorescence value of Primer3\u0026thinsp;+\u0026thinsp;Probe3-4-b has no significant difference compared with the NTC group, the amplification efficiency is extremely lower (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec). In summary, the Primer1\u0026thinsp;+\u0026thinsp;Probe1 combination has the best amplification efficiency, which was used in the subsequent RAA-Cas13a-LFD experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOptimization of the RAA-Cas13a-LFD assay conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe preferred time for the RAA-Cas13a-LFD reaction were evaluated. First, RAA basic reactions were carried out at 37 ℃ for 40 minutes in a heating block. Results of the amplification showed that the target DNA could be successfully amplified. A body temperature of 37 ℃ was chosen as the optimal RAA-Cas13a-LFD temperature. Take the plasmids with concentrations of 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e ng/\u0026micro;L, 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e ng/\u0026micro;L and 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e ng/\u0026micro;L as templates; the amplification times are 20min, 30min and 40min for the reaction. The results showed that when the RAA-Cas13a-LFD reaction was amplified for 20 minutes, the detection limit of plasmid concentrations was 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e ng/\u0026micro;L, and when the RAA-Cas13a-LFD reaction was amplified for 30 minutes and 40 minutes, the detection limit of plasmid concentrations was 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e ng/\u0026micro;L (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). The detection limit of amplification yielded did not change with the increase of time from 30min to 40min, so 30 minutes was chosen as the RAA-Cas13a-LFD reaction time in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSensitivity of the established RAA-Cas13a-LFD assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sensitivity of the RAA-Cas13a-LFD assay was determined by using serial 10-fold dilutions of a positive control template (positive recombinant plasmid of \u003cem\u003eT. gondii\u003c/em\u003e). These dilutions ranged were from 1 ng/\u0026micro;L to 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e ng/\u0026micro;L, with ddH\u003csub\u003e2\u003c/sub\u003eO included as a negative control. The amplified reaction was performed for 30min, and the lowest detection concentration of RAA-Cas13a-LFD method was determined. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003ea, there were the corresponding visible test lines when the concentration of recombinant plasmids was \u0026gt;\u0026thinsp;1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e ng/\u0026micro;L. We also performed a qPCR as described before. It can be seen that the minimum detection limit of the qPCR is 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e ng/\u0026micro;L (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB). The results indicated that the limit of RAA-Cas13a-LFD assay for \u003cem\u003eT. gondii\u003c/em\u003e is slightly less sensitive compared with qPCR in the level of detection limit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSpecificity of the established RAA-Cas13a-LFD assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe tested specificity of RAA-Cas13a-LFD and qPCR methods using genomic DNA samples from human blood, \u003cem\u003eAscaris lumbricoides\u003c/em\u003e, \u003cem\u003eDigramma interrupta\u003c/em\u003e, \u003cem\u003eEntamoeba coli\u003c/em\u003e, \u003cem\u003eFasciola gigantica\u003c/em\u003e, \u003cem\u003ePlasmodium vivax\u003c/em\u003e, \u003cem\u003eSchistosoma japonicum\u003c/em\u003e, \u003cem\u003eTaenia solium\u003c/em\u003e and \u003cem\u003eTrichinella spiralis\u003c/em\u003e. The \u003cem\u003eT. gondii\u003c/em\u003e positive plasmid was used as a positive control, and ddH\u003csub\u003e2\u003c/sub\u003eO was used as a negative control. Only \u003cem\u003eT. gondii\u003c/em\u003e positive plasmids showed amplification using both methods, and produced visible test bands (RAA-Cas13a-LFD) and amplification curves (qPCR). While the other DNA templates showed no signals (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e), demonstrating that the established RAA-Cas13a-LFD