c-di-GMP is a key regulator of Pseudomonas aeruginosa response to UVA radiation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article c-di-GMP is a key regulator of Pseudomonas aeruginosa response to UVA radiation Candela Rodriguez, Lucas Paré Schiaffino, Cristina S. Costa, Magdalena Pezzoni This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7819024/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Mar, 2026 Read the published version in Photochemical & Photobiological Sciences → Version 1 posted 7 You are reading this latest preprint version Abstract The intracellular signaling molecule bis-(3',5')-cyclic dimeric guanosine monophosphate (c-di-GMP) plays a crucial role in several bacterial processes, including biofilm formation. c-di-GMP levels depend on the balance between its production and breakdown, controlled by diguanylate cyclases (DGCs) and phosphodiesterases (PDEs), respectively. In this work, the role of c-di-GMP in the response of Pseudomonas aeruginosa to ultraviolet A radiation (UVA, 400 − 315 nm) was evaluated. Solar UVA radiation is a major environmental stressor for bacteria; its harmful effects on microorganisms, due mainly to oxidative damage, have been exploited for natural solar and commercial disinfection methods. It was demonstrated here that sublethal doses of UVA produce an early increase in c-di-GMP levels and in cell adhesion. qRT-PCR assays revealed that UVA modulates the expression of genes involved in c-di-GMP metabolism, by up-regulating the DGCs-encoding genes PA3177, yfiN, sadC and wspR , and down-regulating the PDEs-coding genes bifA and rbdA , indicating a regulation at the transcriptional level. Studies with mutants deficient for the genetic regulatory systems Stringent Response (SR) and Quorum Sensing (QS) demonstrated that the up-regulation of PA3177, yfiN , and sadC appears to depend on the UVA-induced SR-QS pathway, while the induction of wspR seems to be exclusively regulated by the SR. In contrast, the repression by UVA of bifA and rbdA do not seem to be linked to either of these regulatory systems. It was also demonstrated that c-di-GMP has a role in the survival of planktonic and biofilm cells under lethal UVA, possibly by promoting the production of Pel and/or Psl exopolysaccharides. Pseudomonas aeruginosa cyclic dimeric GMP c-di-GMP ultraviolet A UVA biofilm Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1 Introduction Pseudomonas aeruginosa is a human opportunistic pathogen capable of causing both acute and chronic infections [ 1 ]. This microorganism is also well known by its capacity to prosper in diverse environments, including soil, water, insects, plants and animals [ 2 ]. This ubiquity is in great part due to its ability to form strong biofilms when it adheres to biotic or abiotic suitable surfaces. The biofilm formation process involves several stages [ 3 ]. At the initial stage, planktonic cells come into weak, reversible contact, and motility mediated by flagella or pili helps the cells move towards the surface. Then, motility decreases and an irreversible attachment occurs by expression of adhesins and secretion of extracellular polymeric substances. Cells attach firmly and biofilm matrix components become relevant. Surface sensing triggers changes in gene expression, leading cells to transition into a sessile state. Attached cells begin to divide developing into a structured and complex community, the biofilm itself, characterized by its enhanced resistance to environmental stressors such as detergents, radiation, antimicrobials and host immune system [ 4 – 9 ]. It has been well established in several bacterial species that the transition from motile to sessile lifestyle largely depends on the intracellular levels of the signaling molecule bis-(3',5')-cyclic dimeric guanosine monophosphate (c-di-GMP) [ 10 ]. Biofilms traits modulated by c-di-GMP range from flagella and pili movements, exopolysaccharides production, expression of adhesins, resistance to antimicrobial agents, to biofilm dispersion [ 11 ]. The synthesis of c-di-GMP is mediated from GTP by diguanylate cyclases (DGCs) identified by a conserved GGDEF domain, while the hydrolisis of c-di-GMP into 5′-phosphoguanylyl-(3’- 5’)-guanosine (pGpG) or two GMP molecules, occurs by the action of phosphodiesterases (PDEs) carrying a conserved EAL or HD-GYP domain, respectively [ 12 ]. P. aeruginosa encodes about 40 putative c-di-GMP metabolizing genes; transcriptional control, post-translational regulation, and modulation of enzymatic activity of DGCs and PDEs determine the final c-di-GMP levels [ 13 ]. The interaction of c-di-GMP with effectors such as enzymes, transcriptional regulators and riboswitches modifies expression patterns at the transcriptional, translational, or post-translational level [ 11 , 14 ], with the consequent modifications on bacterial physiology. Besides biofilm formation, other biological processes depends on c-di-GMP levels, such as virulence, secondary metabolite production and stress response to several stress agents [ 15 , 16 ]. One of the main environmental stress agents for bacteria is solar UVA radiation, the major fraction of ultraviolet radiation reaching the Earth’s surface [ 17 , 18 ]. Exposure of bacteria to lethal UVA doses produces oxidative damage to proteins, lipids and DNA, with the consequent loss of bacterial viability [ 19 – 22 ]. The damage is produced by the action of the reactive oxygen species (ROS), which are generated by the absorption of UVA by endogenous photosensitizers such as flavoproteins, cytochromes and quinones, in presence of oxygen [ 23 , 24 ]. Because of its lethal effect on microorganisms, the use of this light has been proposed in disinfection strategies, such as the SODIS method, using the sunlight alone or in the presence of photocatalysts that enhance the toxic effects [ 25 – 27 ]. The use of UVA lamps as therapeutic antibacterial agent is currently under study [ 28 , 29 ]. The response elicited by exposure to low UVA doses is also of interest. Sublethal UVA doses produce oxidative disturbance of bacterial membranes [ 30 ] and direct damage to certain tRNAs [ 31 ], increasing the levels of the Stringent Response regulator ppGpp [ 32 , 33 ]. In order to cope with UVA-induced death, bacteria have evolved adaptive mechanisms triggered by sublethal doses [ 34 – 39 ]. Particularly, in P. aeruginosa , these involve induction of enzymatic antioxidative systems [ 40 ], increased biofilm formation [ 41 ], increased membrane fluidity due to higher proportion of membrane unsaturated fatty acids [ 42 ] and enhanced production of biofilm matrix exopolysaccharides alginate, Pel and Psl [ 43 , 44 ]. Recently, the whole transcriptome of P. aeruginosa exposed to sublethal UVA exposure revealed the induction of genes involved in DNA damage, [Fe-S] cluster biogenesis, intracellular iron homeostasis and denitrification pathways [ 45 ]. In this study, the role of the second messenger c-di-GMP in the response of P. aeruginosa to ultraviolet A radiation (UVA, 400 − 315 nm) was evaluated. Several findings provide a compelling rationale for this study: i) Like c-di-GMP, UVA exposure is linked to biofilm formation [ 41 ], ii) UVA-induced biofilm formation relies on polysaccharides Pel and Psl [ 46 ], whose expression is regulated by c-di-GMP levels [ 47 , 48 ], and iii) c-di-GMP is associated with oxidative stress response [ 49 – 51 ], which is the most well-documented effect of UVA exposure. Through the use of different genetic tools, it was demonstrated here that c-di-GMP has a key role on the UVA response of P. aeruginosa . Sublethal UVA doses were capable to increase c-di-GMP levels, and enhanced cell attachment, the first stage of biofilm formation, could be ascribed to this phenomenon. Transcriptional up-regulation by UVA of DGCs genes PA3177, yfiN , sadC and wspR could explain the rise of second messenger levels under radiation conditions. In addition, c-di-GMP demonstrated to be important in the survival of planktonic cells and biofilms exposed to lethal doses of this radiation. Results obtained using mutants with alterations in the regulatory systems Stringent Response (SR) and Quorum Sensing (QS) led to the assumption that c-di-GMP-UVA up-regulation is in part related to these global regulatory genetic mechanisms. 2 Materials and methods 2.1 Bacterial strains and culture conditions Table 1 lists the strains used in this study; all of them are derivatives of the wild-type PAO1. Bacterial cultures were routinely grown at 37° C with shaking in complete LB broth (10 g tryptone, 5 g yeast extract and 5 g NaCl bring the volume up to 1000 ml in distilled water); for solid medium 15 gl -1 agar was added. The plasmid-based reporter pP cdrA :: gfp [ 57 ] was introduced into the wild-type and its relA derivative by transformation with Cl 2 Ca and selection in solid LB medium added with 30 µg ml -1 gentamicin. Strains PAO1 yfiN ind and PAO1 rbdA ind carrying AraC/P BAD regulatory-promoter systems were grown with 0.3% arabinose in order to achieve controllable c-di-GMP levels [ 56 , 58 ]. Table 1 Strains and plasmid used in this study Strain or plasmid Relevant genotype and/or phenotype Source of reference PAO1 Wild-type [ 52 ] PW2696 relA ::Is lac Z/hah [ 53 ] PAO-JP1 lasI ::Tet [ 54 ] PDO100 rhlI ::Tn 501 -2 [ 55 ] PAO-JP2 lasI ::Tet rhlI ::Tn 501 -2 [ 54 ] PAO1 yfin ind pP BAD YfiN ind integrated in the chromosome [ 56 ] PAO1 rbdA ind pP BAD RbdA ind integrated in the chromosome [ 56 ] pP cdrA :: gfp pUCP22 carrying the P cdrA :: gfp fusion; Gm r [ 57 ] 2.2 Irradiation source Cell suspensions were irradiated using a bench with two Philips TDL 18W/08 tubes (> 95% UVA emission at 365 nm). The incident irradiance under the experimental conditions was measured at the surface of the suspensions with a 9811.58 radiometer (Cole-Parmer Instruments). The light field was homogeneous, ensuring that all samples received equal radiation under a given condition. The irradiances employed in this study may be encountered normally in the environment [ 36 ]. 2.3 pP cdrA :: gfp reporter assays under exposure to sublethal UVA doses Mid-exponential cultures (OD 650 0.3) of the wild-type and relA strains carrying the pP cdrA :: gfp plasmid were diluted to OD 650 0.05 in LB medium and divided into two 15 ml fractions, each of which was placed in a glass beaker (4.5 cm internal diameter). The beakers were placed in a multi-chamber coupled to a thermocycler bath to maintain the temperature of the suspensions at 37° C. The cell suspensions were stirred continuously with a magnetic bar. One of the fractions was irradiated from above at an irradiance of 25 W m − 2 at the level of the free surface of the suspension, while the other was covered with a black plastic sheet (dark control). Cell growth was followed by measuring the OD at 650 nm. 1 ml samples were taken during 90 min at 15 min intervals, centrifuged, and the supernatant was removed. Bacterial pellets were suspended in 1 ml of saline solution (NaCl 0.1 M) and fluorescence produced by the the GFP marker (excitation 485 nm, emission 535 nm) was recorded with a microplate reader. Data are presented as relative fluorescent units (RFU) per OD 650 unit. 2.4 Cell attachment assays under exposure to sublethal UVA doses The experimental setup for cell attachment assays was similar to that described in Section 2.3 , but sterile glass slides (20 mm x 25 mm x 1 mm) were placed vertically at the bottom of the glass beakers carrying the bacterial suspensions (only half of the slide is submerged). This biofilm formation system, known as ALI (air-liquid interface) was employed in order to facilitate the short-term analysis since cell attachment is favored in the air-liquid interface. Cell suspensions were maintained at 37° C as described above, but without agitation. One of the fractions was irradiated from above at an irradiance of 25 W m − 2 at the level of the free surface of the suspension, while the other was covered with a black plastic sheet (dark control). Different slides were removed at 15 and 30 min and cell attachment was determined by evaluating the number of attached bacteria on the slides using crystal violet staining. To evaluate the number of attached bacteria, the slides were washed with sterile saline solution to remove unattached cells; slides were then scraped with a sterile plastic spatula, and the material was recovered in 0.5 ml of saline solution and homogenized by vigorous vortexing. Appropriate dilutions of these suspensions were plated on LB solid medium. Plates were incubated for 24 h at 37° C and the number of colonies was expressed as CFU per cm 2 . For crystal violet staining, slides were washed with distilled water to remove unattached cells and 0.1% (w/v) aqueous crystal violet solution was added for 30 min. The crystal violet solution was then discarded, and the slides were washed with distilled water to remove residual stain. After photographing glass slides, the crystal violet adhered to each slide was dissolved in 2 ml of a mixture of 96% ethanol and 30% acetic acid (1:1) and absorbance at 575 nm was measured in the resulting solutions. 2.5 UVA sensitivity assays 2.5.1 Planktonic cells Stationary-phase cultures of the wild-type, PAO1 yfiN ind and PAO1 rbdA ind strains were obtained in LB medium with or without 0.3% arabinose. A fraction of these cultures was washed and suspended in saline solution at an OD 650 of 0.4. Each suspension was divided into two 15 ml fractions, each of which was placed in a glass beaker (4.5 cm internal diameter) located in a multi-chamber coupled to a thermo cycler bath. The temperature of the suspensions was maintained at 20° C. One of the fractions was irradiated from above at an irradiance of 20 W m − 2 for 240 min (radiant exposure 288 kJ m − 2 ), while the other was covered with a black plastic sheet (dark control). The irradiance applied was lower than the one used to generate a sublethal stress level (25 W m − 2 ) because, unlike LB medium (employed in experiments of sublethal UVA assays), saline solution does not absorb radiation at 365 nm (Fig. S1 ). The cell suspensions were stirred continuously with a magnetic bar. Samples were taken at regular intervals from both fractions, diluted in saline solution and plated on LB solid medium to assess cell viability by counting the number of CFU. Plates were incubated at 37° C in the dark to prevent light-induced DNA repair and the colonies were counted after 24 h. Survival was expressed as the fraction of the CFU ml − 1 at time 0. 2.5.2 Biofilms Overnight cultures of the wild-type, PAO1 yfiN ind and PAO1 rbdA ind strains were diluted to an OD 650 of 0.1 in LB medium with or without 0.3% arabinose. In order to obtain submerged mature biofilms, 10 ml of these suspensions were placed in 100 ml glass beakers, each containing a sterile glass slide (20 mm x 25 mm x 1 mm) placed horizontally on the bottom. The beakers were capped with cotton plugs and incubated at 37°C for 24 h without shaking. The slides were then removed, washed once with distilled water to eliminate unattached cells, and placed in small Petri dishes (diameter 4.5 cm) open to air and covered with 5 mL saline solution. Treated biofilms were irradiated from above at an irradiance of 20 W m − 2 for 180 min (radiant exposure 216 kJ m − 2 ), while control biofilms were kept in the dark by covering the plates with a black plastic sheet. To evaluate the cell viability, the CFU per area unit was quantified in UVA-treated and control biofilms. To do this, the slides supporting the biofilms were removed and washed by letting sterile distilled water (about 10 ml) drop down gently on them to remove unattached cells. The bacterial biomass was then scraped from the glass with a sterile plastic spatula, recovered in 0.5 ml of saline solution, and homogenized by vigorous vortexing. Appropriate dilutions of these suspensions were plated on LB solid medium. Plates were incubated in the dark immediately after irradiation and the colonies were counted after incubation for 24 h at 37° C. Survival was expressed as a fraction of the CFU cm − 2 at time 0. 2.6 Quantitative real-time PCR (qRT-PCR) Total RNA of strains exposed to sublethal UVA or maintained in the dark as described in Section 2.3 was extracted by using a Total RNA Extraction kit (Ambion-Life Technology). After treatment with DNase I, cDNA was obtained using random hexamers (Promega) and avian myeloblastosis virus reverse transcriptase (Promega) following the manufacturer’s instructions. qRT-PCR was performed using a Real-time PCR cycler (Rotor-Gene Q; QIAGEN) and Real-time PCR Mix (qPCR Mix Biodynamics). The employed primers and their origin are listed in Table 2 . Primers for amplification of PA3177, siaD and 16S rRNA genes were employed in previous works while primers for amplification of yfiN , sadC , wspR , bifA and rbdA genes were designed by using the Primer3 program (Whitehead Institute for Biomedical Research). The cycling conditions for PA3177, yfiN, sadC, wspR, siaD, bifA and rbdA genes were as follows: denaturation at 95°C for 5 min; 40 cycles at 95°C for 20 s, 56°C for 20 s and 72°C for 15 s. The 16S rRNA gene was used as reference for normalization of expression levels of target genes in each condition [ 40 ]. Relative changes in the expression of individual genes between the treated and control conditions were obtained through the relative standard curve method [ 61 ]. Table 2 Primers used in this study Primer Sequence (5´→ 3´) Source or reference 16S Fw AGCTTGCTCCTTGATTCAGC [ 40 ] 16S Rv AAGGGCCATGATGACTTGAC [ 40 ] PA3177 Fw CTCCCAAGCAGTCCAATA [ 59 ] PA3177 Rv AGAAGAACAGGCCGAGAATC [ 59 ] yfiN Fw AGCATCGCGAGCAATTGG This study yfinN Rv ATGTTGACCAGCACGGTGTC This study sadC Fw TTCAGGCGGGTAATTCGGAT This study sadC Rv GGTTGCCTAGTCGAACGAAC This study wspR Fw ATACCTGGAGATGGAGTGGCG This study wspR Rv GCCGAAGGTGTCGTTGTAGCT This study siaD Fw GCTGGCAATGCTCGATGTGGACTT [ 60 ] siaD Rv CAGCGGCCGCAGAGGTCGTAT [ 60 ] bifA Fw GCCCGCCCTATAGCGAATAC This study bifA Rv GAGAATGCCGGAGATGAAGATG This study rbdA Fw AGGACATGCTCGAGGATCCC This study rbdA Rv TCGACGGTCTCGACGAACTC This study 2.7 Statistical analysis All samples were analyzed at least in triplicate. Data are shown as mean ± SE. The significance of each treatment was evaluated by Student’s t test with confidence levels at > 95% ( i . e ., P < 0.05 was considered significant). 3. Results 3.1 Increase of c-di-GMP levels by UVA in P. aeruginosa It has been previously demonstrated that exposure of planktonic cells of P. aeruginosa to sublethal UVA doses induces biofilm formation [ 41 ]. In order to analyze the role of the second messenger c-di-GMP in this phenomenon, the possibility that UVA induces changes in c-di-GMP levels was studied by using the transcriptional fusion P cdrA :: gfp . The cdrA gene codes for a large adhesin and its promoter is positively regulated by c-di-GMP concentration; therefore, the expression of this reporter, quantified by GFP fluorescence, serves as a biosensor for intracellular c-di-GMP content [ 57 ]. The expression of P cdrA :: gfp was tested in cultures of PAO1 exposed to sublethal UVA radiation (irradiance 25 W·m − ²) for 90 min; control cultures were kept in the dark. This irradiation condition, utilized in previous studies, do not alter cell viability significantly but produces oxidative damage [ 43 , 44 ]. As shown in Fig. 1 , a significant increase of fluorescence values was observed in response to the radiation for all tested times, mainly after 15 and 30 min exposure ( P < 0.005), indicating higher levels of c-di-GMP regarding to the control. It should be noted that fluorescence levels increased both in irradiated and control cultures with respect to time zero, in a similar trend (Fig. 1 ). 