The relationship between high serum UA levels and decidualization and angiogenesis in endometrium | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The relationship between high serum UA levels and decidualization and angiogenesis in endometrium Jinran Li, Meihua He, Min Huang, Jiahui Xiang, Limei Zhang, Yinghui Liu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5599602/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Hyperuricemia (HUA) is the second most common metabolic disease after diabetes and refers to a type of disease in which serum uric acid (SUA) levels are excessively high due to excessive production of uric acid (UA) or reduced metabolic capacity. To elucidate the effect of HUA on angiogenesis in endometrial decidualization, the authors investigated endometrial decidualization markers and angiogenesis factors in the decidua after abortion in women with high uric acid levels and the uterus of mice with high uric acid induced by purines on day 7.5 (D7.5) of gestation. Moreover, immunohistochemical staining was used to measure the diameter of the microvascular lumen and the density of the vessels.Real-time PCR and Western blot results showed that the expressions of prolactin (PRL) and decidua/trophoblast PRL-related protein Prl8a2 in the decidua of human decidua and the pregnant uterus of high uric acid mice with D7.5 days of gestation were significantly reduced. Additionally, the diameter and density of the microvascular lumen were decreased by immunohistochemical staining of uterine CD34. The expression of VEGFA in the endometrium was significantly decreased (P < 0.05). High UA can lead to endometrial decidualization damage and angiogenesis disorders in early pregnancy in humans and mice. Health sciences/Endocrinology Health sciences/Diseases/Endocrine system and metabolic diseases Health sciences/Diseases/Reproductive disorders Hyperuricemia Endometrium angiogenesis decidualization Reproduction Female fertility Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction With the development of the food processing industry, especially the extensive use of fructose as an additive 1 , abnormally elevated uric acid (UA) levels have become more common in the population. According to the latest statistics 2 , up to 21% of the general population worldwide suffers from asymptomatic hyperuricemia (HUA), with an increasing trend toward younger age groups, HUA has become the second most common metabolic disease after diabetes mellitus. So the impact of abnormal UA on reproductive function is gradually becoming better known. In women of childbearing age, it has been confirmed that abnormally elevated serum UA levels increase the prevalence of infertility 3 or the risk of recurrent miscarriage 4 . In addition, the association between serum UA and preeclampsia has also been confirmed and seems to correlate with impaired angiogenesis through endothelial function 5 . However, the prevalence of hyperuricemia in women of childbearing age is generally lower than that in men and elderly women 6 due to the influence of sex hormones on the process of UA excretion 7 and the fact that there is no unified standard for the definition of HUA in various regions. All these factors hamper the exploration of HUA and reproductive related diseases in women. In this study, we refer to the United States Centers for Disease Control and Prevention recommendations 8 , which defined serum UA > 340 µmol/L as high UA in women of childbearing age. During early gestation, before placenta formation, uterine interstitial cells undergo decidualization changes to maintain endometrial receptivity and guide trophoblast invasion, thereby accurately regulating the establishment and maintenance of pregnancy 9 . At the same time, a complex blood sinus and blood vessel network system in decidua is gradually formed for the exchange of substances between mother and embryo. This process is crucial for the maintenance of normal pregnancy 10 . When this link is disrupted, the invasion of trophoblast cells into the endometrium is impaired, which in turn may lead to adverse pregnancy outcomes such as miscarriage, preeclampsia, and fetal growth restriction 11 , 12 . Currently, attempts have been made to explore the regulatory mechanism of endometrial decidualization and angiogenesis from various factors such as metabolism, immunity, etc. It has been demonstrated that high levels of UA can cause dysfunction of vascular endothelial cells by inducing inflammatory responses 13 , 14 and oxidative stress 15 . Meanwhile, the deposition of UA crystalline salt (monosodium urate, MSU) in the endometrium can trigger decidualization in mice by inducing sterile inflammation 16 . In our previous study 17 , high maternal serum UA may lead to an increased early abortion rate in the frozen embryo transfer (FET) population. Combined with the correlation between high UA and various adverse pregnancy outcomes confirmed by existing studies, we conjecture that high levels of UA may lead to adverse pregnancy outcomes by affecting endometrial decidualization angiogenesis. 2. Materials and methods 2.1 Clinical patient selection and decidua collection From October 2022 to November 2023, a total of 9 patients in the 7th to 9th weeks of pregnancy who underwent “curettage” in the Affiliated Hospital of Nantong University due to “embryo damage” were selected to be included in the experimental group and divided into the normal UA group (4 cases) according to the serum UA level before pregnancy ≤ 340 µmol/L and the high UA group (5 cases) according to the serum UA level before pregnancy > 340 µmol/L 8 . To compare the level of endometrial decidualization and angiogenesis changes in normal physiological conditions during early pregnancy, 5 patients with normal embryonic development indicated by B-scan ultrasonography at the same period who underwent “curettage” in the Affiliated Hospital of Nantong University due to “social factors” in the 7th to 9th weeks of pregnancy were selected to be included in the normal control group. All patients met the following criteria: ① 20 years old ≤ age < 35 years old; ② No abnormality was found in villi chromosome after operation; ③ No other underlying diseases; ④ No history of medication use in the last 3 months; ⑤ Previous pregnancy history ≤ 3 times. This study was approved by the Ethics Review Committee of the Affiliated Hospital of Nantong University (Approval No. 2024-L099) and all experiments were performed in accordance with relevant guidelines and regulations. Pregnancy was terminated by artificial abortion in all patients. Fresh decidua were obtained and rinsed with sterile saline. Informed consent was obtained from all the participants. All methods were carried out in accordance with the Declaration of Helsinki. 