Role of AMPK/ACC/SREBP-1 and MAPK Pathways in Glucose Intolerance and Liver Dysfunction of Largemouth Bass

Role of AMPK/ACC/SREBP-1 and MAPK Pathways in Glucose Intolerance and Liver Dysfunction of Largemouth Bass | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Role of AMPK/ACC/SREBP-1 and MAPK Pathways in Glucose Intolerance and Liver Dysfunction of Largemouth Bass zhihong liao, xuanshu he, xinyu gu, tao ye, anqi chen, yucai guo, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5652582/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background and Objectives Largemouth bass ( Micropterus salmoides ), a carnivorous fish, struggles to process dietary carbohydrates, often resulting in energy metabolism issues and fatty liver disease. This study explored the liver glycolipid accumulation and mitochondrial dysfunction in both largemouth bass and primary hepatocytes treated with high glucose. Methods An 8-week feeding experiment was conducted to evaluated the effects of high carbohydrate (HC) diet on liver morphology, fatty acid metabolism, bile acid metabolism, and MAPK signaling pathways in largemouth bass. Primary hepatocytes were treated with high-glucose (HG) medium to simulate the conditions of high carbohydrate feeding to further evaluated the effects of high-glucose treatment on cell growth, ROS production, antioxidant capacity, mitochondrial fusion, fission, mitophagy and mitochondrial apoptosis. Results The results showed that the HC diet significantly increased the hepatosomatic and visceral somatic indices, causing liver enlargement, mitochondrial damage, and glycolipid buildup. Compared to a control diet, the HC diet enhanced lipid synthesis through the AMPK/ACC/SREBP-1 pathway and increased the phosphorylation levels of ERK, JNK and p38 MAPK, while it decreased bile acid synthesis by downregulating cholesterol 7-hydroxylase ( CYP7A1 ) and sterol 12-hydroxylase ( CYP8B1 ). In vitro experiments showed that high glucose (HG) treatment in primary hepatocytes inhibited cell growth, promoted apoptosis, increased reactive oxygen species (ROS), and reduced antioxidant capacity. Mechanistically, HG treatment led to mitochondrial fission and damage. Damaged mitochondria bind to autophagosomes for lysosomal degradation, resulting in mitochondrion-dependent apoptosis by regulating p38 MAPK/BCL-2/CAS3 signaling pathway. Conclusions High glucose could not only induce accumulation of lipid and glycogen mediated by the AMPK/ACC/SREBP-1 signaling pathway, but could activate p38MAPK-mediated signaling to induce mitochondrial apoptosis. Largemouth bass AMPK/ACC/SREBP-1 Bile acid metabolism Mitochondrial function Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction In recent years, aquacultural production of largemouth bass ( Micropterus salmoides ) in China has rapidly expanded in parallel to the development and optimization of compound feed. By 2025, Chinese aquaculture production of largemouth bass is predicted to reach 900 thousand tons [1]. Multiple studies have demonstrated that a high carbohydrate content (exceeding 10%) in formulated feed induces prevalent metabolic liver disease [2, 3, 4, 5, 6]. Additionally, high-carbohydrate diets have been shown to induce vacuolization of liver parenchymal cells and reduce survival in largemouth bass, which may be correlated to increased liver damage [7, 8]. Therefore, low-carbohydrate feed has become the predominant choice within the largemouth bass industry [9]. However, the excessive of fish meal in low-carbohydrate feed leads to elevated costs and environmental concerns, significantly impeding the industry's development. Excessive lipid and glycogen accumulation in the liver has been identified as a critical factor contributing to growth retardation and hepatic damage in fish subjected to a high-carbohydrate diet [10, 11]. Hepatic fat accumulation generally arises from an imbalance between lipogenesis and lipolysis, mediated by various transcriptional regulators and enzymatic activities involved in hepatic lipid homeostasis [12]. Xie et al. [13] found that the fat accumulation was greater in Nile tilapia fed high-carbohydrate diets than in fish fed high-fat diets. In hybrid grouper ( Epinephelus fuscoguttatus ♀×E. lanceolatus ♂), a high-carbohydrate diet significantly downregulates ATGL expression, leading to hepatic triglyceride accumulation [14]. The expression levels of fatty acid synthase (FAS) and acetyl-CoA carboxylase 1 (ACC1) are significantly up-regulated, resulting in increased plasma cholesterol and total fat content in grass carp fed with high carbohydrate diets [15]. Furthermore, it was also shown that AMP-activated protein kinase (AMPK) and sterol regulatory element-binding protein 1 (SREBP1) are both involved in triglyceride accumulation in largemouth bass fed high-carbohydrate diet [16]. To fully elucidate the mechanisms of the lipid-increasing effects of high carbohydrate diet, changes in lipogenesis and lipolysis process were studied. The liver is the sole organ for bile acid (BA) synthesis. Bile acid synthesis constitutes the primary mechanism for cholesterol elimination and is crucial for maintaining cholesterol homeostasis [17]. Within the classic bile acid synthesis pathway, cholesterol 7-hydroxylase (CYP7A1) serves as the rate-limiting enzyme, whereas sterol 12-hydroxylase (CYP8B1) facilitates bile acid synthesis. FXR-mediated SHP decreases bile acid biosynthesis by inhibiting CYP7A1 expression [18]. Concurrently, FXR stimulates FGF-19 in the enterocytes, which subsequently activates fibroblast growth factor receptor 4 (FGFR4). This activation triggers the c-JUN and ERK signaling pathways, leading to a reduction in new bile acid synthesis through negative feedback mechanisms [19]. However, these studies predominantly focused on mammals, research on MAPK signaling pathways in farmed fish remains nascent, with limited understanding of the detailed mechanisms and regulatory functions [20, 21, 22, 23, 24]. In Nile tilapia, it has been observed that the NF-κB pathway, rather than the p38 MAPK pathway, is implicated in intestinal inflammation induced by high-carbohydrate diets [25]. In largemouth bass, high carbohydrate intake may impair spleen immune function through inflammatory response mediated by the MAPK/FoxO pathway [26]. To elucidate the mechanisms underlying high-carbohydrate-induced lipid metabolic disorders in largemouth bass, this study will concentrate on the MAPK signaling pathway within vivo and vitro. In mammals and fish, the mitochondria are essential to cellular function, and mitochondrial dysfunction is linked to several diseases [27]. Fish, as ectothermic organisms, exhibit unique mitochondrial adaptations that are essential for their survival in diverse aquatic environments. Moreover, the mechanisms underlying mitochondrial dysfunction in fish are similar to those observed in other vertebrates, including the involvement of oxidative phosphorylation and the role of mitochondrial dynamics in maintaining cellular homeostasis [28]. Liver damage and glycogen accumulation in fish caused by a high-carbohydrate diet can lead to mitochondrial dysfunction, including mitophagy and changes in mitochondrial dynamics [29, 30, 31]. These processes are essential for maintaining mitochondrial homeostasis and overall cellular health. However, to date, no systematic study has been conducted to explore the specific effects of a high carbohydrate diet on mitochondrial homeostasis in largemouth bass. Understanding how high glucose impacts mitochondrial function could provide insights into metabolic disorders in fish and inform dietary strategies to mitigate these effects. Current research on the effects of a high-carbohydrate diet in largemouth bass is predominantly confined to animal experiments, with limited validation at the cellular level [32, 33, 34]. In this study, primary hepatocytes were treated with high-glucose medium to simulate the conditions of high carbohydrate feeding. The purpose of this study is to explore the effects of high carbohydrate diet on lipid metabolism, bile acid metabolism and mitochondrial homeostasis in largemouth bass. Methods Feeding trial and sampling Juvenile largemouth bass were randomly assigned to of one two diets: a control diet (CON) and a high carbohydrate diet (HC) for 8-week trial starting at 8.24 ± 0.01 g initial weight. As shown in Table 1 , these two diets were made, packed, and stored according to our standard laboratory procedures [35]. Briefly, all ingredients were ground into powder and mixed thoroughly by a feed mixer (A-200T Mixer Bench Model unit, Resell Food Equipment Ltd, Ottawa, Canada). A screw-press pelletizer was used to obtain 2.0 mm pellets from the mixture containing fish oil, soy oil, and soya lecithin and water (F-26, South China University of Technology, Guangzhou, China). Pellets were dried at 16°C in a well-ventilated condition until moisture content dropped below 10%, and then stored at -20°C. A total of 240 fish were randomly allocated into 6 tanks (capacity: 100 L) with 30 fish per tank. There were four replicates of each diet. All fish were cultured in an experimental system with commercial feed (Tongwei Co., Ltd., China) for two weeks to adapt to the experimental conditions. During the 8-week trial, fish were fed two times per day at 9:00 and 17:00 and maintained under recirculating aquaculture system of 25–28℃ water temperature, 9.0 mg L − 1 dissolved oxygen, 7.9–8.2 pH, and lower than 0.2 mg L − 1 ammonia nitrogen level. After the trial, fish were anaesthetized and euthanized with MS-222 (200 mg/L; Sigma, USA) and then weighed. The viscera and liver of each fish were also weighed and photographed for the evaluation of hepatic and visceral lipid accumulation. For future analyses, tissues (including liver, heart, brain, intestine, and head kidney) were promptly frozen in liquid nitrogen and stored at -80°C. Table 1 Ingredients and nutrient composition of the experimental diets (% dry matter) Ingredients CON HC Corn starch 0 20 Fish meal 45 45 Krill meal 3 3 Beer yeast 5 5 Soybean meal 10.3 10.3 Wheat gluten 10 10 Fish oil 1 1 Soy oil 1 1 Soya lecithin 1 1 Mineral premix 1 1 1 Vitamin premix 2 1 1 Choline chloride (50%) 0.5 0.5 Monocalcium phosphate 1 1 Vitamin C 0.2 0.2 Bone meal 20 0 Sum 100 100 Nutrient composition (%) Crude protein 47.92 48.66 Crude lipid 6.66 6.68 1 Mineral premix provides the following per kg of diet: MgSO 4 ∙7H 2 O, 1090 mg; KH 2 PO 4 , 932 mg; NaH 2 PO 4 ∙2H 2 O, 432 mg; FeC 6 H 5 O 7 ∙5H 2 O, 181 mg; ZnCl 2 , 80 mg; CuSO 4 ∙5H 2 O, 63 mg; AlCl 3 ∙6H 2 O, 51 mg; MnSO 4 ∙H 2 O, 31mg; KI, 28 mg; CoCl 2 ∙6H 2 O, 6 mg; Na 2 SeO 3 ∙H 2 O, 0.8 mg. 2 Vitamin premix provides the following per kg of diet: Vitamin B 1 , 30 mg; Vitamin B 2 , 60 mg; Vitamin B 6 , 60 mg; Nicotinic acid, 200 mg; Calcium pantothenate, 100 mg; Inositol, 100 mg; Biotin, 2.5 mg; Folic acid, 10 mg; Vitamin B 12 , 0.1 mg; Vitamin K3, 40 mg; Vitamin A, 10000IU, Vitamin, 160 IU. Vitamin B 1 and B 2 are termed as thiamin and riboflavin. PAS staining and glycogen content detection of the liver Liver tissue sections (1–4 µm) were fixed in 4% paraformaldehyde (Servicebio, Wuhan, China) for 24 h and embedded in paraffin. Liver glycogen staining was conducted using the periodic acid-Schiff (PAS) reaction. Images were acquired by a light NikonNi-U microscope (Nikon Corporation, Japan) with 20× magnification. The glycogen content was measured by spectrophotometry using standard commercial kits from Wuhan Abbkine Co., China (KTB1340). Primary hepatocyte isolation and treatment Primary hepatocytes were isolated from juvenile healthy largemouth bass (weight: 10–20 g) livers, which feed with commercial diets (Tongwei Co., Ltd., China) two times per day at 9:00 and 17:00, and cultured following established protocols (35). Briefly, healthy largemouth bass were first bled and sacrificed by gill cutting under sterile conditions. The livers were aseptically excised and finely minced using scissors in phosphate-buffered saline (PBS) at pH 7.4. Subsequently, the minced liver tissue underwent enzymatic digestion with trypsin (25200072; Thermo Fisher, USA) at 28°C for 40 min. The resulting cell suspension was then filtered through a 70 µm mesh and washed multiple times with PBS. A total of 1×10 6 living cells per well were seeded into 6-well plates and culture at 28°C in a humidified incubator with air charge of 5% CO 2 . Cells were treated with either low-glucose (LG; 1000mg/L) or high-glucose (HG; 4500mg/L) for 24 h, 48 h, and 72 h when they reached 70–80% confluence. The cells were pretreated with various concentrations of SB203580 (p38 MAPK pathway inhibitor; S1076, Selleck Chemicals, Houston, Texas, USA) for 2 h, then treated with HG for 48 h. Cell viability assays Cell viability assays were examined by Cell Counting Kit-8 (CCK8) (FD3788; Fdbio Science, HangZhou, China). The isolated primary hepatocytes were seeded in 96-well plates (100 µL/well) at a density of 1×10 4 cell/well. After 24 h, 48 h, and 72 h cultured in either LG or HG medium, 10 µL of CCK8 was added to each well 2 h prior to measuring the absorbance at 450 nm using a multifunctional microplate reader. Annexin V-FITC/PI staining Cell apoptosis was evaluated with flow cytometry (BL110A; Biosharp Life Sciences, Beijing, China). Primary hepatocytes were seeded in 6-well plates and subsequently digested with EDTA-free trypsin after LG or HG treatments. According to the manufacturer's instructions, both the supernatants and cell pellets were collected and stained with 5 µL of Annexin V-FITC and 10 µL of PI staining solution, respectively. The apoptotic cells were detected by flow cytometry (Backman cytoflex). Assessment of mitochondrial membrane potential (MMP) Assessment of the electrical potential across the mitochondrial membrane (ΔΨm). The MMP alterations were evaluated using the MMP assay kit containing JC-1 (C2006; Beyotime Biotechnology, Shanghai, China). Hepatocytes were initially cultured with LG and HG for 48 h, followed by resuspension and subsequent incubation with JC-1 at a temperature of 28°C for 20 min. Afterward, the stained cells were examined with a fluorescence microscope called SP8 STED confocal laser scanning microscope. Measurement of ROS Generation of intracellular ROS was identified by utilizing the H2DCF-DA probe (C-2938; Invitrogen™, Waltham, MA, USA). After LG or HG treated for 48 h, cells were incubated in serum-free DMEM with 15 µM H2DCF-DA for 30 min, shielded from light, and then the medium were replaced with pre-warmed PBS. ROS fluorescence was visualized under a Leica SP8 STED confocal laser scanning microscope (Leica Microsystems GmbH), and the intensities were measured using Image-Pro Plus software. Additionally, the level of ROS was also detected by flow cytometry (Cytoflex, Beckman Coulter, Inc.). Electron microscopy For TEM microscopy, liver tissues and cells were fixed in 2.5% glutaraldehyde (AAPR46; Servicebio, Wuhan, China) and rinsed with PBS. The samples were dehydrated in a graded series of ethanol and embedded in pure resin overnight. In order to observe various structures within the livers and cells, a transmission electron microscope (JEM-1400 Flash, Japan) was used for observation and photography. Oil Red O staining and PAS staining For the cellular experiments, Oil Red O staining and PAS staining were performed according to the manufacturer’s protocol (cat. nos. C0157 and C0142 respectively; Beyotime Institute of Biotechnology, Shanghai, China). lipid and glycogen accumulation in cells was observed using a 20🗴fluorescence microscope (Leica DM1000; Leica Microsystems GmbH, Wetzlar, Germany). Analysis of mitochondrial-related indicators Mitochondrial staining assay was determined by staining the cells with Mito Tracker Red (cat. no. M7521; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and Mito Tracker Green FM (cat. no. M7514; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s protocol. The fluorescence intensity was assessed in 1×10 4 cells by flow cytometry. For mitochondrial reactive oxygen species (mROS) production and mitochondrial morphology analysis, cells were labeled with 5 µM Mito Tracker Red probe (CM-H2XRos; M-7513; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 5 µM Mito Tracker Red (M7521; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in PBS at 28°C for 30 min, and visualized using a Leica SP8 STED microscope (Leica Microsystems GmbH, Wetzlar, Germany). Confocal microscopy GFP-LC3 was stored in our laboratory. pcDNA3.1(+)-MITO/Turbo RFP was purchased from Yunzhou Biology Company (VB211020-1156jcn). Cells were transfected with 1 µg DNA plasmid with jetPRIME® (101000046; Polypolus, Strasbourg, France) in a laser confocal culture dish (80100215). To stain the acidic compartments, live cells were stained with 50 nM LysoTracker Red (L7528; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and incubated for 2 h at 28˚C in the dark Subsequent, cells were permeabilized using 0.1% Triton X-100 (AAPR96) and blocked using 2% BSA (AAPR305) in TBST. After incubation with primary antibodies (Tom20; 1:100; p-P38; 1:100) for one night, the membranes were washed with TBST and incubated with appropriate secondary antibodies (Alexa Fluor goat anti-rabbit 594, 1:100) for 1 h. Finally, ProLong Gold Antifade (P36941) was used to stain the nuclei and prevent fluorescence quenching. The slips were imaged using a Leica SP8 STED confocal laser scanning microscope (Leica Microsystems GmbH). Quantitative real-time PCR (RT-PCR) and western blot Total RNA was extracted from various tissues of largemouth bass and cells using RNAiso Plus reagent (9109, Takara Bio, Inc., Japan) and reverse transcribed to cDNA on the specification (AK2601; Takara Bio, Inc., Japan). RT-PCR was performed using the Roche Light Cycler 480II Real-Time System (Switzerland), and the gene expression levels were normalized with reference to EF-1α (GenBank accession no. KT827794) using the 2-ΔΔCq method. PCR amplification primer sequences were shown in Table 2 . Table 2 Sequences of primers used in this study Genes Forward primers (5’ to 3’) Reverse primers (5’ to 3’) Sources/GenBank No. CPTⅠ TTCCCCTTTATTGACTTTGGC AGAACTTCCCTTTGTCCCTGTAA [67] HSL AGGACAGGACAGTGAAGAGTTGC CAGATAATTCTCATGGGATTTGG NW_024040152.1 ATGL CCATGATGCTCCCCTACACT GGCAGATACACTTCGGGAAA NW_024044570.1 PPAR-α CCACCGCAATGGTCGATATG TGCTGTTGATGGACTGGGAAA NW_024041484.1 FAS CAGCCCTTGACTCATTCCG CGCAGACTACGACCCGACAG NW_024041262.1 ACC1 ATCCCTCTTTGCCACTGTTG GAGGTGATGTTGCTCGCATA NW_024044681.1 SREBP-1 AGTCTGAGCTACAGCGACAAGG TCATCACCAACAGGAGGTCACA NW_024040041.1 PPAR-γ CCTGTGAGGGCTGTAAGGGTTT TTGTTGCGGGACTTCTTGTGA NW_024043372.1 LPL ACCAGCACTACCCGACCTCC CAGACTGTAACCCAGCAGATGAAT NW_024040374.1 APOB AGGCTGGGTGTTGTTGATGG GAGAGCTGAGGGATGTTCTTGTTTAG NW_024041039.1 APOB100 CAACTTGAAAATGTCCCTCTCTC TCTTAATGACTGATGACTCTGCCT [67] FABP1 GAACCTCAAGGAGAGCCAGAA CACCGTCCACCGAGATAATAGT NW_024044459.1 CYP7A1 CTGGGCTTCACAGGCTAACACC TTCAGTGTGGGGTCGTTGGG [67] CYP8B1 TAGACAGCGGCAACCAGGAG CCGTGCTTTTGTTTCATCCTATC [67] FXR TTGAGCCGAAAGATGCCCAA CCGATCTGGTGTCAGGATGG NW_024044570.1 RXRα GTCTGTCCAACCCTGGTGAG TCGCCGATGAGCTTGAAGAA NW_024041151.1 SHP AACCAACTCTTGCTGAAGTCCAC TTCAACAAACGACAAGGCACTC [67] HMGCR GGTGGAGTGCTTAGTAATCGG