Gene Expression Disparity in Coronary Artery Disease: Insights from MEIS1, HIRA, and Myocardin

Gene Expression Disparity in Coronary Artery Disease: Insights from MEIS1, HIRA, and Myocardin | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Gene Expression Disparity in Coronary Artery Disease: Insights from MEIS1, HIRA, and Myocardin Elnaz Javanshir, Zahra Javadpour Ebrahimi, Seyedeh Tarlan MirzohrehM, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4194767/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Introduction: Coronary artery disease (CAD) manifesting in young adults can have devastating consequences. MEIS1 gene plays an important role in vascular networks and heart development. Also, this gene has a great effect on the regeneration capacity of the heart. This study investigates the expression level of MEIS1, HIRA, and Myocardin genes in patients with premature CAD in comparison to healthy subjects and evaluates the relationship between these genes and possible inflammatory factors. Methods and Results A case-control study was employed to investigate HIRA, MEIS1, and Myocardin gene expression as well as IL-6, IL-10, and TNF-α in Peripheral Blood Mononuclear Cells (PBMCs) obtained from CAD patients. Thirty-five patients diagnosed with CAD and 35 healthy individuals enrolled through simple randomization. RNAs were extracted from PBMCs and cDNA synthesis was performed to determine the expression levels of studied genes using real-time PCR. PBMCs of CAD cases demonstrated higher levels of MEIS1 and HIRA gene expression compared to the control group with a fold change of 2.45 and 3.6 respectively. Expression of MEIS1 exhibited a negative correlation with IL-10 (r= -0.312) expression and a positive correlation with IL-6 (r = 0.415) and TNF-α (r = 0.534) gene expressions. Moreover, there was an inverse correlation between the gene expressions of HIRA and IL-10 (r= -0.326), and a positive correlation was revealed between this gene and the IL-6 (r = 0.453) and TNF-α (r = 0.572) gene expressions. Conclusion This research demonstrated a distinct disparity in the expression levels of MEIS1, HIRA, and Myocardin as early myocardial marker genes between individuals with CAD and healthy subjects. Results showed that two specific genes, MEIS1 and HIRA, may play a significant role in regulating the synthesis of pro-inflammatory cytokines, namely TNF-α and IL-6. MEIS1 HIRA Myocardin cytokines CAD Figures Figure 1 Figure 2 Introduction The epidemiological studies highlight that coronary artery disease (CAD) and coronary atherosclerosis stand as the foremost causes of morbidity and mortality in the general population across the globe ( 1 , 2 ). CAD develops through a series of steps, beginning with a normal blood vessel and progressing toward severe stenosis, accompanied by molecular changes. The molecular alterations and environmental modifications that trigger the onset of cardiovascular disease occur before any morphological abnormalities in the tissue ( 3 , 4 ). Molecular alterations research can offer significant insights into the early identification of CAD severity in asymptomatic individuals, thus providing valuable information ( 5 , 6 ). Additionally, there have been reports linking gene expression variants in peripheral blood cells with the extent of CAD severity ( 7 ). Therefore, exploring gene expression variations concerning CAD severity could prove to be a potent methodology to gain a deeper understanding of the underlying causes of CAD ( 8 ). Monocytes, which are the predominant type of mononuclear cells in peripheral blood, play a crucial role in the development of atherosclerosis. The attachment of monocytes to the endothelium and their migration into the intima are crucial processes in the development of atherosclerosis ( 9 ). Possessing an extensive array of approximately 10,000 genes, monocytes contain genes associated with immunity and coronary artery disease (CAD). The expression of monocyte genes can be modified in response to environmental stimuli, potentially serving as a distinctive indicator for individuals at an elevated risk of CAD ( 10 ). One of the recent discoveries in the field of cardiovascular research is the role of Myeloid ecotropic viral integration site 1 (MEIS1) in the regulation of the cell cycle of cardiomyocytes. This discovery has opened up new avenues for researchers to explore the role of MEIS1 in the regeneration of the cardiovascular system ( 11 ). The MEIS1 transcription factor, belonging to the homeobox (Hox) gene family, plays a crucial role in regulating various biological processes such as oxidative stress responses, differentiation, and embryonic development ( 12 – 15 ). The specific molecular mechanisms underlying the role of the MEIS1 gene in cardiac regeneration remain unknown. However, animal studies have provided novel evidence of significant changes associated with the MEIS1 gene. In the context of cardiac function, alterations in the level of MEIS1 have been observed in both postnatal and post-infarcted hearts, leading to the loss of regenerative capacity in mice ( 14 , 16 ). Furthermore, recent research has indicated that MEIS1 functions as a novel controller of ischemic arrhythmias in mice and could potentially play a role in the regulation of cardiac conduction and heart rhythm ( 17 , 18 ). In a study conducted by Mahmoud et al., it was found that deleting the MEIS1 gene in mouse models led to the re-activation of cardiomyocyte mitosis in the adult heart without causing hypertrophy or any other harmful effects on cardiac function. Conversely, overexpression of MEIS1 was found to decrease the proliferation of cardiac cells and inhibit cardiac regeneration( 14 ). Moreover, based on findings of previous studies the downregulation of a specific type of circular RNA in MEIS1 downstream promoted angiogenesis, which restored the myocardial blood flow in adult mice ( 19 ). Furthermore, investigation into the epigenetic control of cardiac lineage development revealed that the MEIS1/Hoxa9 axis was concentrated in specific enhancers during the cardiac precursor stage. Through an analysis of enhancer-based gene networks, it was observed that MEIS1 activates the enhancer associated with Myocardin (Myocd), a crucial gene in the differentiation and proliferation of vascular smooth muscle cells. This discovery confirms the functional association of Hox proteins with MEIS1 partners at the molecular level during heart development ( 11 ). The progression of cardiogenesis involves a sequence of events orchestrated by the regulated expression of various temporal genes, resulting in chromatin and histone modifications. During the embryonic stage, the histone chaperone HIRA influences gene expression as a marker of euchromatin, indicating active gene activity. Conditional knockout of HIRA in embryonic mouse hearts leads to cardiac septal defects, accompanied by the selective down-regulation of MEIS1 ( 11 , 20 ). Recent research has established that the analysis of gene expression variations in peripheral blood cells (PBMCs) is a viable method for exploring genetic predisposition, as well as capturing the impact of disease activity, environmental modifiers, and responses to treatment ( 21 – 23 ). Furthermore, there is convincing evidence that CAD is not only a lipid accumulation-mediated disease but also a chronic inflammatory disease of the vessel wall that is largely driven by an innate immune response through myeloid cells such as monocytes and macrophages ( 24 ). Based on the findings that MEIS1 plays a crucial role in cardiac tissue development and progression of myocardial infarction, we aimed to investigate the expression level of MEIS1, HIRA, and Myocardin genes in patients with premature CAD in comparison to healthy subjects and evaluate the relationship between these genes and possible inflammatory factors. Material and Methods Participants and data collection The study enrolled patients who were diagnosed with and without CAD using coronary angiography (CAG). A total of 35 consecutive patients with CAD and 35 controls with angiographically normal coronary arteries were evaluated in the present study. The inclusion criteria were delineated as follows: Patients over 18 years of age who underwent elective CAG based on the presence of chest-related symptoms or non-invasive tests. Exclusion criteria were a history of valvular heart disease, congenital heart disease, atrial fibrillation, aortic aneurysm, revascularization, coronary artery ectasia, heart failure, pulmonary embolism, chronic obstructive pulmonary disease, acute or chronic infections, cancer, autoimmune or inflammatory diseases, thyroid disease, the administration of medication with anti-inflammatory properties, hepatic or renal dysfunction, left ventricular dysfunction, and left ventricular hypertrophy on echocardiography. All participants provided written informed consent and the study received approval from the Ethics Committee of Tabriz University of Medical Sciences. From each patient, 5 ml of blood in a fasting state was collected into EDTA (ethylenediaminetetraacetic acid) collection tubes for laboratory and genetic analysis. Molecular analysis PBMC isolation An equal volume of blood sample was introduced into phosphate-buffered saline (PBS) and homogenized. The resulting mixture was then carefully added to Falcon tubes containing Ficoll and subjected to centrifugation at a speed of 3000 rpm for 20 minutes at a temperature of 25°C. Upon completion of the designated time, the tubes were carefully retrieved, and the layer consisting of isolated PBMCs was cautiously extracted using a sampler. The extracted PBMCs were then transferred to a separate Falcon tube and subjected to a subsequent wash with PBS (Lymphodex, Innotrain, Germany method)(25). Gene Expression In this research, the expression level of MEIS1, HIRA, Myocardin, IL-10, IL-6, and TNF-α, genes were investigated using Real Time PCR technique. RNA Extraction Ambion Trizol LS reagent (Thermo Fisher Scientific, USA) was used to separate high-quality total RNA from freshly acquired PBMCs, as directed by the manufacturer. The resulting solution was transferred to -70°C for storage, to enable subsequent cDNA synthesis and Real Time PCR. RNA extraction quality A spectrophotometer (NanoDrop™ One/OneC Microvolume UV, Thermo Scientific) was used to measure the relative absorbance ratio at A260/280 and A260/230, confirming the purity and quantity of RNA. cDNA Synthesis RNA was transcribed to cDNA using Ferments' RevertAidTM First Strand cDNA Synthesis Kit, which included a reverse transcription enzyme and Random Hexamer Primer. The reverse transcription reaction for cDNA synthesis was performed using a thermocycler (SENSQUEST) in accordance with the temperature program. The resulting cDNA product can be directly utilized for Real Time PCR reactions or stored at -20°C for future use . Real Time PCR Real-time reverse transcription PCR (qRT-PCR) was used to quantify mRNA in the samples. The Roche Life Science/Real-Time PCR (LightCycler® Instrument, Germany) assessed the expression levels of MEIS1, HIRA, Myocardin, IL-10, IL-6, and TNF-α mRNAs. The SYBR Green Master Mix (AMPLIQON, Denmark) was used for qRT-PCR. The amplification procedure included one cycle at 95°C for 5 minutes, followed by 40 cycles of denaturing at 95°C for 10 seconds, annealing at 54°C for 35 seconds, and extension at 72°C for 20 seconds. The primer sequences were created using PrimerBank, and NCBI, and are summarized in Table 1. The housekeeping gene β-actin was used as an endogenous reference gene, and relative quantification was done by normalizing the signals of the different genes to the β-actin signal. The relative mRNA abundance was calculated with the 2 (-ΔΔCT) technique (26). All samples were tested in triplicate. Laboratory assessment Laboratory investigations were performed to evaluate a range of parameters encompassing fasting insulin level, fasting glucose, lipid profile, white blood cell count, hemoglobin