2.2 Animal model construction and sample collection Forty-eight healthy adult SPF female ICR mice (8 weeks old, 25-30g) and 48 male ICR mice (8 weeks old, 30-35g) were purchased from the Laboratory Animal Center of Nantong University. All procedures involving animals were approved by the Animal Studies Committee of Nantong University (Approval No. P20221222-003).All methods were performed in accordance with the relevant guidelines and regulations. This study is reported in accordance with ARRIVE guidelines. Pregnancy model: 8-week-old female mice and 8-week-old male mice were caged on a 1:1 basis at 17:00 p.m. The female mice were checked for vaginal plugs in the next morning and those with plugs were defined as the 0.5 days of pregnancy (D0.5). High UA model: Female mice which were confirmed pregnant (with no statistical difference in body weight) were randomly divided into the control group (CON) and the high UA group (HUA), and the disease group model was constructed concerning the literature 18 starting on day 1.5 of gestation (D1.5): In the HUA group, potassium oxonate (300 mg/kg, dissolved in 0.2 ml 0.5% CMC-Na solution) was injected intraperitoneally and hypoxanthine (500 mg/kg, dissolved in 0.2 ml 0.5% CMC-Na solution) was orally administrated at 8:00 am; In CON group, 0.2 ml 0.5% CMC-Na solution was injected intraperitoneally and 0.2 ml 0.5% CMC-Na solution was orally administrated at 8:00 am. All treatments continued until day 7.5 of gestation (D7.5). Mice were anesthetized with an intraperitoneal injection of sodium pentobarbital (75 mg/kg) 2 hours after administration and serum and uterus (rinsed with PBS) were collected. Serological test: The mice were fasted one night in advance, about 0.5 ml of blood was collected from the submandibular vein of mice on pregnancy D7.5 and then centrifuged at 3000 rpm for 15 min at 4℃ after being left at room temperature for 0.5 h. The serum was frozen at -80℃. Blood glucose, urea nitrogen, creatinine, and UA were measured by an automatic biochemical analyzer (Siemens, Germany). 2.3 Immunohistochemistry The tissues were fixed in 4% paraformaldehyde solution for 24 h, embedded in paraffin at 65°C, sectioned at 5 µm thickness, and baked at 60℃. The sections were dewaxed in xylene, hydrated in gradient alcohol, and repaired in Improved Sodium Citrate Antigenic Repair Solution. After being rinsed and dried with PBS, the sections were permeabilized in 0.5% Triton-X-100-supplemented PBS for 15 min and sealed in 10% goat serum at room temperature for 1 h. Subsequently, the sections were incubated with CD34 (14486-1-AP, Proteintech, 1:1000) at 4℃ overnight and incubated with the secondary antibody at room temperature for 1 h after washing with PBST. Finally, the sections were stained with DAB and sealed with neutral gum. 2.4 Real-time PCR RNA was extracted by RNA extraction kit (TaKaRa, Japan), and the concentration of RNA was detected by a microspectrophotometer (Thermo Scientific, USA). Reverse transcription to cDNA was performed by a reverse transcription kit (Vazyme, Nanjing). Amplification procedure: 95℃ for 30 s; 40 cycles, 95℃ for 10 s, 60℃ for 20 s, 72℃ for 20 s; 95℃ for 10 s, 65℃ for 60s, 97℃ for 1 s. The primer sequence was synthesized by Shanghai Sangon. Gene Species Forword (5´→3´) Reverse (5´→3´) PRL 人 CCACTACATCCATAACCTCTCC GTTGATGGCCTTGGTAATGAAC VEGFA 人 ATCGAGTACATCTTCAAGCCAT GTGAGGTTTGATCCGCATAATC ANG-1 人 GATATCACACATGACGGGTTTG CGGAAAGTGTTTTTCTGGGAAT β-Actin 人 CCTGGCACCCAGCACAAT GGGCCGGACTCGTCATAC Prl8a2 小鼠 TCAACCTCACTTCTGGGCACTC GAGCAGCCATTCTCTCCTGTTTG VEGFA 小鼠 CTGCTGTAACGATGAAGCCCTG GCTGTAGGAAGCTCATCTCTCC ANG-1 小鼠 CACATAGGGTGCAGCAACCA CGTCGTGTTCTGGAAGAATGA β-Actin 小鼠 CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG 2.5 Western blot The tissues were placed in the lysate buffer (Shanghai Beyotime) and cryo-milled, the supernatant was collected to measure the protein concentration by a BCA kit (Nanjing Vazyme). The remaining proteins were denatured at 100°C. Then proteins were separated by SDS-PAGE electrophoresis, transferred onto PVDF membranes, and blocked in 5% no-fat milk. Then the membranes were incubated with the first antibody at 4℃ overnight and washed 3 times with TBST. Finally, the membranes were incubated with the corresponding second antibody at room temperature for 1 h and scanned. The primary antibodies were as follows: PRL (Abclonal, A1618, 1:1000), Prl8a2 (self-made by Xiamen University, 1:1000), VEGFA (Proteintech, 19003-1-AP, 1:1000), ANG-1 (Proteintech, 23302-1-AP, 1:700), VEGFR2 (Proteintech, 26415-1-AP, 1:2000), TIE2 (Proteintech, 19157-1-AP, 1:500), Vinculin (Proteintech, 66305-1-Ig, 1:1000), β-Actin (Proteintech, 1:3000). The secondary antibodies were as follows: Anti-mouse IgG (H + L) (CST, 5470), Anti-rabbit IgG(H + L) (CST, 5151). 2.6 Statistical analysis The comparison between the two groups was analyzed using Graphpad Prism 8.0 statistical software by independent sample t test, and the results were expressed as Mean ± SEM. Each experiment was repeated at least 3 times, and P < 0.05 was considered statistically significant. 3. Results 3.1 Comparison of basic data of clinical samples A total of 14 clinical samples were included in this study, including 5 cases in the normal control group, 4 cases in the normal UA group, and 5 cases in the high UA group. There were no significant differences in age, days of gestation, and pre-pregnancy BMI among the three groups (Fig. 1 A, P > 0.05). There were no statistically significant differences in fasting blood glucose, urea nitrogen, and creatinine levels between the normal UA group and the high UA group (P > 0.05), and only the UA level was significantly higher in the high UA group (Fig. 1 B, P < 0.001). 