3.2 Induction of cell attachment under UVA exposure In order to correlate the UVA-promoted c-di-GMP increase with cell attachment, this parameter was investigated in an ALI-type biofilm formation system under the conditions that showed the greatest differences in the reporter assay (Fig. 1 ). As shown in Fig. 2 a, UVA significantly increased the number of cells attached to the glass surfaces after 15 and 30 min exposure ( P < 0.05). Furthermore, crystal violet staining demonstrated significantly higher total biofilm mass under UVA exposure (Figs. 2 b and 2 c). These results allow us to correlate the early increase in c-di-GMP levels with greater cell adhesion by effect of UVA. 3.3 Regulation of expression of DGCs and PDEs genes by UVA With the purpose of deepening in the mechanism of UVA-promoted increased levels of c-di-GMP, the effect of UVA on the expression of genes coding for some DGCs (PA3177, yfiN , sadC , wspR , siaD ) and PDEs ( bifA , rbdA ) was analyzed. These genes were chosen given their relationship with determinants of biofilm establishment and/or oxidative stress [ 62 ]. Planktonic PAO1 cells were grown under sublethal UVA doses (irradiance 25 W·m − ²) or maintained in the dark, and samples were taken after 30 min to analyze gene expression by qRT-PCR. A very significant induction in UVA-exposed cells was observed for PA3177 and yfiN genes ( P < 0.0005) compared to the dark controls (Fig. 3 a). A lesser, but still significant increase was observed in sadC and wspR expression ( P < 0.05) and no changes were detected in the siaD gene after UVA treatment (Fig. 3 a). Conversely, a significant reduction in the expression of bifA and rbdA PDEs genes was observed in response to UVA radiation ( P < 0.005, P < 0.05, respectively; Fig. 3 b). It is concluded that the UVA-promoted increase of c-di-GMP levels could obey, at least in part, to the induction of DGSs PA3177, yfiN , sadC and wspR , and/or repression of PDEs bifA and rbdA . 3.4 Role of Stringent Response (SR) and Quorum Sensing (QS) in the increase of c-di-GMP levels by UVA It has been demonstrated in P. aeruginosa that the induction of biofilm formation by exposure to UVA depends at first instance on the master transcriptional regulator ppGpp, the main effector of the SR [ 46 ]. To investigate if c-di-GMP has a role in this pathway, the expression of the P cdrA :: gfp reporter and cell attachment under sublethal UVA doses were studied in a relA mutant, which has very low levels of ppGpp [ 63 ]. As shown in Fig. 4 , no increase of fluorescence was observed after UVA exposure in the relA pP cdrA :: gfp strain, which indicates that intracellular c-di-GMP levels were not modified in response to UVA treatment. In addition, no changes were also observed between the different times, both in control and exposed cells (Fig. 4 ). In the same line, sublethal UVA exposure did not induce early cell attachment in the relA mutant, measured as CFU cm − 2 or crystal violet staining (Figs. 5 a, 5 b and 5 c). To further investigate the role of ppGpp on the UVA-induced modulation of DGCs and PDEs, the relA strain was grown under UVA exposure (irradiance 25 W m − 2 ) or in the dark, and samples were taken after 30 min to study the expression of DGCs and PDEs genes as described for the wild-type. In contrast to that observed with the parental strain, Fig. 6 a shows that PA3177, yfiN , sadC , and wspR genes were not up-regulated by UVA; no changes were observed in the siaD gene after UVA exposure, as was seen in PAO1. On the contrary, PDEs genes bifA and rbdA were significantly ( P < 0.05) downregulated by UVA, as observed in the wild-type strain (Fig. 6 b). Taken together, these results suggest that the transcriptional effector ppGpp controls the UVA-mediated up-regulation of DGCs genes PA3177, yfiN , sadC , and wspR , with the consequent increase of c-di-GMP levels and cell attachment. QS, a cell-to-cell communication system that regulates gene expression in a population-dependent manner, has also been demonstrated to be involved in UVA-induced biofilm formation, in a ppGpp-dependent way [ 46 ]. Therefore, the role of QS systems las and rhl in the modulation by UVA of DGCs and PDEs was also analyzed. Mutants deficient in the production of QS autoinducers 3OC12-HSL ( lasI ), C4-HSL ( rhlI ), or both ( lasI rhlI ) were grown under sublethal UVA doses (irradiance 25 W m − 2 ) or in the dark. Samples exposed for 30 min were taken to study the expression genes coding for DGCs PA3177, yfiN , sadC , and wspR , and PDEs bifA and rbdA . Results are presented in Figs. 7 a ( lasI strain), 7b ( rhl strain) and 7c ( lasI rhlI strain). No induction of PA3177 was observed in the three QS mutants by the UVA treatment. yfinN was only induced by UVA in the lasI strain (but at lesser extent compared to the wild-type), suggesting low and strong dependence on las and rhl systems, respectively. The regulation of sadC appears to depend on the las system, as gene induction by UVA was observed only in the rhlI strain. Induction of wspR by UVA seems independent of QS regulation. Expression of genes coding for bifA and rbdA followed the same pattern of the wild-type and relA strains, that is, they were down-regulated by UVA (data not shown). It was also observed that early cell attachment was not induced in QS mutants after 15 and 30 min of UVA exposure (data not shown). 3.5 High levels of c-di-GMP confer resistance to lethal UVA doses Finally, the role of c-di-GMP in the defense against lethal UVA doses was analyzed, both in planktonic cells and biofilms. To this end, the wild-type strain and two derivatives with regulatable levels of c-di-GMP, PAO1 yfiN ind and PAO1 rbdA ind , were exposed to lethal UVA doses and survival fractions were evaluated. c-di-GMP levels in PAO1 yfiN ind and PAO1 rbdA ind were controlled by arabinose, allowing a tight control of target gene expression in response to this inductor. In the presence of arabinose, PAO1 yfiN ind presents high c-di-GMP levels (25 to 1850 pg/mg of protein) while PAO1 rbdA ind presents low c-di-GMP levels (8 to 15 pg/mg of protein), smaller than the wild-type [ 56 ]. Stationary-phase planktonic cells grown with or without 0.3% arabinose were exposed to UVA (irradiance 20 W m − 2 ) or maintained in the dark for 240 min, and survival was evaluated. A similar decrease was observed during the first 120 min of exposure for all tested strains, but after 180 and 240 min, the PAO1 yfiN ind strain grown with arabinose exhibited a significantly increased survival compared to the other strains (Fig. 8 a). A similar result was observed for 24 h-mature biofilms (Fig. 8 b). Biofilms of PAO1 yfiN ind grown with arabinose showed significantly higher survival regarding to those grown in the absence of this compound (Fig. 8 b). Control samples of planktonic cells and biofilms maintained in the dark did not show changes throughout the experiment (data not shown). These results indicate that high c-di-GMP levels could protect P. aeruginosa planktonic cells and biofilms from lethal doses of UVA. 4. Discussion Several external stimuli, including white light, nitric oxide, nutrients, iron, and oxidative stress, have been demonstrated to modulate c-di-GMP levels in bacteria, and specific DGCs and PDEs involved in these responses have been identified [ 49 , 64 – 69 ]. To date, the effect of UVA radiation on c-di-GMP regulation has not been reported. Here, we present novel evidence demonstrating that UVA exposure increases intracellular c-di-GMP levels in P. aeruginosa . The increase in c-di-GMP levels is accompanied by an enhanced cell attachment at low UVA total doses, thereby suggesting its adaptive function within the physiological framework of this bacterium. UVA-induced cell attachment was previously reported at longer time intervals compared to those used in this study, and this effect demonstrated to be dependent on increased levels of Pel and Psl exopolysaccharides [ 44 , 46 ]. Operons coding for pel and psl are modulated at the transcriptional level by several systems, with c-di-GMP being one of the main regulators of their expression [ 47 , 70 ]. Then, the rise of c-di-GMP levels by UVA could result in increased Pel and Psl levels, and, in turn, promote cell attachment. Pel and Psl have been described as the predominant exopolysaccharides in P. aeruginosa biofilms, being critical for the initial cell attachment and in the maintenance of cell-cell interactions [ 71 , 72 ]. This adaptive mechanism could help the bacteria quickly respond to UVA stress by reinforcing biofilm formation, thereby improving their survival under adverse environmental conditions (Pezzoni et al 2014). As reported by Eilers et al. [ 13 ], the overall levels of c-di-GMP in P. aeruginosa are the result of the activity of enzymes encoded by 41 putative DGCs and PDEs genes, each one responding to specific (and, in many cases, unknown) environmental conditions. It was demonstrated in the referred study that although most of 41 deletion mutants for individual DGCs or PDEs show a distinctive phenotype with regard to cell attachment and biofilm architecture, they presented limited changes in c-di-GMP levels. Then, an environmental stimulus such as UVA radiation, which is able to significantly change c-di-GMP concentrations, could control several and/or specific DGCs and/or PDEs in a concerted response. To investigate this subject in greater depth, the role of UVA on the expression of some key genes involved in the synthesis and degradation of this molecule was analyzed. It was demonstrated here that UVA exposure triggered the up-regulation of DGCs genes PA3177, yfiN , sadC , and wspR , whereas PDEs genes bifA and rbdA were down-regulated, suggesting a regulatory shift toward enhanced biofilm formation. The four genes encoding UVA-regulated DGCs were demonstrated to be upregulated by oxidative stress agents [ 49 , 50 , 66 , 73 ]. PA3177 and yfiN displayed the highest levels of induction, with 50-fold and 60-fold increases, respectively, under the experimental conditions. Strempel et al. [ 50 ] reported that PA3177 is induced by hypochlorite, a host defense compound and commonly used disinfectant. This induction is accompanied by enhancement of initial cell attachment and a strong increase in c-di-GMP levels, with Pel and Psl exopolysaccharides acting as the effectors in this PA1377-regulated network. Strikingly, PA1377 is not part of a general response to oxidative stress since no induction is observed in the presence of hydrogen peroxide or paraquat [ 50 ], suggesting that hypochlorite and UV radiation share similar mechanistic features in their mode of action that distinguish them from other oxidative stress-inducing agents. Katharios et al. [ 73 ] showed that yfiN activity is linked to oxidative damage affecting the cell envelope, a phenomenon also observed with UVA exposure [ 18 , 19 , 21 ]. As described for PA3177, Pel and Psl polysaccharides are effectors of yfiN , and resistance to macrophage phagocytosis depends on the action of these exopolysaccharides [ 74 ]. A protective role of c-di-GMP from lethal UVA radiation, both in planktonic and biofilm cells, is reported in this study. Participation of c-di-GMP on bacterial resistance to nutrient stress, antibiotics, detergents, toxic compounds and oxidative stress has been reported in different bacteria [ 16 ]. The role of c-di-GMP in the bacterial response to stressful conditions has been usually attributed to its function in the transition from planktonic to biofilm state. Biofilm cells exhibit increased resistance to a wide range of stress-inducing agents than their planktonic counterparts [ 4 – 9 , 75 ]. However, there are evidences suggesting that c-di-GMP can promote resistance to lethal agents by regulating the expression of specific defensive effectors, for example, katB and katE catalase genes, involved in antioxidative responses [ 76 , 77 ]. In this way, it is particularly interesting the result observed in free-living cells, since the biofilm matrix is not acting as a physical barrier limiting the penetration of radiation, thereby protecting the underlying bacterial cells. As suggested for UVA-induced cell attachment, a c-di-GMP-dependent increase of Pel and/or Psl levels could be also responsible for the protection from lethal UVA. The involvement of these polysaccharides in the defense against oxidative stress was confirmed by the response of pel and psl mutants exposed to lethal doses of UVA, H 2 O 2 and sodium hypochlorite [ 44 ]. It was proposed that Psl could act as a barrier reducing ROS penetration across bacterial membranes, enhancing survival capabilities [ 49 ] and several studies show a relevant role for Pel against different oxidative agents [ 49 , 50 , 71 ]. Alternatively, Pel and/or Psl could act as shields, absorbing or deviating the radiation and preventing photons from reaching cellular targets [ 78 ]. The versatility of P. aeruginosa obeys to a complex regulatory network which allows it to adapt to stressful conditions by precisely regulating its gene expression. In this regard, the intricate interactions between the Stringent Response, QS and c-di-GMP play crucial roles in regulating bacterial stress responses, biofilm formation, and virulence [ 79 – 82 ]. Attempting to link the findings related to adaptive responses to UVA in P. aeruginosa , a pathway that connects this radiation to the sequential activation of the Stringent Response, Quorum Sensing and biofilm formation was previously outlined [ 43 , 46 ]. Briefly, exposure of planktonic cells to sublethal UVA doses produces elevated ppGpp levels able to induce the expression of QS regulatory genes [ 83 ]. In turn, QS activation promotes the transcription of pel, psl and alg operons coding for enzymes responsible for the biosynthesis of biofilm matrix exopolysaccharides Pel, Psl and alginate [ 43 , 44 ]. The most significant physiological response of this pathway could be the enhancement of biofilm formation, but additional adaptive responses as higher resistance to subsequent lethal doses of UVA, hydrogen peroxide, and hypochlorite attributable to the induction of other defensive systems than biofilm formation were also observed [ 40 , 43 , 44 ]. The findings presented in this study support the incorporation of the c-di-GMP signaling pathway into this model (Fig. 9 ). The induction of most of the analyzed genes coding for DGCs (PA3177, yfiN , and sadC ) appears to be dependent on the ppGpp-QS pathway, while wspR seems to rely exclusively on the Stringent Response. Conversely, the UVA-repressed genes bifA and rbdA do not seem to be integrated into the UVA-ppGpp-QS pathway and its sole repression by UVA would not be sufficient for c-di-GMP increase and induction of cell adhesion, as observed in the case of the relA mutant (Figs. 4 and 5 ). Then, coordinated regulation of biofilm-related genes through these signaling pathways would allow P. aeruginosa to quickly respond to UVA stress by starting biofilm formation and activating other protective mechanisms. The high susceptibility of P. aeruginosa to UVA radiation [ 18 , 24 ] carries significant implications for environmental ecology, as well as for sectors including healthcare systems and industrial processes. This study is particularly relevant as it investigates the impact of UVA exposure on adaptive responses, an important issue when the use of this radiation is proposed as a potential adjunctive approach to overcome the intrinsic or/and acquired resistance mechanisms of P. aeruginosa against conventional antimicrobial agents. Abbreviations ALI Air liquid interface c-di-GMP bis-(3',5')-cyclic dimeric guanosine monophosphate CFU Colony forming units DGCs Diguanilate ciclases GFP Green fluorescent protein LB Luria-Bertani PDEs Phosphodiesterases ppGpp Guanosine tetraphosphate qRT-PCR Quantitative real time PCR QS Quorum sensing ROS Reactive oxygen species SR Stringent response UVA Ultraviolet-A Declarations Conflict of interest The authors have no relevant financial or nonfinancial interests to disclose. Funding Financial support for this research was received from the Comisión Nacional de Energía Atómica, and the Consejo Nacional de Investigaciones Científicas y Técnicas (PIP 11220200100710), Argentina Author Contribution C.R. and L.P.S : Formal analysis and methodology. C.S.C : Formal analysis, investigation, supervision, visualization, writing (original draft, review and editing). M. P.: Conceptualization, formal analysis, funding acquisition, investigation, methodology, project administration, validation, visualization, writing (original draft, review and editing). Acknowledgement The excellent technical assistance of Ms. P. Pereyra Schuth (Comisión Nacional de Energía Atómica, Argentina) is gratefully acknowledged. We thank Dr. Peter Greenberg for providing the QS mutants, Dr. Livia Leoni and Alessandra Fortuna for providing the PAO1 yfiNind and PAO1 rbd ind strains, and Dr. Morten Rybtke for providing the pPcdrA::gfp reporter. M.P. is career researcher at Consejo Nacional de Investigaciones Científicas y Técnicas, Argentina. References Qin, S., Xiao, W., Zhou, C., Pu, Q., Deng, X., Lan, L., Liang, H., Song, X., & Wu, M. (2022). Pseudomonas aeruginosa : pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduction and Targeted Therapy , 7 (1):199. doi: 10.1038/s41392-022-01056-1 Hardalo, C., & Edberg, S. C. (1997). Pseudomonas aeruginosa : assessment of risk from drinking water. Critical Reviews in Microbiology, 23 (1), 47-75. doi: 10.3109/10408419709115130 David, A., Tahrioui, A., Tareau, A. S., Forge, A., Gonzalez, M., Bouffartigues, E., Lesouhaitier, O., & Chevalier, S. (2024). Pseudomonas aeruginosa biofilm lifecycle: involvement of mechanical constraints and timeline of matrix production. Antibiotics (Basel) , 13 (8):688. doi: 10.3390/antibiotics13080688 Ophir, T., & Gutnick, D. L. (1994). A role for exopolysaccharides in the protection of microorganisms from desiccation. Applied and Environmental Microbiology , 60 (2), 740-745. doi: 10.1128/aem.60.2.740-745.1994 Stewart, P. S., & Costerton, J. W. (2001). Antibiotic resistance of bacteria in biofilms. Lancet, 358 (9276), 135-138. doi: 10.1016/s0140-6736(01)05321-1 Stoodley, P., Sauer, K., Davies, D. G., & Costerton, J. W. (2002). Biofilms as complex differentiated communities. Annual Review of Microbiology, 56 , 187-209. doi: 10.1146/annurev.micro.56.012302.160705 Drenkard, E. (2003). Antimicrobial resistance of Pseudomonas aeruginosa biofilms. Microbes and Infection , 5 (13), 1213-1219. doi: 10.1016/j.micinf.2003.08.009 Harrison, J. J., Turner, R. J., & Ceri, H. (2005). Persister cells, the biofilm matrix and tolerance to metal cations in biofilm and planktonic Pseudomonas aeruginosa . Environmental Microbiology , 7 (7), 981-994. doi: 10.1111/j.1462-2920.2005.00777.x Flemming, H. C., & Wingender, J. (2010). The biofilm matrix. Nature Reviews Microbiology , 8 (9), 623-633. doi: 10.1038/nrmicro2415 Valentini, M., & Filloux, A. (2016). Biofilms and cyclic di-GMP (c-di-GMP) signaling: lessons from Pseudomonas aeruginosa and other bacteria. Journal of Biological Chemistry , 291 (24), 12547-12555. doi: 10.1074/jbc.R115.711507 Römling, U., Galperin, M. Y., & Gomelsky, M. (2013). Cyclic di-GMP: the first 25 years of a universal bacterial second messenger. Microbiology and Molecular Biology Reviews , 77 (1), 1-52. doi: 10.1128/MMBR.00043-12 Hengge, R. (2009). Principles of c-di-GMP signalling in bacteria. Nature Reviews Microbiology , 7 (4), 263–273. doi:10.1038/nrmicro2109 Eilers, K., Kuok Hoong Yam, J., Morton, R., Mei Hui Yong, A., Brizuela, J., Hadjicharalambous, C., Liu, X., Givskov, M., Rice, S. A., & Filloux, A. (2022). Phenotypic and integrated analysis of a comprehensive Pseudomonas aeruginosa PAO1 library of mutants lacking cyclic-di-GMP-related genes. Frontiers in Microbiology , 13 :949597. doi: 10.3389/fmicb.2022.949597 Valentini, M., & Filloux, A. (2019). Multiple roles of c-di-GMP signaling in bacterial pathogenesis. Annual Review of Microbiology , 8(73), 387-406. doi: 10.1146/annurev-micro-020518-115555 