concentration, platelet count, and C-reactive protein level, across all blood samples. Statistical analysis Data are presented as means± standard deviations (SD) unless otherwise stated. Statistical analysis was performed using IBM SPSS 24. Fisher's exact test was utilized to compare the qualitative variables between the two study groups. Additionally, the independent t-test was employed to compare the quantitative variables between the two groups. Pearson's correlation analysis was used to examine the relationships between HIRA, MEIS, Myocardin, and cytokines expression. A significance level of p<0.05 was considered statistically significant . Results Demographic and laboratory assay The analysis of demographic data and biochemical markers in the two study groups demonstrated that individuals with CAD exhibited higher total cholesterol (TC) levels (166.3 ± 5.05) compared to the healthy control group (138 ± 8.38), with a statistically significant p-value of 0.015. Furthermore, patients with CAD displayed a significantly elevated mean fasting blood sugar (FBS) level (151 ± 6.72) in comparison to the healthy control group (118.2 ± 10.6), with a p-value of 0.027. Detailed results are presented in Table 2 . Cytokines expression level (IL-10, IL-6 and TNF-α) Figure 1 (A-C) illustrates the levels of gene expression for both anti-inflammatory and inflammatory factors. According to the data, the expression level of the IL-10 gene in the CAD group has decreased by 55% compared to the normal group (Fold change=0.45, P-value=0.004). Conversely, the expression of the IL-6 inflammatory factor gene in the CAD group showed a non-significant increase of 1.2 times compared to the normal group (Fold changes=1.20, P-value=0.141). In addition, the expression level of the TNF-α gene in the CAD group was significantly increased by 2.4 times compared to the normal group (Fold changes=2.4, P-value=0.008). HIRA, Myocardin, MEIS1 expression level Figure 2 (A-C) revealed that the CAD group exhibited a significant elevation in HIRA gene expression, with a fold change of 3.6, which was significantly higher compared to the healthy group (P-value<0.001). Similarly, the CAD group demonstrated a significant increase in MEIS1 mRNA expression, with a fold change of 2.45, when compared to the control group (P-value<0.001). On the other hand, the Myocardian gene expression in the CAD group displayed a non-significant increase of 1.74 times in comparison to the normal group, with a fold change of 1.74 (P-value=0.241). Correlation analysis HIRA and cytokines There was an inverse correlation between the gene expressions of HIRA and the anti-inflammatory factor IL-10 (r= -0.326), while a significant positive correlation was revealed between the HIRA gene and the inflammatory factors IL-6 (r= 0.453) and TNF-α (r= 0.572). Elevating the expression of the HIRA gene leads to a reduction in IL-10 expression and an increase in IL-6 and TNF-α expression (Table 3) . MEIS1 and Cytokines The findings indicated that the MEIS1 gene exhibited a negative correlation with the anti-inflammatory cytokine IL-10 (r= -0.312) while showing a positive correlation with the pro-inflammatory cytokines IL-6 (r= 0.415) and TNF-α (r= 0.534). Elevating the expression levels of the MEIS1 gene leads to a reduction in IL-10 expression and an elevation in IL-6 and TNF-α expression (Table 3) . Myocardin and cytokines There is not a statistically significant correlation between the Myocardin mRNA expression and the present anti-inflammatory and inflammatory factors (Table 3) . Discussion The present study introduces new findings that establish a previously unexplored expression level of early cardiac genes in PBMCs of patients with stable CAD and their connection with pro/anti-inflammatory cytokines. Our investigation successfully demonstrated that CAD patients display altered expression patterns of MEIS1, HIRA, and Myocardin as early cardiac marker genes associated with cardiovascular disease in the PBMCs of stable CAD patients compared to healthy individuals serving as controls. Moreover, findings revealed a statistically significant positive correlation between the expression levels of MEIS1 and HIRA genes and the levels of TNF-a and IL-6 cytokines. Conversely, a negative correlation was observed between the expression levels of MEIS1 and HIRA genes and the expression levels of Il-10 cytokine. Despite significant advancements in the treatment and comprehension of the intricate disease of atherosclerosis over the past two decades, the condition remains a significant source of morbidity and mortality, particularly in its advanced stages ( 27 ). Due to the systemic nature of atherosclerosis, our hypothesis posits that individuals afflicted with this condition exhibit indicators in their peripheral blood that signify the progression of the disease. In recent times, the practice of gene expression profiling in peripheral blood has gained widespread usage in the identification of pathophysiological mechanisms and risk prediction markers for various diseases( 28 ). In the specific context of coronary artery disease, numerous studies have explored the transcriptome of peripheral blood ( 29 – 32 ), as well as purified monocytes or mononuclear cells ( 23 , 31 , 33 ). These investigations were designed to assess the transcriptome in the presence of coronary artery disease or to forecast the extent of the disease based on transcriptomic data. Over the last twenty years, scientists have identified various genes that play a role in the development and healing of the cardiovascular system and could be potential targets for therapy ( 34 – 37 ). Notably, Nkx2.5, HIRA, Tbx20, and Myocardin have been identified as pivotal genes in the cardiovascular development process ( 38 – 41 ). The discovery of MEIS1 and its involvement in regulating the cell cycle of cardiomyocytes has provided researchers with a new opportunity to understand its role in cardiovascular regeneration ( 14 ). Since being first identified, MEIS1 has been extensively studied by researchers who have investigated its involvement in limb development and various medical conditions, such as cardiac defects. As a result, there has been significant interest in exploring MEIS1 as a potential target for therapeutic interventions ( 42 ). Xiang and colleagues have reported that MEIS1 is directly bound and repressed by Tbx20, a gene that is specific to the cardiac tissue, in adult cardiomyocytes (CM). This repression of MEIS1 by Tbx20 promotes the proliferation of adult CMs and helps to preserve cardiac performance following myocardial infarction ( 43 ). The use of RNA-Sequence techniques in the study of cardiac development has revealed that MEIS1 and Nkx2-5 bind to the enhancers of multiple regulatory genes involved in the heart ( 44 ). These studies provide some insight into the genes that interact with MEIS1. Research findings provide a limited understanding of the upstream and downstream genes associated with MEIS1. Specifically, HIRA has been identified as a binding agent to the enhancer of MEIS1, thereby facilitating the activation of its expression. This activation subsequently initiates the activation of numerous cardiac-specific genes downstream during the process of myocardial differentiation ( 11 ). Our study showed that patient with CAD expressed higher levels of circulating MEIS1 and HIRA compared to healthy controls. Furthermore, our findings regarding the modified expression of Myocardin genes in PBMCs of patients with CAD compared to individuals without the disease are consistent with previous research, suggesting that peripheral blood may serve as a potential indicator of gene expression changes occurring in response to CAD ( 29 ). In additon, the results of the correlation analysis revealed a statistically significant positive correlation between the expression levels of MEIS1 and HIRA genes and the levels of TNF-a and IL-6 cytokines. Conversely, a negative correlation was observed between the expression levels of MEIS1 and HIRA genes with the expression levels of Il-10 cytokine. Increased concentrations of proinflammatory cytokines, including IFN-γ, IL-1β, IL-6, and TNF-α, have been associated with a range of cardiovascular diseases, such as coronary heart disease, atherosclerotic heart disease, and congestive heart failure. These cytokines are pivotal in the pathogenesis of atherosclerotic plaque formation( 45 ). The buildup of various cells and material, including macrophages, fatty cells, mast cells, T cells, and other degenerative substances, in the inner layer of artery walls, referred to as the "tunica intima," leads to the creation of atheroma ( 46 – 48 ). This fatty deposit is then followed by the release of different inflammatory molecules, cytokines, and chemokines by activated macrophages, resulting in tissue damage and inflammation ( 49 , 50 ). Moreover, it is widely acknowledged within the scientific community that inflammatory cytokines play a crucial role in the pathogenesis of diverse chronic inflammatory conditions. A recent study has shed light on the fact that the excessive release of cytokines, including TNF-α, IL-6, and IL-1, actively contributes to the amplification of proatherogenic gene expression ( 51 , 52 ). The initial step in causing inflammation within the vessel wall is the buildup and penetration of the tunica intima by endothelial cells. This occurs when LDL undergo changes, either through enzymatic breakdown or oxidation, in the inner layer of the vessel ( 53 ). These modifications cause the release of phospholipids, which activate endothelial cells and may expedite the expression of genes related to inflammation. This process can then trigger a series of inflammatory reactions within the artery due to the presence of cells or lipids filled with fats ( 54 ). Chemokines are responsible for the recruitment of monocytes into the tunica intima, where they undergo transformation into macrophages( 55 ). These macrophages play a critical role in initiating the formation of foam cells( 56 ). Furthermore, the macrophages undergo multiplication and release various inflammatory cytokines and growth factors, thereby amplifying proinflammatory signals. This process is crucial for the proper development of atherosclerotic lesions. Additionally, it upregulates toll-like receptors, which, upon stimulation, initiate a signaling cascade that activates the cell ( 57 ). The activated macrophage then releases cytotoxic oxygen, proteases, nitrogen radical molecules, and inflammatory cytokines ( 58 ). Altogether, PBMC are an integral part of the immune system and have been found to play a crucial role in the development of atherosclerosis and the gene expressions within them have been extensively studied in relation to atherogenesis and shown to contribute significantly to the pathophysiological mechanisms involved in the development and progression of this cardiovascular disease. These gene expressions stimulate the production and secretion of pro-inflammatory cytokines which perpetuate the inflammatory response and promote the recruitment of additional immune cells into the plaque. It can be inferred that some genes including MEIS1 and HIRA may have an impact on controlling the synthesis of pro-inflammatory cytokines such as TNF-a and IL-6, as well as suppressing the production of the anti-inflammatory cytokine Il-10. To gain a comprehensive understanding of the underlying mechanisms and the possible consequences for disease progression and therapy, additional investigation is required. Conclusion Overall, this research has demonstrated a distinct disparity in the expression levels of MEIS1, HIRa and Myocardin as early myocardial marker genes between individuals with CAD and those in a normal physiological state. Additionally, it appears that two specific genes, MEIS1 and HIRA, may play a significant role in regulating the synthesis of pro-inflammatory cytokines, namely TNF-a and IL-6. Interestingly, the study suggests that MEIS1 and HIRA may also be involved in suppressing the production of an anti-inflammatory cytokine, Il-10. It is important to note that a definitive causal relationship cannot be established based on these findings alone. If a direct association does exist, it would be reasonable to hypothesize that early developmental genes may be implicated in the pathogenesis of this disease. Declarations Conflict of Interest The authors declare no conflicts of interest. Ethics approval The ethics committee of the Tabriz University of Medical Science reviewed and approved the study protocol (ethics code: IR.TBZMED.REC.1402.280) Acknowledgments The authorization to perform this research was granted by the Cardiovascular Research Center at Tabriz University of Medical Sciences, for which the authors are grateful. The authors would also like to thank all of the patients who took part in this study. Authors contribution statement Z.J and S.M contributed to write text. N.R and S.G contributed to modify text mistakes. N.R and E.J contributed to design of the work N,M and E.B contributed to prepare tables and figures. E.J and Z.J contributed to analyze data. N.M and E.B contributed to collect data. N.R contributed to submit manuscript and will coordinate between authors. References Kuller LH. Ethnic differences in atherosclerosis, cardiovascular disease and lipid metabolism. Current opinion in lipidology. 