method has good specificity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical performance of the established RAA-Cas13a-LFD assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the clinical performance of the \u003cem\u003eT. gondii\u003c/em\u003e RAA-Cas13a-LFD assay, a total of 267 clinical blood samples (137 males and 130 females) were collected from patients of Laboratory Medicine and tested using ECL, qPCR and the established RAA-Cas13a-LFD methods, respectively. The results showed that the positive rates of \u003cem\u003eT. gondii\u003c/em\u003e in the blood samples are various in different methods (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Higher positive rates were detected by RAA-Cas13a-LFD (1.50%, 4/267) than by ECL-IgM (1.12%, 3/267). Compared with qPCR, there was a consistent positive rate between qPCR and RAA-Cas13a-LFD assays (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Indicating that the established RAA-Cas13a-LFD assay offers excellent performance for detecting \u003cem\u003eT. gondii\u003c/em\u003e as the same as qPCR in clinical setting.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable border=\"1\" id=\"Tab3\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eComparation of ECL, qPCR and RAA-Cas13a-LFD assay for detection of \u003cem\u003eT. gondii\u003c/em\u003e in blood samples\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eTest methods\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eBlood samples (n\u0026thinsp;=\u0026thinsp;267)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003epositive\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003enegative\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eECL IgG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e34 (12.73%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e233 (87.27%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIgM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3 (1.12%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e264 (98.88%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eqPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4 (1.50%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e263 (98.50%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRAA-Cas13a-LFD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4 (1.50%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e263 (98.50%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThus far, several nucleic acid-based detection platforms have been developed for \u003cem\u003eT. gondii\u003c/em\u003e, including traditional PCR, nested PCR, qPCR and LAMP coupled with LFD. Although these methods offer good sensitivity, they are limited by various constraints such as susceptibility to false positives and lack of compatibility with point-of-need applications [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. LAMP is characterized by a streamlined protocol and exemplary detection limit of 1 copy of \u003cem\u003eT. gondii\u003c/em\u003e DNA per reaction, but spurious amplification can occasionally arise and is prone to aerosol pollution [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. RAA-LFD is to perform isothermal amplification of the target gene or specimen by the RAA method and then combine with LFD technology, LFD is a technology that finally realizes the visual analysis of amplified products. This technology does not require expensive equipment, can quickly and effectively amplify the target fragment under constant temperature conditions, and the result of the reaction can be judged by the naked eye. Whereas RAA alone was not sensitive enough to detect low levels of target [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In multiple Cas family members, including Cas13, Cas12 and Cas14 effector, cutting the target nucleic acid can trigger the cleavage of irrelevant single-strand DNA (ssDNA) or single-strand RNA (ssRNA). This collateral cleavage has been exploited for nucleic acid detection [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. CRISPR-Cas13a (formerly C2c2), a Type VI Class 2 CRISPR-Cas effector, is a single-component enzyme targeting single-stranded RNA with a guide RNA. Binding with a complementary ssRNA will activate its targeting and general ssRNase activity [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], the latter responsible for collateral ssRNA cleavage. In the specific high-sensitivity enzymatic reporter unlocking (SHERLOCK) platform, quenched fluorophore is added to the collateral substrate, Cas13a system cleaves a nucleic acid reporter and generates a detectable signal, thus enabling target RNA detection [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The fluorescence signal is monitored using the spectroscopy reader, such as LDF. The CRISPR-Cas13a system has been employed for nucleic acid detection of a variety of pathogens, including SARS-CoV-2, Zika virus, dengue virus, among others [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTherefore, for nucleic acid detection of \u003cem\u003eT. gondii\u003c/em\u003e in this study, a RAA is used to amplify target DNA, which is then transcribed by T7 RNA polymerase promoter into RNA for subsequent LwCas13a detection, then the fluorescence signal is monitored by LFD observation with naked eyes. A new type of RAA-LFD combined Cas13a detection method for \u003cem\u003eT. gondii\u003c/em\u003e based on 529 bp gene was successfully established. It had no cross-reactivity with other parasites and could consistently detect 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e ng/\u0026micro;L of DNA per reaction. The established RAA-Cas13a-LFD assay can complete the amplification reaction at a constant temperature of 37℃ for less than 2 hours for naked eye visualization.\u003c/p\u003e \u003cp\u003eWith the detection limit of 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e ng/\u0026micro;L per reaction, the sensitivity of RAA-Cas13a-LFD assay is slightly less sensitive than qPCR, which could explain the disagreement between two approaches at the lowest target concentration of \u003cem\u003eT. gondii\u003c/em\u003e [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In addition, qPCR and RAA-Cas13a-LFD are suitable for different environmental and laboratory conditions to detection of \u003cem\u003eT. gondii\u003c/em\u003e. These advantages combined render RAA-Cas13a-LFD a strong option for routine surveillance in resource-limited settings. Nonetheless, RAA-LFD combined Cas13a assay developed in this work should still be sensitive enough to permit timely detection of \u003cem\u003eT. gondii\u003c/em\u003e among the clinical samples; the positive rate of RAA-Cas13a-LFD was consistent with that of qPCR among the clinical samples. It was found that qPCR and RAA-Cas13a-LFD methods were all detected 4 positive cases of 267 clinical samples, while ELISA method (IgM\u003csup\u003e+\u003c/sup\u003e) only detected 3 cases of positive specimens. The assay established in this study indicated that the sensitivity of RAA-Cas13a-LFD method is higher than conventional ECL detection.\u003c/p\u003e \u003cp\u003eThrough the \u003cem\u003eT. gondii\u003c/em\u003e can be detected from the clinical blood samples within 2h by naked eye observation under a constant temperature heating block in this study, but it is on the premise of the genome DNA from the blood sample has been extracted. The effective acquisition of nucleic acid detection is the basis of simple and fast RAA-Cas13a-LFD assay in the current study. Therefore, further development is needed especially for simply DNA acquisition techniques from blood sample. A rapid and sensitive RAA assay to detect \u003cem\u003eBordetella pertussis\u003c/em\u003e using the DNA obtained by boiling clinical samples of respiratory secretions has been reported [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Additionally, compared with traditional PCR technology, CRISPR/ Cas13-based nucleic acid detection technology has higher sensitivity, better specificity, and does not require expensive equipment and professional operators [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. While compared with qPCR in this study, the detection limit of blood-extracted \u003cem\u003eT. gondii\u003c/em\u003e DNA RAA-Cas13a-LFD assay should be fully determined through screening of primer and probe combination, to achieve a more similar sensitivity to qPCR.