3.2 Construction of animal models While collecting clinical samples, we also constructed a pregnant mouse model with high UA using ICR mice (Fig. 2 A). To exclude the interference of metabolic syndrome that may associated with high UA, we also compared the changes in body weight of mice before and after modeling (Fig. 2 B) and the fasting blood glucose level of mice after modeling (Fig. 2 C), which were no significant differences (P > 0.05). In addition, after the completion of modeling, the serum UA level in the HUA group was significantly higher than that in the CON group (P < 0.001), while other renal indicators were not affected (Fig. 2 C), suggesting that the modeling was successful. After the successful verification of the model, the pregnant uterus of mice were dissected. The uterus of the HUA group was slightly smaller than that of the CON group (Fig. 2 D). However there was no significant difference in the number of points of implantation (Fig. 2 E) and the weight of the pregnant uterus (Fig. 2 F) between the two groups (P > 0.05). 3.3 High UA levels impair endometrial decidualization levels Our preliminary findings suggest that the harm of high serum UA to pregnancy is especially manifested in early pregnancy before 12 weeks, and this period is the key period of endometrial decidualization before placenta formation. To verify the adverse effect of high serum UA on endometrial decidualization during pregnancy, we analyzed the expression of PRL in human decidua. The results of both Real-time PCR and Western blot showed (Fig. 3 A, C) that compared with a normal control group and normal UA group, high UA could significantly reduce the mRNA and protein expression levels of decidualization marker PRL. Similarly, we also found reduced mRNA and protein expression levels of Prl8a2, a PRL-related protein in the decidua/ trophoblastic layer in the pregnant uterus of D7.5 mice in the HUA group (Fig. 3 B, D). 3.4 High UA levels impair endometrial angiogenesis The previous data suggest that high UA leads to impaired endometrial decidualization. In the process of endometrial decidualization, the blood sinuses and vascular networks established by angiogenesis are crucial for later normal pregnancy. The abnormal expression of VEGF and ANG seems to be involved in the development of spontaneous abortion. To confirm the level of angiogenesis in each sample, CD34, a microvascular marker, was first selected for immunohistochemical staining of clinical decidua (Fig. 4 A) and mouse pregnancy uterus samples (Fig. 4 B) of each group to compare the differences in microvascular diameter and blood vessel density. We found that in clinical samples, microvascular lumen diameter and vascular density in the HUA group were smaller than those in the normal control group and normal UA group. This phenomenon has also been confirmed in the uterus of pregnant mice. Angiogenesis in endometrium is mainly regulated by two key pathways, VEGFA and its receptor VEGFR2 and ANG-1 and its receptor TIE2. Consequently, our analysis focused on these pathways, VEGFA and ANG-1. Real-time PCR analyse of decidual tissue from clinical patients showed (Fig. 4 C) that the mRNA expression level of ANG-1 in the high UA group was significantly lower than that in the normal UA group (P < 0.05). However, no statistically significant difference was observed between the normal control group and either of the other two groups. Western blot analysis revealed (Fig. 4 E) that the protein expression of VEGFA was significantly reduced in the high UA group compared to the normal UA group (P < 0.05), and there was no difference in the protein expression of VEGFR2, ANG-1 and its receptor TIE2. Similarly, the above results have been confirmed in the uterus of pregnant mice (Fig. 4 D, F). So we therefore concluded that high UA levels can cause disturbances in the level of endometrial angiogenesis. 4. Discussion PRL is produced by stromal cells after decidualization 19 and is one of the widely used markers of decidualization in human endometrial studies 20 . In mice, Prl8a2 (also known as Dtprp) from the PRL family is commonly used as a marker of decidualization. When we targeted the patients with high UA in early pregnancy, we found that PRL mRNA and protein levels in the decidua of patients with high UA were significantly down-regulated compared with the week-matched normal pregnancy groups and normal UA groups. The mRNA and protein levels of Prl8a2 in the uterus of D7.5 pregnancy of high UA mice were also significantly decreased compared with the control group, so we concluded that high circulating UA levels can cause impaired endometrial decidualization which in turn leads to adverse pregnancy outcomes. A study by Zhu YY et al 16 concluded that monosodium urate (MSU) crystals could induce endometrial decidualization in stromal cells of mice by triggering aseptic inflammation and significantly up-regulated expression of Prl8a2 was observed in the MSU treated group. However, needle-like, immune-stimulating MSU crystals precipitated only when serum UA levels exceed 480 µmol/L 21 , a level rarely reached in women of reproductive age. In addition, Zhu YY et al. 16 injected UA solutions with concentrations of 0.002 mg/mL (11.9µmol/L) and 0.02 mg/mL (119µmol/L) into the uterine corners of mice to observe their decidualization, but no significant changes in expression of Prl8a2 mRNA were observed. We believe that there may be several reasons for this difference in results: (1) UA is a weak acid with low solubility, and the concentration of UA solution used in this experiment has not reached the normal serum UA level in women of childbearing age; (2) We did not use the experimental design in which the UA solution was in direct contact with the endometrium, but rather simulated the pathology of high serum UA in clinical patients and constructed a mouse model of circulating high UA, which may lead to the change of endometrium decidualization through other