Jenal, U., Reinders, A., & Lori, C. (2017). Cyclic di-GMP: second messenger extraordinaire. Nature Reviews Microbiology , 15 (5), 271-284. doi: 10.1038/nrmicro.2016.190 Wang, Z., Song, L., Liu, X., Shen, X., & Li, X. (2023). Bacterial second messenger c-di-GMP: emerging functions in stress resistance. Microbiological Research , 268:127302. doi: 10.1016/j.micres.2023.127302 Webb, R.B. (1977). Lethal and mutagenic effects of near-ultraviolet radiation. Photochemical and Photobiological Reviews , 2 , 169-261 Fernández, R. O., & Pizarro, R. A. (1996). Lethal effect induced in Pseudomonas aeruginosa exposed to ultraviolet-A radiation. Photochemistry and Photobiology , 64 (2), 334-339. doi: 10.1111/j.1751-1097.1996.tb02467.x Chamberlain, J., & and Moss, S. H. (1987). Lipid peroxidation and other membrane damage produced in Escherichia coli K1060 by near-UV radiation and deuterium oxide. Photochemistry and Photobiology , 45 (5), 625-630. doi: 10.1111/j.1751-1097.1987.tb07389.x Hu, M. L., & Tappel, A. L. (1992). Potentiation of oxidative damage to proteins by ultraviolet A and protection by antioxidants. Photochemistry and Photobiology, 56 (3), 357-363. doi: 10.1111/j.1751-1097.1992.tb02171.x Bosshard, F., Bucheli, M., Meur, Y., & Egli, T. (2010). The respiratory chain is the cell's Achilles' heel during UVA inactivation in Escherichia coli . Microbiology , 156 (Pt 7), 2006-2015. doi: 10.1099/mic.0.038471-0 Girard, P. M., Francesconi, S., Pozzebon, M., Graindorge, D., Rochette, P., Drouin, R. & Sage, E. (2011). UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes Journal of. Physics: Conference Series , 261 (1):012002 doi:10.1088/1742-6596/261/1/012002 Baümler, W., Regensburger, J., Knak, A., Felgenträger, A., & Maisch, T. (2012). UVA and endogenous photosensitizers- the detection of singlet oxygen by its luminescence. Photochemistry and Photobiological Sciences, 11 , 107-117. doi.org/10.1039/C1PP05142C Pezzoni, M., Meichtry, M., Pizarro R. A., & Costa C. S. (2015). Role of the Pseudomonas quinolone signal (PQS) in sensitizing Pseudomonas aeruginosa to UVA radiation. Journal of Photochemistry and Photobiology B: Biology, 142 , 129-140. doi: 10.1016/j.jphotobiol.2014.11.014 Wegelin, M., Canonica, S., Mechsner, K., Fleischmann, T., Pesaro F., & Metzler, A. (1994). Solar water disinfection: scope of the process and analysis of radiation experiments. Journal of Water Supply: Research and Technology- AQUA , 43 , 154-169. Blanco-Galvez, J., Fernández-Ibáñez, P., & Malato-Rodríguez, S. (2007). Solar photocatalytic detoxification and disinfection of water: recent overview. Journal of Solar Energy Engineering , 129 (1). doi.org/10.1115/1.2390948 Gamage, J., & Zhang, Z. (2010). Applications of photocatalytic disinfection. International Journal of Photoenergy , 2010 . doi.org/10.1155/2010/764870 Rezaie, A., Leite, G. G. S., Melmed, G. Y., Mathur, R., Villanueva-Millan, M. J., Parodi, G., Sin, J., Germano, J. F., Morales, W., Weitsman, S., Kim S. Y., Park, J. H., Sakhaie, S., & Pimentel, M. (2020). Ultraviolet A light effectively reduces bacteria and viruses including coronavirus . PLoS One , 15 (7), e0236199. doi.org/10.1371/journal.pone.0236199. Erratum in: PLoS One (2020), 15 (8), e0237782. Yiyu, O., & Petersen, P. M. (2021). Application of ultraviolet light sources for in vivo disinfection, Japanese Journal of Applied Physics , 60 (10), 100501. doi.org/10.35848/1347-4065/ac1f47. Pizarro, R. A. (1995.) UVA oxidative damage modified by environmental conditions in Escherichia coli . International Journal of Radiation Biology , 68 (3), 293-299. doi: 10.1080/09553009514551221 Jagger, J. (1981). Near UV radiation effects on microorganisms. Photochemistry and Photobiology, 34 (6), 761-768. PMID: 7031713 Ramabhadran, T. V., & Jagger, J. (1976) Mechanism of growth delay induced in Escherichia coli by near ultraviolet radiation. Proceedings of the National Academy of Sciences of the United States of America , 73 (1), 59-63. doi: 10.1073/pnas.73.1.59 Favre, A., Hajnsdorf, E., Thiam, K., & Caldeira de Araujo, A. (1985). Mutagenesis and growth delay induced in Escherichia coli by near-ultraviolet radiations. Biochimie , 67 (3-4), 335-342. doi: 10.1016/s0300-9084(85)80076-6 Kramer, G. F., Baker, J. C., & Ames, B. N. (1988) Near-UV stress in Salmonella typhimurium : 4-thiouridine in tRNA, ppGpp, and ApppGpp as components of an adaptive response. Journal of Bacteriology , 170 (5), 2344-2351. doi: 10.1128/jb.170.5.2344-2351.1988 Caldeira de Araujo, A., & Favre, A. (1986). Near ultraviolet DNA damage induce the SOS response in Escherichia coli. EMBO Journal , 5 (1), 1795-1799. doi.org/10.1002/j.1460-2075.1986.tb04193.x Hoerter, J. D., Arnold, A. A., Kuczynska, D. A., Shibuya, A., Ward, C. S., Sauer, M. G., Gizachew, A., Hotchkiss, T. M., Fleming, T. J., & Johnson, S. (2005). Effects of sublethal UVA irradiation on activity levels of oxidative defense enzymes and protein oxidation in Escherichia coli . Journal of Photochemistry and Photobiology B: Biology , 81 (3), 171-180. doi: 10.1016/j.jphotobiol.2005.07.005 Qiu, X., Sundin, G. W., Wu, L., Zhou, J., & Tiedje, J. M.(2005). Comparative analysis of differentially expressed genes in Shewanella oneidensis MR-1 following exposure to UVC, UVB, and UVA radiation. Journal of Bacteriology , 187 (10), 3556-3564. doi.org/10.1128/JB.187.10.3556-3564.2005 Berney, M., Weilenmann, H. U., & Egli, T. (2006). Gene expression of Escherichia coli in continuous culture during adaptation to artificial sunlight. Environmental Microbiology , 8(9) , 1635-1647. https://doi.org/10.1111/j.1462-2920.2006.01057.x. McClary, J. S., & Boehm, A. B. (2018). Transcriptional response of Staphylococcus aureus to sunlight in oxic and anoxic conditions. Frontiers in Microbiology , 9 , 249. doi.org/10.3389/fmicb.2018.00249 Pezzoni, M., Tribelli, P. M., Pizarro, R. A., Lopez, N. I., & Costa, C. S. (2016). Exposure to low UVA doses increases KatA and KatB catalase activities, and confers cross-protection against subsequent oxidative injuries in Pseudomonas aeruginosa . Microbiology , 162 (5), 855-864. doi: 10.1099/mic.0.000268 Pezzoni, M., Pizarro, R. A., & Costa, C. S. (2018). Exposure to low doses of UVA increases biofilm formation in Pseudomonas aeruginosa . Biofouling , 34 (6), 673-684. doi: 10.1080/08927014.2018.1480758 Pezzoni, M., De Troch, M., Pizarro, R. A. & Costa, C. S. (2021). Homeophasic adaptation in response to UVA radiation in Pseudomonas aeruginosa : changes of membrane fatty Acid composition and induction of desA and desB e xpression. Photochemistry and Photobiology , 98 (4), 886-893. doi: 10.1111/php.13548 Pezzoni, M., Lemos, M., Pizarro, R. A., & Costa, C. S. (2022). UVA as environmental signal for alginate production in Pseudomonas aeruginosa : role of this polysaccharide in the protection of planktonic cells and biofilms against lethal UVA doses. Photochemistry & Photobiological Sciences , 21 (8), 1459-1472. doi.org/10.1007/s43630-022-00236-w Grossich, R., Lemos Vilches, M., Costa, C. S., & Pezzoni, M. (2023). Role of Pel and Psl polysaccharides in the response of Pseudomonas aeruginosa to environmental challenges: oxidative stress agents (UVA, H 2 O 2 , sodium hypochlorite) and its competitor Staphylococcus aureus. Microbiology , 169( 2 ), 001301. doi.org/10.1099/mic.0.001301 Ricardi, M. M., Tribelli, P. M., Costa, C. S. & Pezzoni, M. (2024). Global transcriptional response of Pseudomonas aeruginosa to UVA radiation. Photochemical and Photobiological Sciences, 23 (11), 2029-2044. doi: 10.1007/s43630-024-00649-9 Pezzoni, M., Pizarro, R. A. & Costa, C. S. (2020). Role of quorum sensing in UVA-induced biofilm formation in Pseudomonas aeruginosa . Microbiology , 166 (8), 735-750. doi: 10.1099/mic.0.000932 Lee, V. T., Matewish, J. M., Kessler, J. L., Hyodo, M., Hayakawa, Y. & Lory, S. (2007). A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. Molecular Microbiology , 65 (6), 1474-1484. doi: 10.1111/j.1365-2958.2007.05879.x Irie, Y., Borlee, B. R., O'Connor, J. R., Hill, P. J., Harwood, C. S., Wozniak, D. J. & Parsek, M. R. (2012). Self-produced exopolysaccharide is a signal that stimulates biofilm formation in Pseudomonas aeruginosa . Proceedings of the National Academy of Sciences of the United States of America , 109 (50), 20632-20636. doi: 10.1073/pnas.1217993109 Chua, S. L., Ding, Y., Liu, Y., Cai, Z., Zhou, J., Swarup, S., Drautz-Moses, D. I., Schuster, S. C., Kjelleberg, S., Givskov, M. & Yang, L. (2016). Reactive oxygen species drive evolution of pro-biofilm variants in pathogens by modulating cyclic-di-GMP levels. Open Biology , 6 (11), 160162. doi: 10.1098/rsob.160162 Strempel, N., Nusser, M., Neidig, A., Brenner-Weiss, G., & Overhage, J. (2017). The oxidative stress agent hypochlorite stimulates c-di-GMP synthesis and biofilm formation in Pseudomonas aeruginosa . Frontiers in Microbiology, 8 , 2311. doi: 10.3389/fmicb.2017.02311 Xu, A., Zhang, X., Wang, T., Xin, F., Ma, L. Z., Zhou, J., Dong, W., & Jiang, M. (2021). Rugose small colony variant and its hyper-biofilm in Pseudomonas aeruginosa : Adaption, evolution, and biotechnological potential. Biotechnology Advances , 53 , 107862, doi.org/10.1016/j.biotechadv.2021.107862 Holloway, B. W. (1955). Genetic recombination in Pseudomonas aeruginosa . Journal of General Microbiology , 13 (3), 572-581. doi: 10.1099/00221287-13-3-572 Jacobs, M. A., Alwood, A., Thaipisuttikul, I., Spencer, D., Haugen, E., Ernst, S., Will, O., Kaul, R., Raymond, C., Levy, R., Chun-Rong, L., Guenthner, D., Bovee, D., Olson, M. V., & Manoil, C. (2003). Comprehensive transposon mutant library of Pseudomonas aeruginosa . Proceedings of the National Academy of Sciences of the United States of America , 100 (24), 14339-14344. doi: 10.1073/pnas.2036282100. 100: 14339-14344 Pearson, J. P., Pesci, E. C., Iglewski, B. H. (1997). Roles of Pseudomonas aeruginosa la s and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes. Journal of Bacteriology, 179( 18):5756-5767. doi: 10.1128/jb.179.18.5756-5767.1997. 179: 5756-67 Brint, J. M., & Ohman, E. E. (1995). Synthesis of multiple exoproducts in Pseudomonas aeruginosa is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxR-LuxI family. Journal of Bacteriology , 177 (24), 7155-7163. doi: 10.1128/jb.177.24.7155-7163.1995 Pawar, S. V., Messina, M., Rinaldo, S., Cutruzzolà, F., Kaever, V., Rampioni, G., & Leoni, L. (2016). Novel genetic tools to tackle c-di-GMP-dependent signalling in Pseudomonas aeruginosa . Journal of Applied Microbiology , 120 (1), 205-217. doi: 10.1111/jam.12984. Rybtke, M. T., Borlee, B. R., Murakami, K., Irie, Y., Hentzer, M., Nielsen, T. E., Givskov, M., Parsek, M. R., & Tolker-Nielsen, T. (2012), Fluorescence-based reporter for gauging cyclic di-GMP levels in Pseudomonas aeruginosa . Applied and Environmental Microbiology , 78(15), 5060-5069. doi: 10.1128/AEM.00414-12 Brautaset, T., Lale, R. & Valla, S. (2009). Positively regulated bacterial expression systems. Microbial Biotechnology , 2 (1), 15-30. doi: 10.1111/j.1751-7915.2008.00048.x Poudyal, B., & Sauer, K. (2018). (2018). The PA3177 gene encodes an active diguanylate cyclase that contributes to biofilm antimicrobial tolerance but not biofilm formation by Pseudomonas aeruginosa . Antimicrobial Agents and Chemotherapy, 62 (10), e01049-18. doi: 10.1128/AAC.01049-18 Colley, B., Dederer, V., Carnell, M., Kjelleberg, S., Rice, S. A., & Klebensberger, J. (2016). SiaA/D interconnects c-di-GMP and RsmA signaling to coordinate cellular aggregation of Pseudomonas aeruginosa in response to environmental conditions. Frontiers in Microbiology , 7:179, doi: 10.3389/fmicb.2016.00179 Larionov, A., Krause, A. & Miller, W. (2005). A standard curve based method for relative real time PCR data processing. BMC Bioinformatics , 6 :62, doi: 10.1186/1471-2105-6-62 Pestrak, M. J., & Wozniak, D. J. (2020). Regulation of Cyclic di-GMP signaling in Pseudomonas aeruginosa. In Microbial Cyclic Di-Nucleotide Signaling (pp. 471-486). Springer International Publishing. doi.org/10.1007/978-3-030-33308-9_28 Erickson, D. L., Lines, J. L., Pesci, E. C., Venturi, V., & Storey, D. G. (2004). Pseudomonas aeruginosa relA contributes to virulence in Drosophila melanogaster . Infection and Immunity , 72 (10), 5638-5645. doi: 10.1128/IAI.72.10.5638-5645.2004 Barraud, N., Schleheck, D., Klebensberger, J., Webb, J. S., Hassett, D. J., Rice, S. A., & Kjelleberg, S. (2009). Nitric oxide signaling in Pseudomonas aeruginosa biofilms mediates phosphodiesterase activity, decreased cyclic di-GMP levels, and enhanced dispersal. Journal of Bacteriology , 191 (23), 7333-7342. doi: 10.1128/JB.00975-09 Basu Roy, A., & Sauer, K. (2014). Diguanylate cyclase NicD-based signalling mechanism of nutrient-induced dispersion by Pseudomonas aeruginosa . Molecular Microbiology , 94 (4), 771-793. doi: 10.1111/mmi.12802 Chua, S. L., Sivakumar, K., Rybtke, M., Yuan, M., Andersen, J. B., Nielsen, T. E., Givskov, M., Tolker-Nielsen, T., Cao, B., Kjelleberg, S., & Yang, L. (2015). C-di-GMP regulates Pseudomonas aeruginosa stress response to tellurite during both planktonic and biofilm modes of growth. Scientific Reports , 20 (5), 10052. doi: 10.1038/srep10052 Ren, G. X., Fan, S., Guo, X. P., Chen, S., & Sun, Y. C. (2016). Differential regulation of c-di-GMP metabolic enzymes by environmental signals modulates biofilm formation in Yersinia pestis . Froniers in Microbiology, 7 , 821. doi: 10.3389/fmicb.2016.00821 Kahl, L. J., Price-Whelan, A., & Dietrich, L. E. P. (2020). Light-mediated decreases in c cyclic di-GMP levels inhibit structure formation in Pseudomonas aeruginosa biofilms. Journal of Bacteriology , 202 (14), e00117-20. doi: 10.1128/JB.00117-20 Zhan, X., Zhang, K, Wang, C., Fan, Q., Tang, X., Zhang, X., Wang, K., Fu, Y., & Liang, H. A. (2024) c-di-GMP signaling module controls responses to iron in Pseudomonas aeruginosa . Nature Communications , 15(1), 1860. doi: 10.1038/s41467-024-46149-3. Erratum in (2024), Nature Communications , 15(1), 8707. doi: 10.1038/s41467-024-52012-2 Hickman, J. W., & Harwood, C. S. (2008). Identification of FleQ from Pseudomonas aeruginosa as a c-di-GMP responsive transcription factor. Molecular Microbiology , 69 (2), 376-389. doi: 10.1111/j.1365-2958.2008.06281.x Colvin, K. M., Gordon, V. D., Murakami, K., Borlee, B. R., Wozniak, D. J., Wong, G. C., & Parsek, M, R. (2011). The Pel polysaccharide can serve a structural and protective role in the biofilm matrix of Pseudomonas aeruginosa . PLOS Pathogens . 7 (1), e1001264. doi: 10.1371/journal.ppat.1001264 Jennings, L. K., Storek, K. M., Ledvina, H. E., Coulon, C., Marmont, L. S., Sadovskaya, I., Secor, P. R., Tseng, B. S., Scian, M., Filloux, A., Wozniak, D. J., Howell, P. L., & Parsek, M.R. (2015). Pel is a cationic exopolysaccharide that cross-links extracellular DNA in the Pseudomonas aeruginosa biofilm matrix. Proceedings of the National Academy of Sciences of the United States of America , 112 (36), 11353-11358. doi: 10.1073/pnas.1503058112 Katharios-Lanwermeyer, S., Koval, S. A., Barrack, K. E., & O'Toole, G. A. (2022). The diguanylate cyclase YfiN of Pseudomonas aeruginosa regulates biofilm maintenance in response to Peroxide. Journal of Bacteriology , 204 (1), e0039621. doi: 10.1128/JB.00396-21 Malone, J. G., Jaeger, T., Spangler, C., Ritz, D., Spang, A., Arrieumerlou, C., Kaever, V., Landmann, R., & Jenal, U. (2010). YfiBNR mediates cyclic di-GMP dependent small colony variant formation and persistence in Pseudomonas aeruginosa . PLoS Pathogens , 6 (3), e1000804. doi: 10.1371/journal.ppat.1000804 Pezzoni, M., Pizarro, R. A., & Costa, C. S. (2014). Protective role of extracellular catalase (KatA) against UVA radiation in Pseudomonas aeruginosa biofilms. Journal of Photochemistry and Photobiology B: Biology . 131 , 53-64. doi: 10.1016/j.jphotobiol.2014.01.005 Fernandez, N. L., & Waters, C. M. (2019). Cyclic di-GMP increases catalase production and hydrogen peroxide tolerance in Vibrio cholerae . Applied and Environmental Microbiology , 85 (18), e01043-19. doi: 10.1128/AEM.01043-19 Xiao, Y., Zhu, W., He, M., Nie, H., Chen, W., & Huang, Q. (2019). High c-di-GMP promotes expression of fpr-1 and katE involved in oxidative stress resistance in Pseudomonas putida KT2440. Applied Microbiology and Biotechnology, 103 (21-22), 9077-9089. doi: 10.1007/s00253-019-10178-6 Gao, Q., & Garcia-Pichel, F. (2011). Microbial ultraviolet sunscreens. Nature Reviews Microbiology , 9 (11), 791-802. doi: 10.1038/nrmicro2649. PMID: 21963801 Ueda, A., & Wood, T. K. (2009). Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885). PLoS Pathogens . 5 (6), e1000483. doi: 10.1371/journal.ppat.1000483 Fontaine, B. M., Duggal, Y., & Weinert, E. E. (2018). Exploring the links between nucleotide signaling and quorum sensing pathways in regulating bacterial virulence. ACS Infectious Diseases Journal , 4 (12), 1645-1655. doi: 10.1021/acsinfecdis.8b00255 Kim, B., Park, J. S., Choi, H. Y., Yoon, S. S., & Kim, W. G. (2018). Terrein is an inhibitor of quorum sensing and c-di-GMP in Pseudomonas aeruginosa : a connection between quorum sensing and c-di-GMP. Scientific Reports , 8 (1), 8617. doi: 10.1038/s41598-018-26974-5 Condinho, M., Carvalho, B., Cruz, A., Pinto, S. N., Arraiano, C. M., & Pobre, V. (2023). The role of RNA regulators, quorum sensing and c-di-GMP in bacterial biofilm formation. FEBS Open Bio , 13 (6), 975-991. doi: 10.1002/2211-5463.13389 Costa, C. S., Pezzoni, M., Fernández, R. O., & Pizarro, R. A. (2010). Role of the quorum sensing mechanism in the response of Pseudomonas aeruginosa to lethal and sublethal UVA irradiation. Photochemistry and Photobiology , 86 (6), 1334-1342. doi: 10.1111/j.1751-1097.2010.00800.x Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.doc Graphicalabstract.pdf Cite Share Download PDF Status: Published Journal Publication published 03 Mar, 2026 Read the published version in Photochemical & Photobiological Sciences → Version 1 posted Editorial decision: Revision requested 11 Jan, 2026 Reviews received at journal 11 Jan, 2026 Reviewers agreed at journal 16 Oct, 2025 Reviewers invited by journal 10 Oct, 2025 Editor assigned by journal 10 Oct, 2025 Submission checks completed at journal 10 Oct, 2025 First submitted to journal 09 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7819024","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":532479986,"identity":"571355e2-b801-4bfa-97c7-ab4db17488b8","order_by":0,"name":"Candela Rodriguez","email":"","orcid":"","institution":"Comisión Nacional de Energía Atómica","correspondingAuthor":false,"prefix":"","firstName":"Candela","middleName":"","lastName":"Rodriguez","suffix":""},{"id":532479987,"identity":"b017a5fc-ea34-4605-9965-d1f41a178dc0","order_by":1,"name":"Lucas Paré Schiaffino","email":"","orcid":"","institution":"Comisión Nacional de Energía Atómica","correspondingAuthor":false,"prefix":"","firstName":"Lucas","middleName":"Paré","lastName":"Schiaffino","suffix":""},{"id":532479988,"identity":"1367b75f-1b71-40b8-b037-592476e42ba4","order_by":2,"name":"Cristina S. Costa","email":"","orcid":"","institution":"Comisión Nacional de Energía Atómica","correspondingAuthor":false,"prefix":"","firstName":"Cristina","middleName":"S.","lastName":"Costa","suffix":""},{"id":532479989,"identity":"e1ab900d-39fa-4d7c-841f-e1912919f395","order_by":3,"name":"Magdalena Pezzoni","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABLklEQVRIie3QsUrDUBSA4VMCZjmQ9ZaGvoFwyoWUoOir9FJIl1CFLhm0BAJm6QMUBH2Fii+QEkiWiLhdsUOL0ClDi0uEggZRVLgqboL5p+QmH/dwAKqq/mgMDt9f0Hh7om/Jh69Y939LgKIfyHaY3siCdvvGaRCvC29m8vRqOi/guNkGbblSECtzB/aInAGbJR1i2RKtrN9tjSDltr/FxyoSuQ5DioUvXeq0TmK0JFoMIRGTCLhqMOs6d+obehLn8mAViZLwMbYfNy9Ef1AS2UsaSJGYSLfmT0tCDC0N4agkqL5F5tqOSV1xMUt4zc9iZJnLGyZF3A5woB6st7jNvT1xdhfclxuL940wa61zb9hs6+Gles34un/26ZRiAE0NAPS5isDwq/+rqqqq/l/Pt2NpTbwbuQkAAAAASUVORK5CYII=","orcid":"","institution":"Comisión Nacional de Energía Atómica","correspondingAuthor":true,"prefix":"","firstName":"Magdalena","middleName":"","lastName":"Pezzoni","suffix":""}],"badges":[],"createdAt":"2025-10-09 