2004;15(2):109-13. Marmot M, Marmot M, Elliott P. Coronary heart disease epidemiology: from aetiology to public health: Oxford Medical Publications; 2005. Martin-Lorenzo M, Gonzalez-Calero L, Maroto AS, Martinez PJ, Zubiri I, de la Cuesta F, et al. Cytoskeleton deregulation and impairment in amino acids and energy metabolism in early atherosclerosis at aortic tissue with reflection in plasma. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 2016;1862(4):725-32. Frąk W, Wojtasińska A, Lisińska W, Młynarska E, Franczyk B, Rysz J. Pathophysiology of Cardiovascular Diseases: New Insights into Molecular Mechanisms of Atherosclerosis, Arterial Hypertension, and Coronary Artery Disease. Biomedicines. 2022;10(8). Patterson AJ, Song MA, Choe D, Xiao D, Foster G, Zhang L. Early Detection of Coronary Artery Disease by Micro-RNA Analysis in Asymptomatic Patients Stratified by Coronary CT Angiography. Diagnostics (Basel). 2020;10(11). Jaffer FA, Verjans JW. Molecular imaging of atherosclerosis: clinical state-of-the-art. Heart. 2014;100(18):1469-77. Anand SS, Yusuf S, Vuksan V, Devanesen S, Teo KK, Montague PA, et al. Differences in risk factors, atherosclerosis, and cardiovascular disease between ethnic groups in Canada: the Study of Health Assessment and Risk in Ethnic groups (SHARE). The lancet. 2000;356(9226):279-84. Khera AV, Kathiresan S. Genetics of coronary artery disease: discovery, biology and clinical translation. Nat Rev Genet. 2017;18(6):331-44. Kang H, Li X, Xiong K, Song Z, Tian J, Wen Y, et al. The Entry and Egress of Monocytes in Atherosclerosis: A Biochemical and Biomechanical Driven Process. Cardiovasc Ther. 2021;2021:6642927. Zeller T, Hughes M, Tuovinen T, Schillert A, Conrads-Frank A, Ruijter H, et al. BiomarCaRE: rationale and design of the European BiomarCaRE project including 300,000 participants from 13 European countries. Eur J Epidemiol. 2014;29(10):777-90. Paul S, Zhang X, He JQ. Homeobox gene Meis1 modulates cardiovascular regeneration. Semin Cell Dev Biol. 2020;100:52-61. Roychoudhury J, Clark JP, Gracia-Maldonado G, Unnisa Z, Wunderlich M, Link KA, et al. MEIS1 regulates an HLF-oxidative stress axis in MLL-fusion gene leukemia. Blood. 2015;125(16):2544-52. Su Z, Si W, Li L, Zhou B, Li X, Xu Y, et al. MiR-144 regulates hematopoiesis and vascular development by targeting meis1 during zebrafish development. The International Journal of Biochemistry & Cell Biology. 2014;49:53-63. Mahmoud AI, Kocabas F, Muralidhar SA, Kimura W, Koura AS, Thet S, et al. Meis1 regulates postnatal cardiomyocyte cell cycle arrest. Nature. 2013;497(7448):249-53. Islam MM, Li Y, Luo H, Xiang M, Cai L. Meis1 regulates Foxn4 expression during retinal progenitor cell differentiation. Biol Open. 2013;2(11):1125-36. Nguyen NUN, Canseco DC, Xiao F, Nakada Y, Li S, Lam NT, et al. A calcineurin-Hoxb13 axis regulates growth mode of mammalian cardiomyocytes. Nature. 2020;582(7811):271-6. Liu Y, Li J, Xu N, Yu H, Gong L, Li Q, et al. Transcription factor Meis1 act as a new regulator of ischemic arrhythmias in mice. J Adv Res. 2022;39:275-89. Pfeufer A, van Noord C, Marciante KD, Arking DE, Larson MG, Smith AV, et al. Genome-wide association study of PR interval. Nat Genet. 2010;42(2):153-9. Huang S, Li X, Zheng H, Si X, Li B, Wei G, et al. Loss of Super-Enhancer-Regulated circRNA Nfix Induces Cardiac Regeneration After Myocardial Infarction in Adult Mice. Circulation. 2019;139(25):2857-76. Valenzuela N, Fan Q, Fa'ak F, Soibam B, Nagandla H, Liu Y, et al. Cardiomyocyte-specific conditional knockout of the histone chaperone HIRA in mice results in hypertrophy, sarcolemmal damage and focal replacement fibrosis. Dis Model Mech. 2016;9(3):335-45. Laguna JC, Alegret M. Regulation of gene expression in atherosclerosis: insights from microarray studies in monocytes/macrophages. Pharmacogenomics. 2012;13(4):477-95. Aziz H, Zaas A, Ginsburg GS. Peripheral blood gene expression profiling for cardiovascular disease assessment. Genomic medicine. 2007;1(3):105-12. Nührenberg TG, Langwieser N, Binder H, Kurz T, Stratz C, Kienzle RP, et al. Transcriptome analysis in patients with progressive coronary artery disease: identification of differential gene expression in peripheral blood. J Cardiovasc Transl Res. 2013;6(1):81-93. Wolf D, Ley K. Immunity and Inflammation in Atherosclerosis. Circ Res. 2019;124(2):315-27. Ghavami A, Roshanravan N, Alipour S, Barati M, Mansoori B, Ghalichi F, et al. Assessing the Effect of High Performance Inulin Supplementation via KLF5 mRNA Expression in Adults with Type 2 Diabetes: A Randomized Placebo Controlled Clinical Trail. Advanced pharmaceutical bulletin. 2018;8(1):39-47. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif). 2001;25(4):402-8. Hong J, Maron DJ, Shirai T, Weyand CM. Accelerated atherosclerosis in patients with chronic inflammatory rheumatologic conditions. International journal of clinical rheumatology. 2015;10(5):365-81. Mohr S, Liew CC. The peripheral-blood transcriptome: new insights into disease and risk assessment. Trends in molecular medicine. 2007;13(10):422-32. Kontaraki JE, Kochiadakis GE, Marketou ME, Chlouverakis G, Igoumenidis NE, Saloustros IG, et al. Early cardiac gene transcript levels in peripheral blood mononuclear cells reflect severity in stable coronary artery disease. Hellenic journal of cardiology : HJC = Hellenike kardiologike epitheorese. 2014;55(2):119-25. Ma J, Liew CC. Gene profiling identifies secreted protein transcripts from peripheral blood cells in coronary artery disease. Journal of molecular and cellular cardiology. 2003;35(8):993-8. Patino WD, Mian OY, Kang JG, Matoba S, Bartlett LD, Holbrook B, et al. Circulating transcriptome reveals markers of atherosclerosis. Proceedings of the National Academy of Sciences of the United States of America. 2005;102(9):3423-8. Liu M, Jiang S, Ma Y, Ma J, Hassan W, Shang J. Peripheral-blood gene expression profiling studies for coronary artery disease and its severity in Xinjiang population in China. Lipids in health and disease. 2018;17(1):154. Sinnaeve PR, Donahue MP, Grass P, Seo D, Vonderscher J, Chibout SD, et al. Gene expression patterns in peripheral blood correlate with the extent of coronary artery disease. PloS one. 2009;4(9):e7037. Lee SJ, Lee CK, Kang S, Park I, Kim YH, Kim SK, et al. Angiopoietin-2 exacerbates cardiac hypoxia and inflammation after myocardial infarction. The Journal of clinical investigation. 2018;128(11):5018-33. Ingason AB, Goldstone AB, Paulsen MJ, Thakore AD, Truong VN, Edwards BB, et al. Angiogenesis precedes cardiomyocyte migration in regenerating mammalian hearts. The Journal of thoracic and cardiovascular surgery. 2018;155(3):1118-27.e1. Miyagawa S, Sawa Y, Taketani S, Kawaguchi N, Nakamura T, Matsuura N, et al. [Myocardial regeneration therapy for heart failure: hepatocyte growth factor enhances the effect of cellular cardiomyoplasty]. Journal of cardiology. 2003;41(1):36-8. Mathison M, Gersch RP, Nasser A, Lilo S, Korman M, Fourman M, et al. In vivo cardiac cellular reprogramming efficacy is enhanced by angiogenic preconditioning of the infarcted myocardium with vascular endothelial growth factor. Journal of the American Heart Association. 2012;1(6):e005652. Chung IM, Rajakumar G. Genetics of Congenital Heart Defects: The NKX2-5 Gene, a Key Player. Genes. 2016;7(2). Dilg D, Saleh RN, Phelps SE, Rose Y, Dupays L, Murphy C, et al. HIRA Is Required for Heart Development and Directly Regulates Tnni2 and Tnnt3. PloS one. 2016;11(8):e0161096. Chen JF, Wang S, Wu Q, Cao D, Nguyen T, Chen Y, et al. Myocardin marks the earliest cardiac gene expression and plays an important role in heart development. Anatomical record (Hoboken, NJ : 2007). 2008;291(10):1200-11. Mandel EM, Kaltenbrun E, Callis TE, Zeng XX, Marques SR, Yelon D, et al. The BMP pathway acts to directly regulate Tbx20 in the developing heart. Development (Cambridge, England). 2010;137(11):1919-29. Mercader N, Leonardo E, Azpiazu N, Serrano A, Morata G, Martínez C, et al. Conserved regulation of proximodistal limb axis development by Meis1/Hth. Nature. 1999;402(6760):425-9. Xiang FL, Guo M, Yutzey KE. Overexpression of Tbx20 in Adult Cardiomyocytes Promotes Proliferation and Improves Cardiac Function After Myocardial Infarction. Circulation. 2016;133(11):1081-92. Dupays L, Shang C, Wilson R, Kotecha S, Wood S, Towers N, et al. Sequential Binding of MEIS1 and NKX2-5 on the Popdc2 Gene: A Mechanism for Spatiotemporal Regulation of Enhancers during Cardiogenesis. Cell reports. 2015;13(1):183-95. Tian R, Hou G, Li D, Yuan TF. A possible change process of inflammatory cytokines in the prolonged chronic stress and its ultimate implications for health. TheScientificWorldJournal. 2014;2014:780616. Hotamisligil GS. Endoplasmic reticulum stress and atherosclerosis. Nature medicine. 2010;16(4):396-9. Oh J, Riek AE, Weng S, Petty M, Kim D, Colonna M, et al. Endoplasmic reticulum stress controls M2 macrophage differentiation and foam cell formation. The Journal of biological chemistry. 2012;287(15):11629-41. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. The New England journal of medicine. 2005;352(16):1685-95. Mehta JL, Saldeen TG, Rand K. Interactive role of infection, inflammation and traditional risk factors in atherosclerosis and coronary artery disease. Journal of the American College of Cardiology. 1998;31(6):1217-25. Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation. 2002;105(9):1135-43. Clinton SK, Underwood R, Hayes L, Sherman ML, Kufe DW, Libby P. Macrophage colony-stimulating factor gene expression in vascular cells and in experimental and human atherosclerosis. The American journal of pathology. 1992;140(2):301-16. Yudkin JS, Kumari M, Humphries SE, Mohamed-Ali V. Inflammation, obesity, stress and coronary heart disease: is interleukin-6 the link? Atherosclerosis. 2000;148(2):209-14. Leitinger N. Oxidized phospholipids as modulators of inflammation in atherosclerosis. Curr Opin Lipidol. 2003;14(5):421-30. Dai G, Kaazempur-Mofrad MR, Natarajan S, Zhang Y, Vaughn S, Blackman BR, et al. Distinct endothelial phenotypes evoked by arterial waveforms derived from atherosclerosis-susceptible and -resistant regions of human vasculature. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(41):14871-6. Libby P. Inflammation and cardiovascular disease mechanisms. The American journal of clinical nutrition. 2006;83(2):456s-60s. Smith JD, Trogan E, Ginsberg M, Grigaux C, Tian J, Miyata M. Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E. Proceedings of the National Academy of Sciences of the United States of America. 1995;92(18):8264-8. Edfeldt K, Swedenborg J, Hansson GK, Yan ZQ. Expression of toll-like receptors in human atherosclerotic lesions: a possible pathway for plaque activation. Circulation. 