pathways; (3) We used a natural pregnancy mouse model, which may be different from artificially induced decidualization mouse. In the process of decidualization, angiogenesis is an extremely critical part. The successful establishment of blood sinuses and vascular network systems lays a solid foundation for the maintenance of the following pregnancy 10 . We used CD34 to stain human decidua and mouse pregnant uterus and found that the blood sinus size and microvascular density of the high UA group were significantly smaller than that of the control group. Endometrial angiogenesis is mainly regulated by VEGFA and ANG-1 and their receptors, among which VEGFA is a key molecule in regulating decidua angiogenesis and spiral artery remodeling 22 . In our results, high UA disrupted the expression of relevant angiogenic pathways, leading to a significant downregulation of ANG-1 at the level of mRNA and a significant reduction of VEGFA at the level of protein.VEGFA is a major endogenous driver of angiogenesis 23 . In the research model of ischemic stroke, UA treatment can reduce the level of VEGFA and thus inhibit endothelial cell angiogenesis 24 . In addition, studies have pointed out that when VEGFA is in action, ANG-1 does not participate in the process of stimulating the proliferation of vascular endothelial cells thereby triggering the process of angiogenesis and remodeling 25 . Therefore, we hypothesized that it is the high UA level that down-regulates the protein expression of VEGFA and thus inhibits the proliferation of vascular endothelial cells, leading to the impairment of decidualized angiogenesis. The up-regulation of the mRNA of ANG-1 occurs as a result of the body's compensation. Therefore, we suggest that high UA levels mainly act on the VEGFA-dominated pathway, which leads to insufficient angiogenesis of decidua in early pregnancy. It is now known that PI3K/Akt pathway is a classical VEGFA-induced downstream signaling pathway of VEGFR2, which is particularly important for normal blood vessel growth 26 . Endothelial nitric oxide synthases (eNOS) as one of its downstream targets are mainly responsible for regulating the diameter of blood vessels 27 . In animal models, activation of the PI3K/Akt/eNOS pathway promotes endometrial angiogenesis 28 , 29 . Currently, in vitro studies have confirmed that high levels of UA can induce vascular endothelial cell dysfunction through the PI3K/Akt/eNOS pathway 30 . During the process of endometrial decidualization, whether high serum UA levels can cause angiogenesis disorder by acting on the PI3K/Akt/eNOS pathway is the next question we want to solve. There are still some limitations in this study. Due to the presence of uric acid oxidase (UOX) in mice, it is difficult to replicate human chronic hyperuricemia in mice through diet or drugs. Therefore, we selected an acute mouse model of hyperuricemia 18 which only simulates the effect of high UA on endometrium in early pregnancy and it is still necessary to explore a more stable mouse model that is close to the human pathological state for further verification. In addition, we only collected the UA levels of clinical patients before pregnancy for detection and did not further analyze the UA levels after confirming pregnancy. However, it is generally believed that estrogen and progesterone can cause a decrease in UA by accelerating the clearance of UA 31 , 32 . So UA levels usually decrease during the first 12 weeks of pregnancy 33 and then increase until they reach or exceed pre-pregnancy levels before delivery 34 . However, it has also been shown that an increase of UA is observed at 5 to 6 weeks of gestation and a decrease after abortion 16 , which may indicate that the increase of UA is associated with the process of decidualization, but the causal relationship still needs to be further explored. 5. Conclusion In summary, our findings suggest that high UA can lead to endometrial decidualization injury and angiogenesis disorders in early gestation in both humans and mice, which may be one of the mechanisms of early abortion induced by HUA. Therefore, monitoring the serum UA level of patients before pregnancy and correcting the possible HUA in time have important clinical value in reducing the abortion rate. Declarations Acknowledgments We would like to extend our sincere thanks to Haibin Wang team from Medical School of Xiamen University for their primary antibody. Author contributions JL: Writing- original draft, Writing- review & editing, Methodology. MMH: Writing- original draft, Writing- review & editing. MH: Writing- original draft. JX: Formal Analysis, Software. LZ: Writing- review & editing. YL: Writing- review & editing. XHZ: Resources, Project administration, Supervision, Writing- review & editing. XS: Conceptualization, Project administration, Supervision, Resources, Writing- original draft, Writing- review & editing. Funding This study was funded by grants from Jiangsu Provincial Research Hospital (YJXYY202204-YSB44 to XS), Key Laboratory of Reproductive Health Diseases Research and Translation of Ministry of Education from Hainan Medical University (SZLAB202306 to YM), the Society and livelihood Project of Nantong City (MS22022119 to XS), Health Commission of Nantong City (MS2023019 to XS). Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. Competing interests The authors declare that they have no competing interests. Ethical approval The studies involving humans were approved by the Ethics Committee of Nantong University Affiliated Hospital(2024-L099). All experiments on human subjects were performed in accordance with the Declaration of Helsinki for the medical community. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. The animal studies were approved by Institutional Animal Ethical Committee (IAEC) of Nantong University (P20221222-003, Nantong, China). The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study. References Nakagawa, T. et al. Endogenous Fructose Metabolism Could Explain the Warburg Effect and the Protection of SGLT2 Inhibitors in Chronic Kidney Disease. Front. Immunol. 