ACGCAGGGAAGAAAGTCAT NW_024044459.1 FGFR4 ATTCAATCGGATTCGCTCACCAGTC AGGAAACCACAGGCATAGATGATGATG XM_038708053.1 FGF19 AGGCTGTGTTGTCATCAAAGGAGTAG GTCTCTGCTGTAGGTGTGCGATG XM_038702190.1 FGF21 ATCTCGCTGACTCCAACCCTCTC TTACTTCCCGATACTCTCCCATCCAG XM_038736351.1 CYTB CTGCCGCCACAGTAATCCATCTAC CGAACCCGAGCAAGTCTTTATAGGAG NC_008106.1 NRF2 CTCTGTTCCCAGTATGGCCC GAAGGGAGGCTTGTTTGGGA NW_024040596.1 KEAP1a AAACGTCCCACACGTGACTC ACACAACATCTCCTGCCGTC NW_024041039.1 KEAP1b CCTGTGTGATCAGTGGGCTT ATGTGATCCACCAACCGCAT NW_024040263.1 NQO1 GACATCATCGGCGACCTGAA GCAGGAACGCTGAACCAGTA NW_024044348.1 ENNP1 GCAGTGATGGAAACGGAGGGAAG CCAAGGACACCAGGATGAGAGGAG XM_038726340.1 GYS2 CCCTGATCGCCTGGTTCTTCAAAG CAGCCTGCCACTCGTGGAAATG XM_038738888.1 ACADM TGGCTGAGATGGCAATGAAGGTG TTGGCGATGGAGGCGTAGTAGG XM_038717481.1 BCL-2 TGCCTTTGTGGAGCTGTATG GGAAGAGGAGGAGGAGGATG [67] BAX TCTTCACTCAGTCCCACAAA ATACCCTCCCAGCCACC XM_038704178.1 BAD CACATTTCGGATGCCACTAT TTCTGCTCTTCTGCGATTGA XM_038730645.1 P53 AGATTGAATGGTGGTGGG GTTCTGGCGGACTGGA [67] CAS3 GCTTCATTCGTCTGTGTTC CGAAAAAGTGATGTGAGGTA [67] CAS8 GAGACAGACAGCAGACAACCA TTCCATTTCAGCAAACACATC [67] CAS9 CTGGAATGCCTTCAGGAGACGGG GGGAGGGGCAAGACAACAGGGTG [67] CAS10 CAAACCACTCACAGCGTCTACAT TGGTTGGTTGAGGACAGAGAGGG [67] EF-1α TGCTGCTGGTGTTGGTGAGTT TTCTGGCTGTAAGGGGGCTC KT827794.1 A mixture of protease inhibitors (FD1002; Fdbio science, Hangzhou, China) was added to RIPA lysis buffer (FD009; Fdbio science, Hangzhou, China; 1:100) to extract total protein from livers and cells. All details of the primary antibodies and corresponding secondary antibodies used were stated in Table 3 . Bands were visualized using an Azure 300 ultra-sensitive chemiluminescence imager (Azure Biosystems, USA). Protein levels were standardized to β-actin levels and quantified using Image-Pro Plus software. Table 3 Antibodies used in this study Antibody Dilution ratio Supplier information ACC 1:1000 Cell Signaling Technology, #3662 Phospho-ACC(Ser69) 1:1000 Cell Signaling Technology, #3661 AMPKα 1:1000 Cell Signaling Technology, #5831 Phospho-AMPKα (Thr172) 1:1000 Cell Signaling Technology, #2535 JNK1 1:1000 Cell Signaling Technology, #3708 Phospho-SAPK/JNK (Thr183/Tyr185) 1:1000 Cell Signaling Technology, #4668 p38MAPK 1:10000 Cell Signaling Technology, #9212 Phospho-p38 MAPK (Thr180/Tyr182) 1:10000 Cell Signaling Technology, #4511 p44/42 MAPK 1:1000 Cell Signaling Technology, #4695 Phospho-p44/42 MAPK (Thr202/Tyr204) 1:1000 Cell Signaling Technology, #4370 Hsp60 1:1000 Proteintech, #15282 Drp1 1:1000 Cell Signaling Technology, #43110T Tom20 1:1000 Cell Signaling Technology, #43110T LC3B 1:1000 Sigma, # L7543 PARK2/Parkin 1:1000 Proteintech, #66674 Pink1 1:1000 Cell Signaling Technology, #14060T CAS3 1:1000 Abmart, #T40044 DyLight™ 594 Goat anti-Rabbit IgG 1:100 Invitrogen, #35561 Goat Anti-Rabbit IgG 1:10000 Proteintech, #SA00001-2 Goat Anti-Mouse IgG 1:10000 Proteintech, #SA00001-1 Statistical analysis Analysis of variance (ANOVA) or unpaired/paired t-tests of three independent repeats were performed with GraphPad Prism 8 (GraphPad Software, Inc., La Jolla, CA, USA). Data are presented as the mean ± SEM. Results High glucose treatment induced hepatic glycolipid accumulation, liver damage and oxidative stress in both largemouth bass and primary hepatocytes Following the 8-week experimental period, compared to the CON diet, the hepatosomatic index (HSI) and viscerosomatic index (VSI) were significantly increased in the largemouth bass fed HC diet (Fig. 1 A and 1 B). Consistent with the HSI and VSI, HC-fed largemouth bass developed hepatomegaly (Fig. 1 C). PAS staining in the liver tissue of largemouth bass further corroborated that HC diet caused profound glycogen accumulation (Fig. 1 D). Correspondingly, hepatic glycogen content in the HC diet was elevated by approximately 50% relative to the CON diet (Fig. 1 E). Largemouth bass primary hepatocytes were exposed to a high-glucose medium to replicate in vivo conditions associated with high carbohydrate intake, aiming to elucidate the impact of a high-carbohydrate diet on hepatic glycolipid accumulation. The results indicated that HG treatment significantly inhibited cell proliferation at 48 and 72 h (Fig. 1 F). Consequently, a 48-h treatment duration was chosen for subsequent high-glucose exposure in primary hepatocytes. The results of oil red O staining and PAS staining proved that HG treatment promoted the accumulation of lipid droplets and glycogen in primary hepatocytes (Fig. 1 G and H). Meanwhile, we also evaluated the expression of glycogenesis-related genes and the content of glycogen in primary hepatocytes. The results exhibited that HG treatment induced glycogen synthesis, as evidenced by an increase in the mRNA levels of GYS2 (Fig. 1 L) and the content of glycogen (Fig. 1 K). Moreover, generation of ROS was observed by fluorescence microscopy to detect whether HG treatment can result in oxidative stress. In primary hepatocytes, HG treatment increased mean fluorescence intensity (MFI) of H2DCF-DA dye, indicating elevated ROS production as compared to LG treatment (Fig. 1 I). Flow cytometry analysis also demonstrated that HG treatment resulted in approximately 9% increased intracellular ROS levels in primary hepatocytes (Fig. 1 J). Additionally, the gene expression level of NRF2 was up-regulated, and the gene expression levels of NQO1 was down-regulated after HG treatment (Fig. 1 M). High glucose treatment disturbs fatty acid metabolism, bile acid metabolism and activates MAPK signal pathway in both largemouth bass and primary hepatocytes Given that HC diet can lead to fat accumulation in visceral tissues, we further investigated the impact of HC diet on fatty acid metabolism and bile acid metabolism. Compared with CON diet, HC diet resulted in the upregulation of lipolysis/fatty acid oxidation, lipogenesis and fatty acid transport-associated genes, as evidenced by upregulated expression of ATGL , FAS , ACC1 , SREBP1 , PPAR-γ , APOB , APOB100 and FABP1 . The gene expression levels of CYP7A1 , CYP8B1 , and SHP were down-regulated, and the gene expression levels of FGFR4 was up-regulated in largemouth bass fed HC diet (Fig. 2 A). Western blot results indicated that HC diet effectively inhibited the phosphorylation of AMPK and promoted the phosphorylation of ACC (Fig. 2 B). To further characterize the impact of high glucose treatment on fatty acid metabolism, the phosphorylation of in vivo-validated AMPK and ACC were further analyzed in an in vitro model. Consistent with the in vivo results, HG treatment activated the phosphorylation of ACC and suppressed the phosphorylation of AMPK (Fig. 2 C). Since FGFR4 activation has been shown to initiate receptor tyrosine kinase signaling cascades, thereby activating the c-JUN and ERK signaling pathways (Liu et al., 2020), we further investigated whether HC diet might activate the MAPK signal pathways. Compared with CON diet, HC diet increased the phosphorylation of ERK, JNK and p38MAPK (Fig. 2 D). As indicated in Fig. 2 E, the phosphorylation of ERK, JNK and p38MAPK were up-regulated after HG treatment. Thus, both in vivo and in vitro experiments demonstrated that high glucose treatment could promote fat synthesis by regulating the AMPK/ACC/SREBP-1 pathway and activate ERK, JNK and p38MAPK signal pathway. High glucose treatment damages mitochondria function in both largemouth bass and primary hepatocytes Transmission electron microscopy (TEM) was used to further visualize the livers' ultramicroscopic characteristics and structural attributes. Largemouth bass fed HC diet exhibited a reduced mitochondria number, an increased damaged mitochondria and a large glycogen accumulation (Fig. 3 A). It was well-established that that mitochondrial CYTB transcription decreases with mitochondrial mass (Hauck et al., 2012). HC diet markedly decreased the expression CYTB in liver and elevated the expression CYTB in intestine, whereas the expression of the other tissues did not significantly change (Fig. 3 B). Other than that, flow cytometry analysis revealed that HG treatment promoted cell apoptosis (Fig. 3 C). Mito Tracker Red/Mito Tracker Green intensity ratio was significantly decreased in HG-treated cells, indicating that loss of mitochondrial membrane potential (Fig. 3 D). The decline in mitochondrial membrane potential serves as an initial indicator of cell apoptosis. HG treatment resulted in a significant increase in the number of cells exhibiting depolarized mitochondria (green), indicating a decline in mitochondrial membrane potential in primary hepatocytes (Fig. 3 E). To visualize the morphological changes in primary hepatocytes treated HG, the cellular ultramicroscopic structures were also view by TEM. The mitochondria of HG-treated cells exhibited significant damage, characterized by a decrease in the number of mitochondria, mitochondrial swelling with partial vacuolation (Yellow arrow), an increased in the number of lipid droplets and an increase in the number of mitophagosomes (Red arrow) (Fig. 3 F). This was consistent with what we observed in vivo. High glucose treatment affects mitochondrial morphology and mitochondrial dynamics in primary hepatocytes In the in vitro experiments, mitochondrial fusion and fission were initially detected using Mito-Tracker Red staining, and morphological alterations were observed via confocal microscopy. Under normal physiological conditions, mitochondria typically exhibit large, elongated structures with distinct networks. However, our results revealed that a significant reduction in mitochondrial length after HG treatment, indicating that HG treatment facilitated mitochondrial fission and degradation (Fig. 4 A). Furthermore, the results showed that HG treatment notably elevated mitochondrial reactive oxygen species (mitoROS) production (Fig. 4 B). A mitochondrial marker, Tom20, was immunofluorescence stained to further assess mitochondrial morphology. The results indicated that mitochondrial length decreased and division increased after HG treatment, which further indicated that HG treatment would lead to mitochondrial fracture and promote mitochondrial fission (Fig. 4 C). In addition, the expression of related proteins was determined by western blot, which indicated that demonstrated a decrease in Tom20 and an increase in Drp1 levels following HG treatment, suggesting that HG treatment may play an important role in mitochondrial fission (Fig. 4 D). High glucose treatment promotes mitophagy and autophagy flow in primary hepatocytes Mitochondrial dynamics, encompassing fusion and fission processes, alongside autophagy, function as critical quality control mechanisms for maintaining mitochondrial homeostasis. An array of proteins associated with mitophagy, notably Pink1 and Parkin, in addition to autophagic proteins such as LC3II, were investigated (Fig. 5 A). In response to HG treatment, there was a marked upregulation of Pink1, Parkin, and LC3II, indicating that HG treatment may induce mitochondrial damage linked to Pink1/Parkin-mediated mitophagy. In order to further investigate the regulatory mechanism of HG treatment on autophagy, primary hepatocytes were transfected with a GFP-LC3 plasmid to quantify autophagosome formation. The results demonstrated that LG treated cells exhibited a limited number of autophagosomes, whereas a substantial increase in autophagosome formation was observed following HG treatment (Fig. 5 B). Subsequently, laser confocal microscopy was employed to assess the colocalization of autophagosomes with lysosomes, mitochondria with lysosomes, and autophagosomes with mitochondria. The fusion of autophagosomes with lysosomes and mitochondria was increased, indicating that HG treatment increased the autophagic flux (Fig. 5 C and 5 D), meanwhile, HG treatment facilitated the fusion of mitochondria and lysosomes (Fig. 5 F). In light of the above data, we have demonstrated HG treatment enhanced Pink1/Parkin-mediated mitophagy in vitro. High glucose treatment causes mitochondrial apoptosis in primary hepatocytes In order to elucidate the impact of high glucose treatment on mitochondrial apoptosis. RT-PCR was used to quantify the expression of Bcl-2 family ( BCL-2 , BAX , and BAD ) and Caspase family ( CAS3 , CAS8 , CAS9 , CAS10 and P53 ). As expected, HG treatment boosted mitochondrial apoptosis, as evidenced by elevated expressions of BAX , BAD CAS3 , and CAS9 , and decreased expressions of BCL-2 (Fig. 6 A). P-P38 immunofluorescence was markedly enhanced both in the cytoplasm and nucleus in HG treated primary hepatocytes (Fig. 6 B). Thus, we ensured that HG treatment significantly inhibited the p38MAPK signal pathway. Primary hepatocytes were pretreated with different concentrations of SB203580 for 2 h and incubated with HG for another 48 h. The gene and protein levels of CAS3 were significantly downregulated by the addition of SB203580 (Fig. 6 C and 6 D). Furthermore, the gene expression levels of BCL-2 , BAX and CAS3 were significantly altered in cells treated with HG in the presence of SB203580 (Fig. 6 D). The results suggest that high glucose treatment can induce mitochondrial apoptosis by activating the P38MAPK signaling pathway. Discussion The hepatosomatic index (HSI) is widely acknowledged as an essential marker for assessing the size of the liver in fish and is additionally utilized to evaluate the general development and well-being of fish [38, 39]. In a study of grouper ( Epinephelus akaara ), HSI was significantly elevated when the fish was fed high carbohydrate diet [40]. Similarly, in the present study, both HIS and VSI of largemouth bass fed HC diet showed significant increases Subsequent cellular experiments revealed a greater accumulation of lipid droplets in cells treated with high glucose, further corroborating that a high-carbohydrate diet induced an over-accumulation of lipid in the liver. A similar phenomenon was also observed in Nile tilapia ( Oreochromis niloticus ) [41], Gibel Carp ( Carassius gibelio ) [42], and rainbow trout ( Oncorhynchus mykiss ) [43]. Excessive glycogen accumulation in the liver has been reported to cause more significant hepatocellular injury compared to lipid accumulation [44]. PAS staining and biochemical analysis revealed excessive accumulation of glycogen in the liver, which a critical factor contributing to the higher HSI observed in largemouth bass fed HC diet compared to those fed CON diet. Lipid accumulation is well recognized to be mediated by AMPK and SREBP. The activated form of SREBP-1 is responsible for the upregulation of gene expression related to lipid biosynthesis, leading to an increase in lipid droplet formation and overall lipid content [45]. It has been shown that the high glucose treatment of hepatocytes suppresses the expression of SREBP-1 target genes by AMPK by repressing its cleavage and translocation intranuclearly [46]. Interestingly, HC diet could increase lipid production by inhibiting AMPK, causing ACC , SREBP1 , and FAS to be increased, but had little effect on CPT1 , ATGL and PPAR-α . Additionally, FABP1 functions as a transport agent, a transporter, and a metabolic regulator of fatty acids [47]. This study found that HC diet significantly upregulated APOB , APOB100 and FABP1 in largemouth bass that had fatty liver, indicating that it promoted the absorption and transport of fatty acids and the synthesis of triglycerides. Despite differences in feed formulas, our results were in agreement with previous studies [3]. Current findings indicated that liver damage and lipid accumulation in largemouth bass can be induced by HC diet. Similar phenomena have been reported in other fish species [48–50]. Liver injury is primarily attributed to the initial toxic effects of excessive lipids [51]. Mounting evidence shows that the accumulation of both cholesterol and triglycerides may result in lipotoxicity [52]. Beyond that, abnormal accumulation of free cholesterol is believed to compromise the integrity of mitochondrial and endoplasmic reticulum membranes, thereby exacerbating promote mitochondrial oxidative damage and endoplasmic reticulum stress, and finally induce and aggravate liver injury [53]. This study found that HC diet greatly suppressed the expression of genes related to bile acid metabolism ( CYP7A1 , CYP8B1 , SHP ), indicating disrupted cholesterol homeostasis. Meanwhile, HC diet caused mitochondrial oxidative damage and lipid accumulation in largemouth bass and cell experiments, suggesting it may directly lead to liver injury and lipid buildup. In the present study, we found that HC diet did not affect mRNA expressions of FXR , RXRα and HMGCR in the liver, aligning with previous research [54]. This might be because FXR primarily functions in the liver-gut axis, and the HC diet has a less effect on regulating FXR expression in the liver. Division and fusion of mitochondria are essential for maintaining their function, especially when cells experience metabolic or environmental stress [55]. It has been reported that high-fat diet in Pelteobagrus pelteobagrus can activate mitochondrial biogenesis, promote mitochondrial fusion and induce oxidative stress, consequently leading to increased lipid accumulation [30]. Prolonged consumption of high-carbohydrate diets has been associated with the induction of oxidative stress, which may impair mitochondrial respiratory chain activity in the liver of rainbow trout [56] and Megalobrama amblycephala [57]. In this study, HG treatment caused mitochondrial rupture and increased mitoROS levels. It decreased the fusion protein Tom20 and increased the fission protein Drp1, suggesting HG promotes fission over fusion. This excess ROS from fission may trigger mitochondrial autophagy. Mechanically, the overproduction of ROS due to mitochondrial fission may also trigger mitochondrial autophagy [58, 59]. Previous studies have shown that Pink1 and Parkin are crucial for both clearing damaged mitochondria and regulating mitochondrial dynamics [60]. The results showed that HG treatment significantly increased Pink1 and Parkin protein levels, suggesting that mitochondrial morphological changes in HG environments may be related to Pink1 accumulation and Parkin translocation, and these processes may affect mitochondrial quality control and the autophagy machinery [61]. Furthermore, it was found that HG treatment significantly reduced the total number of mitochondria while increasing mitochondrial autophagosomes and damaged mitochondria. Additionally, HG treatment enhanced the co-localization of autophagosomes with lysosomes, autophagosomes with mitochondria, and mitochondria with lysosomes, suggesting increased mitochondrial degradation via the autophagosome-lysosome pathway. It has been shown that a wide array of extracellular stimuli can activate the MAPK signaling pathway, including stress induced by high glucose treatment [62, 63]. The MAPK signaling pathway is an important downstream signal in multiple proliferation, differentiation, apoptosis and survival pathways [64]. We further elucidated the regulatory role of the p38MAPK pathway in mitochondrial apoptosis in high glucose treated cells, which was consistent with previous results [35]. In insulin resistant HepG2, high glucose levels have been shown to induce insulin resistance by regulating