2002;105(10):1158-61. Janeway CA, Jr., Medzhitov R. Innate immune recognition. Annual review of immunology. 2002;20:197-216. Tables Table1. sequence of Genes primers for qRT-PCR Gene Primers MEIS1 Forward: GGCTCCTCTGTCAATGACG Reverse: GGGGTACAAGTAGCTAATTCACA HIRA Forward: CCACTGCCCAGATCATCGAAC Reverse: CTAGGCTTCGCAGAACTCCC Myocardin Forward: AAAAGATGGCTGGTTTACACT Reverse: GGTCATTTGCTGCTTTACGG IL-10 Forward: GTTGAGCTGTTTTCCCTGA Reverse: TGAAGTGGTTGGGGAATGAG IL-6 Forward: GCAGAAAACAACCTGAACC Reverse: GCTTGTTCCTCACTACTCTC TNF-α Forward: GCAGGTCTACTTTGGGATCATT Reverse: AGAAGAGGTTGAGGGTGTCT β-actin Forward GGTGAAGGTGACAGCAGT Reverse TGGGGTGGCTTTTAGGAT Table 2: Baseline characteristics of the study population CAD group Control group P-Value Age 54.7 ± 1.6 54.3 ± 0.72 0.790 Gender Male 18 (51.9%) 23 (65.3%) 0.141 Female 17 (48.1%) 12 (34.7%) BMI 28.4 ± 0.9 28.9 ± 0.4 0.646 SBP 121.6 ± 2.13 122.4 ± 11.6 0.786 DBP 78.2 ± 1.9 79.6 ± 1.9 0.756 DM 8 (18.5%) 10 (28.5%) 0.479 HTN 13 (37.1%) 18 (51.9%) 0.237 HLP 14 (40%) 15 (42.8%) 0.796 HDL-c (mg/dl) 42.6 ± 1.3 42.7 ± 2.7 0.981 LDL-c (mg/dl) 99.8 ± 7.5 75.1 ± 9.6 0.051 TG (mg/dl) 182.3 ± 10.8 99.3 ± 10.8 0.051 TC (mg/dl) 166.3 ± 5.08 138 ± 8.38 0.015 FBS (mg/dl) 151.7 ± 6.7 118.2 ± 10.6 0.027 BMI: body mass index; SBP: systolic blood pressure; DBP: diastolic blood pressure; DM: diabetes mellitus; HTN: hypertension; HLP: hyperlipidemia; HDL-c: high density lipoprotein; LDL-c: low density lipoprotein; TC: total cholesterol; TG: triglyceride; FBS: fasting blood sugar, p-value<0.05 is significant. Table 3. Correlation between the gene expressions and the anti-inflammatory and inflammatory factors. IL-10 IL-6 TNF- HIRA *r -0.326 0.453 0.572 P-Value 0.040 <0.001 <0.001 MEIS1 *r -0.312 0.415 0.534 P-Value 0.030 <0.001 <0.001 Myocardin *r -0.216 0.341 0.441 P-Value 0.060 0.240 0.430 IL: Interleukin, TNF-α: Tumor Necrosis Factor alpha, p-value<0.05 is significant Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 16 Apr, 2024 Reviews received at journal 15 Apr, 2024 Reviewers agreed at journal 04 Apr, 2024 Reviews received at journal 03 Apr, 2024 Reviewers agreed at journal 03 Apr, 2024 Reviewers invited by journal 03 Apr, 2024 Editor assigned by journal 01 Apr, 2024 Submission checks completed at journal 01 Apr, 2024 First submitted to journal 31 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4194767","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":287246572,"identity":"df730d12-d331-4484-9907-1b2ca540c828","order_by":0,"name":"Elnaz Javanshir","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Elnaz","middleName":"","lastName":"Javanshir","suffix":""},{"id":287246574,"identity":"22c579a4-22b7-4f2e-867a-f1408c6e1f4b","order_by":1,"name":"Zahra Javadpour Ebrahimi","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"Javadpour","lastName":"Ebrahimi","suffix":""},{"id":287246575,"identity":"be28a057-0448-4e3e-949d-d72790f8504b","order_by":2,"name":"Seyedeh Tarlan MirzohrehM","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Seyedeh","middleName":"Tarlan","lastName":"MirzohrehM","suffix":""},{"id":287246577,"identity":"9d225a59-b3ef-49e0-bab9-dada591f0d93","order_by":3,"name":"Samad Ghaffari","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Samad","middleName":"","lastName":"Ghaffari","suffix":""},{"id":287246579,"identity":"72a3d8eb-a621-4c12-88f6-50c0bf38bd51","order_by":4,"name":"Erfan Banisefid","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Erfan","middleName":"","lastName":"Banisefid","suffix":""},{"id":287246581,"identity":"7c139149-fa24-4b89-b07a-e94c865d6aac","order_by":5,"name":"Naimeh Mesri Alamdari","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Naimeh","middleName":"Mesri","lastName":"Alamdari","suffix":""},{"id":287246583,"identity":"55856c55-214e-4169-9f46-abc62b4817dd","order_by":6,"name":"Neda Roshanravan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHklEQVRIiWNgGAWjYHACAyQSCNiYmQ8AKQkZ4rXwsbclgLTwEK9FjucMmI1Tizl788YPjHts7M3Zzx778LPNLo9NIufzqxs1FjwM7IePbsCixbLnWLEEw7O0xJ09eckze9uSi9kkcrdZ5xwDOownLe0GNlfdyDGQYDhwOMHgQI4xA88Z5sQ2oBbjHDagFgkeM6xa7r8x/gHUYm9w/o0x458z9UAtOc+Mc/7h0XKDxwxkC+OGGznGzDwVhxPbgFY9zm3Do+VMWplFwoG0xA033hgzy1QcT2xjbzNjzu2T4GHD5Zfjhzff+HDABuiwHGPGNwbVifObmR9/zvlWJ8fPfvgYNi1gkIDGZ5MAk7iUYwPMH0hRPQpGwSgYBcMeAADazGJ8/GZYkAAAAABJRU5ErkJggg==","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Neda","middleName":"","lastName":"Roshanravan","suffix":""}],"badges":[],"createdAt":"2024-03-31 08:29:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4194767/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4194767/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54109003,"identity":"3114724f-94c6-4189-9427-8258a99ba93f","added_by":"auto","created_at":"2024-04-04 17:41:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":83793,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression level of IL-10 (A), IL-6 (B) and TNF-α(C) genes in two healthy groups and CAD group\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFold change of IL-10, IL-6, and TNF-α mRNAs expression. Values are the mean of fold change ± s.e.m. Data analysis was done using independent-t test. ***P \u0026lt; 0.05 \u003cem\u003evs\u003c/em\u003e. normal group. Abbreviations: IL-10, Interleukin 10; IL-6, Interleukin 6, TNF-α, Tumour Necrosis Factor alpha\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4194767/v1/4e2aad4c43652abf56c43353.png"},{"id":54109004,"identity":"d3a0db16-54bc-4923-9997-1f0a3ca25adb","added_by":"auto","created_at":"2024-04-04 17:41:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":60377,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression level of HIRA(A) ، MEIS1(B) and Myocardian (C) genes in two healthy groups and CAD group\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFold change of HIR, MEIS1, and Myocardian mRNAs expression. Values are the mean of fold change ± s.e.m. Data analysis was done using independent-t test. ***P \u0026lt; 0.05 vs. normal group. Abbreviations: HIRA, Histone cell cycle regulator; MEIS1, Myeloid ecotropic viral integration site 1\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4194767/v1/4c704f401b7d987d32d756f2.png"},{"id":54109638,"identity":"d199ccb0-d537-47a3-9c7e-8353597d9d09","added_by":"auto","created_at":"2024-04-04 17:49:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":599341,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4194767/v1/5ac2294c-fdcc-400e-bd23-91dfb97f2921.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Gene Expression Disparity in Coronary Artery Disease: Insights from MEIS1, HIRA, and Myocardin","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe epidemiological studies highlight that coronary artery disease (CAD) and coronary atherosclerosis stand as the foremost causes of morbidity and mortality in the general population across the globe (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). CAD develops through a series of steps, beginning with a normal blood vessel and progressing toward severe stenosis, accompanied by molecular changes. The molecular alterations and environmental modifications that trigger the onset of cardiovascular disease occur before any morphological abnormalities in the tissue (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Molecular alterations research can offer significant insights into the early identification of CAD severity in asymptomatic individuals, thus providing valuable information (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Additionally, there have been reports linking gene expression variants in peripheral blood cells with the extent of CAD severity (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Therefore, exploring gene expression variations concerning CAD severity could prove to be a potent methodology to gain a deeper understanding of the underlying causes of CAD (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMonocytes, which are the predominant type of mononuclear cells in peripheral blood, play a crucial role in the development of atherosclerosis. The attachment of monocytes to the endothelium and their migration into the intima are crucial processes in the development of atherosclerosis (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Possessing an extensive array of approximately 10,000 genes, monocytes contain genes associated with immunity and coronary artery disease (CAD). The expression of monocyte genes can be modified in response to environmental stimuli, potentially serving as a distinctive indicator for individuals at an elevated risk of CAD (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOne of the recent discoveries in the field of cardiovascular research is the role of Myeloid ecotropic viral integration site 1 (MEIS1) in the regulation of the cell cycle of cardiomyocytes. This discovery has opened up new avenues for researchers to explore the role of MEIS1 in the regeneration of the cardiovascular system (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). The MEIS1 transcription factor, belonging to the homeobox (Hox) gene family, plays a crucial role in regulating various biological processes such as oxidative stress responses, differentiation, and embryonic development (\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). The specific molecular mechanisms underlying the role of the MEIS1 gene in cardiac regeneration remain unknown. However, animal studies have provided novel evidence of significant changes associated with the MEIS1 gene. In the context of cardiac function, alterations in the level of MEIS1 have been observed in both postnatal and post-infarcted hearts, leading to the loss of regenerative capacity in mice (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Furthermore, recent research has indicated that MEIS1 functions as a novel controller of ischemic arrhythmias in mice and could potentially play a role in the regulation of cardiac conduction and heart rhythm (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). In a study conducted by Mahmoud et al., it was found that deleting the MEIS1 gene in mouse models led to the re-activation of cardiomyocyte mitosis in the adult heart without causing hypertrophy or any other harmful effects on cardiac function. Conversely, overexpression of MEIS1 was found to decrease the proliferation of cardiac cells and inhibit cardiac regeneration(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Moreover, based on findings of previous studies the downregulation of a specific type of circular RNA in MEIS1 downstream promoted angiogenesis, which restored the myocardial blood flow in adult mice (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurthermore, investigation into the epigenetic control of cardiac lineage development revealed that the MEIS1/Hoxa9 axis was concentrated in specific enhancers during the cardiac precursor stage. Through an analysis of enhancer-based gene networks, it was observed that MEIS1 activates the enhancer associated with Myocardin (Myocd), a crucial gene in the differentiation and proliferation of vascular smooth muscle cells. This discovery confirms the functional association of Hox proteins with MEIS1 partners at the molecular level during heart development (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). The progression of cardiogenesis involves a sequence of events orchestrated by the regulated expression of various temporal genes, resulting in chromatin and histone modifications. During the embryonic stage, the histone chaperone HIRA influences gene expression as a marker of euchromatin, indicating active gene activity. Conditional knockout of HIRA in embryonic mouse hearts leads to cardiac septal defects, accompanied by the selective down-regulation of MEIS1 (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecent research has established that the analysis of gene expression variations in peripheral blood cells (PBMCs) is a viable method for exploring genetic predisposition, as well as capturing the impact of disease activity, environmental modifiers, and responses to treatment (\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Furthermore, there is convincing evidence that CAD is not only a lipid accumulation-mediated disease but also a chronic inflammatory disease of the vessel wall that is largely driven by an innate immune response through myeloid cells such as monocytes and macrophages (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBased on the findings that MEIS1 plays a crucial role in cardiac tissue development and progression of myocardial infarction, we aimed to investigate the expression level of MEIS1, HIRA, and Myocardin genes in patients with premature CAD in comparison to healthy subjects and evaluate the relationship between these genes and possible inflammatory factors.