15:08:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7819024/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7819024/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s43630-026-00875-3","type":"published","date":"2026-03-03T15:58:47+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94361926,"identity":"92f03f89-b077-400b-ba68-44b4c5ca8887","added_by":"auto","created_at":"2025-10-27 13:04:37","extension":"doc","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":214528,"visible":true,"origin":"","legend":"","description":"","filename":"Maintext.doc","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/0dccf313f8ec59c5102f78b3.doc"},{"id":94362963,"identity":"2d2c2786-a3a8-4896-87e1-7505b418dccd","added_by":"auto","created_at":"2025-10-27 13:05:45","extension":"doc","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":32256,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.doc","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/51ae573f0c508771d9e299d8.doc"},{"id":94362270,"identity":"c30045dc-9789-4478-bf54-dba1a343423f","added_by":"auto","created_at":"2025-10-27 13:04:53","extension":"doc","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37888,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.doc","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/7cb1fd4b8be089237800b43e.doc"},{"id":94362913,"identity":"4e9e64c4-7750-4abb-abd3-508a3ffaca40","added_by":"auto","created_at":"2025-10-27 13:05:42","extension":"json","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6480,"visible":true,"origin":"","legend":"","description":"","filename":"533884595a714797ac76e0ce671f4ab2.json","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/192ce4ccf3f6a61fbdcfe06e.json"},{"id":94362478,"identity":"805bc904-1550-4877-8c30-a0fa87ca778e","added_by":"auto","created_at":"2025-10-27 13:05:09","extension":"doc","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":178688,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.doc","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/698349a1fbe2abc22abbbf53.doc"},{"id":94362833,"identity":"e5a659a0-da37-4d18-88a4-25575bad7eab","added_by":"auto","created_at":"2025-10-27 13:05:29","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":217008,"visible":true,"origin":"","legend":"","description":"","filename":"533884595a714797ac76e0ce671f4ab21enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/f4d7c4a777158e637bdc3b1d.xml"},{"id":94362724,"identity":"684c6cb6-c6f2-43b8-89de-d1778e9d4900","added_by":"auto","created_at":"2025-10-27 13:05:21","extension":"pdf","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":90809,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/309a06f17ac9dafbadf02d6d.pdf"},{"id":94362338,"identity":"b2989770-f025-4b59-8016-10de69554b4e","added_by":"auto","created_at":"2025-10-27 13:05:02","extension":"pdf","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":174231,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/cfdcac064eee2798e02b6933.pdf"},{"id":94362392,"identity":"190da71c-10fc-4c57-94f1-93fe385f1952","added_by":"auto","created_at":"2025-10-27 13:05:07","extension":"pdf","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":161618,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/36d410d30f5b8f690592b1d4.pdf"},{"id":94489091,"identity":"b4c33be1-1212-4121-b536-ff2dc6107a79","added_by":"auto","created_at":"2025-10-27 17:03:06","extension":"pdf","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":90451,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/40432d423f08a9f041b55ccd.pdf"},{"id":94362273,"identity":"febd8a67-ad53-4adb-8beb-cac8e9316d3c","added_by":"auto","created_at":"2025-10-27 13:04:54","extension":"pdf","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":185421,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/b5a968953626f66b59cffb2e.pdf"},{"id":94362762,"identity":"c42d3d52-6d76-409e-909f-7972a43c4a8c","added_by":"auto","created_at":"2025-10-27 13:05:25","extension":"pdf","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":161460,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/af28a4a2ca0eebee5a52c2fb.pdf"},{"id":94362726,"identity":"27a984e3-7d8c-4269-a2eb-e3015774fc84","added_by":"auto","created_at":"2025-10-27 13:05:21","extension":"pdf","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":158534,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/abd758e49a9f2ce17901072f.pdf"},{"id":94362182,"identity":"1d390804-1a82-4ad7-abca-226a171cc7de","added_by":"auto","created_at":"2025-10-27 13:04:46","extension":"pdf","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":157701,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/d623fd715401827730f24800.pdf"},{"id":94361884,"identity":"4f96775d-eef0-48b5-8711-dabc89937600","added_by":"auto","created_at":"2025-10-27 13:04:31","extension":"pdf","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":81476,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/7891dc915b5a88463579fcd1.pdf"},{"id":94362047,"identity":"c2706abb-a4b3-45cc-9aeb-5926c1f20a46","added_by":"auto","created_at":"2025-10-27 13:04:44","extension":"pdf","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":84869,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/74a16814582e55ea3f6ccd90.pdf"},{"id":94362587,"identity":"7ee870db-f7ea-4152-94f8-21529a098c42","added_by":"auto","created_at":"2025-10-27 13:05:16","extension":"xml","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":217806,"visible":true,"origin":"","legend":"","description":"","filename":"533884595a714797ac76e0ce671f4ab21structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/bc186a23f377f21efeb6b4f3.xml"},{"id":94362721,"identity":"56430f43-d561-47ee-9ecc-7bcea3e83ced","added_by":"auto","created_at":"2025-10-27 13:05:20","extension":"html","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":240526,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/e86e17c6b89e5cb476d76f09.html"},{"id":94362758,"identity":"213f9fd0-55a2-44b5-b25b-5c0e4a6d321b","added_by":"auto","created_at":"2025-10-27 13:05:24","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":76756,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of sublethal UVA doses (irradiance 25 W m\u003csup\u003e-2\u003c/sup\u003e) on P\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp \u003c/em\u003etranscriptional fusion expression in the PAO1 strain. Control cells were grown under identical conditions but kept in the dark. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; ** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.005\u003c/p\u003e","description":"","filename":"fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/f5558ab856bf7d9daa02f57a.jpg"},{"id":94362226,"identity":"6a0358ee-4cdf-4aa4-9041-ee313cda13b4","added_by":"auto","created_at":"2025-10-27 13:04:53","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":138971,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of sublethal UVA doses (irradiance 25 W m\u003csup\u003e-2\u003c/sup\u003e) on cell attachment in the PAO1 strain, measured as CFU cm\u003csup\u003e-2\u003c/sup\u003e (\u003cstrong\u003ea\u003c/strong\u003e) and crystal violet staining (\u003cstrong\u003eb\u003c/strong\u003e and \u003cstrong\u003ec\u003c/strong\u003e).\u0026nbsp; Control cells were grown under identical conditions but kept in the dark. Images of representative experiments are shown (\u003cstrong\u003eb\u003c/strong\u003e). * \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05\u003c/p\u003e","description":"","filename":"fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/f503efc39c1c43822482c2cb.jpg"},{"id":94362837,"identity":"0c3a33b8-f375-495e-868e-5de8530b5505","added_by":"auto","created_at":"2025-10-27 13:05:30","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":86919,"visible":true,"origin":"","legend":"\u003cp\u003eqRT-PCR of genes coding for DGCs PA1377, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e, \u003cem\u003ewspR\u003c/em\u003e and \u003cem\u003esiaD \u003c/em\u003e(\u003cstrong\u003ea\u003c/strong\u003e) and PDEs \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e (\u003cstrong\u003eb\u003c/strong\u003e) from the PAO1 strain, grown under sublethal UVA radiation (irradiance 25 W m\u003csup\u003e-2\u003c/sup\u003e, 30 min) or kept in the dark. The 16S rRNA gene was used as reference for normalization in each condition. * \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.005\u003c/p\u003e","description":"","filename":"fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/c0fbda2a2089a348f0c65caa.jpg"},{"id":94362291,"identity":"0a239ba0-5570-4620-adb1-0c79aa2f912c","added_by":"auto","created_at":"2025-10-27 13:04:58","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":66967,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of sublethal UVA doses (irradiance 25 W m\u003csup\u003e-2\u003c/sup\u003e) on P\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp \u003c/em\u003etranscriptional fusion expression in the \u003cem\u003erelA\u003c/em\u003e strain. Control cells were grown under identical conditions but kept in the dark\u003c/p\u003e","description":"","filename":"fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/fdd64ae1440dd45624726e71.jpg"},{"id":94361883,"identity":"bf049bb9-08c8-44d9-8c57-31d66d928a20","added_by":"auto","created_at":"2025-10-27 13:04:30","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":109297,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of sublethal UVA doses (irradiance 25 W m\u003csup\u003e-2\u003c/sup\u003e) on cell attachment in the \u003cem\u003erelA\u003c/em\u003e strain, measured as CFU cm\u003csup\u003e-2\u003c/sup\u003e (\u003cstrong\u003ea\u003c/strong\u003e) and crystal violet staining (\u003cstrong\u003eb\u003c/strong\u003e and \u003cstrong\u003ec\u003c/strong\u003e).\u0026nbsp; Images of representative experiments are shown (\u003cstrong\u003eb\u003c/strong\u003e)\u003c/p\u003e","description":"","filename":"fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/6b1be8dfa20f295c1986a482.jpg"},{"id":94362753,"identity":"c9bc2661-ab52-4d70-91b3-8a2d733d34d5","added_by":"auto","created_at":"2025-10-27 13:05:23","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":89733,"visible":true,"origin":"","legend":"\u003cp\u003eqRT-PCR of genes coding for DGCs PA1377, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e, \u003cem\u003ewspR\u003c/em\u003e and \u003cem\u003esiaD \u003c/em\u003e(\u003cstrong\u003ea\u003c/strong\u003e) and PDEs \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e (\u003cstrong\u003eb\u003c/strong\u003e) from the \u003cem\u003erelA\u003c/em\u003e strain, grown under sublethal UVA radiation (irradiance 25 W m\u003csup\u003e-2\u003c/sup\u003e, 30 min) or kept in the dark. The 16S rRNA gene was used as reference for normalization in each condition. * \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05\u003c/p\u003e","description":"","filename":"fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/4b9e36ce054ace7c5cf6b734.jpg"},{"id":94362755,"identity":"a79ba4da-8da3-4e1c-9689-8fb8823be6ab","added_by":"auto","created_at":"2025-10-27 13:05:24","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":155920,"visible":true,"origin":"","legend":"\u003cp\u003eqRT-PCR of genes coding for DGCs PA1377, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e and \u003cem\u003ewspR\u003c/em\u003e from strains \u003cem\u003elasI\u003c/em\u003e (\u003cstrong\u003ea\u003c/strong\u003e), \u003cem\u003erhlI\u003c/em\u003e (\u003cstrong\u003eb\u003c/strong\u003e) and \u003cem\u003elasI rhlI\u003c/em\u003e (\u003cstrong\u003ec\u003c/strong\u003e) grown under sublethal UVA radiation (irradiance 25 W m\u003csup\u003e-2\u003c/sup\u003e, 30 min) or kept in the dark. The 16S rRNA gene was used as reference for normalization in each condition. * \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05\u003c/p\u003e","description":"","filename":"fig7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/558e42f9b934a9b3cd2a1186.jpg"},{"id":94362311,"identity":"c7a40c6c-2786-4a2b-9e50-f07c7c5c28ae","added_by":"auto","created_at":"2025-10-27 13:04:59","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":164608,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of lethal UVA doses (irradiance 20 W m\u003csup\u003e-2\u003c/sup\u003e) on survival of stationary-phase cells (\u003cstrong\u003ea\u003c/strong\u003e) and mature biofilms (\u003cstrong\u003eb\u003c/strong\u003e) of PAO1, PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e and PAO1 \u003cem\u003erbdA\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e grown in absence or presence of 0.3 % arabinose. * \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05\u003c/p\u003e","description":"","filename":"fig8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/3c4831975d2673faee406a6b.jpg"},{"id":94362400,"identity":"4090246e-2d13-4969-ae8d-2236ea8cf1b0","added_by":"auto","created_at":"2025-10-27 13:05:08","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":238176,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic illustration of possible mechanisms linking UVA radiation and the second messenger c-di-GMP in \u003cem\u003eP. aeruginosa\u003c/em\u003e. Oxidative stress and direct tRNAs damage generated by exposure to sublethal UVA doses induce genetic regulatory systems SR (mediated by ppGpp) and QS. In consequence, genes involved in the synthesis of c-di-GMP are up-regulated, depending on both regulatory systems (PA3177, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e) or only on SR (\u003cem\u003ewspR\u003c/em\u003e). At least two genes involved in c-di-GMP degradation (\u003cem\u003ebifA\u003c/em\u003e, \u003cem\u003erbdA\u003c/em\u003e) are repressed by UVA by unknown mechanisms. High levels of the second messenger c-di-GMP generated by UVA exposure could induce Pel and/or Psl overexpression, with the consequent enhancement of biofilm formation and resistance to lethal doses of oxidative stress agents. The results obtained in this study are highlighted in the flowchart.\u003c/p\u003e","description":"","filename":"fig9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/5375a7c1e06f4adb675b5191.jpg"},{"id":104250692,"identity":"a0367acd-43f5-4b3a-abf4-cc4b192a97c5","added_by":"auto","created_at":"2026-03-09 16:05:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2400041,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/b6530ecf-17c2-42b1-82f0-2ead7763a0b5.pdf"},{"id":94362929,"identity":"aacf3d52-57e3-4b22-be6a-d52a484122f0","added_by":"auto","created_at":"2025-10-27 13:05:44","extension":"doc","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":178688,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.doc","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/80dd51ba63dc2d7a813db62a.doc"},{"id":94361925,"identity":"fb01fb98-1242-4671-b190-36938f7639f1","added_by":"auto","created_at":"2025-10-27 13:04:36","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":84869,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7819024/v1/49c3e7a5aa1f0db4605acd23.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"c-di-GMP is a key regulator of Pseudomonas aeruginosa response to UVA radiation","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003e\u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e is a human opportunistic pathogen capable of causing both acute and chronic infections [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This microorganism is also well known by its capacity to prosper in diverse environments, including soil, water, insects, plants and animals [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This ubiquity is in great part due to its ability to form strong biofilms when it adheres to biotic or abiotic suitable surfaces. The biofilm formation process involves several stages [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. At the initial stage, planktonic cells come into weak, reversible contact, and motility mediated by flagella or pili helps the cells move towards the surface. Then, motility decreases and an irreversible attachment occurs by expression of adhesins and secretion of extracellular polymeric substances. Cells attach firmly and biofilm matrix components become relevant. Surface sensing triggers changes in gene expression, leading cells to transition into a sessile state. Attached cells begin to divide developing into a structured and complex community, the biofilm itself, characterized by its enhanced resistance to environmental stressors such as detergents, radiation, antimicrobials and host immune system [\u003cspan additionalcitationids=\"CR5 CR6 CR7 CR8\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIt has been well established in several bacterial species that the transition from motile to sessile lifestyle largely depends on the intracellular levels of the signaling molecule bis-(3',5')-cyclic dimeric guanosine monophosphate (c-di-GMP) [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Biofilms traits modulated by c-di-GMP range from flagella and pili movements, exopolysaccharides production, expression of adhesins, resistance to antimicrobial agents, to biofilm dispersion [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The synthesis of c-di-GMP is mediated from GTP by diguanylate cyclases (DGCs) identified by a conserved GGDEF domain, while the hydrolisis of c-di-GMP into 5\u0026prime;-phosphoguanylyl-(3\u0026rsquo;- 5\u0026rsquo;)-guanosine (pGpG) or two GMP molecules, occurs by the action of phosphodiesterases (PDEs) carrying a conserved EAL or HD-GYP domain, respectively [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. \u003cem\u003eP. aeruginosa\u003c/em\u003e encodes about 40 putative c-di-GMP metabolizing genes; transcriptional control, post-translational regulation, and modulation of enzymatic activity of DGCs and PDEs determine the final c-di-GMP levels [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The interaction of c-di-GMP with effectors such as enzymes, transcriptional regulators and riboswitches modifies expression patterns at the transcriptional, translational, or post-translational level [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], with the consequent modifications on bacterial physiology. Besides biofilm formation, other biological processes depends on c-di-GMP levels, such as virulence, secondary metabolite production and stress response to several stress agents [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOne of the main environmental stress agents for bacteria is solar UVA radiation, the major fraction of ultraviolet radiation reaching the Earth\u0026rsquo;s surface [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Exposure of bacteria to lethal UVA doses produces oxidative damage to proteins, lipids and DNA, with the consequent loss of bacterial viability [\u003cspan additionalcitationids=\"CR20 CR21\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The damage is produced by the action of the reactive oxygen species (ROS), which are generated by the absorption of UVA by endogenous photosensitizers such as flavoproteins, cytochromes and quinones, in presence of oxygen [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Because of its lethal effect on microorganisms, the use of this light has been proposed in disinfection strategies, such as the SODIS method, using the sunlight alone or in the presence of photocatalysts that enhance the toxic effects [\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The use of UVA lamps as therapeutic antibacterial agent is currently under study [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The response elicited by exposure to low UVA doses is also of interest. Sublethal UVA doses produce oxidative disturbance of bacterial membranes [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and