the JNK-IRS-1 signaling pathway [65]. Our study found that HG treatment augmented the production of ROS and induced oxidative stress in primary hepatocytes. Excessive ROS generation can activate the c-Jun NH 2 -terminal kinase (JNK) pathway, leading to the phosphorylation of insulin receptor substrate-1 (IRS-1) at Ser307 [66]. Related research has demonstrated that high glucose levels induce insulin resistance through the activation of the JNK signaling pathway, which may contribute to starch intolerance in largemouth bass. Conclusions To conclude, our results demonstrate first-time evidence that the AMPK-mediated ACC/SREBP-1 pathway contributes to lipid accumulation in largemouth bass, both in vivo and in vitro. Concurrently, high carbohydrate diet may lead to the disruption of cholesterol homeostasis and the activation of the MAPK (p38MAPK, ERK and JNK) signaling pathways. In addition, this study is also the first to establish a primary hepatocyte injury model using high glucose, confirming its role in mitochondrial damage and glycolipid accumulation. Simultaneously, we found a correlation between mitophagy and high glucose treatment, and identified a regulatory mechanism of Pink1/Parkin-mediated mitophagy in primary hepatocytes. CRediT authorship contribution statement Liao Zhi-Hong: Conceptualization, Methodology, Formal analysis, Writing-original draft. He Xuan-Shu: Methodology, Data curation, Investigation. Ye Tao: Conceptualization, Writing-review & editing. Gu Xing-Yu: Writing-review & editing. Chen An-Qi: Methodology, Data curation. Guo Yu-Cai: Writing-review & editing. Zhao Wei and Niu Jin: Conceptualization, Supervision, Writing-review & editing. All data were generated in-house, and no paper mill was used. All authors agree to be accountable for all aspects of work ensuring integrity and accuracy. Abbreviations ACADM Acyl-CoA dehydrogenase medium ACC1 Acetyl-CoA carboxylase 1 APOB Apolipoprotein B ATGL Adipose triglyceride lipase AMPK Adenosine 5‘-monophosphate (AMP)-activated protein kinase BA Bile acid CCK8 Cell counting kit-8 CON Control CPT1 Carnitine palmitoyltransferase 1 CYP7A1 Cholesterol 7-hydroxylase CYP8B1 Sterol 12-hydroxylase CYTB Cytochrome b EDTA Ethylenediaminetetraacetic acid EF-1α Elongation factor 1α ENNP1 Phosphodiesterase 1 FABP1 Fatty acid binding protein 1 FAS Fatty acid synthase FBS Fetal bovine serum FGFR4 Fibroblast growth factor receptor 4 FITC Fluorescein isothiocyanate FXR Farnesoid X receptor GSY2 Glycogen synthase 2 HC High carbohydrate HG High glucose HSL Hormone-sensitive lipase HSI Hepatosomatic index Keap1 Kelch-like ECH-associated protein 1 LG Low glucose LPL Lipoprotein lipase MAPK Microtubule-associated protein kinase MMP Mitochondrial membrane potential mitoROS Mitochondrial reactive oxygen species NIH National institutes of health Nqo1 NAD(P)H oxidoreductase 1 Nrf2 Nuclear factor erythroid 2-related factor 2 PAS Periodic acid-schiff PBS Phosphate-buffered saline PI Propidium iodide ‌ PPAR-α Peroxisome proliferator-activated receptor alpha PPAR-γ Peroxisome proliferator-activated receptorγ qRT-PCR Quantitative real-time PCR ROS Reactive oxygen species SHP Small heterodimer partner SREBP1 Sterol regulatory element-binding protein 1 TEM Transmission electron microscopy VSI Viscerosomatic index Declarations Conflict of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Ethics approval and consent to participate The National Institutes of Health (NIH) guidelines for laboratory animal care and use were strictly followed during all experimental procedures. The study protocol was approved by Experimental Animal Ethics Committee of Sun Yat-Sen University. The protocol number was SYSU-LS-IACUC-2024-0020. Consent for publication No applicable. Author Contribution Liao Zhi-Hong: Conceptualization, Methodology, Formal analysis, Writing-original draft. GHe Xuan-Shu: Methodology, Data curation, Investigation. u Xing-Yu: Writing-review & editing. Ye Tao: Conceptualization, Writing-review & editing. Chen An-Qi: Methodology, Data curation. Guo Yu-Cai: Writing-review & editing. Zhao Wei and Niu Jin: Conceptualization, Supervision, Writing-review & editing. Acknowledgment This research was supported by Project of National Natural Science Foundation of China (32172982), Project of Science and Technology of Guangdong Province (2021B0202050002), Project of Science and Technology of Guangdong Province (2023A1515012627). National Natural Science Foundation of China (32303014), Guangdong Basic and Applied Basic Research Foundation (2024A1515010444). We also thank the Home for Researchers ( www.home-for-researchers.com ). Availability of data and material Not applicable. References Li X, Zheng S, Han T, Song F, Wu G. Effects of dietary protein intake on the oxidation of glutamate, glutamine, glucose and palmitate in tissues of largemouth bass ( Micropterus salmoides ). Amino Acids 2020; 52 (11-12):1491-1503. Lin S, Shi CM, Mu MM, Chen YJ, Luo L. Effect of high dietary starch levels on growth, hepatic glucose metabolism, oxidative status and immune response of juvenile largemouth bass, Micropterus salmoides . Fish Shellfish Immunol 2018; 78:121-126. Xue M, Yao T, Xue M, Francis F, Qin Y, Jia M, Li J, Gu X. Mechanism analysis of metabolic fatty liver on largemouth bass ( Micropterus salmoides ) based on integrated lipidomics and proteomics. Metabolites 2022; 12 (8): 759. Zhang Y, Xie SW, Wei HL, Zheng L, Liu ZL, Fang HH, Xie J, Liao S, Tian L, Liu Y, Niu J. High dietary starch impaired growth performance, liver histology and hepatic glucose metabolism of juvenile largemouth bass, Micropterus salmoides . Aquac. Nutr 2020; 26 (4): 1083-1095. Li X, Zheng S, Ma XT, Song F, Wu G. Effects of dietary starch and lipid levels on the protein retention and growth of largemouth bass ( Micropterus salmoides ). Amino Acids 2020; 52 (6-7):999-1016. Zhang BY, Yang HL, Nie QJ, Zhang Y, Cai GH, Sun YZ. High dietary wheat starch negatively regulated growth performance, glucose and lipid metabolisms, liver and intestinal health of juvenile largemouth bass Micropterus salmoides . Fish Physiol. Biochem 2024; 50 (2): 635-651. Li S, Sang C, Turchini GM, Wang A, Zhang J, Chen N. Starch in aquafeeds: the benefits of a high amylose to amylopectin ratio and resistant starch content in diets for the carnivorous fish, largemouth bass ( Micropterus salmoides ). Br. J. Nutr 2020; 124 (11):1145-1155. Xie S, Xu J, Chen L, Qi Y, Yang H, Tan B. Single-cell transcriptomic analysis revealed the cell population changes and cell-cell communication in the liver of a carnivorous fish in response to high-carbohydrate diet. J. Nutr 2024; 154 (8):2381-2395. Zhou YL, He GL, Jin T, et al. High dietary starch impairs intestinal health and microbiota of largemouth bass, Micropterus salmoides . Aquaculture 2021; 534:736261. Alves A, Pereira RT, Rosa PV. Morphology of the digestive system in carnivorous freshwater Dourado salminus brasiliensis . J. Fish Biol 2021; 99(4): 1222-1235. Li S, Wang A, Li Z, Chen YJ, Dai FY, Luo L, Lin SM. Antioxidant defenses and non-specific immunity at enzymatic and transcriptional levels in response to dietary carbohydrate in a typical carnivorous fish, hybrid grouper ( Epinephelus fuscoguttatus ♀× E. Lanceolatus ♂). Fish Shellfish Immunol 2020; 100: 109-116. Bechmann LP, Hannivoort RA, Gerken G, Hotamisligil GS, Trauner M, Canbay A. The interaction of hepatic lipid and glucose metabolism in liver diseases. J. Hepatol 2012; 56 (4):952-964. Xie D, Yang L, Yu R, Chen F, Lu R, Qin C, Nie G. Effects of dietary carbohydrate and lipid levels on growth and hepatic lipid deposition of juvenile tilapia, Oreochromis niloticus . Aquaculture 2017; 479:696-703. Li S, Sang C, Zhang J, et al. Molecular cloning, expression profiling of adipose triglyceride lipase (atgl) and forkhead box o1 (foxo1), and effects of dietary carbohydrate level on their expression in hybrid grouper ( Epinephelus fuscoguttatus ♀ × E. Lanceolatus ♂). Aquaculture 2018; 492:103-112. Cai W, Liang X, Yuan X, Li Z, Chen N. Different strategies of grass carp ( Ctenopharyngodon idella ) responding to insufficient or excessive dietary carbohydrate. Aquaculture 2018; 497:292-298. Liang X, Chen P, Wu X, Xin, S, Morais S, He M, Gu X, Xue M. Effects of high starch and supplementation of an olive extract on the growth performance, hepatic antioxidant capacity and lipid metabolism of largemouth bass ( Micropterus salmoides ). Antioxidants 2022; 11 (3):577. Marin JJ, Macias RI, Briz O, Banales JM, Monte MJ. Bile acids in physiology, pathology and pharmacology. Curr. Drug Metab 2015; 17 (1):4-29. Wang H, He Q, Wang G, Xu X, Hao H. Fxr modulators for enterohepatic and metabolic diseases. Expert Opin. Ther. Patents 2018; 28 (11):765-782. Wang LX, Frey MR, Kohli R. The role of fgf19 and malrd1 in enterohepatic bile acid signaling. Front. Endocrinol 2021; 12:799648. Gehart H, Kumpf S, Ittner A, Ricci R. MAPK signaling in cellular metabolism: stress or wellness? Embo Rep 2010; 11 (11):834-840. Deng J, Zhang X, Lin B, Mi H, Zhang L. Excessive dietary soluble arabinoxylan impairs the intestinal physical and immunological barriers via activating MAPK/NF-κB signaling pathway in rainbow trout ( Oncorhynchus mykiss ). Fish Shellfish Immunol 2023; 141:109041. Song ZX, Jiang WD, Liu Y, Wu P, Jiang J, Zhou XQ, Kuang SY, Tang L, Tang WN, Zhang YA. Dietary zinc deficiency reduced growth performance, intestinal immune and physical barrier functions related to NF-κB, TOR, Nrf2, JNK and MLCK signaling pathway of young grass carp ( Ctenopharyngodon idella ). Fish Shellfish Immunol 2017; 66:497-523. Li X, Cui K, Fang W, Chen Q, Xu D, Mai K, Zhang Y, Ai Q. High level of dietary olive oil decreased growth, increased liver lipid deposition and induced inflammation by activating the p38 MAPK and JNK pathways in large yellow croaker ( Larimichthys crocea ). Fish Shellfish Immunol 2019; 94:157-165. Zhang W, Dan Z, Zheng J, Du J, Liu Y, Zhao Z, Gong Y, Mai K, Ai Q. Optimal dietary lipid levels alleviated adverse effects of high temperature on growth, lipid metabolism, antioxidant and immune responses in juvenile turbot ( Scophthalmus maximus l. ). Comp. Biochem. Physiol. B-Biochem. Mol. Biol 2024; 272:110962. Li M, Hu FC, Qiao F, Du ZY, Zhang ML. Sodium acetate alleviated high-carbohydrate induced intestinal inflammation by suppressing MAPK and NF-κB signaling pathways in Nile tilapia ( Oreochromis niloticus ). Fish Shellfish Immunol 2020; 98:758-765. Liu H, Chen B, Cao Y, Geng Y, Ouyang P, Chen D, Li L, Huang X. High starch diets attenuate the immune function of Micropterus salmoide s immune organs by modulating Keap1/Nrf2 and MAPK signaling pathways. Fish Shellfish Immunol 2023; 142:109079. Sule R, Condon L, Gomes A. Common feature of pesticides: oxidative stress-the role of oxidative stress in pesticide-induced toxicity. Oxid Med Cell Longev 2022; 2022:5563759. Xu C, Liu WB, Zhang DD, Shi JH, Zhang L, Li XF. Benfotiamine, a lipid-soluble analog of vitamin B1, improves the mitochondrial biogenesis and function in blunt snout bream ( Megalobrama amblycephala ) fed high-carbohydrate diets by promoting the AMPK/PGC-1β/NRF-1 axis. Front Physiol 2018; 9:1-15. Shen HC, Chen ZQ, Chen F, Chen S, Ning, LJ, Tian HY, Xu C. DHA alleviates high glucose-induced mitochondrial dysfunction in Oreochromis niloticus by inhibiting DRP1-mediated mitochondrial fission. Int J Biol Macromol 2023; 244:125409. Song YF, Hogstrand C, Ling SC, Chen GH, Luo Z. Creb-Pgc1α pathway modulates the interaction between lipid droplets and mitochondria and influences high fat diet-induced changes of lipid metabolism in the liver and isolated hepatocytes of yellow catfish. J Nutr Biochem 2020; 80:108364. Catalani E, Silvestri F, Bongiorni S, Taddei AR, Fanelli G, Rinalducci S, Palma CD. Retinal damage in a new model of hyperglycemia induced by high-sucrose diets. Pharmacol Res 2021; 166:195488. Wang KW, Liu QQ, Zhu J, Deng X, Luo L, Lin SM, Qin CJ, Chen YJ. Transcriptome analysis provides insights into the molecular mechanism of liver inflammation and apoptosis in juvenile largemouth bass Micropterus salmoides fed low protein high starch diets. Comp. Biochem. Physiol. D-Genomics Proteomics 2023; 45:101047. Xie Y, Shao X, Zhang P, Zhang H, Yu J, Yao X, Fu Y, Wei J, Wu C. High starch induces hematological variations, metabolic changes, oxidative stress, inflammatory responses, and histopathological lesions in largemouth bass (Micropterus salmoides ). Metabolites 2024; 14 (4):236. Shi B, Qian T, Yin Z, Zhang Y, Feng T, Dong Z, Cai W, Zhang Y. Comparing effects of high starch diet or high lipid diet supplemented with different levels of zinc on intestinal barrier and microbe community in largemouth bass Micropterus salmoides . Fish Shellfish Immunol 2024; 154:109911. Liao ZH, He XS, Chen AQ, Zhong J, Lin SH, Guo YC, Chen BY, Zhao W, Niu J. Astaxanthin attenuates glucose-induced liver injury in largemouth bass: role of p38MAPK and PI3K/Akt signaling pathways. Cell Biosci 2024; 14 (1):122. Hauck L, Stanley-Hasnain S, Fung A, Grothe D, Rao V, Mak TW, Mak TW, Billia F. Cardiac-specific ablation of the e3 ubiquitin ligase mdm2 leads to oxidative stress, broad mitochondrial deficiency and early death. Plos One 2017; 12 (12):e0189861. Liu Y, Cao M, Cai Y, Li X, Zhao C, Cui R. Dissecting the role of the FGF19-FGFR4 signaling pathway in cancer development and progression. Front. Cell. Dev. Biol 2020; 8:95. Li X, Zheng S, Ma X, Cheng K, Wu G. Use of alternative protein sources for fishmeal replacement in the diet of largemouth bass ( Micropterus salmoides ). Part I: effects of poultry by-product meal and soybean meal on growth, feed utilization, and health. Amino Acids 2021; 53 (1):33-47. Du ZY, Turchini GM. Are we actually measuring growth? -an appeal to use a more comprehensive growth index system for advancing aquaculture research. Rev. Aquac 20222; 14 (2):525-527. Wang J, Li X, Han T, Yang Y, Jiang Y, Yang M, Xu Y, Harpaz S. Effects of different dietary carbohydrate levels on growth, feed utilization and body composition of juvenile grouper Epinephelus akaara . Aquaculture 2016; 459:143-147. Xu R, Li M, Wang T, Zhao YW, Shan CJ, Qiao F, Chen LQ, Zhang WB, Du ZY, Zhang ML. Bacillus amyloliquefaciens ameliorates high-carbohydrate diet-induced metabolic phenotypes by restoration of intestinal acetate-producing bacteria in Nile tilapia. Br. J. Nutr 2022; 127 (5):653-665. Gong Y, Xi L, Liu Y, Lu Q, Zhang Z, Liu H, Jin J, Yang Y, Zhu X, Xie S, Han D. Sequential activations of CHREBP and SREBP1 signals regulate the high-carbohydrate diet-induced hepatic lipid deposition in Gibel carp ( Carassius gibelio ). Aquac. Nutr 2023; 2023:6672985. Yu H, Geng S, Li S, Wang Y, Ren X, Zhong D, Mo H, Yao M, Yu J, Li Y, Wang L. The MAPK and AKT/GSK3beta pathways are involved in recombinant proteins fibroblast growth factor 1 (RFGF1 and RFGF1a) improving glycolipid metabolism in Rainbow trout ( Oncorhynchus mykiss ) fed a high carbohydrate diet. Anim. Nutr 2024; 17:11-24. Allende DS, Gawrieh S, Cummings OW, Belt P, Wilson L, Van-Natta M, Behling CA, Carpenter D, Gill RM, Kleiner DE, Yeh MM, Chalasani N, Guy CD. Glycogenosis is common in nonalcoholic fatty liver disease and is independently associated with ballooning, but lower steatosis and lower fibrosis. Liver Int 2021; 41 (5):996-1011. Walker AK, Jacobs RL, Watts JL, Rottiers V, Jiang K, Finnegan DM, Shioda T, Hansen M, Yang F, Niebergall LJ, Vance DE, Tzoneva M, Hart AC, Naar AM. A conserved srebp-1/phosphatidylcholine feedback circuit regulates lipogenesis in metazoans. Cell 2011; 147 (4):840-852. Han Y, Hu Z, Cui A, Liu Z, Ma F, Xue Y, Liu, Y, Zhang F, Zhao Z, Yu Y, Gao J, Wei C, Li J, Fang J, Li J, Fan JG, Song BL, Li Y. Post-translational regulation of lipogenesis via AMPK-dependent phosphorylation of insulin-induced gene. Nat. Commun 2019; 10 (1):623. Ito H, Yamashita H, Nakashima M, Takaki A, Yukawa C, Matsumoto S, Omoto T, Shinozaki M, Nishio S, Abe M, Antoku S, Mifune M, Togane M. Current metabolic status affects urinary liver-type fatty-acid binding protein in normoalbuminuric patients with type 2 diabetes. J Clin Med Res 2017; 9 (4):366-373. Ge Y, Zhang L, Chen W, Sun M, Liu W, Li X. Resveratrol modulates the redox response and bile acid metabolism to maintain the cholesterol homeostasis in fish Megalobrama amblycephala offered a high-carbohydrate diet. Antioxidants 2023; 12 (1):121. Yu C, Wang L, Cai W, Zhang W, Hu Z, Wang Z, Yang Z, Peng M, Huo H, Zhang Y, Zhou Q. Dietary macroalgae saccharina japonica ameliorates liver injury induced by a high-carbohydrate diet in swamp eel ( Monopterus albus ). Front. Vet. Sci 2022; 9:869369. Zhou NN, Wang T, Lin YX, Xu R, Wu HX, Ding FF, Qiao F, Du ZY, Zhang ML. Uridine alleviates high-carbohydrate diet-induced metabolic syndromes by activating SIRT1/AMPK signaling pathway and promoting glycogen synthesis in Nile tilapia ( Oreochromis niloticus ), Anim. Nutr 2023; 14:56-66. Marra F, Svegliati-Baroni G. Lipotoxicity and the gut-liver axis in nash pathogenesis. J. Hepatol 2018; 68(2) :280-295. Ioannou GN. The role of cholesterol in the pathogenesis of NASH. Trends Endocrinol. Metab 2016; 27 (2):84-95. Zhou M, Liu X, Wu Y, Xiang Q, Yu R. Liver lipidomics analysis revealed the protective mechanism of zuogui jiangtang qinggan formula in type 2 diabetes mellitus with non-alcoholic fatty liver disease. J. Ethnopharmacol 2024; 329:118160. Zheng Y, Lu Q, Cao J, Liu Y, Liu H, Jin J, Zhang Z, Yang Y, Zhu X, Han D, Xie S. Supplementation of mangiferin to a high-starch diet alleviates hepatic injury and lipid accumulation potentially through modulating cholesterol metabolism in Channel catfish ( Ictalurus punctatus ). Antioxidants 2024; 13 (6):722. Richard J, Youle AW, Van B. Mitochondrial fission, fusion, and stress. Science 2012; 337(6098):1062-1065. Eya JC, Yossa R, Perera D, Okubajo O, Gannam A. Combined effects of diets and temperature on mitochondrial function, growth and nutrient efficiency in rainbow trout ( Oncorhynchus mykiss ). Comp Biochem Physiol B Biochem Mol Biol 2017; 212:1-11. Li XF, Wang BK, Xu C, Shi HJ, Zhang L, Liu JD, Tian HY, Liu WB. Regulation of mitochondrial biosynthesis and function by dietary carbohydrate levels and lipid references in juvenile blunt snout bream Megalobrama amblycephala . Comp Biochem Physiol A Mol Integr Physiol 2019; 227:14-24. Yu TZ, Jhun BS, Yoon Y. High-glucose stimulation increases reactive oxygen species production through the calcium and mitogen-activated protein kinase-mediated activation of mitochondrial fission. Antioxid Redox Signal 2011; 14(3):425-37. Du JJ, Hang PZ, Pan Y, Feng B, Zheng YY, Chen TT, Zhao LH, Du ZM. Inhibition of miR-23a attenuates doxorubicin-induced mitochondria-dependent cardiomyocyte apoptosis by targeting the PGC-1α/Drp1 pathway. Toxicol Appl Pharmacol 2019; 369:73-81. Kane LA, Youle RJ. PINK1 and Parkin flag Miro to direct mitochondrial traffic. Cell 2011; 147(4):721-3. Jin SM, Youle RJ. The accumulation of misfolded proteins in the mitochondrial matrix is sensed by PINK1 to induce PARK2/Parkin-mediated mitophagy of polarized mitochondria. Autophagy 2013; 9(11):1750-7. Burotto M, Chiou VL, Lee JM, Kohn EC. The MAPK pathway across different malignancies: a new perspective. Cancer 2014; 120 (22):3446-3456. Turner NA, Blythe NM. Cardiac fibroblast p38 MAPK: a critical regulator of myocardial remodeling. J. Cardiovasc. Dev. Dis 2019; 6 (3):27. Su Y, Zong S, Wei C, Song F, Feng H, Qin A, Lian Z, Fu F, Shao S, Fang F, Wu T, Xu J, Liu Q, Zhao J. Salidroside promotes rat spinal cord injury recovery by inhibiting inflammatory cytokine expression and NF-κB and MAPK signaling pathways. J. Cell. Physiol 2019; 234 (8):14259-14269. Xia T, Duan W, Zhang Z, Fang B, Zhang B, Xu B, de la Cruz C, El-Seedi H, Simal-Gandara J, Wang S, Wang M, Xiao J. Polyphenol-rich extract of zhenjiang aromatic vinegar ameliorates high glucose-induced insulin resistance by regulating JNK-IRS-1 and PI3K/Akt signaling pathways. Food Chem 2021; 335:127513. Bloch-Damti A, Potashnik R, Gual P, Le Marchand-Brustel Y, Tanti JF, Rudich A, Bashan N. Differential effects of IRS1 phosphorylated on Ser307 or Ser632 in the induction of insulin resistance by oxidative stress. Diabetologia 2006; 49 (10):2463-2473. Yu LL, Yu HH, Liang XF, Li N, Wang X, Li FH, Wu XF, Zheng YH, Xue M, Liang XF. Dietary butylated hydroxytoluene improves lipid metabolism, antioxidant and anti-apoptotic response of largemouth bass ( Micropterus salmoides ). Fish Shellfish Immunolo 2018; 72:220-229. Additional Declarations No competing interests reported. Supplementary Files Graphicalabstract.png westerndata.