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e\u003cstrong\u003eParticipants and data collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study enrolled patients who were diagnosed with and without CAD using coronary angiography (CAG). A total of 35 consecutive patients with CAD and 35 controls with angiographically normal coronary arteries were evaluated in the present study. The inclusion criteria were delineated as follows: Patients over 18 years of age who underwent elective CAG based on the presence of chest-related symptoms or non-invasive tests. Exclusion criteria were a history of valvular heart disease, congenital heart disease, \u0026nbsp;atrial fibrillation, aortic aneurysm, revascularization, coronary artery ectasia, heart failure, pulmonary embolism, chronic obstructive pulmonary disease, acute or chronic infections, cancer, autoimmune or inflammatory diseases, thyroid disease, the administration of medication with anti-inflammatory properties, hepatic or renal dysfunction, left ventricular dysfunction, and left ventricular hypertrophy on echocardiography.\u003c/p\u003e\n\u003cp\u003eAll participants provided written informed consent and the study received approval from the Ethics Committee of Tabriz University of Medical Sciences. From each patient, 5 ml of blood in a fasting state was collected into EDTA (ethylenediaminetetraacetic acid) collection tubes for laboratory and genetic analysis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePBMC isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAn equal volume of blood sample was introduced into phosphate-buffered saline (PBS) and homogenized. The resulting mixture was then carefully added to Falcon tubes containing Ficoll and subjected to centrifugation at a speed of 3000 rpm for 20 minutes at a temperature of 25\u0026deg;C. Upon completion of the designated time, the tubes were carefully retrieved, and the layer consisting of isolated PBMCs was cautiously extracted using a sampler. The extracted PBMCs were then transferred to a separate Falcon tube and subjected to a subsequent wash with PBS (Lymphodex, Innotrain, Germany method)(25).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene Expression \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this research, the expression level of MEIS1, HIRA, Myocardin, IL-10, IL-6, and TNF-\u0026alpha;, genes were investigated using Real Time PCR technique.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA Extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAmbion Trizol LS reagent (Thermo Fisher Scientific, USA) was used to separate high-quality total RNA from freshly acquired PBMCs, as directed by the manufacturer. The resulting solution was transferred to -70\u0026deg;C for storage, to enable subsequent cDNA synthesis and Real Time PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction quality\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA spectrophotometer (NanoDrop\u0026trade; One/OneC Microvolume UV, Thermo Scientific) was used to measure the relative absorbance ratio at A260/280 and A260/230, confirming the purity and quantity of RNA.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ecDNA Synthesis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNA was transcribed to cDNA using Ferments\u0026apos; RevertAidTM First Strand cDNA Synthesis Kit, which included a reverse transcription enzyme and Random Hexamer Primer. The reverse transcription reaction for cDNA synthesis was performed using a thermocycler (SENSQUEST) in accordance with the temperature program. The resulting cDNA product can be directly utilized for Real Time PCR reactions or stored at -20\u0026deg;C for future use\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal Time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReal-time reverse transcription PCR (qRT-PCR) was used to quantify mRNA in the samples. The Roche Life Science/Real-Time PCR (LightCycler\u0026reg; Instrument, Germany) assessed the expression levels of MEIS1, HIRA, Myocardin, IL-10, IL-6, and TNF-\u0026alpha; mRNAs. The SYBR Green Master Mix (AMPLIQON, Denmark) was used for qRT-PCR. The amplification procedure included one cycle at 95\u0026deg;C for 5 minutes, followed by 40 cycles of denaturing at 95\u0026deg;C for 10 seconds, annealing at 54\u0026deg;C for 35 seconds, and extension at 72\u0026deg;C for 20 seconds. The primer sequences were created using PrimerBank, and NCBI, and are summarized in Table 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe housekeeping gene \u0026beta;-actin was used as an endogenous reference gene, and relative quantification was done by normalizing the signals of the different genes to the \u0026beta;-actin signal. The relative mRNA abundance was calculated with the 2\u003csup\u003e(-\u0026Delta;\u0026Delta;CT)\u003c/sup\u003e technique\u0026nbsp;(26). All samples were tested in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLaboratory assessment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLaboratory investigations were performed to evaluate a range of parameters encompassing fasting insulin level, fasting glucose, lipid profile, white blood cell count, hemoglobin concentration, platelet count, and C-reactive protein level, across all blood samples.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are presented as means\u0026plusmn;\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003estandard deviations (SD) unless otherwise stated. Statistical analysis was performed using IBM SPSS 24. Fisher\u0026apos;s exact test was utilized to compare the qualitative variables between the two study groups. Additionally, the independent t-test was employed to compare the quantitative variables between the two groups. Pearson\u0026apos;s correlation analysis was used to examine the relationships between HIRA, MEIS, Myocardin, and cytokines expression. \u0026nbsp;A significance level of p\u0026lt;0.05 was considered statistically significant\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eDemographic and laboratory assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe analysis of demographic data and biochemical markers in the two study groups demonstrated that individuals with CAD exhibited higher total cholesterol (TC) levels (166.3 \u0026plusmn; 5.05) compared to the healthy control group (138 \u0026plusmn; 8.38), with a statistically significant p-value of 0.015. Furthermore, patients with CAD displayed a significantly elevated mean fasting blood sugar (FBS) level (151 \u0026plusmn; 6.72) in comparison to the healthy control group (118.2 \u0026plusmn; 10.6), with a p-value of 0.027. Detailed results are presented in \u003cstrong\u003eTable 2\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCytokines\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eexpression level (IL-10, IL-6 and TNF-\u0026alpha;)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure 1\u003c/strong\u003e (A-C) illustrates the levels of gene expression for both anti-inflammatory and inflammatory factors. According to the data, the expression level of the IL-10 gene in the CAD group has decreased by 55% compared to the normal group (Fold change=0.45, P-value=0.004). Conversely, the expression of the IL-6 inflammatory factor gene in the CAD group showed a non-significant increase of 1.2 times compared to the normal group (Fold changes=1.20, P-value=0.141). In addition, the expression level of the TNF-\u0026alpha; gene in the CAD group was significantly increased by 2.4 times compared to the normal group (Fold changes=2.4, P-value=0.008).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHIRA, Myocardin, MEIS1 expression level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure 2\u003c/strong\u003e (A-C) revealed that the CAD group exhibited a significant elevation in HIRA gene expression, with a fold change of 3.6, which was significantly higher compared to the healthy group (P-value\u0026lt;0.001). Similarly, the CAD group demonstrated a significant increase in MEIS1 mRNA expression, with a fold change of 2.45, when compared to the control group (P-value\u0026lt;0.001). On the other hand, the Myocardian gene expression in the CAD group displayed a non-significant increase of 1.74 times in comparison to the normal group, with a fold change of 1.74 (P-value=0.241).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrelation analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHIRA and cytokines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was an inverse correlation between the gene expressions of HIRA and the anti-inflammatory factor IL-10 (r= -0.326), while a significant positive correlation was revealed between the HIRA gene and the inflammatory factors IL-6 (r= 0.453) and TNF-\u0026alpha; (r= 0.572). Elevating the expression of the HIRA gene leads to a reduction in IL-10 expression and an increase in IL-6 and TNF-\u0026alpha; expression \u003cstrong\u003e(Table 3)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMEIS1 and Cytokines\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe findings indicated that the MEIS1 gene exhibited a negative correlation with the anti-inflammatory cytokine IL-10 (r= -0.312) while showing a positive correlation with the pro-inflammatory cytokines IL-6 (r= 0.415) and TNF-\u0026alpha; (r= 0.534). Elevating the expression levels of the MEIS1 gene leads to a reduction in IL-10 expression and an elevation in IL-6 and TNF-\u0026alpha; expression \u003cstrong\u003e(Table 3)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMyocardin and cytokines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere is not a statistically significant correlation between the Myocardin mRNA expression and the present anti-inflammatory and inflammatory factors \u003cstrong\u003e(Table 3)\u003c/strong\u003e.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study introduces new findings that establish a previously unexplored expression level of early cardiac genes in PBMCs of patients with stable CAD and their connection with pro/anti-inflammatory cytokines. Our investigation successfully demonstrated that CAD patients display altered expression patterns of MEIS1, HIRA, and Myocardin as early cardiac marker genes associated with cardiovascular disease in the PBMCs of stable CAD patients compared to healthy individuals serving as controls. Moreover, findings revealed a statistically significant positive correlation between the expression levels of MEIS1 and HIRA genes and the levels of TNF-a and IL-6 cytokines. Conversely, a negative correlation was observed between the expression levels of MEIS1 and HIRA genes and the expression levels of Il-10 cytokine.