direct damage to certain tRNAs [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], increasing the levels of the Stringent Response regulator ppGpp [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In order to cope with UVA-induced death, bacteria have evolved adaptive mechanisms triggered by sublethal doses [\u003cspan additionalcitationids=\"CR35 CR36 CR37 CR38\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Particularly, in \u003cem\u003eP. aeruginosa\u003c/em\u003e, these involve induction of enzymatic antioxidative systems [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], increased biofilm formation [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], increased membrane fluidity due to higher proportion of membrane unsaturated fatty acids [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and enhanced production of biofilm matrix exopolysaccharides alginate, Pel and Psl [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Recently, the whole transcriptome of \u003cem\u003eP. aeruginosa\u003c/em\u003e exposed to sublethal UVA exposure revealed the induction of genes involved in DNA damage, [Fe-S] cluster biogenesis, intracellular iron homeostasis and denitrification pathways [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn this study, the role of the second messenger c-di-GMP in the response of \u003cem\u003eP. aeruginosa\u003c/em\u003e to ultraviolet A radiation (UVA, 400\u0026thinsp;\u0026minus;\u0026thinsp;315 nm) was evaluated. Several findings provide a compelling rationale for this study: i) Like c-di-GMP, UVA exposure is linked to biofilm formation [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], ii) UVA-induced biofilm formation relies on polysaccharides Pel and Psl [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], whose expression is regulated by c-di-GMP levels [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], and iii) c-di-GMP is associated with oxidative stress response [\u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], which is the most well-documented effect of UVA exposure. Through the use of different genetic tools, it was demonstrated here that c-di-GMP has a key role on the UVA response of \u003cem\u003eP. aeruginosa\u003c/em\u003e. Sublethal UVA doses were capable to increase c-di-GMP levels, and enhanced cell attachment, the first stage of biofilm formation, could be ascribed to this phenomenon. Transcriptional up-regulation by UVA of DGCs genes PA3177, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e and \u003cem\u003ewspR\u003c/em\u003e could explain the rise of second messenger levels under radiation conditions. In addition, c-di-GMP demonstrated to be important in the survival of planktonic cells and biofilms exposed to lethal doses of this radiation. Results obtained using mutants with alterations in the regulatory systems Stringent Response (SR) and Quorum Sensing (QS) led to the assumption that c-di-GMP-UVA up-regulation is in part related to these global regulatory genetic mechanisms.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Bacterial strains and culture conditions\u003c/h2\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e lists the strains used in this study; all of them are derivatives of the wild-type PAO1. Bacterial cultures were routinely grown at 37\u0026deg; C with shaking in complete LB broth (10 g tryptone, 5 g yeast extract and 5 g NaCl bring the volume up to 1000 ml in distilled water); for solid medium 15 gl\u003csup\u003e-1\u003c/sup\u003e agar was added. The plasmid-based reporter pP\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e] was introduced into the wild-type and its \u003cem\u003erelA\u003c/em\u003e derivative by transformation with Cl\u003csub\u003e2\u003c/sub\u003eCa and selection in solid LB medium added with 30 \u0026micro;g ml\u003csup\u003e-1\u003c/sup\u003e gentamicin. Strains PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e and PAO1 \u003cem\u003erbdA\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e carrying AraC/P\u003csub\u003eBAD\u003c/sub\u003e regulatory-promoter systems were grown with 0.3% arabinose in order to achieve controllable c-di-GMP levels [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eStrains and plasmid used in this study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStrain or plasmid\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRelevant genotype and/or phenotype\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSource of reference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePAO1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWild-type\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePW2696\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003erelA\u003c/em\u003e::Is\u003cem\u003elac\u003c/em\u003eZ/hah\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePAO-JP1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003elasI\u003c/em\u003e::Tet\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePDO100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003erhlI\u003c/em\u003e::Tn\u003cem\u003e501\u003c/em\u003e-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePAO-JP2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003elasI\u003c/em\u003e::Tet \u003cem\u003erhlI\u003c/em\u003e::Tn\u003cem\u003e501\u003c/em\u003e-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePAO1 \u003cem\u003eyfin\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epP\u003csub\u003eBAD\u003c/sub\u003eYfiN\u003csup\u003eind\u003c/sup\u003e integrated in the chromosome\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePAO1 \u003cem\u003erbdA\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epP\u003csub\u003eBAD\u003c/sub\u003eRbdA\u003csup\u003eind\u003c/sup\u003e integrated in the chromosome\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epP\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epUCP22 carrying the P\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e fusion; Gm\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Irradiation source\u003c/h2\u003e\u003cp\u003eCell suspensions were irradiated using a bench with two Philips TDL 18W/08 tubes (\u0026gt;\u0026thinsp;95% UVA emission at 365 nm). The incident irradiance under the experimental conditions was measured at the surface of the suspensions with a 9811.58 radiometer (Cole-Parmer Instruments). The light field was homogeneous, ensuring that all samples received equal radiation under a given condition. The irradiances employed in this study may be encountered normally in the environment [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 pP\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e reporter assays under exposure to sublethal UVA doses\u003c/h2\u003e\u003cp\u003eMid-exponential cultures (OD\u003csub\u003e650\u003c/sub\u003e 0.3) of the wild-type and \u003cem\u003erelA\u003c/em\u003e strains carrying the pP\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e plasmid were diluted to OD\u003csub\u003e650\u003c/sub\u003e 0.05 in LB medium and divided into two 15 ml fractions, each of which was placed in a glass beaker (4.5 cm internal diameter). The beakers were placed in a multi-chamber coupled to a thermocycler bath to maintain the temperature of the suspensions at 37\u0026deg; C. The cell suspensions were stirred continuously with a magnetic bar. One of the fractions was irradiated from above at an irradiance of 25 W m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e at the level of the free surface of the suspension, while the other was covered with a black plastic sheet (dark control). Cell growth was followed by measuring the OD at 650 nm. 1 ml samples were taken during 90 min at 15 min intervals, centrifuged, and the supernatant was removed. Bacterial pellets were suspended in 1 ml of saline solution (NaCl 0.1 M) and fluorescence produced by the the GFP marker (excitation 485 nm, emission 535 nm) was recorded with a microplate reader. Data are presented as relative fluorescent units (RFU) per OD\u003csub\u003e650\u003c/sub\u003e unit.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Cell attachment assays under exposure to sublethal UVA doses\u003c/h2\u003e\u003cp\u003eThe experimental setup for cell attachment assays was similar to that described in Section \u003cspan refid=\"Sec5\" class=\"InternalRef\"\u003e2.3\u003c/span\u003e, but sterile glass slides (20 mm x 25 mm x 1 mm) were placed vertically at the bottom of the glass beakers carrying the bacterial suspensions (only half of the slide is submerged). This biofilm formation system, known as ALI (air-liquid interface) was employed in order to facilitate the short-term analysis since cell attachment is favored in the air-liquid interface. Cell suspensions were maintained at 37\u0026deg; C as described above, but without agitation. One of the fractions was irradiated from above at an irradiance of 25 W m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e at the level of the free surface of the suspension, while the other was covered with a black plastic sheet (dark control). Different slides were removed at 15 and 30 min and cell attachment was determined by evaluating the number of attached bacteria on the slides using crystal violet staining. To evaluate the number of attached bacteria, the slides were washed with sterile saline solution to remove unattached cells; slides were then scraped with a sterile plastic spatula, and the material was recovered in 0.5 ml of saline solution and homogenized by vigorous vortexing. Appropriate dilutions of these suspensions were plated on LB solid medium. Plates were incubated for 24 h at 37\u0026deg; C and the number of colonies was expressed as CFU per cm\u003csup\u003e2\u003c/sup\u003e. For crystal violet staining, slides were washed with distilled water to remove unattached cells and 0.1% (w/v) aqueous crystal violet solution was added for 30 min. The crystal violet solution was then discarded, and the slides were washed with distilled water to remove residual stain. After photographing glass slides, the crystal violet adhered to each slide was dissolved in 2 ml of a mixture of 96% ethanol and 30% acetic acid (1:1) and absorbance at 575 nm was measured in the resulting solutions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 UVA sensitivity assays\u003c/h2\u003e\u003cdiv id=\"Sec8\" class=\"Section3\"\u003e\u003ch2\u003e2.5.1 Planktonic cells\u003c/h2\u003e\u003cp\u003eStationary-phase cultures of the wild-type, PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e and PAO1 \u003cem\u003erbdA\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e strains were obtained in LB medium with or without 0.3% arabinose. A fraction of these cultures was washed and suspended in saline solution at an OD\u003csub\u003e650\u003c/sub\u003e of 0.4. Each suspension was divided into two 15 ml fractions, each of which was placed in a glass beaker (4.5 cm internal diameter) located in a multi-chamber coupled to a thermo cycler bath. The temperature of the suspensions was maintained at 20\u0026deg; C. One of the fractions was irradiated from above at an irradiance of 20 W m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e for 240 min (radiant exposure 288 kJ m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e), while the other was covered with a black plastic sheet (dark control). The irradiance applied was lower than the one used to generate a sublethal stress level (25 W m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e) because, unlike LB medium (employed in experiments of sublethal UVA assays), saline solution does not absorb radiation at 365 nm (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The cell suspensions were stirred continuously with a magnetic bar. Samples were taken at regular intervals from both fractions, diluted in saline solution and plated on LB solid medium to assess cell viability by counting the number of CFU. Plates were incubated at 37\u0026deg; C in the dark to prevent light-induced DNA repair and the colonies were counted after 24 h. Survival was expressed as the fraction of the CFU ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at time 0.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\u003ch2\u003e2.5.2 Biofilms\u003c/h2\u003e\u003cp\u003eOvernight cultures of the wild-type, PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e and PAO1 \u003cem\u003erbdA\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e strains were diluted to an OD\u003csub\u003e650\u003c/sub\u003e of 0.1 in LB medium with or without 0.3% arabinose. In order to obtain submerged mature biofilms, 10 ml of these suspensions were placed in 100 ml glass beakers, each containing a sterile glass slide (20 mm x 25 mm x 1 mm) placed horizontally on the bottom. The beakers were capped with cotton plugs and incubated at 37\u0026deg;C for 24 h without shaking. The slides were then removed, washed once with distilled water to eliminate unattached cells, and placed in small Petri dishes (diameter 4.5 cm) open to air and covered with 5 mL saline solution. Treated biofilms were irradiated from above at an irradiance of 20 W m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e for 180 min (radiant exposure 216 kJ m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e), while control biofilms were kept in the dark by covering the plates with a black plastic sheet. To evaluate the cell viability, the CFU per area unit was quantified in UVA-treated and control biofilms. To do this, the slides supporting the biofilms were removed and washed by letting sterile distilled water (about 10 ml) drop down gently on them to remove unattached cells. The bacterial biomass was then scraped from the glass with a sterile plastic spatula, recovered in 0.5 ml of saline solution, and homogenized by vigorous vortexing. Appropriate dilutions of these suspensions were plated on LB solid medium. Plates were incubated in the dark immediately after irradiation and the colonies were counted after incubation for 24 h at 37\u0026deg; C. Survival was expressed as a fraction of the CFU cm\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e at time 0.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Quantitative real-time PCR (qRT-PCR)\u003c/h2\u003e\u003cp\u003eTotal RNA of strains exposed to sublethal UVA or maintained in the dark as described in Section \u003cspan refid=\"Sec5\" class=\"InternalRef\"\u003e2.3\u003c/span\u003e was extracted by using a Total RNA Extraction kit (Ambion-Life Technology). After treatment with DNase I, cDNA was obtained using random hexamers (Promega) and avian myeloblastosis virus reverse transcriptase (Promega) following the manufacturer\u0026rsquo;s instructions. qRT-PCR was performed using a Real-time PCR cycler (Rotor-Gene Q; QIAGEN) and Real-time PCR Mix (qPCR Mix Biodynamics). The employed primers and their origin are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Primers for amplification of PA3177, \u003cem\u003esiaD\u003c/em\u003e and 16S rRNA genes were employed in previous works while primers for amplification of \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e, \u003cem\u003ewspR\u003c/em\u003e, \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e genes were designed by using the Primer3 program (Whitehead Institute for Biomedical Research). The cycling conditions for PA3177, \u003cem\u003eyfiN, sadC, wspR, siaD, bifA\u003c/em\u003e and \u003cem\u003erbdA genes\u003c/em\u003e were as follows: denaturation at 95\u0026deg;C for 5 min; 40 cycles at 95\u0026deg;C for 20 s, 56\u0026deg;C for 20 s and 72\u0026deg;C for 15 s. The 16S rRNA gene was used as reference for normalization of expression levels of target genes in each condition [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Relative changes in the expression of individual genes between the treated and control conditions were obtained through the relative standard curve method [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers used in this study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence (5\u0026acute;\u0026rarr; 3\u0026acute;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSource or reference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e16S Fw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGCTTGCTCCTTGATTCAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e16S Rv\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAGGGCCATGATGACTTGAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePA3177 Fw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTCCCAAGCAGTCCAATA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePA3177 Rv\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGAAGAACAGGCCGAGAATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eyfiN\u003c/em\u003e Fw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGCATCGCGAGCAATTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eyfinN\u003c/em\u003e Rv\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATGTTGACCAGCACGGTGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003esadC\u003c/em\u003e Fw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCAGGCGGGTAATTCGGAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003esadC\u003c/em\u003e Rv\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGTTGCCTAGTCGAACGAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ewspR\u003c/em\u003e Fw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATACCTGGAGATGGAGTGGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ewspR\u003c/em\u003e Rv\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCGAAGGTGTCGTTGTAGCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003esiaD\u003c/em\u003e Fw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTGGCAATGCTCGATGTGGACTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003esiaD\u003c/em\u003e Rv\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGCGGCCGCAGAGGTCGTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ebifA\u003c/em\u003e Fw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCCGCCCTATAGCGAATAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ebifA\u003c/em\u003e Rv\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAGAATGCCGGAGATGAAGATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003erbdA\u003c/em\u003e Fw\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGGACATGCTCGAGGATCCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003erbdA\u003c/em\u003e Rv\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCGACGGTCTCGACGAACTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Statistical analysis\u003c/h2\u003e\u003cp\u003eAll samples were analyzed at least in triplicate. Data are shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. The significance of each treatment was evaluated by Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test with confidence levels at \u0026gt;\u0026thinsp;95% (\u003cem\u003ei\u003c/em\u003e.\u003cem\u003ee\u003c/em\u003e., \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significant).