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5652582","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":391448808,"identity":"2a90f14a-1bc6-47cc-b020-b210830e4b61","order_by":0,"name":"zhihong liao","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"zhihong","middleName":"","lastName":"liao","suffix":""},{"id":391448809,"identity":"70f64386-1b11-485b-9bee-a31e1c7ce688","order_by":1,"name":"xuanshu he","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"xuanshu","middleName":"","lastName":"he","suffix":""},{"id":391448810,"identity":"a5eae531-e63b-4ee0-bada-321796e03edb","order_by":2,"name":"xinyu gu","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"xinyu","middleName":"","lastName":"gu","suffix":""},{"id":391448811,"identity":"85e7293a-b638-406c-a9c9-d356d75e6ecf","order_by":3,"name":"tao ye","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"tao","middleName":"","lastName":"ye","suffix":""},{"id":391448812,"identity":"a5ab140e-5677-41c7-b4ad-f89559fe32f7","order_by":4,"name":"anqi chen","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"anqi","middleName":"","lastName":"chen","suffix":""},{"id":391448813,"identity":"18ad56e5-429a-4429-a92c-2ed9095db929","order_by":5,"name":"yucai guo","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"yucai","middleName":"","lastName":"guo","suffix":""},{"id":391448814,"identity":"37f95e2f-63f7-4dd0-b370-8ce98fbf9f94","order_by":6,"name":"wei zhao","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"wei","middleName":"","lastName":"zhao","suffix":""},{"id":391448815,"identity":"234018db-b678-4e14-8ccf-80bf6d62ff3d","order_by":7,"name":"Jin Niu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8ElEQVRIiWNgGAWjYDACZgYGww8VDAxs7HChBMJajCXOALUwE60FBHjbIHqJ02LOzmNQIDlvmzwfMwPzZ54/hxn42XMMGH7uwK3FspnHwKBw223DNmYGNmnetsMMkj1vDBh7z+DWYnAYqEVy221GkBZm3obDDAY3cgyYGdsIaOGdc9u+DeYwe+K0NNxOBGphkOZhA9oiQVALW4GxxLHbyW1AZZJz29J5JM48KzjYi0/L+cPbDD/U3Lad3958+MObP9Zy/O3JGx/8xKMFCNgMIDRjAxMPAwMPiHkArwZgHD6AsRh/EFA6CkbBKBgFIxMAAMahRztghM6jAAAAAElFTkSuQmCC","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":true,"prefix":"","firstName":"Jin","middleName":"","lastName":"Niu","suffix":""}],"badges":[],"createdAt":"2024-12-16 09:53:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5652582/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5652582/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":71913707,"identity":"91d2cba8-5883-45bd-bdb5-f60c0ea04e16","added_by":"auto","created_at":"2024-12-19 16:14:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":39568943,"visible":true,"origin":"","legend":"\u003cp\u003eHigh glucose treatment induced hepatic glycolipid accumulation, liver damage and oxidative stress in both largemouth bass and primary hepatocytes. A Hepatosomatic index (HSI, n=4), B Viscerosomatic index (VSI, n=4), C Liver morphology, D PAS staining of liver sections, E The content of glycogen in the liver, F Cell counting kit-8 test (n=3), G Oil red O staining of cells, H PAS staining of cells, I Intracellular ROS were determined using a fluorescence microscope. J The measurement of intracellular ROS, K The content of glycogen in cells (n=4), L Relative expression of glycogenesis-related genes (\u003cem\u003eENNP1\u003c/em\u003e, \u003cem\u003eGYS2\u003c/em\u003e, and \u003cem\u003eACADM\u003c/em\u003e) in cells (n=3), M Relative expression of anti-oxidant capacity-related genes (\u003cem\u003eNRF2\u003c/em\u003e, \u003cem\u003eKEAP1a\u003c/em\u003e, \u003cem\u003eKEAP1b \u003c/em\u003eand \u003cem\u003eNQO1\u003c/em\u003e) in cells (n=3).\u003c/p\u003e","description":"","filename":"Figure.1.png","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/b3713ac6d50bda89552009a0.png"},{"id":71912703,"identity":"b5d884c3-67cb-4136-8af3-4956d2c4d968","added_by":"auto","created_at":"2024-12-19 16:06:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":11285380,"visible":true,"origin":"","legend":"\u003cp\u003eHigh glucose treatment disturbs fatty acid metabolism, bile acid metabolism and activates MAPK signal pathway in both largemouth bass and primary hepatocytes. A Relative expression of lipolysis/β-oxidation-related genes (\u003cem\u003eCPT1\u003c/em\u003e, \u003cem\u003eHSL\u003c/em\u003e, \u003cem\u003eATGL\u003c/em\u003e and \u003cem\u003ePPAR-α\u003c/em\u003e), lipogenesis/proliferation-related genes (\u003cem\u003eFAS\u003c/em\u003e, \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003eSREBP1\u003c/em\u003eand \u003cem\u003ePPAR-γ\u003c/em\u003e), fatty acid transport -related genes (\u003cem\u003eLPL\u003c/em\u003e, \u003cem\u003eAPOB\u003c/em\u003e, \u003cem\u003eAPOB100\u003c/em\u003e and \u003cem\u003eFABP1\u003c/em\u003e) and bile acid metabolism-related genes (\u003cem\u003eCYP7A1\u003c/em\u003e, \u003cem\u003eCYP8B1\u003c/em\u003e, \u003cem\u003eFXR\u003c/em\u003e, \u003cem\u003eRXRα\u003c/em\u003e,\u003cem\u003e SHP\u003c/em\u003e,\u003cem\u003e HGMCR\u003c/em\u003e,\u003cem\u003e FGFR4\u003c/em\u003e,\u003cem\u003eFGF19\u003c/em\u003e and \u003cem\u003eFGF21\u003c/em\u003e) in the livers of largemouth bass (n=4), B Relative expression of fatty metabolism-related proteins (p-ACC, ACC, p-AMPK, and AMPK) in the livers of largemouth bass (n=3), C Relative expression of fatty metabolism-related proteins (p-ACC, ACC, p-AMPK, and AMPK) in cells (n=3), D Relative expression of MAPK signal pathway (p-P38, P38, p-ERK, ERK, p-JNK, and JNK) in the livers of largemouth bass (n=3), E Relative expression of MAPK signal pathway (p-P38, P38, p-ERK, ERK, p-JNK, and JNK) in cells (n=3).\u003c/p\u003e","description":"","filename":"Figure.2.png","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/4fe61b2c9044742682e676bf.png"},{"id":71912708,"identity":"38d87433-a713-4e54-9b8a-0116e674d7f2","added_by":"auto","created_at":"2024-12-19 16:06:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":24685230,"visible":true,"origin":"","legend":"\u003cp\u003eHigh glucose treatment damages mitochondria function in both largemouth bass and primary hepatocytes. A The ultramicroscopic characteristics and structure of livers under electron microscopy. N: Nucleus; Red frame: Glycogen; Yellow arrow: Damaged mitochondria; M: Normal mitochondria; Scale bar, 2 μm, B Relative expression of \u003cem\u003eCYTB\u003c/em\u003e genes in different tissue of largemouth bass fed two different diets (n=4), C Flow cytometry for apoptosis (n=3), D Mito Tracker Red and Mito Tracker Green staining were measured using flow cytometry in cells (n=3), E Mitochondrial membrane potential (MMP) analyzed by fluorescence microscope, F The ultramicroscopic characteristics and structure of cells under electron microscopy. N: Nucleus; L: Lipid droplet; M: Normal mitochondria; Redframe: Glycogen; Red arrow: Damaged mitochondria. Scale bar, 1 μm.\u003c/p\u003e","description":"","filename":"Figure.3.png","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/1eab1a97701310faa62d9d06.png"},{"id":71912706,"identity":"dad5b025-f631-43c0-8d7c-ee131fa77c11","added_by":"auto","created_at":"2024-12-19 16:06:21","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":23842209,"visible":true,"origin":"","legend":"\u003cp\u003eHigh glucose treatment affects mitochondrial morphology and mitochondrial dynamics in primary hepatocytes. A Morphological changes in the mitochondria of cells. Scale bar, 10 μm, B Intensity of mROS in cells, C Fluorescence photomicrograph of Tom20 examined in cells. Scale bar, 10 μm, D The expression of mitochondrial dynamics-related proteins (Tom20, Hsp60, and Drp1) in cells (n=3).\u003c/p\u003e","description":"","filename":"Figure.4.png","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/753d526afa494d155b2e36e6.png"},{"id":71913709,"identity":"e1fd370f-6d36-4dc7-8713-1dd8d6e88a03","added_by":"auto","created_at":"2024-12-19 16:14:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":15677150,"visible":true,"origin":"","legend":"\u003cp\u003eHigh glucose treatment promotes mitophagy and autophagy flow in primary hepatocytes. A Relative expression of mitophagy-related proteins (LC3II, Pink1 and Parkin) in cells (n=3), B GFP-LC3 staining was used to assess autophagy. Scale bar, 10 μm, C The cells were stained using Lyso-Tracker Red (50 nM; red) and transfected with GFP-LC3 (green) to detect colocalization of autophagosomes and lysosomes. Scale bar, 10 μm, D Mito-RFP (red) and GFP-LC3 (green) were co-transfected to detect the binding of autophagosomes to mitochondria. Scale bar, 10 μm, E The cells were stained using Lyso-Tracker Red (50 nM; red) and Mito-Tracker Green (50 nM; Green) to detect the binding of lysosomes to mitochondria. Scale bar, 10 μm.\u003c/p\u003e","description":"","filename":"Figure.5.png","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/42cb4ac1087b855d58944379.png"},{"id":71912725,"identity":"3e7e56c5-afdf-4217-85b0-d4d60b9235b2","added_by":"auto","created_at":"2024-12-19 16:06:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5667485,"visible":true,"origin":"","legend":"\u003cp\u003eHigh glucose treatment causes mitochondrial apoptosis in primary hepatocytes. A The expression levels of \u003cem\u003eBCL-2\u003c/em\u003e, \u003cem\u003eBAX,\u003c/em\u003e \u003cem\u003eBAD\u003c/em\u003e, \u003cem\u003eCAS3\u003c/em\u003e and \u003cem\u003eCAS9\u003c/em\u003e of primary hepatocytes (n=3). B immunofluorescence for p-P38. C Primary hepatocytes were pretreated with SB203580, expression levels of p-P38, P38 and CAS3 were analyzed using western blotting (n=3). D Primary hepatocytes were pretreated with SB203580, expression levels of\u003cem\u003e BCL-2\u003c/em\u003e, \u003cem\u003eBAX,\u003c/em\u003e \u003cem\u003eBAD\u003c/em\u003e, \u003cem\u003eCAS3\u003c/em\u003eand \u003cem\u003eCAS9\u003c/em\u003e were analyzed using RT-PCR (n=3).\u003c/p\u003e","description":"","filename":"Figure.6.png","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/5236c6389fadb137a5418d32.png"},{"id":72085884,"identity":"40bc2271-e777-4c4c-b6f7-e9f05b0c341b","added_by":"auto","created_at":"2024-12-22 01:32:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":105830933,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/c0ebaf9f-4abe-45b8-8a87-a02dcb6cdb70.pdf"},{"id":71913705,"identity":"dfb5e138-6de6-4273-9d66-53ec7ea9aadb","added_by":"auto","created_at":"2024-12-19 16:14:21","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5868862,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/a41c57ed209b092172a2af42.png"},{"id":71912704,"identity":"5a968574-6cac-4cb9-b2c9-2263d7d3585d","added_by":"auto","created_at":"2024-12-19 16:06:21","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":609524,"visible":true,"origin":"","legend":"","description":"","filename":"westerndata.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5652582/v1/9bfc394228e6b6d5c8f5a9ea.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Role of AMPK/ACC/SREBP-1 and MAPK Pathways in Glucose Intolerance and Liver Dysfunction of Largemouth Bass","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn recent years, aquacultural production of largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e) in China has rapidly expanded in parallel to the development and optimization of compound feed. By 2025, Chinese aquaculture production of largemouth bass is predicted to reach 900 thousand tons [1]. Multiple studies have demonstrated that a high carbohydrate content (exceeding 10%) in formulated feed induces prevalent metabolic liver disease [2, 3, 4, 5, 6]. Additionally, high-carbohydrate diets have been shown to induce vacuolization of liver parenchymal cells and reduce survival in largemouth bass, which may be correlated to increased liver damage [7, 8]. Therefore, low-carbohydrate feed has become the predominant choice within the largemouth bass industry [9]. However, the excessive of fish meal in low-carbohydrate feed leads to elevated costs and environmental concerns, significantly impeding the industry's development.\u003c/p\u003e \u003cp\u003eExcessive lipid and glycogen accumulation in the liver has been identified as a critical factor contributing to growth retardation and hepatic damage in fish subjected to a high-carbohydrate diet [10, 11]. Hepatic fat accumulation generally arises from an imbalance between lipogenesis and lipolysis, mediated by various transcriptional regulators and enzymatic activities involved in hepatic lipid homeostasis [12]. Xie et al. [13] found that the fat accumulation was greater in Nile tilapia fed high-carbohydrate diets than in fish fed high-fat diets. In hybrid grouper (\u003cem\u003eEpinephelus fuscoguttatus\u003c/em\u003e ♀\u0026times;E. \u003cem\u003elanceolatus\u003c/em\u003e ♂), a high-carbohydrate diet significantly downregulates ATGL expression, leading to hepatic triglyceride accumulation [14]. The expression levels of fatty acid synthase (FAS) and acetyl-CoA carboxylase 1 (ACC1) are significantly up-regulated, resulting in increased plasma cholesterol and total fat content in grass carp fed with high carbohydrate diets [15]. Furthermore, it was also shown that AMP-activated protein kinase (AMPK) and sterol regulatory element-binding protein 1 (SREBP1) are both involved in triglyceride accumulation in largemouth bass fed high-carbohydrate diet [16]. To fully elucidate the mechanisms of the lipid-increasing effects of high carbohydrate diet, changes in lipogenesis and lipolysis process were studied.\u003c/p\u003e \u003cp\u003eThe liver is the sole organ for bile acid (BA) synthesis. Bile acid synthesis constitutes the primary mechanism for cholesterol elimination and is crucial for maintaining cholesterol homeostasis [17]. Within the classic bile acid synthesis pathway, cholesterol 7-hydroxylase (CYP7A1) serves as the rate-limiting enzyme, whereas sterol 12-hydroxylase (CYP8B1) facilitates bile acid synthesis. FXR-mediated SHP decreases bile acid biosynthesis by inhibiting CYP7A1 expression [18]. Concurrently, FXR stimulates FGF-19 in the enterocytes, which subsequently activates fibroblast growth factor receptor 4 (FGFR4). This activation triggers the c-JUN and ERK signaling pathways, leading to a reduction in new bile acid synthesis through negative feedback mechanisms [19]. However, these studies predominantly focused on mammals, research on MAPK signaling pathways in farmed fish remains nascent, with limited understanding of the detailed mechanisms and regulatory functions [20, 21, 22, 23, 24]. In Nile tilapia, it has been observed that the NF-κB pathway, rather than the p38 MAPK pathway, is implicated in intestinal inflammation induced by high-carbohydrate diets [25]. In largemouth bass, high carbohydrate intake may impair spleen immune function through inflammatory response mediated by the MAPK/FoxO pathway [26]. To elucidate the mechanisms underlying high-carbohydrate-induced lipid metabolic disorders in largemouth bass, this study will concentrate on the MAPK signaling pathway within vivo and vitro.\u003c/p\u003e \u003cp\u003eIn mammals and fish, the mitochondria are essential to cellular function, and mitochondrial dysfunction is linked to several diseases [27]. Fish, as ectothermic organisms, exhibit unique mitochondrial adaptations that are essential for their survival in diverse aquatic environments. Moreover, the mechanisms underlying mitochondrial dysfunction in fish are similar to those observed in other vertebrates, including the involvement of oxidative phosphorylation and the role of mitochondrial dynamics in maintaining cellular homeostasis [28]. Liver damage and glycogen accumulation in fish caused by a high-carbohydrate diet can lead to mitochondrial dysfunction, including mitophagy and changes in mitochondrial dynamics [29, 30, 31]. These processes are essential for maintaining mitochondrial homeostasis and overall cellular health. However, to date, no systematic study has been conducted to explore the specific effects of a high carbohydrate diet on mitochondrial homeostasis in largemouth bass. Understanding how high glucose impacts mitochondrial function could provide insights into metabolic disorders in fish and inform dietary strategies to mitigate these effects.\u003c/p\u003e \u003cp\u003eCurrent research on the effects of a high-carbohydrate diet in largemouth bass is predominantly confined to animal experiments, with limited validation at the cellular level [32, 33, 34]. In this study, primary hepatocytes were treated with high-glucose medium to simulate the conditions of high carbohydrate feeding. The purpose of this study is to explore the effects of high carbohydrate diet on lipid metabolism, bile acid metabolism and mitochondrial homeostasis in largemouth bass.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eFeeding trial and sampling\u003c/h2\u003e \u003cp\u003eJuvenile largemouth bass were randomly assigned to of one two diets: a control diet (CON) and a high carbohydrate diet (HC) for 8-week trial starting at 8.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 g initial weight. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, these two diets were made, packed, and stored according to our standard laboratory procedures [35]. Briefly, all ingredients were ground into powder and mixed thoroughly by a feed mixer (A-200T Mixer Bench Model unit, Resell Food Equipment Ltd, Ottawa, Canada). A screw-press pelletizer was used to obtain 2.0 mm pellets from the mixture containing fish oil, soy oil, and soya lecithin and water (F-26, South China University of Technology, Guangzhou, China). Pellets were dried at 16\u0026deg;C in a well-ventilated condition until moisture content dropped below 10%, and then stored at -20\u0026deg;C. A total of 240 fish were randomly allocated into 6 tanks (capacity: 100 L) with 30 fish per tank. There were four replicates of each diet. All fish were cultured in an experimental system with commercial feed (Tongwei Co., Ltd., China) for two weeks to adapt to the experimental conditions. During the 8-week trial, fish were fed two times per day at 9:00 and 17:00 and maintained under recirculating aquaculture system of 25\u0026ndash;28℃ water temperature, 9.0 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e dissolved oxygen, 7.9\u0026ndash;8.2 pH, and lower than 0.2 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e ammonia nitrogen level. After the trial, fish were anaesthetized and euthanized with MS-222 (200 mg/L; Sigma, USA) and then weighed. The viscera and liver of each fish were also weighed and photographed for the evaluation of hepatic and visceral lipid accumulation. For future analyses, tissues (including liver, heart, brain, intestine, and head kidney) were promptly frozen in liquid nitrogen and stored at -80\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIngredients and nutrient composition of the experimental diets (% dry matter)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIngredients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCON\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn starch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKrill meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBeer yeast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWheat gluten\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoy oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoya lecithin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMineral premix\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin premix\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholine chloride (50%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMonocalcium phosphate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBone meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNutrient composition (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude lipid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.68\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003csup\u003e1\u003c/sup\u003eMineral premix provides the following per kg of diet: MgSO\u003csub\u003e4\u003c/sub\u003e∙7H\u003csub\u003e2\u003c/sub\u003eO, 1090 mg; KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 932 mg; NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e∙2H\u003csub\u003e2\u003c/sub\u003eO, 432 mg; FeC\u003csub\u003e6\u003c/sub\u003eH\u003csub\u003e5\u003c/sub\u003eO\u003csub\u003e7\u003c/sub\u003e∙5H\u003csub\u003e2\u003c/sub\u003eO, 181 mg; ZnCl\u003csub\u003e2\u003c/sub\u003e, 80 mg; CuSO\u003csub\u003e4\u003c/sub\u003e∙5H\u003csub\u003e2\u003c/sub\u003eO, 63 mg; AlCl\u003csub\u003e3\u003c/sub\u003e∙6H\u003csub\u003e2\u003c/sub\u003eO, 51 mg; MnSO\u003csub\u003e4\u003c/sub\u003e∙H\u003csub\u003e2\u003c/sub\u003eO, 31mg; KI, 28 mg; CoCl\u003csub\u003e2\u003c/sub\u003e∙6H\u003csub\u003e2\u003c/sub\u003eO, 6 mg; Na\u003csub\u003e2\u003c/sub\u003eSeO\u003csub\u003e3\u003c/sub\u003e∙H\u003csub\u003e2\u003c/sub\u003eO, 0.8 mg.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003csup\u003e2\u003c/sup\u003eVitamin premix provides the following per kg of diet: Vitamin B\u003csub\u003e1\u003c/sub\u003e, 30 mg; Vitamin B\u003csub\u003e2\u003c/sub\u003e, 60 mg; Vitamin B\u003csub\u003e6\u003c/sub\u003e, 60 mg; Nicotinic acid, 200 mg; Calcium pantothenate, 100 mg; Inositol, 100 mg; Biotin, 2.5 mg; Folic acid, 10 mg; Vitamin B\u003csub\u003e12\u003c/sub\u003e, 0.1 mg; Vitamin K3, 40 mg; Vitamin A, 10000IU, Vitamin, 160 IU. Vitamin B\u003csub\u003e1\u003c/sub\u003e and B\u003csub\u003e2\u003c/sub\u003e are termed as thiamin and riboflavin.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePAS staining and glycogen content detection of the liver\u003c/h3\u003e\n\u003cp\u003eLiver tissue sections (1\u0026ndash;4 \u0026micro;m) were fixed in 4% paraformaldehyde (Servicebio, Wuhan, China) for 24 h and embedded in paraffin. Liver glycogen staining was conducted using the periodic acid-Schiff (PAS) reaction. Images were acquired by a light NikonNi-U microscope (Nikon Corporation, Japan) with 20\u0026times; magnification. The glycogen content was measured by spectrophotometry using standard commercial kits from Wuhan Abbkine Co., China (KTB1340).\u003c/p\u003e\n\u003ch3\u003ePrimary hepatocyte isolation and treatment\u003c/h3\u003e\n\u003cp\u003ePrimary hepatocytes were isolated from juvenile healthy largemouth bass (weight: 10\u0026ndash;20 g) livers, which feed with commercial diets (Tongwei Co., Ltd., China) two times per day at 9:00 and 17:00, and cultured following established protocols (35). Briefly, healthy largemouth bass were first bled and sacrificed by gill cutting under sterile conditions. The livers were aseptically excised and finely minced using scissors in phosphate-buffered saline (PBS) at pH 7.4. Subsequently, the minced liver tissue underwent enzymatic digestion with trypsin (25200072; Thermo Fisher, USA) at 28\u0026deg;C for 40 min. The resulting cell suspension was then filtered through a 70 \u0026micro;m mesh and washed multiple times with PBS. A total of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e living cells per well were seeded into 6-well plates and culture at 28\u0026deg;C in a humidified incubator with air charge of 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells were treated with either low-glucose (LG; 1000mg/L) or high-glucose (HG; 4500mg/L) for 24 h, 48 h, and 72 h when they reached 70\u0026ndash;80% confluence. The cells were pretreated with various concentrations of SB203580 (p38 MAPK pathway inhibitor; S1076, Selleck Chemicals, Houston, Texas, USA) for 2 h, then treated with HG for 48 h.\u003c/p\u003e\n\u003ch3\u003eCell viability assays\u003c/h3\u003e\n\u003cp\u003eCell viability assays were examined by Cell Counting Kit-8 (CCK8) (FD3788; Fdbio Science, HangZhou, China). The isolated primary hepatocytes were seeded in 96-well plates (100 \u0026micro;L/well) at a density of 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cell/well. After 24 h, 48 h, and 72 h cultured in either LG or HG medium, 10 \u0026micro;L of CCK8 was added to each well 2 h prior to measuring the absorbance at 450 nm using a multifunctional microplate reader.\u003c/p\u003e\n\u003ch3\u003eAnnexin V-FITC/PI staining\u003c/h3\u003e\n\u003cp\u003eCell apoptosis was evaluated with flow cytometry (BL110A; Biosharp Life Sciences, Beijing, China). Primary hepatocytes were seeded in 6-well plates and subsequently digested with EDTA-free trypsin after LG or HG treatments. According to the manufacturer's instructions, both the supernatants and cell pellets were collected and stained with 5 \u0026micro;L of Annexin V-FITC and 10 \u0026micro;L of PI staining solution, respectively. The apoptotic cells were detected by flow cytometry (Backman cytoflex).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of mitochondrial membrane potential (MMP)\u003c/h2\u003e \u003cp\u003eAssessment of the electrical potential across the mitochondrial membrane (ΔΨm). The MMP alterations were evaluated using the MMP assay kit containing JC-1 (C2006; Beyotime Biotechnology, Shanghai, China). Hepatocytes were initially cultured with LG and HG for 48 h, followed by resuspension and subsequent incubation with JC-1 at a temperature of 28\u0026deg;C for 20 min. Afterward, the stained cells were examined with a fluorescence microscope called SP8 STED confocal laser scanning microscope.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMeasurement of ROS\u003c/h3\u003e\n\u003cp\u003eGeneration of intracellular ROS was identified by utilizing the H2DCF-DA probe (C-2938; Invitrogen\u0026trade;, Waltham, MA, USA). After LG or HG treated for 48 h, cells were incubated in serum-free DMEM with 15 \u0026micro;M H2DCF-DA for 30 min, shielded from light, and then the medium were replaced with pre-warmed PBS. ROS fluorescence was visualized under a Leica SP8 STED confocal laser scanning microscope (Leica Microsystems GmbH), and the intensities were measured using Image-Pro Plus software. Additionally, the level of ROS was also detected by flow cytometry (Cytoflex, Beckman Coulter, Inc.).\u003c/p\u003e\n\u003ch3\u003eElectron microscopy\u003c/h3\u003e\n\u003cp\u003eFor TEM microscopy, liver tissues and cells were fixed in 2.5% glutaraldehyde (AAPR46; Servicebio, Wuhan, China) and rinsed with PBS. The samples were dehydrated in a graded series of ethanol and embedded in pure resin overnight. In order to observe various structures within the livers and cells, a transmission electron microscope (JEM-1400 Flash, Japan) was used for observation and photography.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eOil Red O staining and PAS staining\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eFor the cellular experiments, Oil Red O staining and PAS staining were performed according to the manufacturer\u0026rsquo;s protocol (cat. nos. C0157 and C0142 respectively; Beyotime Institute of Biotechnology, Shanghai, China). lipid and glycogen accumulation in cells was observed using a 20\u0026#128500;fluorescence microscope (Leica DM1000; Leica Microsystems GmbH, Wetzlar, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of mitochondrial-related indicators\u003c/h2\u003e \u003cp\u003eMitochondrial staining assay was determined by staining the cells with Mito Tracker Red (cat. no. M7521; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and Mito Tracker Green FM (cat. no. M7514; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer\u0026rsquo;s protocol. The fluorescence intensity was assessed in 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells by flow cytometry. For mitochondrial reactive oxygen species (mROS) production and mitochondrial morphology analysis, cells were labeled with 5 \u0026micro;M Mito Tracker Red probe (CM-H2XRos; M-7513; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 5 \u0026micro;M Mito Tracker Red (M7521; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in PBS at 28\u0026deg;C for 30 min, and visualized using a Leica SP8 STED microscope (Leica Microsystems GmbH, Wetzlar, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eConfocal microscopy\u003c/h2\u003e \u003cp\u003eGFP-LC3 was stored in our laboratory. pcDNA3.1(+)-MITO/Turbo RFP was purchased from Yunzhou Biology Company (VB211020-1156jcn). Cells were transfected with 1 \u0026micro;g DNA plasmid with jetPRIME\u0026reg; (101000046; Polypolus, Strasbourg, France) in a laser confocal culture dish (80100215). To stain the acidic compartments, live cells were stained with 50 nM LysoTracker Red (L7528; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and incubated for 2 h at 28˚C in the dark Subsequent, cells were permeabilized using 0.1% Triton X-100 (AAPR96) and blocked using 2% BSA (AAPR305) in TBST. After incubation with primary antibodies (Tom20; 1:100; p-P38; 1:100) for one night, the membranes were washed with TBST and incubated with appropriate secondary antibodies (Alexa Fluor goat anti-rabbit 594, 1:100) for 1 h. Finally, ProLong Gold Antifade (P36941) was used to stain the nuclei and prevent fluorescence quenching. The slips were imaged using a Leica SP8 STED confocal laser scanning microscope (Leica Microsystems GmbH).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR (RT-PCR) and western blot\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from various tissues of largemouth bass and cells using RNAiso Plus reagent (9109, Takara Bio, Inc., Japan) and reverse transcribed to cDNA on the specification (AK2601; Takara Bio, Inc., Japan). RT-PCR was performed using the Roche Light Cycler 480II Real-Time System (Switzerland), and the gene expression levels were normalized with reference to \u003cem\u003eEF-1α\u003c/em\u003e (GenBank accession no. KT827794) using the 2-ΔΔCq method. PCR amplification primer sequences were shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primers (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primers (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSources/GenBank No.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCPTⅠ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCCCCTTTATTGACTTTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAACTTCCCTTTGTCCCTGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHSL\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGACAGGACAGTGAAGAGTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGATAATTCTCATGGGATTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024040152.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eATGL\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCATGATGCTCCCCTACACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCAGATACACTTCGGGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024044570.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePPAR-α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCACCGCAATGGTCGATATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCTGTTGATGGACTGGGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024041484.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFAS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCCCTTGACTCATTCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCAGACTACGACCCGACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024041262.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eACC1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCCCTCTTTGCCACTGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGTGATGTTGCTCGCATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024044681.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSREBP-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTCTGAGCTACAGCGACAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCATCACCAACAGGAGGTCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024040041.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePPAR-γ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGTGAGGGCTGTAAGGGTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGTTGCGGGACTTCTTGTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024043372.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLPL\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCAGCACTACCCGACCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGACTGTAACCCAGCAGATGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024040374.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAPOB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGCTGGGTGTTGTTGATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGAGCTGAGGGATGTTCTTGTTTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024041039.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAPOB100\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACTTGAAAATGTCCCTCTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTTAATGACTGATGACTCTGCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFABP1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAACCTCAAGGAGAGCCAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCGTCCACCGAGATAATAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024044459.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCYP7A1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGGCTTCACAGGCTAACACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCAGTGTGGGGTCGTTGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCYP8B1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGACAGCGGCAACCAGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGTGCTTTTGTTTCATCCTATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFXR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGAGCCGAAAGATGCCCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGATCTGGTGTCAGGATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024044570.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRXRα\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTGTCCAACCCTGGTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGCCGATGAGCTTGAAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024041151.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSHP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACCAACTCTTGCTGAAGTCCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCAACAAACGACAAGGCACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHMGCR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTGGAGTGCTTAGTAATCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGCAGGGAAGAAAGTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024044459.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFGFR4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTCAATCGGATTCGCTCACCAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGAAACCACAGGCATAGATGATGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038708053.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFGF19\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGCTGTGTTGTCATCAAAGGAGTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCTCTGCTGTAGGTGTGCGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038702190.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFGF21\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCTCGCTGACTCCAACCCTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTACTTCCCGATACTCTCCCATCCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038736351.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCYTB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCCGCCACAGTAATCCATCTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAACCCGAGCAAGTCTTTATAGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNC_008106.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNRF2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCTGTTCCCAGTATGGCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAGGGAGGCTTGTTTGGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024040596.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKEAP1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAACGTCCCACACGTGACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACAACATCTCCTGCCGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024041039.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKEAP1b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGTGTGATCAGTGGGCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGTGATCCACCAACCGCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024040263.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNQO1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACATCATCGGCGACCTGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGAACGCTGAACCAGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNW_024044348.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eENNP1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAGTGATGGAAACGGAGGGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAAGGACACCAGGATGAGAGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038726340.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGYS2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCTGATCGCCTGGTTCTTCAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCCTGCCACTCGTGGAAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038738888.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eACADM\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGCTGAGATGGCAATGAAGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGGCGATGGAGGCGTAGTAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038717481.