12 , 694457. https://doi.org/10.3389/fimmu.2021.694457 (2021). Du, L. et al. Hyperuricemia and its related diseases: mechanisms and advances in therapy. Signal. Transduct. Target. Ther. 9 , 212. https://doi.org/10.1038/s41392-024-01916-y (2024). Luo, C., Cheng, H., He, X., Tan, X. & Huang, X. Association between serum uric acid and female infertility: a cross-sectional study of National Health and Nutrition Examination Survey (NHANES) 2013–2018. BMC Womens Health . 23 , 224. https://doi.org/10.1186/s12905-023-02376-2 (2023). Cho, H. Y. et al. Association of Complement Factor D and H Polymorphisms with Recurrent Pregnancy Loss. Int. J. Mol. Sci. 21 https://doi.org/10.3390/ijms21010017 (2019). Piani, F. et al. Serum uric acid to creatinine ratio and risk of preeclampsia and adverse pregnancy outcomes. J. Hypertens. 41 , 1333–1338. https://doi.org/10.1097/HJH.0000000000003472 (2023). Liu, H., Zhang, X. M., Wang, Y. L. & Liu, B. C. Prevalence of hyperuricemia among Chinese adults: a national cross-sectional survey using multistage, stratified sampling. J. Nephrol. 27 , 653–658. https://doi.org/10.1007/s40620-014-0082-z (2014). Zeng, M. et al. Estrogen receptor beta signaling induces autophagy and downregulates Glut9 expression. Nucleosides Nucleotides Nucleic Acids . 33 , 455–465. https://doi.org/10.1080/15257770.2014.885045 (2014). De Becker, B., Borghi, C., Burnier, M. & van de Borne, P. Uric acid and hypertension: a focused review and practical recommendations. J. Hypertens. 37 , 878–883. https://doi.org/10.1097/HJH.0000000000001980 (2019). Gellersen, B. & Brosens, J. J. Cyclic decidualization of the human endometrium in reproductive health and failure. Endocr. Rev. 35 , 851–905. https://doi.org/10.1210/er.2014-1045 (2014). Cha, J., Sun, X. & Dey, S. K. Mechanisms of implantation: strategies for successful pregnancy. Nat. Med. 18 , 1754–1767. https://doi.org/10.1038/nm.3012 (2012). Bainbridge, S. A. et al. Uric acid attenuates trophoblast invasion and integration into endothelial cell monolayers. Am. J. Physiol. Cell. Physiol. 297 , C440–450. https://doi.org/10.1152/ajpcell.00593.2008 (2009). Salker, M. et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One . 5 , e10287. https://doi.org/10.1371/journal.pone.0010287 (2010). Zoccali, C., Maio, R., Mallamaci, F., Sesti, G. & Perticone, F. Uric acid and endothelial dysfunction in essential hypertension. J. Am. Soc. Nephrol. 17 , 1466–1471. https://doi.org/10.1681/ASN.2005090949 (2006). Kang, D. H., Park, S. K., Lee, I. K. & Johnson, R. J. Uric acid-induced C-reactive protein expression: implication on cell proliferation and nitric oxide production of human vascular cells. J. Am. Soc. Nephrol. 16 , 3553–3562. https://doi.org/10.1681/ASN.2005050572 (2005). Hong, Q. et al. Hyperuricemia induces endothelial dysfunction via mitochondrial Na+/Ca2 + exchanger-mediated mitochondrial calcium overload. Cell. Calcium . 51 , 402–410. https://doi.org/10.1016/j.ceca.2012.01.003 (2012). Zhu, Y. Y. et al. In situ Synthesized Monosodium Urate Crystal Enhances Endometrium Decidualization via Sterile Inflammation During Pregnancy. Front. Cell. Dev. Biol. 9 , 702590. https://doi.org/10.3389/fcell.2021.702590 (2021). 李瑾然 & 何美华 & 孙晓莉. 血清尿酸水平对冻融胚胎移植妊娠结局影响的研究. 中华生殖与避孕杂志 44, 285–290 (2024). https://doi.org/10.3760/cma.j.cn101441-20231024-00175 Yong, T. et al. Caffeic acid phenethyl ester alleviated hypouricemia in hyperuricemic mice through inhibiting XOD and up-regulating OAT3. Phytomedicine 103 , 154256. https://doi.org/10.1016/j.phymed.2022.154256 (2022). Ng, S. W. et al. Endometrial Decidualization: The Primary Driver of Pregnancy Health. Int. J. Mol. Sci. 21 https://doi.org/10.3390/ijms21114092 (2020). Brar, A. K. et al. Laminin decreases PRL and IGFBP-1 expression during in vitro decidualization of human endometrial stromal cells. J. Cell. Physiol. 163 , 30–37. https://doi.org/10.1002/jcp.1041630105 (1995). Ashcroft, J. A. Alternatives to specific uric acid lowering treatment in gout in patients with cardiovascular disease. BMJ 362, k3895 (2018). https://doi.org/10.1136/bmj.k3895 Augustin, H. G., Koh, G. Y., Thurston, G. & Alitalo, K. Control of vascular morphogenesis and homeostasis through the angiopoietin-Tie system. Nat. Rev. Mol. Cell. Biol. 10 , 165–177. https://doi.org/10.1038/nrm2639 (2009). Sato, Y. The vasohibin family: a novel family for angiogenesis regulation. J. Biochem. 153 , 5–11. https://doi.org/10.1093/jb/mvs128 (2013). Vila, E. et al. Uric acid treatment after stroke modulates the Kruppel-like factor 2-VEGF-A axis to protect brain endothelial cell functions: Impact of hypertension. Biochem. Pharmacol. 164 , 115–128. https://doi.org/10.1016/j.bcp.2019.04.002 (2019). Oh, T. W., Park, K. H., Jung, H. W. & Park, Y. K. Neuroprotective effect of the hairy root extract of Angelica gigas NAKAI on transient focal cerebral ischemia in rats through the regulation of angiogenesis. BMC Complement. Altern. Med. 15 , 101. https://doi.org/10.1186/s12906-015-0589-4 (2015). Chen, J. et al. Akt1 regulates pathological angiogenesis, vascular maturation and permeability in vivo. Nat. Med. 11 , 1188–1196. https://doi.org/10.1038/nm1307 (2005). Claesson-Welsh, L. & Welsh, M. VEGFA and tumour angiogenesis. J. Intern. Med. 273 , 114–127. https://doi.org/10.1111/joim.12019 (2013). Xu, Y. et al. ANXA4 promotes trophoblast invasion via the PI3K/Akt/eNOS pathway in preeclampsia. Am. J. Physiol. Cell. Physiol. 316 , C481–C491. https://doi.org/10.1152/ajpcell.00404.2018 (2019). Xing, L. et al. Acupuncture Improves Endometrial Angiogenesis by Activating PI3K/AKT Pathway in a Rat Model with PCOS. Evid Based Complement Alternat Med 1790041 (2022). (2022). https://doi.org/10.1155/2022/1790041 Choi, Y. J. et al. Uric acid induces endothelial dysfunction by vascular insulin resistance associated with the impairment of nitric oxide synthesis. FASEB J. 28 , 3197–3204. https://doi.org/10.1096/fj.13-247148 (2014). Bruderer, S. G., Bodmer, M., Jick, S. S. & Meier, C. R. Association of hormone therapy and incident gout: population-based case-control study. Menopause 22 , 1335–1342. https://doi.org/10.1097/GME.0000000000000474 (2015). Wang, Y. & Charchar, F. J. Establishment of sex difference in circulating uric acid is associated with higher testosterone and lower sex hormone-binding globulin in adolescent boys. Sci. Rep. 11 , 17323. https://doi.org/10.1038/s41598-021-96959-4 (2021). Johnson, R. J., Kanbay, M., Kang, D. H., Sanchez-Lozada, L. G. & Feig, D. Uric acid: a clinically useful marker to distinguish preeclampsia from gestational hypertension. Hypertension 58 , 548–549. https://doi.org/10.1161/HYPERTENSIONAHA.111.178921 (2011). Shakarami, A., Ghafarzadeh, M., Yari, F. & Fathi, L. Association between maternal serum uric acid and preeclampsia. Arch. Physiol. Biochem. 