\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Increase of c-di-GMP levels by UVA in \u003cem\u003eP. aeruginosa\u003c/em\u003e\u003c/h2\u003e\u003cp\u003eIt has been previously demonstrated that exposure of planktonic cells of \u003cem\u003eP. aeruginosa\u003c/em\u003e to sublethal UVA doses induces biofilm formation [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In order to analyze the role of the second messenger c-di-GMP in this phenomenon, the possibility that UVA induces changes in c-di-GMP levels was studied by using the transcriptional fusion P\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e. The \u003cem\u003ecdrA\u003c/em\u003e gene codes for a large adhesin and its promoter is positively regulated by c-di-GMP concentration; therefore, the expression of this reporter, quantified by GFP fluorescence, serves as a biosensor for intracellular c-di-GMP content [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. The expression of P\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e was tested in cultures of PAO1 exposed to sublethal UVA radiation (irradiance 25 W\u0026middot;m\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026sup2;) for 90 min; control cultures were kept in the dark. This irradiation condition, utilized in previous studies, do not alter cell viability significantly but produces oxidative damage [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, a significant increase of fluorescence values was observed in response to the radiation for all tested times, mainly after 15 and 30 min exposure (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.005), indicating higher levels of c-di-GMP regarding to the control. It should be noted that fluorescence levels increased both in irradiated and control cultures with respect to time zero, in a similar trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Induction of cell attachment under UVA exposure\u003c/h2\u003e\u003cp\u003eIn order to correlate the UVA-promoted c-di-GMP increase with cell attachment, this parameter was investigated in an ALI-type biofilm formation system under the conditions that showed the greatest differences in the reporter assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, UVA significantly increased the number of cells attached to the glass surfaces after 15 and 30 min exposure (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Furthermore, crystal violet staining demonstrated significantly higher total biofilm mass under UVA exposure (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). These results allow us to correlate the early increase in c-di-GMP levels with greater cell adhesion by effect of UVA.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Regulation of expression of DGCs and PDEs genes by UVA\u003c/h2\u003e\u003cp\u003eWith the purpose of deepening in the mechanism of UVA-promoted increased levels of c-di-GMP, the effect of UVA on the expression of genes coding for some DGCs (PA3177, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e, \u003cem\u003ewspR\u003c/em\u003e, \u003cem\u003esiaD\u003c/em\u003e) and PDEs (\u003cem\u003ebifA\u003c/em\u003e, \u003cem\u003erbdA\u003c/em\u003e) was analyzed. These genes were chosen given their relationship with determinants of biofilm establishment and/or oxidative stress [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Planktonic PAO1 cells were grown under sublethal UVA doses (irradiance 25 W\u0026middot;m\u003csup\u003e\u0026minus;\u003c/sup\u003e\u0026sup2;) or maintained in the dark, and samples were taken after 30 min to analyze gene expression by qRT-PCR. A very significant induction in UVA-exposed cells was observed for PA3177 and \u003cem\u003eyfiN\u003c/em\u003e genes (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0005) compared to the dark controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). A lesser, but still significant increase was observed in \u003cem\u003esadC\u003c/em\u003e and \u003cem\u003ewspR\u003c/em\u003e expression (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and no changes were detected in the \u003cem\u003esiaD\u003c/em\u003e gene after UVA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Conversely, a significant reduction in the expression of \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e PDEs genes was observed in response to UVA radiation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.005, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, respectively; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). It is concluded that the UVA-promoted increase of c-di-GMP levels could obey, at least in part, to the induction of DGSs PA3177, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e and \u003cem\u003ewspR\u003c/em\u003e, and/or repression of PDEs \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.4 Role of Stringent Response (SR) and Quorum Sensing (QS) in the increase of c-di-GMP levels by UVA\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIt has been demonstrated in \u003cem\u003eP. aeruginosa\u003c/em\u003e that the induction of biofilm formation by exposure to UVA depends at first instance on the master transcriptional regulator ppGpp, the main effector of the SR [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. To investigate if c-di-GMP has a role in this pathway, the expression of the P\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e reporter and cell attachment under sublethal UVA doses were studied in a \u003cem\u003erelA\u003c/em\u003e mutant, which has very low levels of ppGpp [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, no increase of fluorescence was observed after UVA exposure in the \u003cem\u003erelA\u003c/em\u003e pP\u003csub\u003e\u003cem\u003ecdrA\u003c/em\u003e\u003c/sub\u003e::\u003cem\u003egfp\u003c/em\u003e strain, which indicates that intracellular c-di-GMP levels were not modified in response to UVA treatment. In addition, no changes were also observed between the different times, both in control and exposed cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In the same line, sublethal UVA exposure did not induce early cell attachment in the \u003cem\u003erelA\u003c/em\u003e mutant, measured as CFU cm\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e or crystal violet staining (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). To further investigate the role of ppGpp on the UVA-induced modulation of DGCs and PDEs, the \u003cem\u003erelA\u003c/em\u003e strain was grown under UVA exposure (irradiance 25 W m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e) or in the dark, and samples were taken after 30 min to study the expression of DGCs and PDEs genes as described for the wild-type. In contrast to that observed with the parental strain, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea shows that PA3177, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e, and \u003cem\u003ewspR\u003c/em\u003e genes were not up-regulated by UVA; no changes were observed in the \u003cem\u003esiaD\u003c/em\u003e gene after UVA exposure, as was seen in PAO1. On the contrary, PDEs genes \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e were significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) downregulated by UVA, as observed in the wild-type strain (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). Taken together, these results suggest that the transcriptional effector ppGpp controls the UVA-mediated up-regulation of DGCs genes PA3177, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e, and \u003cem\u003ewspR\u003c/em\u003e, with the consequent increase of c-di-GMP levels and cell attachment.\u003c/p\u003e\u003cp\u003eQS, a cell-to-cell communication system that regulates gene expression in a population-dependent manner, has also been demonstrated to be involved in UVA-induced biofilm formation, in a ppGpp-dependent way [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Therefore, the role of QS systems las and rhl in the modulation by UVA of DGCs and PDEs was also analyzed. Mutants deficient in the production of QS autoinducers 3OC12-HSL (\u003cem\u003elasI\u003c/em\u003e), C4-HSL (\u003cem\u003erhlI\u003c/em\u003e), or both (\u003cem\u003elasI rhlI\u003c/em\u003e) were grown under sublethal UVA doses (irradiance 25 W m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e) or in the dark. Samples exposed for 30 min were taken to study the expression genes coding for DGCs PA3177, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e, and \u003cem\u003ewspR\u003c/em\u003e, and PDEs \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e. Results are presented in Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea (\u003cem\u003elasI\u003c/em\u003e strain), 7b (\u003cem\u003erhl\u003c/em\u003e strain) and 7c (\u003cem\u003elasI rhlI\u003c/em\u003e strain). No induction of PA3177 was observed in the three QS mutants by the UVA treatment. \u003cem\u003eyfinN\u003c/em\u003e was only induced by UVA in the \u003cem\u003elasI\u003c/em\u003e strain (but at lesser extent compared to the wild-type), suggesting low and strong dependence on las and rhl systems, respectively. The regulation of \u003cem\u003esadC\u003c/em\u003e appears to depend on the las system, as gene induction by UVA was observed only in the \u003cem\u003erhlI\u003c/em\u003e strain. Induction of \u003cem\u003ewspR\u003c/em\u003e by UVA seems independent of QS regulation. Expression of genes coding for \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e followed the same pattern of the wild-type and \u003cem\u003erelA\u003c/em\u003e strains, that is, they were down-regulated by UVA (data not shown). It was also observed that early cell attachment was not induced in QS mutants after 15 and 30 min of UVA exposure (data not shown).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.5 High levels of c-di-GMP confer resistance to lethal UVA doses\u003c/h2\u003e\u003cp\u003eFinally, the role of c-di-GMP in the defense against lethal UVA doses was analyzed, both in planktonic cells and biofilms. To this end, the wild-type strain and two derivatives with regulatable levels of c-di-GMP, PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e and PAO1 \u003cem\u003erbdA\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e, were exposed to lethal UVA doses and survival fractions were evaluated. c-di-GMP levels in PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e and PAO1 \u003cem\u003erbdA\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e were controlled by arabinose, allowing a tight control of target gene expression in response to this inductor. In the presence of arabinose, PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e presents high c-di-GMP levels (25 to 1850 pg/mg of protein) while PAO1 \u003cem\u003erbdA\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e presents low c-di-GMP levels (8 to 15 pg/mg of protein), smaller than the wild-type [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eStationary-phase planktonic cells grown with or without 0.3% arabinose were exposed to UVA (irradiance 20 W m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e) or maintained in the dark for 240 min, and survival was evaluated. A similar decrease was observed during the first 120 min of exposure for all tested strains, but after 180 and 240 min, the PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e strain grown with arabinose exhibited a significantly increased survival compared to the other strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea). A similar result was observed for 24 h-mature biofilms (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). Biofilms of PAO1 \u003cem\u003eyfiN\u003c/em\u003e\u003csup\u003eind\u003c/sup\u003e grown with arabinose showed significantly higher survival regarding to those grown in the absence of this compound (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). Control samples of planktonic cells and biofilms maintained in the dark did not show changes throughout the experiment (data not shown). These results indicate that high c-di-GMP levels could protect \u003cem\u003eP. aeruginosa\u003c/em\u003e planktonic cells and biofilms from lethal doses of UVA.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eSeveral external stimuli, including white light, nitric oxide, nutrients, iron, and oxidative stress, have been demonstrated to modulate c-di-GMP levels in bacteria, and specific DGCs and PDEs involved in these responses have been identified [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan additionalcitationids=\"CR65 CR66 CR67 CR68\" citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. To date, the effect of UVA radiation on c-di-GMP regulation has not been reported. Here, we present novel evidence demonstrating that UVA exposure increases intracellular c-di-GMP levels in \u003cem\u003eP. aeruginosa\u003c/em\u003e. The increase in c-di-GMP levels is accompanied by an enhanced cell attachment at low UVA total doses, thereby suggesting its adaptive function within the physiological framework of this bacterium. UVA-induced cell attachment was previously reported at longer time intervals compared to those used in this study, and this effect demonstrated to be dependent on increased levels of Pel and Psl exopolysaccharides [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Operons coding for \u003cem\u003epel\u003c/em\u003e and \u003cem\u003epsl\u003c/em\u003e are modulated at the transcriptional level by several systems, with c-di-GMP being one of the main regulators of their expression [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. Then, the rise of c-di-GMP levels by UVA could result in increased Pel and Psl levels, and, in turn, promote cell attachment. Pel and Psl have been described as the predominant exopolysaccharides in \u003cem\u003eP. aeruginosa\u003c/em\u003e biofilms, being critical for the initial cell attachment and in the maintenance of cell-cell interactions [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. This adaptive mechanism could help the bacteria quickly respond to UVA stress by reinforcing biofilm formation, thereby improving their survival under adverse environmental conditions (Pezzoni et al 2014).\u003c/p\u003e\u003cp\u003eAs reported by Eilers et al. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], the overall levels of c-di-GMP in \u003cem\u003eP. aeruginosa\u003c/em\u003e are the result of the activity of enzymes encoded by 41 putative DGCs and PDEs genes, each one responding to specific (and, in many cases, unknown) environmental conditions. It was demonstrated in the referred study that although most of 41 deletion mutants for individual DGCs or PDEs show a distinctive phenotype with regard to cell attachment and biofilm architecture, they presented limited changes in c-di-GMP levels. Then, an environmental stimulus such as UVA radiation, which is able to significantly change c-di-GMP concentrations, could control several and/or specific DGCs and/or PDEs in a concerted response. To investigate this subject in greater depth, the role of UVA on the expression of some key genes involved in the synthesis and degradation of this molecule was analyzed. It was demonstrated here that UVA exposure triggered the up-regulation of DGCs genes PA3177, \u003cem\u003eyfiN\u003c/em\u003e, \u003cem\u003esadC\u003c/em\u003e, and \u003cem\u003ewspR\u003c/em\u003e, whereas PDEs genes \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e were down-regulated, suggesting a regulatory shift toward enhanced biofilm formation. The four genes encoding UVA-regulated DGCs were demonstrated to be upregulated by oxidative stress agents [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e, \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. PA3177 and \u003cem\u003eyfiN\u003c/em\u003e displayed the highest levels of induction, with 50-fold and 60-fold increases, respectively, under the experimental conditions. Strempel et al. [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] reported that PA3177 is induced by hypochlorite, a host defense compound and commonly used disinfectant. This induction is accompanied by enhancement of initial cell attachment and a strong increase in c-di-GMP levels, with Pel and Psl exopolysaccharides acting as the effectors in this PA1377-regulated network. Strikingly, PA1377 is not part of a general response to oxidative stress since no induction is observed in the presence of hydrogen peroxide or paraquat [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], suggesting that hypochlorite and UV radiation share similar mechanistic features in their mode of action that distinguish them from other oxidative stress-inducing agents. Katharios et al. [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e] showed that \u003cem\u003eyfiN\u003c/em\u003e activity is linked to oxidative damage affecting the cell envelope, a phenomenon also observed with UVA exposure [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. As described for PA3177, Pel and Psl polysaccharides are effectors of \u003cem\u003eyfiN\u003c/em\u003e, and resistance to macrophage phagocytosis depends on the action of these exopolysaccharides [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eA protective role of c-di-GMP from lethal UVA radiation, both in planktonic and biofilm cells, is reported in this study. Participation of c-di-GMP on bacterial resistance to nutrient stress, antibiotics, detergents, toxic compounds and oxidative stress has been reported in different bacteria [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The role of c-di-GMP in the bacterial response to stressful conditions has been usually attributed to its function in the transition from planktonic to biofilm state. Biofilm cells exhibit increased resistance to a wide range of stress-inducing agents than their planktonic counterparts [\u003cspan additionalcitationids=\"CR5 CR6 CR7 CR8\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. However, there are evidences suggesting that c-di-GMP can promote resistance to lethal agents by regulating the expression of specific defensive effectors, for example, \u003cem\u003ekatB\u003c/em\u003e and \u003cem\u003ekatE\u003c/em\u003e catalase genes, involved in antioxidative responses [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. In this way, it is particularly interesting the result observed in free-living cells, since the biofilm matrix is not acting as a physical barrier limiting the penetration of radiation, thereby protecting the underlying bacterial cells. As suggested for UVA-induced cell attachment, a c-di-GMP-dependent increase of Pel and/or Psl levels could be also responsible for the protection from lethal UVA. The involvement of these polysaccharides in the defense against oxidative stress was confirmed by the response of \u003cem\u003epel\u003c/em\u003e and \u003cem\u003epsl\u003c/em\u003e mutants exposed to lethal doses of UVA, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and sodium hypochlorite [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. It was proposed that Psl could act as a barrier reducing ROS penetration across bacterial membranes, enhancing survival capabilities [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] and several studies show a relevant role for Pel against different oxidative agents [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. Alternatively, Pel and/or Psl could act as shields, absorbing or deviating the radiation and preventing photons from reaching cellular targets [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe versatility of \u003cem\u003eP. aeruginosa\u003c/em\u003e obeys to a complex regulatory network which allows it to adapt to stressful conditions by precisely regulating its gene expression. In this regard, the intricate interactions between the Stringent Response, QS and c-di-GMP play crucial roles in regulating bacterial stress responses, biofilm formation, and virulence [\u003cspan additionalcitationids=\"CR80 CR81\" citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e]. Attempting to link the findings related to adaptive responses to UVA in \u003cem\u003eP. aeruginosa\u003c/em\u003e, a pathway that connects this radiation to the sequential activation of the Stringent Response, Quorum Sensing and biofilm formation was previously outlined [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Briefly, exposure of planktonic cells to sublethal UVA doses produces elevated ppGpp levels able to induce the expression of QS regulatory genes [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]. In turn, QS activation promotes the transcription of \u003cem\u003epel, psl and alg\u003c/em\u003e operons coding for enzymes responsible for the biosynthesis of biofilm matrix exopolysaccharides Pel, Psl and alginate [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The most significant physiological response of this pathway could be the enhancement of biofilm formation, but additional adaptive responses as higher resistance to subsequent lethal doses of UVA, hydrogen peroxide, and hypochlorite attributable to the induction of other defensive systems than biofilm formation were also observed [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The findings presented in this study support the incorporation of the c-di-GMP signaling pathway into this model (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). The induction of most of the analyzed genes coding for DGCs (PA3177, \u003cem\u003eyfiN\u003c/em\u003e, and \u003cem\u003esadC\u003c/em\u003e) appears to be dependent on the ppGpp-QS pathway, while \u003cem\u003ewspR\u003c/em\u003e seems to rely exclusively on the Stringent Response. Conversely, the UVA-repressed genes \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e do not seem to be integrated into the UVA-ppGpp-QS pathway and its sole repression by UVA would not be sufficient for c-di-GMP increase and induction of cell adhesion, as observed in the case of the \u003cem\u003erelA\u003c/em\u003e mutant (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Then, coordinated regulation of biofilm-related genes through these signaling pathways would allow \u003cem\u003eP. aeruginosa\u003c/em\u003e to quickly respond to UVA stress by starting biofilm formation and activating other protective mechanisms.