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, the developed RAA-LFD combined Cas13a assay has high specificity and sensitivity, and is visual, rapid and reliable for \u003cem\u003eT. gondii\u003c/em\u003e detection. A heating instrument cannot be procured; it may even be possible to exploit body heat for incubation in this establishment assay. Furthermore, the assay could be adapted into an LFD format that does not demand any visualization instrument to achieve visual detection of \u003cem\u003eT. gondii\u003c/em\u003e. It has the advantages of simple operation, fast response, high sensitivity, good specificity, and visualization of reaction results. It is very suitable for on-site testing and has a good prospect in clinical applications.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Dr. Xiaoning Li for guidance and support in collecting the blood samples from Clinical Laboratory and his special enthusiasm with this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJZ and FF conceived and designed the experiments; JZ, FF, QX, ZZ and MZ performed the work and acquired the data. JZ and YL wrote the manuscript. QX provided methodological input, and contributed to writing the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants of Academic Aid Program for top-notch talents in provincial universities (gxbjZD2020071), Key Program in the Youth Elite Support Plan in Universities of Anhui Province (gxyqZD2016171) and Anhui Province Key Laboratory of active biological macro-molecules.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll aspects of the study were performed in accordance with national ethics regulations and approved by the Medical Ethics Committee of Wannan Medical College.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eXue Y, Kong Q, Ding H, Xie C, Zheng B, Zhuo X, Ding J, Tong Q, Lou D, Lu S\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eA novel loop-mediated isothermal amplification-lateral-flow-dipstick (LAMP-LFD) device for rapid detection of Toxoplasma gondii in the blood of stray cats and dogs\u003c/strong\u003e. \u003cem\u003eParasite\u0026nbsp;\u003c/em\u003e2021, \u003cstrong\u003e28\u003c/strong\u003e:41.\u003c/li\u003e\n \u003cli\u003eThangarajah P, Hajissa K, Wong WK, Abdullah MA, Ismail N, Mohamed Z: \u003cstrong\u003eUsefulness of paired samples for the Serodiagnosis of toxoplasmosis infection in a tertiary teaching Hospital in Malaysia\u003c/strong\u003e. \u003cem\u003eBMC infectious diseases\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e19\u003c/strong\u003e(1):202.\u003c/li\u003e\n \u003cli\u003eJi-Long S, Li Y: \u003cstrong\u003e[Prevalence and fundamental researches of prevention and treatment of toxoplasmosis in China: an overview]\u003c/strong\u003e. \u003cem\u003eZhongguo xue xi chong bing fang zhi za zhi = Chinese journal of schistosomiasis control\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e31\u003c/strong\u003e(1):71-76.\u003c/li\u003e\n \u003cli\u003eClough B, Frickel EM: \u003cstrong\u003eThe Toxoplasma Parasitophorous Vacuole: An Evolving Host-Parasite Frontier\u003c/strong\u003e. \u003cem\u003eTrends in parasitology\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e33\u003c/strong\u003e(6):473-488.\u003c/li\u003e\n \u003cli\u003eZhao XY, Ewald SE: \u003cstrong\u003eThe molecular biology and immune control of chronic Toxoplasma gondii infection\u003c/strong\u003e. \u003cem\u003eThe Journal of clinical investigation\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e130\u003c/strong\u003e(7):3370-3380.\u003c/li\u003e\n \u003cli\u003eLima TS, Lodoen MB: \u003cstrong\u003eMechanisms of Human Innate Immune Evasion by Toxoplasma gondii\u003c/strong\u003e. \u003cem\u003eFrontiers in cellular and infection microbiology\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e9\u003c/strong\u003e:103.\u003c/li\u003e\n \u003cli\u003eLi R, Ma Y, Li J, Zhou P, Zheng F, Liu Q, Gao W: \u003cstrong\u003eApplication of Toxoplasma gondii GRA15 peptides in diagnosis and serotyping\u003c/strong\u003e. \u003cem\u003eMicrobial pathogenesis\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e143\u003c/strong\u003e:104168.\u003c/li\u003e\n \u003cli\u003eZhang K, Lin G, Han Y, Li J: \u003cstrong\u003eSerological diagnosis of toxoplasmosis and standardization\u003c/strong\u003e. \u003cem\u003eClinica chimica acta; international journal of clinical chemistry\u0026nbsp;\u003c/em\u003e2016, \u003cstrong\u003e461\u003c/strong\u003e:83-89.