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBCL-2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCCTTTGTGGAGCTGTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAAGAGGAGGAGGAGGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBAX\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTTCACTCAGTCCCACAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATACCCTCCCAGCCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038704178.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBAD\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACATTTCGGATGCCACTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTGCTCTTCTGCGATTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038730645.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eP53\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGATTGAATGGTGGTGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTCTGGCGGACTGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCAS3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTTCATTCGTCTGTGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAAAAAGTGATGTGAGGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCAS8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGACAGACAGCAGACAACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCATTTCAGCAAACACATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCAS9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGAATGCCTTCAGGAGACGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGAGGGGCAAGACAACAGGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCAS10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAACCACTCACAGCGTCTACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTTGGTTGAGGACAGAGAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[67]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEF-1α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCTGCTGGTGTTGGTGAGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTGGCTGTAAGGGGGCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKT827794.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eA mixture of protease inhibitors (FD1002; Fdbio science, Hangzhou, China) was added to RIPA lysis buffer (FD009; Fdbio science, Hangzhou, China; 1:100) to extract total protein from livers and cells. All details of the primary antibodies and corresponding secondary antibodies used were stated in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Bands were visualized using an Azure 300 ultra-sensitive chemiluminescence imager (Azure Biosystems, USA). Protein levels were standardized to β-actin levels and quantified using Image-Pro Plus software.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntibodies used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDilution ratio\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSupplier information\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #3662\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-ACC(Ser69)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #3661\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAMPKα\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #5831\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-AMPKα (Thr172)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #2535\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJNK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #3708\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-SAPK/JNK (Thr183/Tyr185)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #4668\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep38MAPK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:10000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #9212\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-p38 MAPK (Thr180/Tyr182)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:10000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #4511\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep44/42 MAPK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #4695\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhospho-p44/42 MAPK (Thr202/Tyr204)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #4370\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHsp60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProteintech, #15282\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDrp1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #43110T\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTom20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #43110T\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLC3B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSigma, # L7543\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePARK2/Parkin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProteintech, #66674\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePink1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell Signaling Technology, #14060T\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCAS3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAbmart, #T40044\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDyLight\u0026trade; 594 Goat anti-Rabbit IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInvitrogen, #35561\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat Anti-Rabbit IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:10000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProteintech, #SA00001-2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat Anti-Mouse IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:10000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProteintech, #SA00001-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAnalysis of variance (ANOVA) or unpaired/paired t-tests of three independent repeats were performed with GraphPad Prism 8 (GraphPad Software, Inc., La Jolla, CA, USA). Data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eHigh glucose treatment induced hepatic glycolipid accumulation, liver damage and oxidative stress in both largemouth bass and primary hepatocytes\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFollowing the 8-week experimental period, compared to the CON diet, the hepatosomatic index (HSI) and viscerosomatic index (VSI) were significantly increased in the largemouth bass fed HC diet (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Consistent with the HSI and VSI, HC-fed largemouth bass developed hepatomegaly (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). PAS staining in the liver tissue of largemouth bass further corroborated that HC diet caused profound glycogen accumulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Correspondingly, hepatic glycogen content in the HC diet was elevated by approximately 50% relative to the CON diet (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Largemouth bass primary hepatocytes were exposed to a high-glucose medium to replicate in vivo conditions associated with high carbohydrate intake, aiming to elucidate the impact of a high-carbohydrate diet on hepatic glycolipid accumulation. The results indicated that HG treatment significantly inhibited cell proliferation at 48 and 72 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Consequently, a 48-h treatment duration was chosen for subsequent high-glucose exposure in primary hepatocytes. The results of oil red O staining and PAS staining proved that HG treatment promoted the accumulation of lipid droplets and glycogen in primary hepatocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eG and H). Meanwhile, we also evaluated the expression of glycogenesis-related genes and the content of glycogen in primary hepatocytes. The results exhibited that HG treatment induced glycogen synthesis, as evidenced by an increase in the mRNA levels of \u003cem\u003eGYS2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eL) and the content of glycogen (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eK). Moreover, generation of ROS was observed by fluorescence microscopy to detect whether HG treatment can result in oxidative stress. In primary hepatocytes, HG treatment increased mean fluorescence intensity (MFI) of H2DCF-DA dye, indicating elevated ROS production as compared to LG treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eI). Flow cytometry analysis also demonstrated that HG treatment resulted in approximately 9% increased intracellular ROS levels in primary hepatocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). Additionally, the gene expression level of \u003cem\u003eNRF2\u003c/em\u003e was up-regulated, and the gene expression levels of \u003cem\u003eNQO1\u003c/em\u003e was down-regulated after HG treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eM).\u003c/p\u003e \u003cp\u003e \u003cb\u003eHigh glucose treatment disturbs fatty acid metabolism, bile acid metabolism and activates MAPK signal pathway in both largemouth bass and primary hepatocytes\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGiven that HC diet can lead to fat accumulation in visceral tissues, we further investigated the impact of HC diet on fatty acid metabolism and bile acid metabolism. Compared with CON diet, HC diet resulted in the upregulation of lipolysis/fatty acid oxidation, lipogenesis and fatty acid transport-associated genes, as evidenced by upregulated expression of \u003cem\u003eATGL\u003c/em\u003e, \u003cem\u003eFAS\u003c/em\u003e, \u003cem\u003eACC1\u003c/em\u003e, \u003cem\u003eSREBP1\u003c/em\u003e, \u003cem\u003ePPAR-γ\u003c/em\u003e, \u003cem\u003eAPOB\u003c/em\u003e, \u003cem\u003eAPOB100\u003c/em\u003e and \u003cem\u003eFABP1\u003c/em\u003e. The gene expression levels of \u003cem\u003eCYP7A1\u003c/em\u003e, \u003cem\u003eCYP8B1\u003c/em\u003e, and \u003cem\u003eSHP\u003c/em\u003e were down-regulated, and the gene expression levels of \u003cem\u003eFGFR4\u003c/em\u003e was up-regulated in largemouth bass fed HC diet (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Western blot results indicated that HC diet effectively inhibited the phosphorylation of AMPK and promoted the phosphorylation of ACC (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). To further characterize the impact of high glucose treatment on fatty acid metabolism, the phosphorylation of in vivo-validated AMPK and ACC were further analyzed in an in vitro model. Consistent with the in vivo results, HG treatment activated the phosphorylation of ACC and suppressed the phosphorylation of AMPK (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Since FGFR4 activation has been shown to initiate receptor tyrosine kinase signaling cascades, thereby activating the c-JUN and ERK signaling pathways (Liu et al., 2020), we further investigated whether HC diet might activate the MAPK signal pathways. Compared with CON diet, HC diet increased the phosphorylation of ERK, JNK and p38MAPK (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). As indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, the phosphorylation of ERK, JNK and p38MAPK were up-regulated after HG treatment. Thus, both in vivo and in vitro experiments demonstrated that high glucose treatment could promote fat synthesis by regulating the AMPK/ACC/SREBP-1 pathway and activate ERK, JNK and p38MAPK signal pathway.\u003c/p\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eHigh glucose treatment damages mitochondria function in both largemouth bass and primary hepatocytes\u003c/h2\u003e \u003cp\u003eTransmission electron microscopy (TEM) was used to further visualize the livers' ultramicroscopic characteristics and structural attributes. Largemouth bass fed HC diet exhibited a reduced mitochondria number, an increased damaged mitochondria and a large glycogen accumulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). It was well-established that that mitochondrial \u003cem\u003eCYTB\u003c/em\u003e transcription decreases with mitochondrial mass (Hauck et al., 2012). HC diet markedly decreased the expression \u003cem\u003eCYTB\u003c/em\u003e in liver and elevated the expression \u003cem\u003eCYTB\u003c/em\u003e in intestine, whereas the expression of the other tissues did not significantly change (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Other than that, flow cytometry analysis revealed that HG treatment promoted cell apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Mito Tracker Red/Mito Tracker Green intensity ratio was significantly decreased in HG-treated cells, indicating that loss of mitochondrial membrane potential (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The decline in mitochondrial membrane potential serves as an initial indicator of cell apoptosis. HG treatment resulted in a significant increase in the number of cells exhibiting depolarized mitochondria (green), indicating a decline in mitochondrial membrane potential in primary hepatocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). To visualize the morphological changes in primary hepatocytes treated HG, the cellular ultramicroscopic structures were also view by TEM. The mitochondria of HG-treated cells exhibited significant damage, characterized by a decrease in the number of mitochondria, mitochondrial swelling with partial vacuolation (Yellow arrow), an increased in the number of lipid droplets and an increase in the number of mitophagosomes (Red arrow) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). This was consistent with what we observed in vivo.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eHigh glucose treatment affects mitochondrial morphology and mitochondrial dynamics in primary hepatocytes\u003c/h2\u003e \u003cp\u003eIn the in vitro experiments, mitochondrial fusion and fission were initially detected using Mito-Tracker Red staining, and morphological alterations were observed via confocal microscopy. Under normal physiological conditions, mitochondria typically exhibit large, elongated structures with distinct networks. However, our results revealed that a significant reduction in mitochondrial length after HG treatment, indicating that HG treatment facilitated mitochondrial fission and degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Furthermore, the results showed that HG treatment notably elevated mitochondrial reactive oxygen species (mitoROS) production (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). A mitochondrial marker, Tom20, was immunofluorescence stained to further assess mitochondrial morphology. The results indicated that mitochondrial length decreased and division increased after HG treatment, which further indicated that HG treatment would lead to mitochondrial fracture and promote mitochondrial fission (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). In addition, the expression of related proteins was determined by western blot, which indicated that demonstrated a decrease in Tom20 and an increase in Drp1 levels following HG treatment, suggesting that HG treatment may play an important role in mitochondrial fission (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eHigh glucose treatment promotes mitophagy and autophagy flow in primary hepatocytes\u003c/h2\u003e \u003cp\u003eMitochondrial dynamics, encompassing fusion and fission processes, alongside autophagy, function as critical quality control mechanisms for maintaining mitochondrial homeostasis. An array of proteins associated with mitophagy, notably Pink1 and Parkin, in addition to autophagic proteins such as LC3II, were investigated (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In response to HG treatment, there was a marked upregulation of Pink1, Parkin, and LC3II, indicating that HG treatment may induce mitochondrial damage linked to Pink1/Parkin-mediated mitophagy. In order to further investigate the regulatory mechanism of HG treatment on autophagy, primary hepatocytes were transfected with a GFP-LC3 plasmid to quantify autophagosome formation. The results demonstrated that LG treated cells exhibited a limited number of autophagosomes, whereas a substantial increase in autophagosome formation was observed following HG treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Subsequently, laser confocal microscopy was employed to assess the colocalization of autophagosomes with lysosomes, mitochondria with lysosomes, and autophagosomes with mitochondria. The fusion of autophagosomes with lysosomes and mitochondria was increased, indicating that HG treatment increased the autophagic flux (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), meanwhile, HG treatment facilitated the fusion of mitochondria and lysosomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). In light of the above data, we have demonstrated HG treatment enhanced Pink1/Parkin-mediated mitophagy in vitro.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eHigh glucose treatment causes mitochondrial apoptosis in primary hepatocytes\u003c/h2\u003e \u003cp\u003eIn order to elucidate the impact of high glucose treatment on mitochondrial apoptosis. RT-PCR was used to quantify the expression of Bcl-2 family (\u003cem\u003eBCL-2\u003c/em\u003e, \u003cem\u003eBAX\u003c/em\u003e, and \u003cem\u003eBAD\u003c/em\u003e) and Caspase family (\u003cem\u003eCAS3\u003c/em\u003e, \u003cem\u003eCAS8\u003c/em\u003e, \u003cem\u003eCAS9\u003c/em\u003e, \u003cem\u003eCAS10\u003c/em\u003e and \u003cem\u003eP53\u003c/em\u003e). As expected, HG treatment boosted mitochondrial apoptosis, as evidenced by elevated expressions of \u003cem\u003eBAX\u003c/em\u003e, \u003cem\u003eBAD CAS3\u003c/em\u003e, and \u003cem\u003eCAS9\u003c/em\u003e, and decreased expressions of \u003cem\u003eBCL-2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). P-P38 immunofluorescence was markedly enhanced both in the cytoplasm and nucleus in HG treated primary hepatocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Thus, we ensured that HG treatment significantly inhibited the p38MAPK signal pathway. Primary hepatocytes were pretreated with different concentrations of SB203580 for 2 h and incubated with HG for another 48 h. The gene and protein levels of CAS3 were significantly downregulated by the addition of SB203580 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Furthermore, the gene expression levels of \u003cem\u003eBCL-2\u003c/em\u003e, \u003cem\u003eBAX\u003c/em\u003e and \u003cem\u003eCAS3\u003c/em\u003e were significantly altered in cells treated with HG in the presence of SB203580 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). The results suggest that high glucose treatment can induce mitochondrial apoptosis by activating the P38MAPK signaling pathway.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe hepatosomatic index (HSI) is widely acknowledged as an essential marker for assessing the size of the liver in fish and is additionally utilized to evaluate the general development and well-being of fish [38, 39]. In a study of grouper (\u003cem\u003eEpinephelus akaara\u003c/em\u003e), HSI was significantly elevated when the fish was fed high carbohydrate diet [40]. Similarly, in the present study, both HIS and VSI of largemouth bass fed HC diet showed significant increases Subsequent cellular experiments revealed a greater accumulation of lipid droplets in cells treated with high glucose, further corroborating that a high-carbohydrate diet induced an over-accumulation of lipid in the liver. A similar phenomenon was also observed in Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) [41], Gibel Carp (\u003cem\u003eCarassius gibelio\u003c/em\u003e) [42], and rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) [43]. Excessive glycogen accumulation in the liver has been reported to cause more significant hepatocellular injury compared to lipid accumulation [44]. PAS staining and biochemical analysis revealed excessive accumulation of glycogen in the liver, which a critical factor contributing to the higher HSI observed in largemouth bass fed HC diet compared to those fed CON diet.