128 , 1434–1437. https://doi.org/10.1080/13813455.2020.1773863 (2022). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 04 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 13 Jan, 2025 Reviews received at journal 13 Jan, 2025 Reviews received at journal 02 Jan, 2025 Reviewers agreed at journal 02 Jan, 2025 Reviewers agreed at journal 02 Jan, 2025 Reviewers invited by journal 29 Dec, 2024 Editor assigned by journal 29 Dec, 2024 Editor invited by journal 19 Dec, 2024 Submission checks completed at journal 18 Dec, 2024 First submitted to journal 07 Dec, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5599602","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":392406890,"identity":"8f522ccc-22d4-4197-bf1f-a65875e24797","order_by":0,"name":"Jinran Li","email":"","orcid":"","institution":"Center for Reproductive Medicine, Affiliated Hospital of Nantong University, Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Jinran","middleName":"","lastName":"Li","suffix":""},{"id":392406891,"identity":"b7c24647-7482-405a-a388-57e078b6168d","order_by":1,"name":"Meihua He","email":"","orcid":"","institution":"Center for Reproductive Medicine, Affiliated Hospital of Nantong University, Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Meihua","middleName":"","lastName":"He","suffix":""},{"id":392406892,"identity":"d6183b3f-af9a-46fd-945c-384c17de3ff1","order_by":2,"name":"Min Huang","email":"","orcid":"","institution":"Center for Reproductive Medicine, Affiliated Hospital of Nantong University, Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Huang","suffix":""},{"id":392406893,"identity":"9fe90eb3-2e98-4e8f-9a2b-b85d5ce12b3b","order_by":3,"name":"Jiahui Xiang","email":"","orcid":"","institution":"Center for Reproductive Medicine, Affiliated Hospital of Nantong University, Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Jiahui","middleName":"","lastName":"Xiang","suffix":""},{"id":392406894,"identity":"78f8641c-f869-49a5-8100-11fe47b4dd11","order_by":4,"name":"Limei Zhang","email":"","orcid":"","institution":"Center for Reproductive Medicine, Affiliated Hospital of Nantong University, Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Limei","middleName":"","lastName":"Zhang","suffix":""},{"id":392406895,"identity":"aae52f6d-3958-4a59-97bd-f6d672b405f6","order_by":5,"name":"Yinghui Liu","email":"","orcid":"","institution":"Center for Reproductive Medicine, Affiliated Hospital of Nantong University, Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Yinghui","middleName":"","lastName":"Liu","suffix":""},{"id":392406896,"identity":"bd2d822d-c924-458d-b3d6-913dedcbeb86","order_by":6,"name":"Yanlin Ma","email":"","orcid":"","institution":"Hainan Provincial Key Laboratory for Human Reproductive Medicine and Genetics Research,The First Affiliated Hospital of Hainan Medical University, Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanlin","middleName":"","lastName":"Ma","suffix":""},{"id":392406897,"identity":"f162bd4e-5221-49ce-bc84-00b3ed1d808e","order_by":7,"name":"Xuhui Zeng","email":"","orcid":"","institution":"Institute of Reproductive Medicine, Medical School, Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Xuhui","middleName":"","lastName":"Zeng","suffix":""},{"id":392406904,"identity":"64c7120c-b527-45fd-9594-6eac860929ae","order_by":8,"name":"Xiaoli Sun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsklEQVRIiWNgGAWjYNCCAhsefvYGkrQYpMlI9hwgTcthG4MbDkQqlp+RnfyZx+A8D8MNBsYPH3OI0MI4I3eb5AyD2zyMsxuYJWduI0ILs0TuNoYPQC3MMgfYmHmJ0cImkbv5Q4LBOR42iQQitfBI5G6Q+GBwgIeHaC0SPG9BfknmkeA52EycX+Tbczd/5qmws7c/3nzww0ditDAIJMBYjA3EqAcC/gNEKhwFo2AUjIKRCwCK+DFG9C75/wAAAABJRU5ErkJggg==","orcid":"","institution":"Center for Reproductive Medicine, Affiliated Hospital of Nantong University, Nantong University","correspondingAuthor":true,"prefix":"","firstName":"Xiaoli","middleName":"","lastName":"Sun","suffix":""}],"badges":[],"createdAt":"2024-12-07 15:08:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5599602/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5599602/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-22489-y","type":"published","date":"2025-11-04T15:57:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":72050802,"identity":"de9a74cf-0eb7-4441-a9b3-03fd5f68ef96","added_by":"auto","created_at":"2024-12-21 06:02:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":180543,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of basic data of clinical samples and construction of animal models. Comparison of age, days of gestation and pre- pregnancy BMI between normal control group, normal UA group and high UA group ( A ) ; Comparison of fasting blood glucose, urea nitrogen, creatinine and UA between normal UA group and high UA group ( B ). Clinical samples: Normal Control, n= 5; Normal UA, n=4; High UA, n= 5. *** P \u0026lt; 0. 001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5599602/v1/89a37de38bb611f670010f6c.png"},{"id":72051267,"identity":"3b666a44-08bb-4129-8835-9c587913a9aa","added_by":"auto","created_at":"2024-12-21 06:18:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":334831,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of animal models. Establish the pregnant mouse model in CON group and HUA group( A ). Compare the weight difference in pregnant mice between D0. 5 and D7. 5 groups( B ) and fasting blood glucose, serum urea nitrogen, creatinine and UA levels( C ) between the two groups. The pregnant uterus of mice was dissected after the modeling was completed( D ) , count the implantation site ( E ) and weigh the weight of the uterus ( F ). Mouse samples: CON, n= 6 ; HUA, n= 6. *** P\u0026lt; 0. 