\u003c/li\u003e\n \u003cli\u003eHegazy MK, Awad SI, Saleh NE, Hegazy MM: \u003cstrong\u003eLoop mediated isothermal amplification (LAMP) of Toxoplasma DNA from dried blood spots\u003c/strong\u003e. \u003cem\u003eExperimental parasitology\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e211\u003c/strong\u003e:107869.\u003c/li\u003e\n \u003cli\u003eRostami A, Karanis P, Fallahi S: \u003cstrong\u003eAdvances in serological, imaging techniques and molecular diagnosis of Toxoplasma gondii infection\u003c/strong\u003e. \u003cem\u003eInfection\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e46\u003c/strong\u003e(3):303-315.\u003c/li\u003e\n \u003cli\u003eKolm C, Martzy R, Fuhrer M, Mach RL, Krska R, Baumgartner S, Farnleitner AH, Reischer GH: \u003cstrong\u003eDetection of a microbial source tracking marker by isothermal helicase-dependent amplification and a nucleic acid lateral-flow strip test\u003c/strong\u003e. \u003cem\u003eScientific reports\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e9\u003c/strong\u003e(1):393.\u003c/li\u003e\n \u003cli\u003eZhang X, Guo L, Ma R, Cong L, Wu Z, Wei Y, Xue S, Zheng W, Tang S: \u003cstrong\u003eRapid detection of Salmonella with Recombinase Aided Amplification\u003c/strong\u003e. \u003cem\u003eJournal of microbiological methods\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e139\u003c/strong\u003e:202-204.\u003c/li\u003e\n \u003cli\u003eXiong Y, Luo Y, Li H, Wu W, Ruan X, Mu X: \u003cstrong\u003eRapid visual detection of dengue virus by combining reverse transcription recombinase-aided amplification with lateral-flow dipstick assay\u003c/strong\u003e. \u003cem\u003eInternational journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e95\u003c/strong\u003e:406-412.\u003c/li\u003e\n \u003cli\u003eZhao N, Jia L, Che J, He X, Zhang B: \u003cstrong\u003eNovel molecular marker for RAA-LFD visual detection of Cynoglossus semilaevis sex\u003c/strong\u003e. \u003cem\u003eAnimal reproduction science\u0026nbsp;\u003c/em\u003e2021, \u003cstrong\u003e226\u003c/strong\u003e:106713.\u003c/li\u003e\n \u003cli\u003eLi Y, Yu Z, Jiao S, Liu Y, Ni H, Wang Y: \u003cstrong\u003eDevelopment of a recombinase-aided amplification assay for rapid and sensitive detection of porcine circovirus 3\u003c/strong\u003e. \u003cem\u003eJournal of virological methods\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e282\u003c/strong\u003e:113904.\u003c/li\u003e\n \u003cli\u003eWang W, Wang C, Bai Y, Zhang P, Yao S, Liu J, Zhang T: \u003cstrong\u003eEstablishment of reverse transcription recombinase-aided amplification-lateral-flow dipstick and real-time fluorescence-based reverse transcription recombinase-aided amplification methods for detection of the Newcastle disease virus in chickens\u003c/strong\u003e. \u003cem\u003ePoultry science\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e99\u003c/strong\u003e(7):3393-3401.\u003c/li\u003e\n \u003cli\u003eWang W, Wang C, Zhang Z, Zhang P, Zhai X, Li X, Zhang T: \u003cstrong\u003eRecombinase-aided amplification-lateral flow dipstick assay-a specific and sensitive method for visual detection of avian infectious laryngotracheitis virus\u003c/strong\u003e. \u003cem\u003ePoultry science\u0026nbsp;\u003c/em\u003e2021, \u003cstrong\u003e100\u003c/strong\u003e(3):100895.\u003c/li\u003e\n \u003cli\u003eZheng YZ, Chen JT, Li J, Wu XJ, Wen JZ, Liu XZ, Lin LY, Liang XY, Huang HY, Zha GC\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eReverse Transcription Recombinase-Aided Amplification Assay With Lateral Flow Dipstick Assay for Rapid Detection of 2019 Novel Coronavirus\u003c/strong\u003e. \u003cem\u003eFrontiers in cellular and infection microbiology\u0026nbsp;\u003c/em\u003e2021, \u003cstrong\u003e11\u003c/strong\u003e:613304.\u003c/li\u003e\n \u003cli\u003eAbudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DB, Shmakov S, Makarova KS, Semenova E, Minakhin L\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eC2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector\u003c/strong\u003e. \u003cem\u003eScience\u0026nbsp;\u003c/em\u003e2016, \u003cstrong\u003e353\u003c/strong\u003e(6299):aaf5573.\u003c/li\u003e\n \u003cli\u003eBroeders M, Herrero-Hernandez P, Ernst MPT, van der Ploeg AT, Pijnappel W: \u003cstrong\u003eSharpening the Molecular Scissors: Advances in Gene-Editing Technology\u003c/strong\u003e. \u003cem\u003eiScience\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e23\u003c/strong\u003e(1):100789.