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe high susceptibility of \u003cem\u003eP. aeruginosa\u003c/em\u003e to UVA radiation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] carries significant implications for environmental ecology, as well as for sectors including healthcare systems and industrial processes. This study is particularly relevant as it investigates the impact of UVA exposure on adaptive responses, an important issue when the use of this radiation is proposed as a potential adjunctive approach to overcome the intrinsic or/and acquired resistance mechanisms of \u003cem\u003eP. aeruginosa\u003c/em\u003e against conventional antimicrobial agents.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eALI \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Air liquid interface\u003c/p\u003e\n\u003cp\u003ec-di-GMP \u0026nbsp; \u0026nbsp;\u0026nbsp;bis-(3\u0026apos;,5\u0026apos;)-cyclic dimeric guanosine monophosphate\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCFU \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Colony \u0026nbsp;forming units\u003c/p\u003e\n\u003cp\u003eDGCs \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Diguanilate ciclases\u003c/p\u003e\n\u003cp\u003eGFP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Green fluorescent protein\u003c/p\u003e\n\u003cp\u003eLB \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Luria-Bertani\u003c/p\u003e\n\u003cp\u003ePDEs \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Phosphodiesterases\u003c/p\u003e\n\u003cp\u003eppGpp \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Guanosine tetraphosphate\u003c/p\u003e\n\u003cp\u003eqRT-PCR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Quantitative real time PCR\u003c/p\u003e\n\u003cp\u003eQS \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Quorum sensing\u003c/p\u003e\n\u003cp\u003eROS \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Reactive oxygen species\u003c/p\u003e\n\u003cp\u003eSR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Stringent response\u003c/p\u003e\n\u003cp\u003eUVA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Ultraviolet-A\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003cp\u003eThe authors have no relevant financial or nonfinancial interests to disclose.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eFinancial support for this research was received from the Comisi\u0026oacute;n Nacional de Energ\u0026iacute;a At\u0026oacute;mica, and the Consejo Nacional de Investigaciones Cient\u0026iacute;ficas y T\u0026eacute;cnicas (PIP 11220200100710), Argentina\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eC.R. and L.P.S : Formal analysis and methodology. C.S.C : Formal analysis, investigation, supervision, visualization, writing (original draft, review and editing). M. P.: Conceptualization, formal analysis, funding acquisition, investigation, methodology, project administration, validation, visualization, writing (original draft, review and editing).\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe excellent technical assistance of Ms. P. Pereyra Schuth (Comisi\u0026oacute;n Nacional de Energ\u0026iacute;a At\u0026oacute;mica, Argentina) is gratefully acknowledged. We thank Dr. Peter Greenberg for providing the QS mutants, Dr. Livia Leoni and Alessandra Fortuna for providing the PAO1 yfiNind and PAO1 rbd ind strains, and Dr. Morten Rybtke for providing the pPcdrA::gfp reporter. M.P. is career researcher at Consejo Nacional de Investigaciones Cient\u0026iacute;ficas y T\u0026eacute;cnicas, Argentina.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eQin, S., Xiao, W., Zhou, C., Pu, Q., Deng, X., Lan, L., Liang, H., Song, X., \u0026amp; Wu, M. (2022). \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. \u003cem\u003eSignal Transduction and Targeted Therapy\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(1):199. doi: 10.1038/s41392-022-01056-1\u003c/li\u003e\n\u003cli\u003eHardalo, C., \u0026amp; Edberg, S. C. (1997). \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: assessment of risk from drinking water. \u003cem\u003eCritical Reviews in Microbiology, 23\u003c/em\u003e(1), 47-75. doi: 10.3109/10408419709115130\u003c/li\u003e\n\u003cli\u003eDavid, A., Tahrioui, A., Tareau, A. S., Forge, A., Gonzalez, M., Bouffartigues, E., Lesouhaitier, O., \u0026amp; Chevalier, S. (2024). \u003cem\u003ePseudomonas aeruginosa \u003c/em\u003ebiofilm lifecycle: involvement of mechanical constraints and timeline of matrix production. \u003cem\u003eAntibiotics\u003c/em\u003e\u003cem\u003e(Basel)\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(8):688. doi: 10.3390/antibiotics13080688 \u003c/li\u003e\n\u003cli\u003eOphir, T., \u0026amp; Gutnick, D. L. (1994). A role for exopolysaccharides in the protection of microorganisms from desiccation. \u003cem\u003eApplied and Environmental Microbiology\u003c/em\u003e, \u003cem\u003e60\u003c/em\u003e(2), 740-745. doi: 10.1128/aem.60.2.740-745.1994\u003c/li\u003e\n\u003cli\u003eStewart, P. S., \u0026amp; Costerton, J. W. (2001). Antibiotic resistance of bacteria in biofilms. \u003cem\u003eLancet, \u003c/em\u003e\u003cem\u003e358\u003c/em\u003e(9276), 135-138. doi: 10.1016/s0140-6736(01)05321-1 \u003c/li\u003e\n\u003cli\u003eStoodley, P., Sauer, K., Davies, D. G., \u0026amp; Costerton, J. W. (2002). Biofilms as complex differentiated communities. \u003cem\u003eAnnual Review of Microbiology, 56\u003c/em\u003e, 187-209. doi: 10.1146/annurev.micro.56.012302.160705 \u003c/li\u003e\n\u003cli\u003eDrenkard, E. (2003). Antimicrobial resistance of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e biofilms. \u003cem\u003eMicrobes and Infection\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(13), 1213-1219. doi: 10.1016/j.micinf.2003.08.009\u003c/li\u003e\n\u003cli\u003eHarrison, J. J., Turner, R. J., \u0026amp; Ceri, H. (2005). Persister cells, the biofilm matrix and tolerance to metal cations in biofilm and planktonic \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eEnvironmental Microbiology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(7), 981-994. doi: 10.1111/j.1462-2920.2005.00777.x\u003c/li\u003e\n\u003cli\u003eFlemming, H. C., \u0026amp; Wingender, J. (2010). The biofilm matrix. \u003cem\u003eNature Reviews Microbiology\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(9), 623-633. doi: 10.1038/nrmicro2415\u003c/li\u003e\n\u003cli\u003eValentini, M., \u0026amp; Filloux, A. (2016). Biofilms and cyclic di-GMP (c-di-GMP) signaling: lessons from \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e and other bacteria. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, \u003cem\u003e291\u003c/em\u003e(24), 12547-12555. doi: 10.1074/jbc.R115.711507\u003c/li\u003e\n\u003cli\u003eR\u0026ouml;mling, U., Galperin, M. Y., \u0026amp; Gomelsky, M. (2013). Cyclic di-GMP: the first 25 years of a universal bacterial second messenger. \u003cem\u003eMicrobiology and Molecular Biology Reviews\u003c/em\u003e, \u003cem\u003e77\u003c/em\u003e(1), 1-52. doi: 10.1128/MMBR.00043-12 \u003c/li\u003e\n\u003cli\u003eHengge, R. (2009). Principles of c-di-GMP signalling in bacteria. \u003cem\u003eNature\u003c/em\u003e\u003cem\u003eReviews Microbiology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(4), 263\u0026ndash;273. doi:10.1038/nrmicro2109\u003c/li\u003e\n\u003cli\u003eEilers, K., Kuok Hoong Yam, J., Morton, R., Mei Hui Yong, A., Brizuela, J., Hadjicharalambous, C., Liu, X., Givskov, M., Rice, S. A., \u0026amp; Filloux, A. (2022). Phenotypic and integrated analysis of a comprehensive \u003cem\u003ePseudomonas aeruginosa \u003c/em\u003ePAO1 library of mutants lacking cyclic-di-GMP-related genes. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e:949597. doi: 10.3389/fmicb.2022.949597\u003c/li\u003e\n\u003cli\u003eValentini, M., \u0026amp; Filloux, A. (2019). Multiple roles of c-di-GMP signaling in bacterial pathogenesis. \u003cem\u003eAnnual Review of Microbiology\u003c/em\u003e, 8(73), 387-406. doi: 10.1146/annurev-micro-020518-115555 \u003c/li\u003e\n\u003cli\u003eJenal, U., Reinders, A., \u0026amp; Lori, C. (2017). Cyclic di-GMP: second messenger extraordinaire. \u003cem\u003eNature Reviews Microbiology\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(5), 271-284. doi: 10.1038/nrmicro.2016.190\u003c/li\u003e\n\u003cli\u003eWang, Z., Song, L., Liu, X., Shen, X., \u0026amp; Li, X. (2023). Bacterial second messenger c-di-GMP: emerging functions in stress resistance. \u003cem\u003eMicrobiological Research\u003c/em\u003e, 268:127302. doi: 10.1016/j.micres.2023.127302 \u003c/li\u003e\n\u003cli\u003eWebb, R.B. (1977). Lethal and mutagenic effects of near-ultraviolet radiation. \u003cem\u003ePhotochemical and Photobiological Reviews\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e, 169-261\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez, R. O., \u0026amp; Pizarro, R. A. (1996). Lethal effect induced in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e exposed to ultraviolet-A radiation. \u003cem\u003ePhotochemistry and Photobiology\u003c/em\u003e, \u003cem\u003e64\u003c/em\u003e(2), 334-339. doi: 10.1111/j.1751-1097.1996.tb02467.x\u003c/li\u003e\n\u003cli\u003eChamberlain, J., \u0026amp; and Moss, S. H. (1987). Lipid peroxidation and other membrane damage produced in \u003cem\u003eEscherichia coli K1060 \u003c/em\u003eby near-UV radiation and deuterium oxide. \u003cem\u003ePhotochemistry and Photobiology\u003c/em\u003e,\u003cem\u003e 45\u003c/em\u003e(5), 625-630. doi: 10.1111/j.1751-1097.1987.tb07389.x \u003c/li\u003e\n\u003cli\u003eHu, M. L., \u0026amp; Tappel, A. L. (1992). Potentiation of oxidative damage to proteins by ultraviolet A and protection by antioxidants. \u003cem\u003ePhotochemistry and Photobiology,\u003c/em\u003e\u003cem\u003e56\u003c/em\u003e(3), 357-363. doi: 10.1111/j.1751-1097.1992.tb02171.x\u003c/li\u003e\n\u003cli\u003eBosshard, F., Bucheli, M., Meur, Y., \u0026amp; Egli, T. (2010). The respiratory chain is the cell\u0026apos;s Achilles\u0026apos; heel during UVA inactivation in \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eMicrobiology\u003c/em\u003e, \u003cem\u003e156\u003c/em\u003e(Pt 7), 2006-2015. doi: 10.1099/mic.0.038471-0 \u003c/li\u003e\n\u003cli\u003eGirard, P. M., Francesconi, S., Pozzebon, M., Graindorge, D., Rochette, P., Drouin, R. \u0026amp; Sage, E. (2011). UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes \u003cem\u003eJournal of. Physics: Conference Series\u003c/em\u003e, \u003cem\u003e261\u003c/em\u003e(1):012002 doi:10.1088/1742-6596/261/1/012002\u003c/li\u003e\n\u003cli\u003eBa\u0026uuml;mler, W., Regensburger, J., Knak, A., Felgentr\u0026auml;ger, A., \u0026amp; Maisch, T. (2012). UVA and endogenous photosensitizers- the detection of singlet oxygen by its luminescence. \u003cem\u003ePhotochemistry and Photobiological Sciences, 11\u003c/em\u003e, 107-117. doi.org/10.1039/C1PP05142C\u003c/li\u003e\n\u003cli\u003ePezzoni, M., Meichtry, M., Pizarro R. A., \u0026amp; Costa C. S. (2015). Role of the Pseudomonas quinolone signal (PQS) in sensitizing \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e to UVA radiation. \u003cem\u003eJournal of Photochemistry and Photobiology B: Biology,\u003c/em\u003e\u003cem\u003e142\u003c/em\u003e, 129-140. doi: 10.1016/j.jphotobiol.2014.11.014\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eWegelin, M., Canonica, S., Mechsner, K., Fleischmann, T., Pesaro F., \u0026amp; Metzler, A.\u003c/strong\u003e (1994). Solar water disinfection: scope of the process and analysis of radiation experiments. \u003cem\u003eJournal of Water Supply: Research and Technology- AQUA\u003c/em\u003e,\u003cem\u003e \u003c/em\u003e\u003cem\u003e43\u003c/em\u003e, 154-169.\u003c/li\u003e\n\u003cli\u003eBlanco-Galvez, J., Fern\u0026aacute;ndez-Ib\u0026aacute;\u0026ntilde;ez, P., \u0026amp; Malato-Rodr\u0026iacute;guez, S. (2007). Solar photocatalytic detoxification and disinfection of water: recent overview. \u003cem\u003eJournal of Solar Energy Engineering\u003c/em\u003e,\u003cem\u003e 129\u003c/em\u003e(1). doi.org/10.1115/1.2390948\u003c/li\u003e\n\u003cli\u003eGamage, J., \u0026amp; Zhang, Z. (2010). Applications of photocatalytic disinfection. \u003cem\u003eInternational Journal of Photoenergy\u003c/em\u003e, \u003cem\u003e2010\u003c/em\u003e\u003cem\u003e. \u003c/em\u003edoi.org/10.1155/2010/764870\u003c/li\u003e\n\u003cli\u003eRezaie, A., Leite, G. G. S., Melmed, G. Y., Mathur, R., Villanueva-Millan, M. J., Parodi, G., Sin, J., Germano, J. F., Morales, W., Weitsman, S., Kim S. Y., Park, J. H., Sakhaie, S., \u0026amp; Pimentel, M. (2020). \u003cstrong\u003eUltraviolet A light effectively reduces bacteria and viruses including coronavirus\u003c/strong\u003e. \u003cem\u003ePLoS One\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(7), e0236199. doi.org/10.1371/journal.pone.0236199. Erratum in: PLoS One (2020), \u003cem\u003e15\u003c/em\u003e(8), e0237782.\u003c/li\u003e\n\u003cli\u003eYiyu, O., \u0026amp; Petersen, P. M. (2021). Application of ultraviolet light sources for in vivo disinfection, \u003cem\u003eJapanese Journal of Applied Physics\u003c/em\u003e, \u003cem\u003e60\u003c/em\u003e(10), 100501. doi.org/10.35848/1347-4065/ac1f47.\u003c/li\u003e\n\u003cli\u003ePizarro, R. A. (1995.) UVA oxidative damage modified by environmental conditions in \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eInternational Journal of Radiation Biology\u003c/em\u003e, \u003cem\u003e68\u003c/em\u003e(3), 293-299. doi: 10.1080/09553009514551221\u003c/li\u003e\n\u003cli\u003eJagger, J. (1981). Near UV radiation effects on microorganisms. \u003cem\u003ePhotochemistry and Photobiology, \u003c/em\u003e\u003cem\u003e34\u003c/em\u003e(6), 761-768. PMID: 7031713\u003c/li\u003e\n\u003cli\u003eRamabhadran, T. V., \u0026amp; Jagger, J. (1976) Mechanism of growth delay induced in \u003cem\u003eEscherichia coli\u003c/em\u003e by near ultraviolet radiation. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e\u003cem\u003e of the United States of America\u003c/em\u003e, \u003cem\u003e73\u003c/em\u003e(1), 59-63. doi: 10.1073/pnas.73.1.59\u003c/li\u003e\n\u003cli\u003eFavre, A., Hajnsdorf, E., Thiam, K., \u0026amp; Caldeira de Araujo, A. (1985). Mutagenesis and growth delay induced in \u003cem\u003eEscherichia coli\u003c/em\u003e by near-ultraviolet radiations. \u003cem\u003eBiochimie\u003c/em\u003e, \u003cem\u003e67\u003c/em\u003e(3-4), 335-342. doi: 10.1016/s0300-9084(85)80076-6\u003c/li\u003e\n\u003cli\u003eKramer, G. F., Baker, J. C., \u0026amp; Ames, B. N. (1988) Near-UV stress in \u003cem\u003eSalmonella typhimurium\u003c/em\u003e: 4-thiouridine in tRNA, ppGpp, and ApppGpp as components of an adaptive response. \u003cem\u003eJournal of Bacteriology\u003c/em\u003e, \u003cem\u003e170\u003c/em\u003e(5), 2344-2351. doi: 10.1128/jb.170.5.2344-2351.1988 \u003c/li\u003e\n\u003cli\u003eCaldeira de Araujo, A., \u0026amp; Favre, A. (1986). Near ultraviolet DNA damage induce the SOS response in \u003cem\u003eEscherichia coli. \u003c/em\u003e\u003cem\u003e EMBO Journal\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(1), 1795-1799. doi.org/10.1002/j.1460-2075.1986.tb04193.x \u003c/li\u003e\n\u003cli\u003eHoerter, J. D., Arnold, A. A., Kuczynska, D. A., Shibuya, A., Ward, C. S., Sauer, M. G., Gizachew, A., Hotchkiss, T. M., Fleming, T. J., \u0026amp; Johnson, S. (2005). Effects of sublethal UVA irradiation on activity levels of oxidative defense enzymes and protein oxidation in \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eJournal of Photochemistry and Photobiology B: Biology\u003c/em\u003e, \u003cem\u003e81\u003c/em\u003e(3), 171-180. doi: 10.1016/j.jphotobiol.2005.07.005\u003c/li\u003e\n\u003cli\u003eQiu, X., Sundin, G. W., Wu, L., Zhou, J., \u0026amp; Tiedje, J. M.(2005). Comparative analysis of differentially expressed genes in \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1 following exposure to UVC, UVB, and UVA radiation. \u003cem\u003eJournal of Bacteriology\u003c/em\u003e, \u003cem\u003e187\u003c/em\u003e(10), 3556-3564. doi.org/10.1128/JB.187.10.3556-3564.2005 \u003c/li\u003e\n\u003cli\u003eBerney, M., Weilenmann, H. U., \u0026amp; Egli, T. (2006). Gene expression of \u003cem\u003eEscherichia coli\u003c/em\u003e in continuous culture during adaptation to artificial sunlight. \u003cem\u003eEnvironmental Microbiology\u003c/em\u003e, \u003cem\u003e8(9)\u003c/em\u003e, 1635-1647. https://doi.org/10.1111/j.1462-2920.2006.01057.x. \u003c/li\u003e\n\u003cli\u003eMcClary, J. S., \u0026amp; Boehm, A. B. (2018). Transcriptional response of \u003cem\u003eStaphylococcus aureus \u003c/em\u003eto sunlight in oxic and anoxic conditions. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e, 249. doi.org/10.3389/fmicb.2018.00249 \u003c/li\u003e\n\u003cli\u003ePezzoni, M., Tribelli, P. M., Pizarro, R. A., Lopez, N. I., \u0026amp; Costa, C. S. (2016). Exposure to low UVA doses increases KatA and KatB catalase activities, and confers cross-protection against subsequent oxidative injuries in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eMicrobiology\u003c/em\u003e, \u003cem\u003e162\u003c/em\u003e(5), 855-864. doi: 10.1099/mic.0.000268\u003c/li\u003e\n\u003cli\u003ePezzoni, M., Pizarro, R. A., \u0026amp; Costa, C. S. (2018). Exposure to low doses of UVA increases biofilm formation in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eBiofouling\u003c/em\u003e, \u003cem\u003e34\u003c/em\u003e(6), 673-684. doi: 10.1080/08927014.2018.1480758 \u003c/li\u003e\n\u003cli\u003ePezzoni, M., De Troch, M., Pizarro, R. A. \u0026amp; Costa, C. S. (2021). Homeophasic adaptation in response to UVA radiation in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: changes of membrane fatty Acid composition and induction of \u003cem\u003edesA\u003c/em\u003e and \u003cem\u003edesB e\u003c/em\u003expression. \u003cem\u003ePhotochemistry and Photobiology\u003c/em\u003e, \u003cem\u003e98\u003c/em\u003e(4), 886-893. doi: 10.1111/php.13548\u003c/li\u003e\n\u003cli\u003ePezzoni, M., Lemos, M., Pizarro, R. A., \u0026amp; Costa, C. S. (2022). UVA as environmental signal for alginate production in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: role of this polysaccharide in the protection of planktonic cells and biofilms against lethal UVA doses. \u003cem\u003ePhotochemistry \u0026amp; Photobiological Sciences\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e(8), 1459-1472. doi.org/10.1007/s43630-022-00236-w\u003c/li\u003e\n\u003cli\u003eGrossich, R., Lemos Vilches, M., Costa, C. S., \u0026amp; Pezzoni, M. (2023). Role of Pel and Psl polysaccharides in the response of \u003cem\u003ePseudomonas aeruginosa \u003c/em\u003eto environmental challenges: oxidative stress agents (UVA, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, sodium hypochlorite) and its competitor \u003cem\u003eStaphylococcus aureus.