001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5599602/v1/4bfecc598b3c2239e3cfed6d.png"},{"id":72051158,"identity":"b975cf52-093d-49ad-90b4-52f34a96bf24","added_by":"auto","created_at":"2024-12-21 06:10:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":277893,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of expression levels of decidualization related indicators. The mRNA expression level of decidualization marker PRL( A ) in clinical decidualization tissue samples and Prl8a2( B ) in mouse pregnancy tissues were detected by Real-time PCR. Clinical samples: Normal Control, n= 5; Normal UA, n= 4; High UA, n= 5; Mouse samples: n= 6 in each group. The protein expression level of decidualization marker PRL( C ) in clinical samples and the protein expression level of decidualization marker Prl8a2 in mouse pregnancy tissues( D ) were detected by Western blot. n= 3 in each group. * P\u0026lt; 0. 05, ** P\u0026lt; 0.01, *** P\u0026lt; 0. 001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5599602/v1/5ccd5313e62c08b199f3d226.png"},{"id":72051156,"identity":"62748ca8-d621-4934-b65a-d37cdd306c8d","added_by":"auto","created_at":"2024-12-21 06:10:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":846377,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of expression levels of angiogenesis-related indicators. The microangiogenesis levels of clinical samples( A ) and uterus of pregnant mice ( B ) were analyzed by immunohistochemistry stain using CD34. The expression levels of angiogenesis markers VEGFA, VEGFR2, ANG- 1 and TIE2 were detected by Real-time PCR( C, D) and Western blot( E, F) respectively. * P\u0026lt; 0. 05, ** P\u0026lt; 0. 01.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5599602/v1/00d6ab5b257e26992a84f9e6.png"},{"id":95564388,"identity":"dfa10e52-2d39-4e70-b62e-ba6041af9e97","added_by":"auto","created_at":"2025-11-10 16:09:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2440178,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5599602/v1/62704ce0-8217-4ae0-ae76-a8fc7dc3feec.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The relationship between high serum UA levels and decidualization and angiogenesis in endometrium","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eWith the development of the food processing industry, especially the extensive use of fructose as an additive\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e, abnormally elevated uric acid (UA) levels have become more common in the population. According to the latest statistics\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e, up to 21% of the general population worldwide suffers from asymptomatic hyperuricemia (HUA), with an increasing trend toward younger age groups, HUA has become the second most common metabolic disease after diabetes mellitus. So the impact of abnormal UA on reproductive function is gradually becoming better known. In women of childbearing age, it has been confirmed that abnormally elevated serum UA levels increase the prevalence of infertility\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e or the risk of recurrent miscarriage\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. In addition, the association between serum UA and preeclampsia has also been confirmed and seems to correlate with impaired angiogenesis through endothelial function\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. However, the prevalence of hyperuricemia in women of childbearing age is generally lower than that in men and elderly women\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e due to the influence of sex hormones on the process of UA excretion\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e and the fact that there is no unified standard for the definition of HUA in various regions. All these factors hamper the exploration of HUA and reproductive related diseases in women. In this study, we refer to the United States Centers for Disease Control and Prevention recommendations\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e, which defined serum UA\u0026thinsp;\u0026gt;\u0026thinsp;340 \u0026micro;mol/L as high UA in women of childbearing age.\u003c/p\u003e \u003cp\u003eDuring early gestation, before placenta formation, uterine interstitial cells undergo decidualization changes to maintain endometrial receptivity and guide trophoblast invasion, thereby accurately regulating the establishment and maintenance of pregnancy\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. At the same time, a complex blood sinus and blood vessel network system in decidua is gradually formed for the exchange of substances between mother and embryo. This process is crucial for the maintenance of normal pregnancy\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. When this link is disrupted, the invasion of trophoblast cells into the endometrium is impaired, which in turn may lead to adverse pregnancy outcomes such as miscarriage, preeclampsia, and fetal growth restriction\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Currently, attempts have been made to explore the regulatory mechanism of endometrial decidualization and angiogenesis from various factors such as metabolism, immunity, etc. It has been demonstrated that high levels of UA can cause dysfunction of vascular endothelial cells by inducing inflammatory responses\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e and oxidative stress\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Meanwhile, the deposition of UA crystalline salt (monosodium urate, MSU) in the endometrium can trigger decidualization in mice by inducing sterile inflammation\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In our previous study\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, high maternal serum UA may lead to an increased early abortion rate in the frozen embryo transfer (FET) population. Combined with the correlation between high UA and various adverse pregnancy outcomes confirmed by existing studies, we conjecture that high levels of UA may lead to adverse pregnancy outcomes by affecting endometrial decidualization angiogenesis.