\u003c/li\u003e\n \u003cli\u003eZhu CS, Liu CY, Qiu XY, Xie SS, Li WY, Zhu L, Zhu LY: \u003cstrong\u003eNovel nucleic acid detection strategies based on CRISPR-Cas systems: From construction to application\u003c/strong\u003e. \u003cem\u003eBiotechnology and bioengineering\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e117\u003c/strong\u003e(7):2279-2294.\u003c/li\u003e\n \u003cli\u003eWang X, Shang X, Huang X: \u003cstrong\u003eNext-generation pathogen diagnosis with CRISPR/Cas-based detection methods\u003c/strong\u003e. \u003cem\u003eEmerging microbes \u0026amp; infections\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(1):1682-1691.\u003c/li\u003e\n \u003cli\u003eGootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, Verdine V, Donghia N, Daringer NM, Freije CA\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eNucleic acid detection with CRISPR-Cas13a/C2c2\u003c/strong\u003e. \u003cem\u003eScience\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e356\u003c/strong\u003e(6336):438-442.\u003c/li\u003e\n \u003cli\u003eJoung J, Ladha A, Saito M, Kim NG, Woolley AE, Segel M, Barretto RPJ, Ranu A, Macrae RK, Faure G\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eDetection of SARS-CoV-2 with SHERLOCK One-Pot Testing\u003c/strong\u003e. \u003cem\u003eThe New England journal of medicine\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e383\u003c/strong\u003e(15):1492-1494.\u003c/li\u003e\n \u003cli\u003eSoltani Tehrani B, Mirzajani E, Fallahi S, Manouchehri Naeini K, Mahmoudi MR, Safari Kavishahi M, Eskandari V, Zebardast N: \u003cstrong\u003eChallenging TaqMan probe-based real-time PCR and loop-mediated isothermal amplification (LAMP): the two sensitive molecular techniques for the detection of toxoplasmosis, a potentially dangerous opportunistic infection in immunocompromised patients\u003c/strong\u003e. \u003cem\u003eArchives of microbiology\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e202\u003c/strong\u003e(7):1881-1888.\u003c/li\u003e\n \u003cli\u003eKong QM, Lu SH, Tong QB, Lou D, Chen R, Zheng B, Kumagai T, Wen LY, Ohta N, Zhou XN: \u003cstrong\u003eLoop-mediated isothermal amplification (LAMP): early detection of Toxoplasma gondii infection in mice\u003c/strong\u003e. \u003cem\u003eParasites \u0026amp; vectors\u0026nbsp;\u003c/em\u003e2012, \u003cstrong\u003e5\u003c/strong\u003e:2.\u003c/li\u003e\n \u003cli\u003eHoman WL, Vercammen M, De Braekeleer J, Verschueren H: \u003cstrong\u003eIdentification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR\u003c/strong\u003e. \u003cem\u003eInternational journal for parasitology\u0026nbsp;\u003c/em\u003e2000, \u003cstrong\u003e30\u003c/strong\u003e(1):69-75.\u003c/li\u003e\n \u003cli\u003eGootenberg JS, Abudayyeh OO, Kellner MJ, Joung J, Collins JJ, Zhang F: \u003cstrong\u003eMultiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6\u003c/strong\u003e. \u003cem\u003eScience\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e360\u003c/strong\u003e(6387):439-444.\u003c/li\u003e\n \u003cli\u003eSullivan TJ, Dhar AK, Cruz-Flores R, Bodnar AG: \u003cstrong\u003eRapid, CRISPR-Based, Field-Deployable Detection Of White Spot Syndrome Virus In Shrimp\u003c/strong\u003e. \u003cem\u003eScientific reports\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e9\u003c/strong\u003e(1):19702.\u003c/li\u003e\n \u003cli\u003eChen JS, Ma E, Harrington LB, Da Costa M, Tian X, Palefsky JM, Doudna JA: \u003cstrong\u003eCRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity\u003c/strong\u003e. \u003cem\u003eScience\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e360\u003c/strong\u003e(6387):436-439.\u003c/li\u003e\n \u003cli\u003eHarrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP, Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA: \u003cstrong\u003eProgrammed DNA destruction by miniature CRISPR-Cas14 enzymes\u003c/strong\u003e. \u003cem\u003eScience\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e362\u003c/strong\u003e(6416):839-842.\u003c/li\u003e\n \u003cli\u003eLi L, Li S, Wu N, Wu J, Wang G, Zhao G, Wang J: \u003cstrong\u003eHOLMESv2: A CRISPR-Cas12b-Assisted Platform for Nucleic Acid Detection and DNA Methylation Quantitation\u003c/strong\u003e. \u003cem\u003eACS synthetic biology\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e8\u003c/strong\u003e(10):2228-2237.