\u003c/p\u003e \u003cp\u003eDespite significant advancements in the treatment and comprehension of the intricate disease of atherosclerosis over the past two decades, the condition remains a significant source of morbidity and mortality, particularly in its advanced stages (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Due to the systemic nature of atherosclerosis, our hypothesis posits that individuals afflicted with this condition exhibit indicators in their peripheral blood that signify the progression of the disease. In recent times, the practice of gene expression profiling in peripheral blood has gained widespread usage in the identification of pathophysiological mechanisms and risk prediction markers for various diseases(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the specific context of coronary artery disease, numerous studies have explored the transcriptome of peripheral blood (\u003cspan additionalcitationids=\"CR30 CR31\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), as well as purified monocytes or mononuclear cells (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). These investigations were designed to assess the transcriptome in the presence of coronary artery disease or to forecast the extent of the disease based on transcriptomic data.\u003c/p\u003e \u003cp\u003eOver the last twenty years, scientists have identified various genes that play a role in the development and healing of the cardiovascular system and could be potential targets for therapy (\u003cspan additionalcitationids=\"CR35 CR36\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Notably, Nkx2.5, HIRA, Tbx20, and Myocardin have been identified as pivotal genes in the cardiovascular development process (\u003cspan additionalcitationids=\"CR39 CR40\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). The discovery of MEIS1 and its involvement in regulating the cell cycle of cardiomyocytes has provided researchers with a new opportunity to understand its role in cardiovascular regeneration (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Since being first identified, MEIS1 has been extensively studied by researchers who have investigated its involvement in limb development and various medical conditions, such as cardiac defects. As a result, there has been significant interest in exploring MEIS1 as a potential target for therapeutic interventions (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eXiang and colleagues have reported that MEIS1 is directly bound and repressed by Tbx20, a gene that is specific to the cardiac tissue, in adult cardiomyocytes (CM). This repression of MEIS1 by Tbx20 promotes the proliferation of adult CMs and helps to preserve cardiac performance following myocardial infarction (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). The use of RNA-Sequence techniques in the study of cardiac development has revealed that MEIS1 and Nkx2-5 bind to the enhancers of multiple regulatory genes involved in the heart (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). These studies provide some insight into the genes that interact with MEIS1. Research findings provide a limited understanding of the upstream and downstream genes associated with MEIS1. Specifically, HIRA has been identified as a binding agent to the enhancer of MEIS1, thereby facilitating the activation of its expression. This activation subsequently initiates the activation of numerous cardiac-specific genes downstream during the process of myocardial differentiation (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Our study showed that patient with CAD expressed higher levels of circulating MEIS1 and HIRA compared to healthy controls.\u003c/p\u003e \u003cp\u003eFurthermore, our findings regarding the modified expression of Myocardin genes in PBMCs of patients with CAD compared to individuals without the disease are consistent with previous research, suggesting that peripheral blood may serve as a potential indicator of gene expression changes occurring in response to CAD (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn additon, the results of the correlation analysis revealed a statistically significant positive correlation between the expression levels of MEIS1 and HIRA genes and the levels of TNF-a and IL-6 cytokines. Conversely, a negative correlation was observed between the expression levels of MEIS1 and HIRA genes with the expression levels of Il-10 cytokine.\u003c/p\u003e \u003cp\u003eIncreased concentrations of proinflammatory cytokines, including IFN-γ, IL-1β, IL-6, and TNF-α, have been associated with a range of cardiovascular diseases, such as coronary heart disease, atherosclerotic heart disease, and congestive heart failure. These cytokines are pivotal in the pathogenesis of atherosclerotic plaque formation(\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe buildup of various cells and material, including macrophages, fatty cells, mast cells, T cells, and other degenerative substances, in the inner layer of artery walls, referred to as the \"tunica intima,\" leads to the creation of atheroma (\u003cspan additionalcitationids=\"CR47\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). This fatty deposit is then followed by the release of different inflammatory molecules, cytokines, and chemokines by activated macrophages, resulting in tissue damage and inflammation (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMoreover, it is widely acknowledged within the scientific community that inflammatory cytokines play a crucial role in the pathogenesis of diverse chronic inflammatory conditions. A recent study has shed light on the fact that the excessive release of cytokines, including TNF-α, IL-6, and IL-1, actively contributes to the amplification of proatherogenic gene expression (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe initial step in causing inflammation within the vessel wall is the buildup and penetration of the tunica intima by endothelial cells. This occurs when LDL undergo changes, either through enzymatic breakdown or oxidation, in the inner layer of the vessel (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). These modifications cause the release of phospholipids, which activate endothelial cells and may expedite the expression of genes related to inflammation. This process can then trigger a series of inflammatory reactions within the artery due to the presence of cells or lipids filled with fats (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eChemokines are responsible for the recruitment of monocytes into the tunica intima, where they undergo transformation into macrophages(\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). These macrophages play a critical role in initiating the formation of foam cells(\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). Furthermore, the macrophages undergo multiplication and release various inflammatory cytokines and growth factors, thereby amplifying proinflammatory signals. This process is crucial for the proper development of atherosclerotic lesions. Additionally, it upregulates toll-like receptors, which, upon stimulation, initiate a signaling cascade that activates the cell (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e). The activated macrophage then releases cytotoxic oxygen, proteases, nitrogen radical molecules, and inflammatory cytokines (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAltogether, PBMC are an integral part of the immune system and have been found to play a crucial role in the development of atherosclerosis and the gene expressions within them have been extensively studied in relation to atherogenesis and shown to contribute significantly to the pathophysiological mechanisms involved in the development and progression of this cardiovascular disease. These gene expressions stimulate the production and secretion of pro-inflammatory cytokines which perpetuate the inflammatory response and promote the recruitment of additional immune cells into the plaque.\u003c/p\u003e \u003cp\u003eIt can be inferred that some genes including MEIS1 and HIRA may have an impact on controlling the synthesis of pro-inflammatory cytokines such as TNF-a and IL-6, as well as suppressing the production of the anti-inflammatory cytokine Il-10. To gain a comprehensive understanding of the underlying mechanisms and the possible consequences for disease progression and therapy, additional investigation is required.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOverall, this research has demonstrated a distinct disparity in the expression levels of MEIS1, HIRa and Myocardin as early myocardial marker genes between individuals with CAD and those in a normal physiological state. Additionally, it appears that two specific genes, MEIS1 and HIRA, may play a significant role in regulating the synthesis of pro-inflammatory cytokines, namely TNF-a and IL-6.\u003c/p\u003e \u003cp\u003eInterestingly, the study suggests that MEIS1 and HIRA may also be involved in suppressing the production of an anti-inflammatory cytokine, Il-10. It is important to note that a definitive causal relationship cannot be established based on these findings alone. If a direct association does exist, it would be reasonable to hypothesize that early developmental genes may be implicated in the pathogenesis of this disease.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ethics committee of the Tabriz University of Medical Science reviewed and approved\u003c/p\u003e\n\u003cp\u003ethe study protocol (ethics code: IR.TBZMED.REC.1402.280)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authorization to perform this research was granted by the Cardiovascular Research Center at Tabriz University of Medical Sciences, for which the authors are grateful. The authors would also like to thank all of the patients who took part in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZ.J and S.M contributed to write text.\u003c/p\u003e\n\u003cp\u003eN.R and S.G contributed to modify text mistakes.\u003c/p\u003e\n\u003cp\u003eN.R and E.J contributed to design of the work\u003c/p\u003e\n\u003cp\u003eN,M and E.B contributed to prepare tables and figures.\u003c/p\u003e\n\u003cp\u003eE.J and Z.J contributed to analyze data.\u003c/p\u003e\n\u003cp\u003eN.M and E.B contributed to collect data.\u003c/p\u003e\n\u003cp\u003eN.R contributed to submit manuscript and will coordinate between authors.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKuller LH. Ethnic differences in atherosclerosis, cardiovascular disease and lipid metabolism. Current opinion in lipidology. 2004;15(2):109-13.\u003c/li\u003e\n\u003cli\u003eMarmot M, Marmot M, Elliott P. Coronary heart disease epidemiology: from aetiology to public health: Oxford Medical Publications; 2005.\u003c/li\u003e\n\u003cli\u003eMartin-Lorenzo M, Gonzalez-Calero L, Maroto AS, Martinez PJ, Zubiri I, de la Cuesta F, et al. Cytoskeleton deregulation and impairment in amino acids and energy metabolism in early atherosclerosis at aortic tissue with reflection in plasma. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 2016;1862(4):725-32.\u003c/li\u003e\n\u003cli\u003eFrąk W, Wojtasińska A, Lisińska W, Młynarska E, Franczyk B, Rysz J. Pathophysiology of Cardiovascular Diseases: New Insights into Molecular Mechanisms of Atherosclerosis, Arterial Hypertension, and Coronary Artery Disease. Biomedicines. 2022;10(8).\u003c/li\u003e\n\u003cli\u003ePatterson AJ, Song MA, Choe D, Xiao D, Foster G, Zhang L. Early Detection of Coronary Artery Disease by Micro-RNA Analysis in Asymptomatic Patients Stratified by Coronary CT Angiography. Diagnostics (Basel). 2020;10(11).\u003c/li\u003e\n\u003cli\u003eJaffer FA, Verjans JW. Molecular imaging of atherosclerosis: clinical state-of-the-art. Heart. 2014;100(18):1469-77.\u003c/li\u003e\n\u003cli\u003eAnand SS, Yusuf S, Vuksan V, Devanesen S, Teo KK, Montague PA, et al. Differences in risk factors, atherosclerosis, and cardiovascular disease between ethnic groups in Canada: the Study of Health Assessment and Risk in Ethnic groups (SHARE). The lancet. 2000;356(9226):279-84.\u003c/li\u003e\n\u003cli\u003eKhera AV, Kathiresan S. Genetics of coronary artery disease: discovery, biology and clinical translation. Nat Rev Genet. 2017;18(6):331-44.\u003c/li\u003e\n\u003cli\u003eKang H, Li X, Xiong K, Song Z, Tian J, Wen Y, et al. The Entry and Egress of Monocytes in Atherosclerosis: A Biochemical and Biomechanical Driven Process. Cardiovasc Ther. 2021;2021:6642927.