\u003c/p\u003e \u003cp\u003eLipid accumulation is well recognized to be mediated by AMPK and SREBP. The activated form of SREBP-1 is responsible for the upregulation of gene expression related to lipid biosynthesis, leading to an increase in lipid droplet formation and overall lipid content [45]. It has been shown that the high glucose treatment of hepatocytes suppresses the expression of SREBP-1 target genes by AMPK by repressing its cleavage and translocation intranuclearly [46]. Interestingly, HC diet could increase lipid production by inhibiting AMPK, causing \u003cem\u003eACC\u003c/em\u003e, \u003cem\u003eSREBP1\u003c/em\u003e, and \u003cem\u003eFAS\u003c/em\u003e to be increased, but had little effect on \u003cem\u003eCPT1\u003c/em\u003e, \u003cem\u003eATGL\u003c/em\u003e and \u003cem\u003ePPAR-α\u003c/em\u003e. Additionally, FABP1 functions as a transport agent, a transporter, and a metabolic regulator of fatty acids [47]. This study found that HC diet significantly upregulated \u003cem\u003eAPOB\u003c/em\u003e, \u003cem\u003eAPOB100\u003c/em\u003e and \u003cem\u003eFABP1\u003c/em\u003e in largemouth bass that had fatty liver, indicating that it promoted the absorption and transport of fatty acids and the synthesis of triglycerides. Despite differences in feed formulas, our results were in agreement with previous studies [3].\u003c/p\u003e \u003cp\u003eCurrent findings indicated that liver damage and lipid accumulation in largemouth bass can be induced by HC diet. Similar phenomena have been reported in other fish species [48\u0026ndash;50]. Liver injury is primarily attributed to the initial toxic effects of excessive lipids [51]. Mounting evidence shows that the accumulation of both cholesterol and triglycerides may result in lipotoxicity [52]. Beyond that, abnormal accumulation of free cholesterol is believed to compromise the integrity of mitochondrial and endoplasmic reticulum membranes, thereby exacerbating promote mitochondrial oxidative damage and endoplasmic reticulum stress, and finally induce and aggravate liver injury [53]. This study found that HC diet greatly suppressed the expression of genes related to bile acid metabolism (\u003cem\u003eCYP7A1\u003c/em\u003e, \u003cem\u003eCYP8B1\u003c/em\u003e, \u003cem\u003eSHP\u003c/em\u003e), indicating disrupted cholesterol homeostasis. Meanwhile, HC diet caused mitochondrial oxidative damage and lipid accumulation in largemouth bass and cell experiments, suggesting it may directly lead to liver injury and lipid buildup. In the present study, we found that HC diet did not affect mRNA expressions of \u003cem\u003eFXR\u003c/em\u003e, \u003cem\u003eRXRα\u003c/em\u003e and \u003cem\u003eHMGCR\u003c/em\u003e in the liver, aligning with previous research [54]. This might be because FXR primarily functions in the liver-gut axis, and the HC diet has a less effect on regulating FXR expression in the liver.\u003c/p\u003e \u003cp\u003eDivision and fusion of mitochondria are essential for maintaining their function, especially when cells experience metabolic or environmental stress [55]. It has been reported that high-fat diet in \u003cem\u003ePelteobagrus pelteobagrus\u003c/em\u003e can activate mitochondrial biogenesis, promote mitochondrial fusion and induce oxidative stress, consequently leading to increased lipid accumulation [30]. Prolonged consumption of high-carbohydrate diets has been associated with the induction of oxidative stress, which may impair mitochondrial respiratory chain activity in the liver of rainbow trout [56] and \u003cem\u003eMegalobrama amblycephala\u003c/em\u003e [57]. In this study, HG treatment caused mitochondrial rupture and increased mitoROS levels. It decreased the fusion protein Tom20 and increased the fission protein Drp1, suggesting HG promotes fission over fusion. This excess ROS from fission may trigger mitochondrial autophagy. Mechanically, the overproduction of ROS due to mitochondrial fission may also trigger mitochondrial autophagy [58, 59]. Previous studies have shown that Pink1 and Parkin are crucial for both clearing damaged mitochondria and regulating mitochondrial dynamics [60]. The results showed that HG treatment significantly increased Pink1 and Parkin protein levels, suggesting that mitochondrial morphological changes in HG environments may be related to Pink1 accumulation and Parkin translocation, and these processes may affect mitochondrial quality control and the autophagy machinery [61]. Furthermore, it was found that HG treatment significantly reduced the total number of mitochondria while increasing mitochondrial autophagosomes and damaged mitochondria. Additionally, HG treatment enhanced the co-localization of autophagosomes with lysosomes, autophagosomes with mitochondria, and mitochondria with lysosomes, suggesting increased mitochondrial degradation via the autophagosome-lysosome pathway.\u003c/p\u003e \u003cp\u003eIt has been shown that a wide array of extracellular stimuli can activate the MAPK signaling pathway, including stress induced by high glucose treatment [62, 63]. The MAPK signaling pathway is an important downstream signal in multiple proliferation, differentiation, apoptosis and survival pathways [64]. We further elucidated the regulatory role of the p38MAPK pathway in mitochondrial apoptosis in high glucose treated cells, which was consistent with previous results [35]. In insulin resistant HepG2, high glucose levels have been shown to induce insulin resistance by regulating the JNK-IRS-1 signaling pathway [65]. Our study found that HG treatment augmented the production of ROS and induced oxidative stress in primary hepatocytes. Excessive ROS generation can activate the c-Jun NH\u003csub\u003e2\u003c/sub\u003e-terminal kinase (JNK) pathway, leading to the phosphorylation of insulin receptor substrate-1 (IRS-1) at Ser307 [66]. Related research has demonstrated that high glucose levels induce insulin resistance through the activation of the JNK signaling pathway, which may contribute to starch intolerance in largemouth bass.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eTo conclude, our results demonstrate first-time evidence that the AMPK-mediated ACC/SREBP-1 pathway contributes to lipid accumulation in largemouth bass, both in vivo and in vitro. Concurrently, high carbohydrate diet may lead to the disruption of cholesterol homeostasis and the activation of the MAPK (p38MAPK, ERK and JNK) signaling pathways. In addition, this study is also the first to establish a primary hepatocyte injury model using high glucose, confirming its role in mitochondrial damage and glycolipid accumulation. Simultaneously, we found a correlation between mitophagy and high glucose treatment, and identified a regulatory mechanism of Pink1/Parkin-mediated mitophagy in primary hepatocytes.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003eCRediT authorship contribution statement\u003c/h2\u003e \u003cp\u003eLiao Zhi-Hong: Conceptualization, Methodology, Formal analysis, Writing-original draft. He Xuan-Shu: Methodology, Data curation, Investigation. Ye Tao: Conceptualization, Writing-review \u0026amp; editing. Gu Xing-Yu: Writing-review \u0026amp; editing. Chen An-Qi: Methodology, Data curation. Guo Yu-Cai: Writing-review \u0026amp; editing. Zhao Wei and Niu Jin: Conceptualization, Supervision, Writing-review \u0026amp; editing. All data were generated in-house, and no paper mill was used. All authors agree to be accountable for all aspects of work ensuring integrity and accuracy.\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eACADM\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eAcyl-CoA dehydrogenase medium\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eACC1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eAcetyl-CoA carboxylase 1\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eAPOB\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eApolipoprotein B\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eATGL\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eAdipose triglyceride lipase\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eAMPK\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eAdenosine 5\u0026lsquo;-monophosphate (AMP)-activated protein kinase\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eBA\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eBile acid\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eCCK8\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eCell counting kit-8\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eCON\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eControl\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eCPT1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eCarnitine palmitoyltransferase 1\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eCYP7A1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eCholesterol 7-hydroxylase\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eCYP8B1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eSterol 12-hydroxylase\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eCYTB\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eCytochrome b\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eEDTA\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eEthylenediaminetetraacetic acid\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eEF-1\u0026alpha;\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eElongation factor 1\u0026alpha;\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eENNP1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003ePhosphodiesterase 1\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eFABP1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eFatty acid binding protein 1\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eFAS\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eFatty acid synthase\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eFBS\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eFetal bovine serum\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eFGFR4\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eFibroblast growth factor receptor 4\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eFITC\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eFluorescein isothiocyanate\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eFXR\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eFarnesoid X receptor\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eGSY2\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eGlycogen synthase 2\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eHC\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eHigh carbohydrate\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eHG\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eHigh glucose\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eHSL\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eHormone-sensitive lipase\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eHSI\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eHepatosomatic index\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eKeap1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eKelch-like ECH-associated protein 1\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eLG\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eLow glucose\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eLPL\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eLipoprotein lipase\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eMAPK\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eMicrotubule-associated protein kinase\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eMMP\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eMitochondrial membrane potential\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003emitoROS\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eMitochondrial reactive oxygen species\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eNIH\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eNational institutes of health\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eNqo1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eNAD(P)H oxidoreductase 1\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eNrf2\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eNuclear factor erythroid 2-related factor 2\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003ePAS\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003ePeriodic acid-schiff\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003ePBS\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003ePhosphate-buffered saline\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003ePI\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003ePropidium iodide\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u0026zwnj;\u003cstrong\u003ePPAR-\u0026alpha;\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003ePeroxisome proliferator-activated receptor alpha\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003ePPAR-\u0026gamma;\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003ePeroxisome proliferator-activated receptor\u0026gamma;\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eqRT-PCR\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eQuantitative real-time PCR\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eROS\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eReactive oxygen species\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eSHP\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eSmall heterodimer partner\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eSREBP1\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eSterol regulatory element-binding protein 1\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eTEM\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eTransmission electron microscopy\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\n\u003cdiv class=\"Term\"\u003e\u003cstrong\u003eVSI\u003c/strong\u003e\u003c/div\u003e\n\u003cdiv class=\"Description\"\u003e\n\u003cp\u003eViscerosomatic index\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"DefinitionListEntry\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eThe National Institutes of Health (NIH) guidelines for laboratory animal care and use were strictly followed during all experimental procedures. The study protocol was approved by Experimental Animal Ethics Committee of Sun Yat-Sen University. The protocol number was SYSU-LS-IACUC-2024-0020.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo applicable.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eLiao Zhi-Hong: Conceptualization, Methodology, Formal analysis, Writing-original draft. GHe Xuan-Shu: Methodology, Data curation, Investigation. u Xing-Yu: Writing-review \u0026amp; editing. Ye Tao: Conceptualization, Writing-review \u0026amp; editing. Chen An-Qi: Methodology, Data curation. Guo Yu-Cai: Writing-review \u0026amp; editing. Zhao Wei and Niu Jin: Conceptualization, Supervision, Writing-review \u0026amp; editing.\u003c/p\u003e\n\u003ch2\u003eAcknowledgment\u003c/h2\u003e\n\u003cp\u003eThis research was supported by Project of National Natural Science Foundation of China (32172982), Project of Science and Technology of Guangdong Province (2021B0202050002), Project of Science and Technology of Guangdong Province (2023A1515012627). National Natural Science Foundation of China (32303014), Guangdong Basic and Applied Basic Research Foundation (2024A1515010444). We also thank the Home for Researchers (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.home-for-researchers.com\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\n\u003ch2\u003eAvailability of data and material\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLi X, Zheng S, Han T, Song F, Wu G. Effects of dietary protein intake on the oxidation of glutamate, glutamine, glucose and palmitate in tissues of largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e). Amino Acids 2020; 52 (11-12):1491-1503.\u003c/li\u003e\n\u003cli\u003eLin S, Shi CM, Mu MM, Chen YJ, Luo L. Effect of high dietary starch levels on growth, hepatic glucose metabolism, oxidative status and immune response of juvenile largemouth bass, \u003cem\u003eMicropterus salmoides\u003c/em\u003e. Fish Shellfish Immunol 2018; 78:121-126.\u003c/li\u003e\n\u003cli\u003eXue M, Yao T, Xue M, Francis F, Qin Y, Jia M, Li J, Gu X. Mechanism analysis of metabolic fatty liver on largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e) based on integrated lipidomics and proteomics. Metabolites 2022; 12 (8): 759.\u003c/li\u003e\n\u003cli\u003eZhang Y, Xie SW, Wei HL, Zheng L, Liu ZL, Fang HH, Xie J, Liao S, Tian L, Liu Y, Niu J. High dietary starch impaired growth performance, liver histology and hepatic glucose metabolism of juvenile largemouth bass, \u003cem\u003eMicropterus salmoides\u003c/em\u003e. Aquac. Nutr 2020; 26 (4): 1083-1095.\u003c/li\u003e\n\u003cli\u003eLi X, Zheng S, Ma XT, Song F, Wu G. Effects of dietary starch and lipid levels on the protein retention and growth of largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e). Amino Acids 2020; 52 (6-7):999-1016.\u003c/li\u003e\n\u003cli\u003eZhang BY, Yang HL, Nie QJ, Zhang Y, Cai GH, Sun YZ. High dietary wheat starch negatively regulated growth performance, glucose and lipid metabolisms, liver and intestinal health of juvenile largemouth bass \u003cem\u003eMicropterus salmoides\u003c/em\u003e. Fish Physiol. Biochem 2024; 50 (2): 635-651.\u003c/li\u003e\n\u003cli\u003eLi S, Sang C, Turchini GM, Wang A, Zhang J, Chen N. Starch in aquafeeds: the benefits of a high amylose to amylopectin ratio and resistant starch content in diets for the carnivorous fish, largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e). Br. J. Nutr 2020; 124 (11):1145-1155.\u003c/li\u003e\n\u003cli\u003eXie S, Xu J, Chen L, Qi Y, Yang H, Tan B. Single-cell transcriptomic analysis revealed the cell population changes and cell-cell communication in the liver of a carnivorous fish in response to high-carbohydrate diet. J. Nutr 2024; 154 (8):2381-2395.\u003c/li\u003e\n\u003cli\u003eZhou YL, He GL, Jin T, et al. High dietary starch impairs intestinal health and microbiota of largemouth bass, \u003cem\u003eMicropterus salmoides\u003c/em\u003e. Aquaculture 2021; 534:736261.\u003c/li\u003e\n\u003cli\u003eAlves A, Pereira RT, Rosa PV. Morphology of the digestive system in carnivorous freshwater \u003cem\u003eDourado salminus brasiliensis\u003c/em\u003e. J. Fish Biol 2021; 99(4): 1222-1235.