\u003c/em\u003e\u003cem\u003eMicrobiology\u003c/em\u003e, \u003cem\u003e169(\u003c/em\u003e2\u003cem\u003e),\u003c/em\u003e 001301. doi.org/10.1099/mic.0.001301\u003c/li\u003e\n\u003cli\u003eRicardi, M. M., Tribelli, P. M., Costa, C. S. \u0026amp; Pezzoni, M. (2024). Global transcriptional response of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e to UVA radiation. \u003cem\u003ePhotochemical and Photobiological Sciences,\u003c/em\u003e\u003cem\u003e23\u003c/em\u003e(11), 2029-2044. doi: 10.1007/s43630-024-00649-9 \u003c/li\u003e\n\u003cli\u003ePezzoni, M., Pizarro, R. A. \u0026amp; Costa, C. S. (2020). Role of quorum sensing in UVA-induced biofilm formation in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eMicrobiology\u003c/em\u003e, \u003cem\u003e166\u003c/em\u003e(8), 735-750. doi: 10.1099/mic.0.000932\u003c/li\u003e\n\u003cli\u003eLee, V. T., Matewish, J. M., Kessler, J. L., Hyodo, M., Hayakawa, Y. \u0026amp; Lory, S. (2007). A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. \u003cem\u003eMolecular Microbiology\u003c/em\u003e, \u003cem\u003e65\u003c/em\u003e(6), 1474-1484. doi: 10.1111/j.1365-2958.2007.05879.x\u003c/li\u003e\n\u003cli\u003eIrie, Y., Borlee, B. R., O\u0026apos;Connor, J. R., Hill, P. J., Harwood, C. S., Wozniak, D. J. \u0026amp; Parsek, M. R. (2012). Self-produced exopolysaccharide is a signal that stimulates biofilm formation in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e, \u003cem\u003e109\u003c/em\u003e(50), 20632-20636. doi: 10.1073/pnas.1217993109\u003c/li\u003e\n\u003cli\u003eChua, S. L., Ding, Y., Liu, Y., Cai, Z., Zhou, J., Swarup, S., Drautz-Moses, D. I., Schuster, S. C., Kjelleberg, S., Givskov, M. \u0026amp; Yang, L. (2016). Reactive oxygen species drive evolution of pro-biofilm variants in pathogens by modulating cyclic-di-GMP levels. \u003cem\u003eOpen Biology\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(11), 160162. doi: 10.1098/rsob.160162\u003c/li\u003e\n\u003cli\u003eStrempel, N., Nusser, M., Neidig, A., Brenner-Weiss, G., \u0026amp; Overhage, J. (2017). The oxidative stress agent hypochlorite stimulates c-di-GMP synthesis and biofilm formation in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. Frontiers in Microbiology, \u003cem\u003e8\u003c/em\u003e, 2311. doi: 10.3389/fmicb.2017.02311\u003c/li\u003e\n\u003cli\u003eXu, A., Zhang, X., Wang, T., Xin, F., Ma, L. Z., Zhou, J., Dong, W., \u0026amp; Jiang, M. (2021). Rugose small colony variant and its hyper-biofilm in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: Adaption, evolution, and biotechnological potential. \u003cem\u003eBiotechnology Advances\u003c/em\u003e, \u003cem\u003e53\u003c/em\u003e, 107862, doi.org/10.1016/j.biotechadv.2021.107862\u003c/li\u003e\n\u003cli\u003eHolloway, B. W. (1955). Genetic recombination in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eJournal of General Microbiology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(3), 572-581. doi: 10.1099/00221287-13-3-572\u003c/li\u003e\n\u003cli\u003eJacobs, M. A., Alwood, A., Thaipisuttikul, I., Spencer, D., Haugen, E., Ernst, S., Will, O., Kaul, R., Raymond, C., Levy, R., Chun-Rong, L., Guenthner, D., Bovee, D., Olson, M. V., \u0026amp; Manoil, C. (2003). Comprehensive transposon mutant library of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e\u003cem\u003e of the United States of America\u003c/em\u003e, \u003cem\u003e100\u003c/em\u003e(24), 14339-14344. doi: 10.1073/pnas.2036282100. 100: 14339-14344\u003c/li\u003e\n\u003cli\u003ePearson, J. P., Pesci, E. C., Iglewski, B. H. (1997). Roles of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e\u003cem\u003ela\u003c/em\u003es and \u003cem\u003erhl \u003c/em\u003equorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes. \u003cem\u003eJournal of Bacteriology, \u003c/em\u003e\u003cem\u003e179(\u003c/em\u003e18):5756-5767. doi: 10.1128/jb.179.18.5756-5767.1997. 179: 5756-67\u003c/li\u003e\n\u003cli\u003eBrint, J. M., \u0026amp; Ohman, E. E. (1995). Synthesis of multiple exoproducts in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxR-LuxI family. \u003cem\u003eJournal of Bacteriology\u003c/em\u003e, \u003cem\u003e177\u003c/em\u003e(24), 7155-7163. doi: 10.1128/jb.177.24.7155-7163.1995\u003c/li\u003e\n\u003cli\u003ePawar, S. V., Messina, M., Rinaldo, S., Cutruzzol\u0026agrave;, F., Kaever, V., Rampioni, G., \u0026amp; Leoni, L. (2016). Novel genetic tools to tackle c-di-GMP-dependent signalling in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eJournal of Applied Microbiology\u003c/em\u003e, \u003cem\u003e120\u003c/em\u003e(1), 205-217. doi: 10.1111/jam.12984. \u003c/li\u003e\n\u003cli\u003eRybtke, M. T., Borlee, B. R., Murakami, K., Irie, Y., Hentzer, M., Nielsen, T. E., Givskov, M., Parsek, M. R., \u0026amp; Tolker-Nielsen, T. (2012), Fluorescence-based reporter for gauging cyclic di-GMP levels in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eApplied and Environmental Microbiology\u003c/em\u003e, 78(15), 5060-5069. doi: 10.1128/AEM.00414-12 \u003c/li\u003e\n\u003cli\u003eBrautaset, T., Lale, R. \u0026amp; Valla, S. (2009). Positively regulated bacterial expression systems. \u003cem\u003eMicrobial Biotechnology\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e(1), 15-30. doi: 10.1111/j.1751-7915.2008.00048.x\u003c/li\u003e\n\u003cli\u003ePoudyal, B., \u0026amp; Sauer, K. (2018). (2018). The PA3177 gene encodes an active diguanylate cyclase that contributes to biofilm antimicrobial tolerance but not biofilm formation by \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. Antimicrobial Agents and Chemotherapy, \u003cem\u003e62\u003c/em\u003e(10), e01049-18. doi: 10.1128/AAC.01049-18\u003c/li\u003e\n\u003cli\u003eColley, B., Dederer, V., Carnell, M., Kjelleberg, S., Rice, S. A., \u0026amp; Klebensberger, J. (2016). SiaA/D interconnects c-di-GMP and RsmA signaling to coordinate cellular aggregation of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e in response to environmental conditions. \u003cem\u003eFrontiers in Microbiology\u003c/em\u003e, 7:179, doi: 10.3389/fmicb.2016.00179 \u003c/li\u003e\n\u003cli\u003eLarionov, A., Krause, A. \u0026amp; Miller, W. (2005). A standard curve based method for relative real time PCR data processing. \u003cem\u003eBMC Bioinformatics\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e:62, doi: 10.1186/1471-2105-6-62\u003c/li\u003e\n\u003cli\u003ePestrak, M. J., \u0026amp; Wozniak, D. J. (2020). Regulation of Cyclic di-GMP signaling in Pseudomonas aeruginosa. In \u003cem\u003eMicrobial Cyclic Di-Nucleotide Signaling \u003c/em\u003e(pp. 471-486). Springer International Publishing. doi.org/10.1007/978-3-030-33308-9_28\u003c/li\u003e\n\u003cli\u003eErickson, D. L., Lines, J. L., Pesci, E. C., Venturi, V., \u0026amp; Storey, D. G. (2004). \u003cem\u003ePseudomonas aeruginosa relA\u003c/em\u003e contributes to virulence in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. \u003cem\u003eInfection and Immunity\u003c/em\u003e, \u003cem\u003e72\u003c/em\u003e(10), 5638-5645. doi: 10.1128/IAI.72.10.5638-5645.2004\u003c/li\u003e\n\u003cli\u003eBarraud, N., Schleheck, D., Klebensberger, J., Webb, J. S., Hassett, D. J., Rice, S. A., \u0026amp; Kjelleberg, S. (2009). Nitric oxide signaling in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e biofilms mediates phosphodiesterase activity, decreased cyclic di-GMP levels, and enhanced dispersal. \u003cem\u003eJournal of Bacteriology\u003c/em\u003e, \u003cem\u003e191\u003c/em\u003e(23), 7333-7342. doi: 10.1128/JB.00975-09 \u003c/li\u003e\n\u003cli\u003eBasu Roy, A., \u0026amp; Sauer, K. (2014). Diguanylate cyclase NicD-based signalling mechanism of nutrient-induced dispersion by \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eMolecular Microbiology\u003c/em\u003e, \u003cem\u003e94\u003c/em\u003e(4), 771-793. doi: 10.1111/mmi.12802 \u003c/li\u003e\n\u003cli\u003eChua, S. L., Sivakumar, K., Rybtke, M., Yuan, M., Andersen, J. B., Nielsen, T. E., Givskov, M., Tolker-Nielsen, T., Cao, B., Kjelleberg, S., \u0026amp; Yang, L. (2015). C-di-GMP regulates \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e stress response to tellurite during both planktonic and biofilm modes of growth. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(5), 10052. doi: 10.1038/srep10052\u003c/li\u003e\n\u003cli\u003eRen, G. X., Fan, S., Guo, X. P., Chen, S., \u0026amp; Sun, Y. C. (2016). Differential regulation of c-di-GMP metabolic enzymes by environmental signals modulates biofilm formation in \u003cem\u003eYersinia pestis\u003c/em\u003e. Froniers in Microbiology, \u003cem\u003e7\u003c/em\u003e, 821. doi: 10.3389/fmicb.2016.00821\u003c/li\u003e\n\u003cli\u003eKahl, L. J., Price-Whelan, A., \u0026amp; Dietrich, L. E. P. (2020). Light-mediated decreases in c cyclic di-GMP levels inhibit structure formation in \u003cem\u003ePseudomonas aeruginosa \u003c/em\u003ebiofilms. \u003cem\u003eJournal of Bacteriology\u003c/em\u003e, \u003cem\u003e202\u003c/em\u003e(14), e00117-20. doi: 10.1128/JB.00117-20\u003c/li\u003e\n\u003cli\u003eZhan, X., Zhang, K, Wang, C., Fan, Q., Tang, X., Zhang, X., Wang, K., Fu, Y., \u0026amp; Liang, H. A. (2024) c-di-GMP signaling module controls responses to iron in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eNature Communications\u003c/em\u003e, 15(1), 1860. doi: 10.1038/s41467-024-46149-3. Erratum in (2024), \u003cem\u003eNature Communications\u003c/em\u003e, 15(1), 8707. doi: 10.1038/s41467-024-52012-2\u003c/li\u003e\n\u003cli\u003eHickman, J. W., \u0026amp; Harwood, C. S. (2008). Identification of FleQ from \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e as a c-di-GMP responsive transcription factor. \u003cem\u003eMolecular Microbiology\u003c/em\u003e, \u003cem\u003e69\u003c/em\u003e(2), 376-389. doi: 10.1111/j.1365-2958.2008.06281.x\u003c/li\u003e\n\u003cli\u003eColvin, K. M., Gordon, V. D., Murakami, K., Borlee, B. R., Wozniak, D. J., Wong, G. C., \u0026amp; Parsek, M, R. (2011). The Pel polysaccharide can serve a structural and protective role in the biofilm matrix of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003ePLOS Pathogens\u003c/em\u003e. \u003cem\u003e7\u003c/em\u003e(1), e1001264. doi: 10.1371/journal.ppat.1001264\u003c/li\u003e\n\u003cli\u003eJennings, L. K., Storek, K. M., Ledvina, H. E., Coulon, C., Marmont, L. S., Sadovskaya, I., Secor, P. R., Tseng, B. S., Scian, M., Filloux, A., Wozniak, D. J., Howell, P. L., \u0026amp; Parsek, M.R. (2015). Pel is a cationic exopolysaccharide that cross-links extracellular DNA in the \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e biofilm matrix. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e, \u003cem\u003e112\u003c/em\u003e(36), 11353-11358. doi: 10.1073/pnas.1503058112 \u003c/li\u003e\n\u003cli\u003eKatharios-Lanwermeyer, S., Koval, S. A., Barrack, K. E., \u0026amp; O\u0026apos;Toole, G. A. (2022). The diguanylate cyclase YfiN of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e regulates biofilm maintenance in response to Peroxide. \u003cem\u003eJournal of Bacteriology\u003c/em\u003e, \u003cem\u003e204\u003c/em\u003e(1), e0039621. doi: 10.1128/JB.00396-21\u003c/li\u003e\n\u003cli\u003eMalone, J. G., Jaeger, T., Spangler, C., Ritz, D., Spang, A., Arrieumerlou, C., Kaever, V., Landmann, R., \u0026amp; Jenal, U. (2010). YfiBNR mediates cyclic di-GMP dependent small colony variant formation and persistence in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003ePLoS Pathogens\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(3), e1000804. doi: 10.1371/journal.ppat.1000804\u003c/li\u003e\n\u003cli\u003ePezzoni, M., Pizarro, R. A., \u0026amp; Costa, C. S. (2014). Protective role of extracellular catalase (KatA) against UVA radiation in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e biofilms. \u003cem\u003eJournal of Photochemistry and Photobiology B: Biology\u003c/em\u003e. \u003cem\u003e131\u003c/em\u003e, 53-64. doi: 10.1016/j.jphotobiol.2014.01.005 \u003c/li\u003e\n\u003cli\u003eFernandez, N. L., \u0026amp; Waters, C. M. (2019). Cyclic di-GMP increases catalase production and hydrogen peroxide tolerance in \u003cem\u003eVibrio cholerae\u003c/em\u003e. \u003cem\u003eApplied and Environmental Microbiology\u003c/em\u003e, \u003cem\u003e85\u003c/em\u003e(18), e01043-19. doi: 10.1128/AEM.01043-19\u003c/li\u003e\n\u003cli\u003eXiao, Y., Zhu, W., He, M., Nie, H., Chen, W., \u0026amp; Huang, Q. (2019). High c-di-GMP promotes expression of \u003cem\u003efpr-1\u003c/em\u003e and \u003cem\u003ekatE\u003c/em\u003e involved in oxidative stress resistance in \u003cem\u003ePseudomonas putida\u003c/em\u003e KT2440. Applied Microbiology and Biotechnology, \u003cem\u003e103\u003c/em\u003e(21-22), 9077-9089. doi: 10.1007/s00253-019-10178-6\u003c/li\u003e\n\u003cli\u003eGao, Q., \u0026amp; Garcia-Pichel, F. (2011). Microbial ultraviolet sunscreens. \u003cem\u003eNature Reviews Microbiology\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(11), 791-802. doi: 10.1038/nrmicro2649. PMID: 21963801\u003c/li\u003e\n\u003cli\u003eUeda, A., \u0026amp; Wood, T. K. (2009). Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885). \u003cem\u003ePLoS Pathogens\u003c/em\u003e. \u003cem\u003e5\u003c/em\u003e(6), e1000483. doi: 10.1371/journal.ppat.1000483\u003c/li\u003e\n\u003cli\u003eFontaine, B. M., Duggal, Y., \u0026amp; Weinert, E. E. (2018). Exploring the links between nucleotide signaling and quorum sensing pathways in regulating bacterial virulence. \u003cem\u003eACS Infectious Diseases Journal\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e(12), 1645-1655. doi: 10.1021/acsinfecdis.8b00255\u003c/li\u003e\n\u003cli\u003eKim, B., Park, J. S., Choi, H. Y., Yoon, S. S., \u0026amp; Kim, W. G. (2018). Terrein is an inhibitor of quorum sensing and c-di-GMP in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e: a connection between quorum sensing and c-di-GMP. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(1), 8617. doi: 10.1038/s41598-018-26974-5\u003c/li\u003e\n\u003cli\u003eCondinho, M., Carvalho, B., Cruz, A., Pinto, S. N., Arraiano, C. M., \u0026amp; Pobre, V. (2023). The role of RNA regulators, quorum sensing and c-di-GMP in bacterial biofilm formation. \u003cem\u003eFEBS Open Bio\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(6), 975-991. doi: 10.1002/2211-5463.13389\u003c/li\u003e\n\u003cli\u003eCosta, C. S., Pezzoni, M., Fern\u0026aacute;ndez, R. O., \u0026amp; Pizarro, R. A. (2010). Role of the quorum sensing mechanism in the response of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e to lethal and sublethal UVA irradiation. \u003cem\u003ePhotochemistry and Photobiology\u003c/em\u003e, \u003cem\u003e86\u003c/em\u003e(6), 1334-1342. doi: 10.1111/j.1751-1097.2010.00800.x\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"photochemical-and-photobiological-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ppss","sideBox":"Learn more about [Photochemical \u0026 Photobiological Sciences](https://link.springer.com/journal/43630)","snPcode":"43630","submissionUrl":"https://www.editorialmanager.com/ppss/","title":"Photochemical \u0026 Photobiological Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Pseudomonas aeruginosa, cyclic dimeric GMP, c-di-GMP, ultraviolet A, UVA, biofilm","lastPublishedDoi":"10.21203/rs.3.rs-7819024/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7819024/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe intracellular signaling molecule bis-(3',5')-cyclic dimeric guanosine monophosphate (c-di-GMP) plays a crucial role in several bacterial processes, including biofilm formation. c-di-GMP levels depend on the balance between its production and breakdown, controlled by diguanylate cyclases (DGCs) and phosphodiesterases (PDEs), respectively. In this work, the role of c-di-GMP in the response of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e to ultraviolet A radiation (UVA, 400\u0026thinsp;\u0026minus;\u0026thinsp;315 nm) was evaluated. Solar UVA radiation is a major environmental stressor for bacteria; its harmful effects on microorganisms, due mainly to oxidative damage, have been exploited for natural solar and commercial disinfection methods. It was demonstrated here that sublethal doses of UVA produce an early increase in c-di-GMP levels and in cell adhesion. qRT-PCR assays revealed that UVA modulates the expression of genes involved in c-di-GMP metabolism, by up-regulating the DGCs-encoding genes PA3177, \u003cem\u003eyfiN, sadC\u003c/em\u003e and \u003cem\u003ewspR\u003c/em\u003e, and down-regulating the PDEs-coding genes \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e, indicating a regulation at the transcriptional level. Studies with mutants deficient for the genetic regulatory systems Stringent Response (SR) and Quorum Sensing (QS) demonstrated that the up-regulation of PA3177, \u003cem\u003eyfiN\u003c/em\u003e, and \u003cem\u003esadC\u003c/em\u003e appears to depend on the UVA-induced SR-QS pathway, while the induction of \u003cem\u003ewspR\u003c/em\u003e seems to be exclusively regulated by the SR. In contrast, the repression by UVA of \u003cem\u003ebifA\u003c/em\u003e and \u003cem\u003erbdA\u003c/em\u003e do not seem to be linked to either of these regulatory systems. It was also demonstrated that c-di-GMP has a role in the survival of planktonic and biofilm cells under lethal UVA, possibly by promoting the production of Pel and/or Psl exopolysaccharides.\u003c/p\u003e","manuscriptTitle":"c-di-GMP is a key regulator of Pseudomonas aeruginosa response to UVA radiation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-24 18:08:59","doi":"10.21203/rs.3.rs-7819024/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-11T20:31:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-11T14:20:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"224050393309803714632103177356329609863","date":"2025-10-16T19:29:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-10T19:14:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-10T10:13:59+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-10T05:14:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"Photochemical \u0026 Photobiological Sciences","date":"2025-10-09T14:54:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"photochemical-and-photobiological-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ppss","sideBox":"Learn more about [Photochemical \u0026 Photobiological Sciences](https://link.springer.com/journal/43630)","snPcode":"43630","submissionUrl":"https://www.editorialmanager.com/ppss/","title":"Photochemical \u0026 Photobiological Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"b55e6a49-3127-4a96-9c04-0992c26cc233","owner":[],"postedDate":"October 24th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-09T16:02:16+00:00","versionOfRecord":{"articleIdentity":"rs-7819024","link":"https://doi.org/10.1007/s43630-026-00875-3","journal":{"identity":"photochemical-and-photobiological-sciences","isVorOnly":false,"title":"Photochemical \u0026 Photobiological Sciences"},"publishedOn":"2026-03-03 15:58:47","publishedOnDateReadable":"March 3rd, 2026"},"versionCreatedAt":"2025-10-24 18:08:59","video":"","vorDoi":"10.1007/s43630-026-00875-3","vorDoiUrl":"https://doi.org/10.1007/s43630-026-00875-3","workflowStages":[]},"version":"v1","identity":"rs-7819024","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7819024","identity":"rs-7819024","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.