\u003c/li\u003e\n\u003cli\u003eZeller T, Hughes M, Tuovinen T, Schillert A, Conrads-Frank A, Ruijter H, et al. BiomarCaRE: rationale and design of the European BiomarCaRE project including 300,000 participants from 13 European countries. Eur J Epidemiol. 2014;29(10):777-90.\u003c/li\u003e\n\u003cli\u003ePaul S, Zhang X, He JQ. Homeobox gene Meis1 modulates cardiovascular regeneration. Semin Cell Dev Biol. 2020;100:52-61.\u003c/li\u003e\n\u003cli\u003eRoychoudhury J, Clark JP, Gracia-Maldonado G, Unnisa Z, Wunderlich M, Link KA, et al. MEIS1 regulates an HLF-oxidative stress axis in MLL-fusion gene leukemia. Blood. 2015;125(16):2544-52.\u003c/li\u003e\n\u003cli\u003eSu Z, Si W, Li L, Zhou B, Li X, Xu Y, et al. MiR-144 regulates hematopoiesis and vascular development by targeting meis1 during zebrafish development. The International Journal of Biochemistry \u0026amp; Cell Biology. 2014;49:53-63.\u003c/li\u003e\n\u003cli\u003eMahmoud AI, Kocabas F, Muralidhar SA, Kimura W, Koura AS, Thet S, et al. Meis1 regulates postnatal cardiomyocyte cell cycle arrest. Nature. 2013;497(7448):249-53.\u003c/li\u003e\n\u003cli\u003eIslam MM, Li Y, Luo H, Xiang M, Cai L. Meis1 regulates Foxn4 expression during retinal progenitor cell differentiation. Biol Open. 2013;2(11):1125-36.\u003c/li\u003e\n\u003cli\u003eNguyen NUN, Canseco DC, Xiao F, Nakada Y, Li S, Lam NT, et al. A calcineurin-Hoxb13 axis regulates growth mode of mammalian cardiomyocytes. Nature. 2020;582(7811):271-6.\u003c/li\u003e\n\u003cli\u003eLiu Y, Li J, Xu N, Yu H, Gong L, Li Q, et al. Transcription factor Meis1 act as a new regulator of ischemic arrhythmias in mice. J Adv Res. 2022;39:275-89.\u003c/li\u003e\n\u003cli\u003ePfeufer A, van Noord C, Marciante KD, Arking DE, Larson MG, Smith AV, et al. Genome-wide association study of PR interval. Nat Genet. 2010;42(2):153-9.\u003c/li\u003e\n\u003cli\u003eHuang S, Li X, Zheng H, Si X, Li B, Wei G, et al. Loss of Super-Enhancer-Regulated circRNA Nfix Induces Cardiac Regeneration After Myocardial Infarction in Adult Mice. Circulation. 2019;139(25):2857-76.\u003c/li\u003e\n\u003cli\u003eValenzuela N, Fan Q, Fa\u0026apos;ak F, Soibam B, Nagandla H, Liu Y, et al. Cardiomyocyte-specific conditional knockout of the histone chaperone HIRA in mice results in hypertrophy, sarcolemmal damage and focal replacement fibrosis. Dis Model Mech. 2016;9(3):335-45.\u003c/li\u003e\n\u003cli\u003eLaguna JC, Alegret M. Regulation of gene expression in atherosclerosis: insights from microarray studies in monocytes/macrophages. Pharmacogenomics. 2012;13(4):477-95.\u003c/li\u003e\n\u003cli\u003eAziz H, Zaas A, Ginsburg GS. Peripheral blood gene expression profiling for cardiovascular disease assessment. Genomic medicine. 2007;1(3):105-12.\u003c/li\u003e\n\u003cli\u003eN\u0026uuml;hrenberg TG, Langwieser N, Binder H, Kurz T, Stratz C, Kienzle RP, et al. Transcriptome analysis in patients with progressive coronary artery disease: identification of differential gene expression in peripheral blood. J Cardiovasc Transl Res. 2013;6(1):81-93.\u003c/li\u003e\n\u003cli\u003eWolf D, Ley K. Immunity and Inflammation in Atherosclerosis. Circ Res. 2019;124(2):315-27.\u003c/li\u003e\n\u003cli\u003eGhavami A, Roshanravan N, Alipour S, Barati M, Mansoori B, Ghalichi F, et al. Assessing the Effect of High Performance Inulin Supplementation via KLF5 mRNA Expression in Adults with Type 2 Diabetes: A Randomized Placebo Controlled Clinical Trail. Advanced pharmaceutical bulletin. 2018;8(1):39-47.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif). 2001;25(4):402-8.\u003c/li\u003e\n\u003cli\u003eHong J, Maron DJ, Shirai T, Weyand CM. Accelerated atherosclerosis in patients with chronic inflammatory rheumatologic conditions. International journal of clinical rheumatology. 2015;10(5):365-81.\u003c/li\u003e\n\u003cli\u003eMohr S, Liew CC. The peripheral-blood transcriptome: new insights into disease and risk assessment. Trends in molecular medicine. 2007;13(10):422-32.\u003c/li\u003e\n\u003cli\u003eKontaraki JE, Kochiadakis GE, Marketou ME, Chlouverakis G, Igoumenidis NE, Saloustros IG, et al. Early cardiac gene transcript levels in peripheral blood mononuclear cells reflect severity in stable coronary artery disease. Hellenic journal of cardiology : HJC = Hellenike kardiologike epitheorese. 2014;55(2):119-25.\u003c/li\u003e\n\u003cli\u003eMa J, Liew CC. Gene profiling identifies secreted protein transcripts from peripheral blood cells in coronary artery disease. Journal of molecular and cellular cardiology. 2003;35(8):993-8.\u003c/li\u003e\n\u003cli\u003ePatino WD, Mian OY, Kang JG, Matoba S, Bartlett LD, Holbrook B, et al. Circulating transcriptome reveals markers of atherosclerosis. Proceedings of the National Academy of Sciences of the United States of America. 2005;102(9):3423-8.\u003c/li\u003e\n\u003cli\u003eLiu M, Jiang S, Ma Y, Ma J, Hassan W, Shang J. Peripheral-blood gene expression profiling studies for coronary artery disease and its severity in Xinjiang population in China. Lipids in health and disease. 2018;17(1):154.\u003c/li\u003e\n\u003cli\u003eSinnaeve PR, Donahue MP, Grass P, Seo D, Vonderscher J, Chibout SD, et al. Gene expression patterns in peripheral blood correlate with the extent of coronary artery disease. PloS one. 2009;4(9):e7037.\u003c/li\u003e\n\u003cli\u003eLee SJ, Lee CK, Kang S, Park I, Kim YH, Kim SK, et al. Angiopoietin-2 exacerbates cardiac hypoxia and inflammation after myocardial infarction. The Journal of clinical investigation. 2018;128(11):5018-33.\u003c/li\u003e\n\u003cli\u003eIngason AB, Goldstone AB, Paulsen MJ, Thakore AD, Truong VN, Edwards BB, et al. Angiogenesis precedes cardiomyocyte migration in regenerating mammalian hearts. The Journal of thoracic and cardiovascular surgery. 2018;155(3):1118-27.e1.\u003c/li\u003e\n\u003cli\u003eMiyagawa S, Sawa Y, Taketani S, Kawaguchi N, Nakamura T, Matsuura N, et al. [Myocardial regeneration therapy for heart failure: hepatocyte growth factor enhances the effect of cellular cardiomyoplasty]. Journal of cardiology. 2003;41(1):36-8.\u003c/li\u003e\n\u003cli\u003eMathison M, Gersch RP, Nasser A, Lilo S, Korman M, Fourman M, et al. In vivo cardiac cellular reprogramming efficacy is enhanced by angiogenic preconditioning of the infarcted myocardium with vascular endothelial growth factor. Journal of the American Heart Association. 2012;1(6):e005652.\u003c/li\u003e\n\u003cli\u003eChung IM, Rajakumar G. Genetics of Congenital Heart Defects: The NKX2-5 Gene, a Key Player. Genes. 2016;7(2).\u003c/li\u003e\n\u003cli\u003eDilg D, Saleh RN, Phelps SE, Rose Y, Dupays L, Murphy C, et al. HIRA Is Required for Heart Development and Directly Regulates Tnni2 and Tnnt3. PloS one. 2016;11(8):e0161096.\u003c/li\u003e\n\u003cli\u003eChen JF, Wang S, Wu Q, Cao D, Nguyen T, Chen Y, et al. Myocardin marks the earliest cardiac gene expression and plays an important role in heart development. Anatomical record (Hoboken, NJ : 2007). 2008;291(10):1200-11.\u003c/li\u003e\n\u003cli\u003eMandel EM, Kaltenbrun E, Callis TE, Zeng XX, Marques SR, Yelon D, et al. The BMP pathway acts to directly regulate Tbx20 in the developing heart. Development (Cambridge, England). 2010;137(11):1919-29.\u003c/li\u003e\n\u003cli\u003eMercader N, Leonardo E, Azpiazu N, Serrano A, Morata G, Mart\u0026iacute;nez C, et al. Conserved regulation of proximodistal limb axis development by Meis1/Hth. Nature. 1999;402(6760):425-9.\u003c/li\u003e\n\u003cli\u003eXiang FL, Guo M, Yutzey KE. Overexpression of Tbx20 in Adult Cardiomyocytes Promotes Proliferation and Improves Cardiac Function After Myocardial Infarction. Circulation. 2016;133(11):1081-92.\u003c/li\u003e\n\u003cli\u003eDupays L, Shang C, Wilson R, Kotecha S, Wood S, Towers N, et al. Sequential Binding of MEIS1 and NKX2-5 on the Popdc2 Gene: A Mechanism for Spatiotemporal Regulation of Enhancers during Cardiogenesis. Cell reports. 2015;13(1):183-95.\u003c/li\u003e\n\u003cli\u003eTian R, Hou G, Li D, Yuan TF. A possible change process of inflammatory cytokines in the prolonged chronic stress and its ultimate implications for health. TheScientificWorldJournal. 2014;2014:780616.\u003c/li\u003e\n\u003cli\u003eHotamisligil GS. Endoplasmic reticulum stress and atherosclerosis. Nature medicine. 2010;16(4):396-9.\u003c/li\u003e\n\u003cli\u003eOh J, Riek AE, Weng S, Petty M, Kim D, Colonna M, et al. Endoplasmic reticulum stress controls M2 macrophage differentiation and foam cell formation. The Journal of biological chemistry. 2012;287(15):11629-41.\u003c/li\u003e\n\u003cli\u003eHansson GK. Inflammation, atherosclerosis, and coronary artery disease. The New England journal of medicine. 2005;352(16):1685-95.\u003c/li\u003e\n\u003cli\u003eMehta JL, Saldeen TG, Rand K. Interactive role of infection, inflammation and traditional risk factors in atherosclerosis and coronary artery disease. Journal of the American College of Cardiology. 1998;31(6):1217-25.\u003c/li\u003e\n\u003cli\u003eLibby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation. 2002;105(9):1135-43.\u003c/li\u003e\n\u003cli\u003eClinton SK, Underwood R, Hayes L, Sherman ML, Kufe DW, Libby P. Macrophage colony-stimulating factor gene expression in vascular cells and in experimental and human atherosclerosis. The American journal of pathology. 1992;140(2):301-16.\u003c/li\u003e\n\u003cli\u003eYudkin JS, Kumari M, Humphries SE, Mohamed-Ali V. Inflammation, obesity, stress and coronary heart disease: is interleukin-6 the link? Atherosclerosis. 2000;148(2):209-14.\u003c/li\u003e\n\u003cli\u003eLeitinger N. Oxidized phospholipids as modulators of inflammation in atherosclerosis. Curr Opin Lipidol. 2003;14(5):421-30.\u003c/li\u003e\n\u003cli\u003eDai G, Kaazempur-Mofrad MR, Natarajan S, Zhang Y, Vaughn S, Blackman BR, et al. Distinct endothelial phenotypes evoked by arterial waveforms derived from atherosclerosis-susceptible and -resistant regions of human vasculature. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(41):14871-6.\u003c/li\u003e\n\u003cli\u003eLibby P. Inflammation and cardiovascular disease mechanisms. The American journal of clinical nutrition. 2006;83(2):456s-60s.\u003c/li\u003e\n\u003cli\u003eSmith JD, Trogan E, Ginsberg M, Grigaux C, Tian J, Miyata M. Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E. Proceedings of the National Academy of Sciences of the United States of America. 1995;92(18):8264-8.\u003c/li\u003e\n\u003cli\u003eEdfeldt K, Swedenborg J, Hansson GK, Yan ZQ. Expression of toll-like receptors in human atherosclerotic lesions: a possible pathway for plaque activation. Circulation. 2002;105(10):1158-61.\u003c/li\u003e\n\u003cli\u003eJaneway CA, Jr., Medzhitov R. Innate immune recognition. Annual review of immunology. 2002;20:197-216.