\u003c/li\u003e\n \u003cli\u003eKanitchinda S, Srisala J, Suebsing R, Prachumwat A, Chaijarasphong T: \u003cstrong\u003eCRISPR-Cas fluorescent cleavage assay coupled with recombinase polymerase amplification for sensitive and specific detection of Enterocytozoon hepatopenaei\u003c/strong\u003e. \u003cem\u003eBiotechnology reports\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e27\u003c/strong\u003e:e00485.\u003c/li\u003e\n \u003cli\u003eZhang RQ, Li GX, Li XN, Shen XX, Gao Y, Wang L, Fan T, Duan QX, Wang YK, Wang J\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eA rapid and sensitive recombinase aided amplification assay incorporating competitive internal control to detect Bordetella pertussis using the DNA obtained by boiling\u003c/strong\u003e. \u003cem\u003eInternational journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e86\u003c/strong\u003e:108-113.\u003c/li\u003e\n \u003cli\u003eBroughton JP, Deng X, Yu G, Fasching CL, Servellita V, Singh J, Miao X, Streithorst JA, Granados A, Sotomayor-Gonzalez A\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eCRISPR-Cas12-based detection of SARS-CoV-2\u003c/strong\u003e. \u003cem\u003eNature biotechnology\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e38\u003c/strong\u003e(7):870-874.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Toxplasma gondii, recombinase aided amplification, lateral-flow dipstick, CRISPR-Cas13a","lastPublishedDoi":"10.21203/rs.3.rs-823211/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-823211/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eToxoplasmosis caused by infecting with \u003cem\u003eToxplasma gondii\u003c/em\u003e is a kind of parasitic disease that prevalent all over the world and does great harm to pregnant women and newborns. Effective, rapid and accurate diagnosis \u003cem\u003eT. gondii\u003c/em\u003e is urgently needed to prevent and treatment the toxoplasmosis. The purpose of this study was to develop a rapid visual detection assay using recombinase aided amplification (RAA) and lateral flow dipstick (LFD) coupled with CRISPR-Cas13a fluorescence, henceforth RAA-Cas13a-LFD, for detection of \u003cem\u003eT. gondii\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eTargeting 529bp gene of \u003cem\u003eT. gondii\u003c/em\u003e, the primers and probes for RAA-Cas13a-LFD assay were designed and screened. The reaction time of RAA-LFD\u003cem\u003e-\u003c/em\u003eCas13a assay was optimized, as well as the sensitivity and specificity was further validated. Finally, the diagnostic performance of \u003cem\u003eT. gondii \u003c/em\u003ewas evaluated using the RAA-Cas13a-LFD assay for clinical blood samples.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eThe RAA-Cas13a-LFD assay was performed in an incubator block at 37℃ within 2h, and the amplicons were visible through LFD for naked eye visualization. The detection limit of the developed RAA-Cas13a-LFD assay was 1×10\u003csup\u003e-6 \u003c/sup\u003eng/μL with high specificity for \u003cem\u003eT. gondii\u003c/em\u003e. Compared with qPCR assay, there was a consistent positive rate among the clinical blood samples. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eIn this study, A rapid and visual RAA-Cas13a-LFD assay was developed. It requires no sophisticated equipment and shows promise for on-site surveillance of \u003cem\u003eT. gondii\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"A Novel Rapid Visual Detection of Toxoplasma Gondii by Combining Recombinase Polymerase Amplification and Lateral Flow Dipstick Coupled With CRISPR-Cas13a Fluorescence Assay","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-08-24 16:28:17","doi":"10.21203/rs.3.rs-823211/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6a998fdf-faf9-4c5f-85db-4f13db372b78","owner":[],"postedDate":"August 24th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":6672736,"name":"Parasitology"}],"tags":[],"updatedAt":"2021-08-24T16:28:19+00:00","versionOfRecord":[],"versionCreatedAt":"2021-08-24 16:28:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-823211","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-823211","identity":"rs-823211","version":["v1"]},"buildId":"GqpaHPwrfC8PjnIFayRh5","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}