\u003c/li\u003e\n\u003cli\u003eLi S, Wang A, Li Z, Chen YJ, Dai FY, Luo L, Lin SM. Antioxidant defenses and non-specific immunity at enzymatic and transcriptional levels in response to dietary carbohydrate in a typical carnivorous fish, hybrid grouper (\u003cem\u003eEpinephelus fuscoguttatus\u003c/em\u003e ♀\u0026times;\u003cem\u003eE. Lanceolatus\u003c/em\u003e ♂). Fish Shellfish Immunol 2020; 100: 109-116.\u003c/li\u003e\n\u003cli\u003eBechmann LP, Hannivoort RA, Gerken G, Hotamisligil GS, Trauner M, Canbay A. The interaction of hepatic lipid and glucose metabolism in liver diseases. J. Hepatol 2012; 56 (4):952-964.\u003c/li\u003e\n\u003cli\u003eXie D, Yang L, Yu R, Chen F, Lu R, Qin C, Nie G. Effects of dietary carbohydrate and lipid levels on growth and hepatic lipid deposition of juvenile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. Aquaculture 2017; 479:696-703.\u003c/li\u003e\n\u003cli\u003eLi S, Sang C, Zhang J, et al. Molecular cloning, expression profiling of adipose triglyceride lipase (atgl) and forkhead box o1 (foxo1), and effects of dietary carbohydrate level on their expression in hybrid grouper (\u003cem\u003eEpinephelus fuscoguttatus\u003c/em\u003e ♀ \u0026times; \u003cem\u003eE. Lanceolatus \u003c/em\u003e♂). Aquaculture 2018; 492:103-112.\u003c/li\u003e\n\u003cli\u003eCai W, Liang X, Yuan X, Li Z, Chen N. Different strategies of grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e) responding to insufficient or excessive dietary carbohydrate. Aquaculture 2018; 497:292-298.\u003c/li\u003e\n\u003cli\u003eLiang X, Chen P, Wu X, Xin, S, Morais S, He M, Gu X, Xue M. Effects of high starch and supplementation of an olive extract on the growth performance, hepatic antioxidant capacity and lipid metabolism of largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e). Antioxidants 2022; 11 (3):577.\u003c/li\u003e\n\u003cli\u003eMarin JJ, Macias RI, Briz O, Banales JM, Monte MJ. Bile acids in physiology, pathology and pharmacology. Curr. Drug Metab 2015; 17 (1):4-29.\u003c/li\u003e\n\u003cli\u003eWang H, He Q, Wang G, Xu X, Hao H. Fxr modulators for enterohepatic and metabolic diseases. Expert Opin. Ther. Patents 2018; 28 (11):765-782.\u003c/li\u003e\n\u003cli\u003eWang LX, Frey MR, Kohli R. The role of fgf19 and malrd1 in enterohepatic bile acid signaling. Front. Endocrinol 2021; 12:799648.\u003c/li\u003e\n\u003cli\u003eGehart H, Kumpf S, Ittner A, Ricci R. MAPK signaling in cellular metabolism: stress or wellness? Embo Rep 2010; 11 (11):834-840.\u003c/li\u003e\n\u003cli\u003eDeng J, Zhang X, Lin B, Mi H, Zhang L. Excessive dietary soluble arabinoxylan impairs the intestinal physical and immunological barriers via activating MAPK/NF-\u0026kappa;B signaling pathway in rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). Fish Shellfish Immunol 2023; 141:109041.\u003c/li\u003e\n\u003cli\u003eSong ZX, Jiang WD, Liu Y, Wu P, Jiang J, Zhou XQ, Kuang SY, Tang L, Tang WN, Zhang YA. Dietary zinc deficiency reduced growth performance, intestinal immune and physical barrier functions related to NF-\u0026kappa;B, TOR, Nrf2, JNK and MLCK signaling pathway of young grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e). Fish Shellfish Immunol 2017; 66:497-523.\u003c/li\u003e\n\u003cli\u003eLi X, Cui K, Fang W, Chen Q, Xu D, Mai K, Zhang Y, Ai Q. High level of dietary olive oil decreased growth, increased liver lipid deposition and induced inflammation by activating the p38 MAPK and JNK pathways in large yellow croaker (\u003cem\u003eLarimichthys crocea\u003c/em\u003e). Fish Shellfish Immunol 2019; 94:157-165.\u003c/li\u003e\n\u003cli\u003eZhang W, Dan Z, Zheng J, Du J, Liu Y, Zhao Z, Gong Y, Mai K, Ai Q. Optimal dietary lipid levels alleviated adverse effects of high temperature on growth, lipid metabolism, antioxidant and immune responses in juvenile turbot (\u003cem\u003eScophthalmus maximus l.\u003c/em\u003e). Comp. Biochem. Physiol. B-Biochem. Mol. Biol 2024; 272:110962.\u003c/li\u003e\n\u003cli\u003eLi M, Hu FC, Qiao F, Du ZY, Zhang ML. Sodium acetate alleviated high-carbohydrate induced intestinal inflammation by suppressing MAPK and NF-\u0026kappa;B signaling pathways in Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e). Fish Shellfish Immunol 2020; 98:758-765.\u003c/li\u003e\n\u003cli\u003eLiu H, Chen B, Cao Y, Geng Y, Ouyang P, Chen D, Li L, Huang X. High starch diets attenuate the immune function of \u003cem\u003eMicropterus salmoide\u003c/em\u003es immune organs by modulating Keap1/Nrf2 and MAPK signaling pathways. Fish Shellfish Immunol 2023; 142:109079.\u003c/li\u003e\n\u003cli\u003eSule R, Condon L, Gomes A. Common feature of pesticides: oxidative stress-the role of oxidative stress in pesticide-induced toxicity. Oxid Med Cell Longev 2022; 2022:5563759.\u003c/li\u003e\n\u003cli\u003eXu C, Liu WB, Zhang DD, Shi JH, Zhang L, Li XF. Benfotiamine, a lipid-soluble analog of vitamin B1, improves the mitochondrial biogenesis and function in blunt snout bream (\u003cem\u003eMegalobrama amblycephala\u003c/em\u003e) fed high-carbohydrate diets by promoting the AMPK/PGC-1\u0026beta;/NRF-1 axis. Front Physiol 2018; 9:1-15.\u003c/li\u003e\n\u003cli\u003eShen HC, Chen ZQ, Chen F, Chen S, Ning, LJ, Tian HY, Xu C. DHA alleviates high glucose-induced mitochondrial dysfunction in \u003cem\u003eOreochromis niloticus\u003c/em\u003e by inhibiting DRP1-mediated mitochondrial fission. Int J Biol Macromol 2023; 244:125409.\u003c/li\u003e\n\u003cli\u003eSong YF, Hogstrand C, Ling SC, Chen GH, Luo Z. Creb-Pgc1\u0026alpha; pathway modulates the interaction between lipid droplets and mitochondria and influences high fat diet-induced changes of lipid metabolism in the liver and isolated hepatocytes of yellow catfish. J Nutr Biochem 2020; 80:108364.\u003c/li\u003e\n\u003cli\u003eCatalani E, Silvestri F, Bongiorni S, Taddei AR, Fanelli G, Rinalducci S, Palma CD. Retinal damage in a new model of hyperglycemia induced by high-sucrose diets. Pharmacol Res 2021; 166:195488.\u003c/li\u003e\n\u003cli\u003eWang KW, Liu QQ, Zhu J, Deng X, Luo L, Lin SM, Qin CJ, Chen YJ. Transcriptome analysis provides insights into the molecular mechanism of liver inflammation and apoptosis in juvenile largemouth bass \u003cem\u003eMicropterus salmoides\u003c/em\u003e fed low protein high starch diets. Comp. Biochem. Physiol. D-Genomics Proteomics 2023; 45:101047.\u003c/li\u003e\n\u003cli\u003eXie Y, Shao X, Zhang P, Zhang H, Yu J, Yao X, Fu Y, Wei J, Wu C. High starch induces hematological variations, metabolic changes, oxidative stress, inflammatory responses, and histopathological lesions in largemouth bass \u003cem\u003e(Micropterus salmoides\u003c/em\u003e). Metabolites 2024; 14 (4):236.\u003c/li\u003e\n\u003cli\u003eShi B, Qian T, Yin Z, Zhang Y, Feng T, Dong Z, Cai W, Zhang Y. Comparing effects of high starch diet or high lipid diet supplemented with different levels of zinc on intestinal barrier and microbe community in largemouth bass \u003cem\u003eMicropterus salmoides\u003c/em\u003e. Fish Shellfish Immunol 2024; 154:109911.\u003c/li\u003e\n\u003cli\u003eLiao ZH, He XS, Chen AQ, Zhong J, Lin SH, Guo YC, Chen BY, Zhao W, Niu J. Astaxanthin attenuates glucose-induced liver injury in largemouth bass: role of p38MAPK and PI3K/Akt signaling pathways. Cell Biosci 2024; 14 (1):122.\u003c/li\u003e\n\u003cli\u003eHauck L, Stanley-Hasnain S, Fung A, Grothe D, Rao V, Mak TW, Mak TW, Billia F. Cardiac-specific ablation of the e3 ubiquitin ligase mdm2 leads to oxidative stress, broad mitochondrial deficiency and early death. Plos One 2017; 12 (12):e0189861.\u003c/li\u003e\n\u003cli\u003eLiu Y, Cao M, Cai Y, Li X, Zhao C, Cui R. Dissecting the role of the FGF19-FGFR4 signaling pathway in cancer development and progression. Front. Cell. Dev. Biol 2020; 8:95.\u003c/li\u003e\n\u003cli\u003eLi X, Zheng S, Ma X, Cheng K, Wu G. Use of alternative protein sources for fishmeal replacement in the diet of largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e). Part I: effects of poultry by-product meal and soybean meal on growth, feed utilization, and health. Amino Acids 2021; 53 (1):33-47.\u003c/li\u003e\n\u003cli\u003eDu ZY, Turchini GM. Are we actually measuring growth? -an appeal to use a more comprehensive growth index system for advancing aquaculture research. Rev. Aquac 20222; 14 (2):525-527.\u003c/li\u003e\n\u003cli\u003eWang J, Li X, Han T, Yang Y, Jiang Y, Yang M, Xu Y, Harpaz S. Effects of different dietary carbohydrate levels on growth, feed utilization and body composition of juvenile grouper \u003cem\u003eEpinephelus akaara\u003c/em\u003e. Aquaculture 2016; 459:143-147.\u003c/li\u003e\n\u003cli\u003eXu R, Li M, Wang T, Zhao YW, Shan CJ, Qiao F, Chen LQ, Zhang WB, Du ZY, Zhang ML. \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e ameliorates high-carbohydrate diet-induced metabolic phenotypes by restoration of intestinal acetate-producing bacteria in Nile tilapia. Br. J. Nutr 2022; 127 (5):653-665.\u003c/li\u003e\n\u003cli\u003eGong Y, Xi L, Liu Y, Lu Q, Zhang Z, Liu H, Jin J, Yang Y, Zhu X, Xie S, Han D. Sequential activations of CHREBP and SREBP1 signals regulate the high-carbohydrate diet-induced hepatic lipid deposition in Gibel carp (\u003cem\u003eCarassius gibelio\u003c/em\u003e). Aquac. Nutr 2023; 2023:6672985.\u003c/li\u003e\n\u003cli\u003eYu H, Geng S, Li S, Wang Y, Ren X, Zhong D, Mo H, Yao M, Yu J, Li Y, Wang L. The MAPK and AKT/GSK3beta pathways are involved in recombinant proteins fibroblast growth factor 1 (RFGF1 and RFGF1a) improving glycolipid metabolism in Rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) fed a high carbohydrate diet. Anim. Nutr 2024; 17:11-24.\u003c/li\u003e\n\u003cli\u003eAllende DS, Gawrieh S, Cummings OW, Belt P, Wilson L, Van-Natta M, Behling CA, Carpenter D, Gill RM, Kleiner DE, Yeh MM, Chalasani N, Guy CD. Glycogenosis is common in nonalcoholic fatty liver disease and is independently associated with ballooning, but lower steatosis and lower fibrosis. Liver Int 2021; 41 (5):996-1011.\u003c/li\u003e\n\u003cli\u003eWalker AK, Jacobs RL, Watts JL, Rottiers V, Jiang K, Finnegan DM, Shioda T, Hansen M, Yang F, Niebergall LJ, Vance DE, Tzoneva M, Hart AC, Naar AM. A conserved srebp-1/phosphatidylcholine feedback circuit regulates lipogenesis in metazoans. Cell 2011; 147 (4):840-852.\u003c/li\u003e\n\u003cli\u003eHan Y, Hu Z, Cui A, Liu Z, Ma F, Xue Y, Liu, Y, Zhang F, Zhao Z, Yu Y, Gao J, Wei C, Li J, Fang J, Li J, Fan JG, Song BL, Li Y. Post-translational regulation of lipogenesis via AMPK-dependent phosphorylation of insulin-induced gene. Nat. Commun 2019; 10 (1):623.\u003c/li\u003e\n\u003cli\u003eIto H, Yamashita H, Nakashima M, Takaki A, Yukawa C, Matsumoto S, Omoto T, Shinozaki M, Nishio S, Abe M, Antoku S, Mifune M, Togane M. Current metabolic status affects urinary liver-type fatty-acid binding protein in normoalbuminuric patients with type 2 diabetes. J Clin Med Res 2017; 9 (4):366-373.\u003c/li\u003e\n\u003cli\u003eGe Y, Zhang L, Chen W, Sun M, Liu W, Li X. Resveratrol modulates the redox response and bile acid metabolism to maintain the cholesterol homeostasis in fish \u003cem\u003eMegalobrama amblycephala\u003c/em\u003e offered a high-carbohydrate diet. Antioxidants 2023; 12 (1):121.\u003c/li\u003e\n\u003cli\u003eYu C, Wang L, Cai W, Zhang W, Hu Z, Wang Z, Yang Z, Peng M, Huo H, Zhang Y, Zhou Q. Dietary macroalgae saccharina japonica ameliorates liver injury induced by a high-carbohydrate diet in swamp eel (\u003cem\u003eMonopterus albus\u003c/em\u003e). Front. Vet. Sci 2022; 9:869369.\u003c/li\u003e\n\u003cli\u003eZhou NN, Wang T, Lin YX, Xu R, Wu HX, Ding FF, Qiao F, Du ZY, Zhang ML. Uridine alleviates high-carbohydrate diet-induced metabolic syndromes by activating SIRT1/AMPK signaling pathway and promoting glycogen synthesis in Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e), Anim. Nutr 2023; 14:56-66.\u003c/li\u003e\n\u003cli\u003eMarra F, Svegliati-Baroni G. Lipotoxicity and the gut-liver axis in nash pathogenesis. J. Hepatol 2018; 68(2) :280-295.\u003c/li\u003e\n\u003cli\u003eIoannou GN. The role of cholesterol in the pathogenesis of NASH. Trends Endocrinol. Metab 2016; 27 (2):84-95.\u003c/li\u003e\n\u003cli\u003eZhou M, Liu X, Wu Y, Xiang Q, Yu R. Liver lipidomics analysis revealed the protective mechanism of zuogui jiangtang qinggan formula in type 2 diabetes mellitus with non-alcoholic fatty liver disease. J. Ethnopharmacol 2024; 329:118160.\u003c/li\u003e\n\u003cli\u003eZheng Y, Lu Q, Cao J, Liu Y, Liu H, Jin J, Zhang Z, Yang Y, Zhu X, Han D, Xie S. Supplementation of mangiferin to a high-starch diet alleviates hepatic injury and lipid accumulation potentially through modulating cholesterol metabolism in Channel catfish (\u003cem\u003eIctalurus punctatus\u003c/em\u003e). Antioxidants 2024; 13 (6):722.\u003c/li\u003e\n\u003cli\u003eRichard J, Youle AW, Van B. Mitochondrial fission, fusion, and stress. Science 2012; 337(6098):1062-1065.\u003c/li\u003e\n\u003cli\u003eEya JC, Yossa R, Perera D, Okubajo O, Gannam A. Combined effects of diets and temperature on mitochondrial function, growth and nutrient efficiency in rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). Comp Biochem Physiol B Biochem Mol Biol 2017; 212:1-11.\u003c/li\u003e\n\u003cli\u003eLi XF, Wang BK, Xu C, Shi HJ, Zhang L, Liu JD, Tian HY, Liu WB. Regulation of mitochondrial biosynthesis and function by dietary carbohydrate levels and lipid references in juvenile blunt snout bream \u003cem\u003eMegalobrama amblycephala\u003c/em\u003e. Comp Biochem Physiol A Mol Integr Physiol 2019; 227:14-24.\u003c/li\u003e\n\u003cli\u003eYu TZ, Jhun BS, Yoon Y. High-glucose stimulation increases reactive oxygen species production through the calcium and mitogen-activated protein kinase-mediated activation of mitochondrial fission. Antioxid Redox Signal 2011; 14(3):425-37.\u003c/li\u003e\n\u003cli\u003eDu JJ, Hang PZ, Pan Y, Feng B, Zheng YY, Chen TT, Zhao LH, Du ZM. Inhibition of miR-23a attenuates doxorubicin-induced mitochondria-dependent cardiomyocyte apoptosis by targeting the PGC-1\u0026alpha;/Drp1 pathway. Toxicol Appl Pharmacol 2019; 369:73-81.\u003c/li\u003e\n\u003cli\u003eKane LA, Youle RJ. PINK1 and Parkin flag Miro to direct mitochondrial traffic. Cell 2011; 147(4):721-3.\u003c/li\u003e\n\u003cli\u003eJin SM, Youle RJ. The accumulation of misfolded proteins in the mitochondrial matrix is sensed by PINK1 to induce PARK2/Parkin-mediated mitophagy of polarized mitochondria. Autophagy 2013; 9(11):1750-7.\u003c/li\u003e\n\u003cli\u003eBurotto M, Chiou VL, Lee JM, Kohn EC. The MAPK pathway across different malignancies: a new perspective. Cancer 2014; 120 (22):3446-3456.\u003c/li\u003e\n\u003cli\u003eTurner NA, Blythe NM. Cardiac fibroblast p38 MAPK: a critical regulator of myocardial remodeling. J. Cardiovasc. Dev. Dis 2019; 6 (3):27.\u003c/li\u003e\n\u003cli\u003eSu Y, Zong S, Wei C, Song F, Feng H, Qin A, Lian Z, Fu F, Shao S, Fang F, Wu T, Xu J, Liu Q, Zhao J. Salidroside promotes rat spinal cord injury recovery by inhibiting inflammatory cytokine expression and NF-\u0026kappa;B and MAPK signaling pathways. J. Cell. Physiol 2019; 234 (8):14259-14269.\u003c/li\u003e\n\u003cli\u003eXia T, Duan W, Zhang Z, Fang B, Zhang B, Xu B, de la Cruz C, El-Seedi H, Simal-Gandara J, Wang S, Wang M, Xiao J. Polyphenol-rich extract of zhenjiang aromatic vinegar ameliorates high glucose-induced insulin resistance by regulating JNK-IRS-1 and PI3K/Akt signaling pathways. Food Chem 2021; 335:127513.\u003c/li\u003e\n\u003cli\u003eBloch-Damti A, Potashnik R, Gual P, Le Marchand-Brustel Y, Tanti JF, Rudich A, Bashan N. Differential effects of IRS1 phosphorylated on Ser307 or Ser632 in the induction of insulin resistance by oxidative stress. Diabetologia 2006; 49 (10):2463-2473.\u003c/li\u003e\n\u003cli\u003eYu LL, Yu HH, Liang XF, Li N, Wang X, Li FH, Wu XF, Zheng YH, Xue M, Liang XF. Dietary butylated hydroxytoluene improves lipid metabolism, antioxidant and anti-apoptotic response of largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e). Fish Shellfish Immunolo 2018; 72:220-229.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Largemouth bass, AMPK/ACC/SREBP-1, Bile acid metabolism, Mitochondrial function","lastPublishedDoi":"10.21203/rs.3.rs-5652582/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5652582/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground and Objectives\u003c/b\u003e\u003c/p\u003e \u003cp\u003eLargemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e), a carnivorous fish, struggles to process dietary carbohydrates, often resulting in energy metabolism issues and fatty liver disease. This study explored the liver glycolipid accumulation and mitochondrial dysfunction in both largemouth bass and primary hepatocytes treated with high glucose.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAn 8-week feeding experiment was conducted to evaluated the effects of high carbohydrate (HC) diet on liver morphology, fatty acid metabolism, bile acid metabolism, and MAPK signaling pathways in largemouth bass. Primary hepatocytes were treated with high-glucose (HG) medium to simulate the conditions of high carbohydrate feeding to further evaluated the effects of high-glucose treatment on cell growth, ROS production, antioxidant capacity, mitochondrial fusion, fission, mitophagy and mitochondrial apoptosis.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe results showed that the HC diet significantly increased the hepatosomatic and visceral somatic indices, causing liver enlargement, mitochondrial damage, and glycolipid buildup. Compared to a control diet, the HC diet enhanced lipid synthesis through the AMPK/ACC/SREBP-1 pathway and increased the phosphorylation levels of ERK, JNK and p38 MAPK, while it decreased bile acid synthesis by downregulating cholesterol 7-hydroxylase (\u003cem\u003eCYP7A1\u003c/em\u003e) and sterol 12-hydroxylase (\u003cem\u003eCYP8B1\u003c/em\u003e). In vitro experiments showed that high glucose (HG) treatment in primary hepatocytes inhibited cell growth, promoted apoptosis, increased reactive oxygen species (ROS), and reduced antioxidant capacity. Mechanistically, HG treatment led to mitochondrial fission and damage. Damaged mitochondria bind to autophagosomes for lysosomal degradation, resulting in mitochondrion-dependent apoptosis by regulating p38 MAPK/BCL-2/CAS3 signaling pathway.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusions\u003c/b\u003e\u003c/p\u003e \u003cp\u003eHigh glucose could not only induce accumulation of lipid and glycogen mediated by the AMPK/ACC/SREBP-1 signaling pathway, but could activate p38MAPK-mediated signaling to induce mitochondrial apoptosis.\u003c/p\u003e","manuscriptTitle":"Role of AMPK/ACC/SREBP-1 and MAPK Pathways in Glucose Intolerance and Liver Dysfunction of Largemouth Bass","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-19 16:06:15","doi":"10.21203/rs.3.rs-5652582/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bf13dd19-2cc5-4803-810b-7915d6c979f9","owner":[],"postedDate":"December 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-12-22T01:23:11+00:00","versionOfRecord":[],"versionCreatedAt":"2024-12-19 16:06:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5652582","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5652582","identity":"rs-5652582","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}