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable1. sequence of Genes primers for qRT-PCR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.84599589322382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.15400410677618%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.84599589322382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMEIS1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.15400410677618%\" valign=\"top\"\u003e\n \u003cp\u003eForward: GGCTCCTCTGTCAATGACG\u003c/p\u003e\n \u003cp\u003eReverse: GGGGTACAAGTAGCTAATTCACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.84599589322382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHIRA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.15400410677618%\" valign=\"top\"\u003e\n \u003cp\u003eForward: CCACTGCCCAGATCATCGAAC\u003c/p\u003e\n \u003cp\u003eReverse: CTAGGCTTCGCAGAACTCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.84599589322382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMyocardin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.15400410677618%\" valign=\"top\"\u003e\n \u003cp\u003eForward: AAAAGATGGCTGGTTTACACT\u003c/p\u003e\n \u003cp\u003eReverse: GGTCATTTGCTGCTTTACGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.84599589322382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL-10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.15400410677618%\" valign=\"top\"\u003e\n \u003cp\u003eForward: GTTGAGCTGTTTTCCCTGA\u003c/p\u003e\n \u003cp\u003eReverse: TGAAGTGGTTGGGGAATGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.84599589322382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL-6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.15400410677618%\" valign=\"top\"\u003e\n \u003cp\u003eForward: GCAGAAAACAACCTGAACC\u003c/p\u003e\n \u003cp\u003eReverse: GCTTGTTCCTCACTACTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.84599589322382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTNF-\u0026alpha;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.15400410677618%\" valign=\"top\"\u003e\n \u003cp\u003eForward: GCAGGTCTACTTTGGGATCATT\u003c/p\u003e\n \u003cp\u003eReverse: AGAAGAGGTTGAGGGTGTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.84599589322382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026beta;-actin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.15400410677618%\" valign=\"top\"\u003e\n \u003cp\u003eForward \u0026nbsp; GGTGAAGGTGACAGCAGT\u003c/p\u003e\n \u003cp\u003eReverse \u0026nbsp; TGGGGTGGCTTTTAGGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2: Baseline characteristics of the study population\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"623\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCAD group\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl group\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-Value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e54.7 \u0026plusmn; 1.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e54.3 \u0026plusmn; 0.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.790\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.85897435897436%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGender\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.14102564102564%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMale\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e18 (51.9%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e23 (65.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.141\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.81218274111675%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFemale\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.59390862944162%\" valign=\"top\"\u003e\n \u003cp\u003e17 (48.1%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.59390862944162%\" valign=\"top\"\u003e\n \u003cp\u003e12 (34.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eBMI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e28.4 \u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e28.9 \u0026plusmn; 0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.646\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSBP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e121.6 \u0026plusmn; 2.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e122.4 \u0026plusmn; 11.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.786\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDBP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e78.2 \u0026plusmn; 1.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e79.6 \u0026plusmn; 1.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.756\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDM\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e8 (18.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e10 (28.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.479\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHTN\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e13 (37.1%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e18 (51.9%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.237\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHLP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e14 (40%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e15 (42.8%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.796\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHDL-c (mg/dl)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e42.6 \u0026plusmn; 1.3\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e42.7 \u0026plusmn; 2.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.981\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eLDL-c (mg/dl)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e99.8 \u0026plusmn; 7.5\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e75.1 \u0026plusmn; 9.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.051\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTG (mg/dl)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e182.3 \u0026plusmn; 10.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e99.3 \u0026plusmn; 10.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.051\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTC (mg/dl)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e166.3 \u0026plusmn; 5.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e138 \u0026plusmn; 8.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.015\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFBS (mg/dl)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e151.7 \u0026plusmn; 6.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e118.2 \u0026plusmn; 10.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.027\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eBMI: body mass index; SBP: systolic blood pressure; DBP: diastolic blood pressure; DM: diabetes mellitus; HTN: hypertension; HLP: hyperlipidemia; HDL-c: high density lipoprotein; LDL-c: low density lipoprotein; TC: total cholesterol; TG: triglyceride; FBS: fasting blood sugar, p-value\u0026lt;0.05 is significant.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3. Correlation between the gene expressions and the anti-inflammatory and inflammatory factors.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL-10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL-6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTNF-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.942307692307692%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHIRA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.057692307692308%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e*r\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e-0.326\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.453\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.572\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.849162011173185%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-Value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e0.040\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.942307692307692%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMEIS1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.057692307692308%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e*r\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e-0.312\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.415\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.534\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.849162011173185%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-Value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e0.030\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;0.001\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.942307692307692%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMyocardin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.057692307692308%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e*r\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e-0.216\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.341\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003e0.441\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.849162011173185%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-Value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e0.060\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e0.240\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.050279329608937%\" valign=\"top\"\u003e\n \u003cp\u003e0.430\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eIL: Interleukin, TNF-\u0026alpha;: Tumor Necrosis Factor alpha, p-value\u0026lt;0.05 is significant\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"MEIS1, HIRA, Myocardin, cytokines, CAD","lastPublishedDoi":"10.21203/rs.3.rs-4194767/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4194767/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eIntroduction:\u003c/h2\u003e \u003cp\u003eCoronary artery disease (CAD) manifesting in young adults can have devastating consequences. MEIS1 gene plays an important role in vascular networks and heart development. Also, this gene has a great effect on the regeneration capacity of the heart. This study investigates the expression level of MEIS1, HIRA, and Myocardin genes in patients with premature CAD in comparison to healthy subjects and evaluates the relationship between these genes and possible inflammatory factors.\u003c/p\u003e\u003ch2\u003eMethods and Results\u003c/h2\u003e \u003cp\u003eA case-control study was employed to investigate HIRA, MEIS1, and Myocardin gene expression as well as IL-6, IL-10, and TNF-α in Peripheral Blood Mononuclear Cells (PBMCs) obtained from CAD patients. Thirty-five patients diagnosed with CAD and 35 healthy individuals enrolled through simple randomization. RNAs were extracted from PBMCs and cDNA synthesis was performed to determine the expression levels of studied genes using real-time PCR. PBMCs of CAD cases demonstrated higher levels of MEIS1 and HIRA gene expression compared to the control group with a fold change of 2.45 and 3.6 respectively. Expression of MEIS1 exhibited a negative correlation with IL-10 (r= -0.312) expression and a positive correlation with IL-6 (r\u0026thinsp;=\u0026thinsp;0.415) and TNF-α (r\u0026thinsp;=\u0026thinsp;0.534) gene expressions. Moreover, there was an inverse correlation between the gene expressions of HIRA and IL-10 (r= -0.326), and a positive correlation was revealed between this gene and the IL-6 (r\u0026thinsp;=\u0026thinsp;0.453) and TNF-α (r\u0026thinsp;=\u0026thinsp;0.572) gene expressions.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThis research demonstrated a distinct disparity in the expression levels of MEIS1, HIRA, and Myocardin as early myocardial marker genes between individuals with CAD and healthy subjects. Results showed that two specific genes, MEIS1 and HIRA, may play a significant role in regulating the synthesis of pro-inflammatory cytokines, namely TNF-α and IL-6.\u003c/p\u003e","manuscriptTitle":"Gene Expression Disparity in Coronary Artery Disease: Insights from MEIS1, HIRA, and Myocardin","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-04 17:40:58","doi":"10.21203/rs.3.rs-4194767/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-16T08:58:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-15T16:08:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"33d12035-500b-4038-8284-1c935b7ad653","date":"2024-04-04T17:09:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-03T19:23:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"d19ad291-a24d-4c80-acaa-3be961673cc7_SNPRID","date":"2024-04-03T19:05:53+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-03T10:02:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-01T14:05:19+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-01T14:05:19+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2024-03-31T08:14:30+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"20524400-4fb4-4533-8b1e-5aab0d38bbc2","owner":[],"postedDate":"April 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-05-20T10:50:16+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-04 17:40:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4194767","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4194767","identity":"rs-4194767","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}