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Clinical patient selection and decidua collection\u003c/h2\u003e \u003cp\u003eFrom October 2022 to November 2023, a total of 9 patients in the 7th to 9th weeks of pregnancy who underwent \u0026ldquo;curettage\u0026rdquo; in the Affiliated Hospital of Nantong University due to \u0026ldquo;embryo damage\u0026rdquo; were selected to be included in the experimental group and divided into the normal UA group (4 cases) according to the serum UA level before pregnancy\u0026thinsp;\u0026le;\u0026thinsp;340 \u0026micro;mol/L and the high UA group (5 cases) according to the serum UA level before pregnancy\u0026thinsp;\u0026gt;\u0026thinsp;340 \u0026micro;mol/L\u003csup\u003e8\u003c/sup\u003e. To compare the level of endometrial decidualization and angiogenesis changes in normal physiological conditions during early pregnancy, 5 patients with normal embryonic development indicated by B-scan ultrasonography at the same period who underwent \u0026ldquo;curettage\u0026rdquo; in the Affiliated Hospital of Nantong University due to \u0026ldquo;social factors\u0026rdquo; in the 7th to 9th weeks of pregnancy were selected to be included in the normal control group. All patients met the following criteria: ① 20 years old\u0026thinsp;\u0026le;\u0026thinsp;age\u0026thinsp;\u0026lt;\u0026thinsp;35 years old; ② No abnormality was found in villi chromosome after operation; ③ No other underlying diseases; ④ No history of medication use in the last 3 months; ⑤ Previous pregnancy history\u0026thinsp;\u0026le;\u0026thinsp;3 times. This study was approved by the Ethics Review Committee of the Affiliated Hospital of Nantong University (Approval No. 2024-L099) and all experiments were performed in accordance with relevant guidelines and regulations.\u003c/p\u003e \u003cp\u003ePregnancy was terminated by artificial abortion in all patients. Fresh decidua were obtained and rinsed with sterile saline. Informed consent was obtained from all the participants. All methods were carried out in accordance with the Declaration of Helsinki.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Animal model construction and sample collection\u003c/h2\u003e \u003cp\u003eForty-eight healthy adult SPF female ICR mice (8 weeks old, 25-30g) and 48 male ICR mice (8 weeks old, 30-35g) were purchased from the Laboratory Animal Center of Nantong University. All procedures involving animals were approved by the Animal Studies Committee of Nantong University (Approval No. P20221222-003).All methods were performed in accordance with the relevant guidelines and regulations. This study is reported in accordance with ARRIVE guidelines.\u003c/p\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003ePregnancy model: 8-week-old female mice and 8-week-old male mice were caged on a 1:1 basis at 17:00 p.m. The female mice were checked for vaginal plugs in the next morning and those with plugs were defined as the 0.5 days of pregnancy (D0.5).\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eHigh UA model: Female mice which were confirmed pregnant (with no statistical difference in body weight) were randomly divided into the control group (CON) and the high UA group (HUA), and the disease group model was constructed concerning the literature\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e starting on day 1.5 of gestation (D1.5): In the HUA group, potassium oxonate (300 mg/kg, dissolved in 0.2 ml 0.5% CMC-Na solution) was injected intraperitoneally and hypoxanthine (500 mg/kg, dissolved in 0.2 ml 0.5% CMC-Na solution) was orally administrated at 8:00 am; In CON group, 0.2 ml 0.5% CMC-Na solution was injected intraperitoneally and 0.2 ml 0.5% CMC-Na solution was orally administrated at 8:00 am. All treatments continued until day 7.5 of gestation (D7.5). Mice were anesthetized with an intraperitoneal injection of sodium pentobarbital (75 mg/kg) 2 hours after administration and serum and uterus (rinsed with PBS) were collected.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eSerological test: The mice were fasted one night in advance, about 0.5 ml of blood was collected from the submandibular vein of mice on pregnancy D7.5 and then centrifuged at 3000 rpm for 15 min at 4℃ after being left at room temperature for 0.5 h. The serum was frozen at -80℃. Blood glucose, urea nitrogen, creatinine, and UA were measured by an automatic biochemical analyzer (Siemens, Germany).\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Immunohistochemistry\u003c/h2\u003e \u003cp\u003eThe tissues were fixed in 4% paraformaldehyde solution for 24 h, embedded in paraffin at 65\u0026deg;C, sectioned at 5 \u0026micro;m thickness, and baked at 60℃. The sections were dewaxed in xylene, hydrated in gradient alcohol, and repaired in Improved Sodium Citrate Antigenic Repair Solution. After being rinsed and dried with PBS, the sections were permeabilized in 0.5% Triton-X-100-supplemented PBS for 15 min and sealed in 10% goat serum at room temperature for 1 h. Subsequently, the sections were incubated with CD34 (14486-1-AP, Proteintech, 1:1000) at 4℃ overnight and incubated with the secondary antibody at room temperature for 1 h after washing with PBST. Finally, the sections were stained with DAB and sealed with neutral gum.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Real-time PCR\u003c/h2\u003e \u003cp\u003eRNA was extracted by RNA extraction kit (TaKaRa, Japan), and the concentration of RNA was detected by a microspectrophotometer (Thermo Scientific, USA). Reverse transcription to cDNA was performed by a reverse transcription kit (Vazyme, Nanjing). Amplification procedure: 95℃ for 30 s; 40 cycles, 95℃ for 10 s, 60℃ for 20 s, 72℃ for 20 s; 95℃ for 10 s, 65℃ for 60s, 97℃ for 1 s. The primer sequence was synthesized by Shanghai Sangon.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForword (5\u0026acute;\u0026rarr;3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse (5\u0026acute;\u0026rarr;3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePRL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e人\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACTACATCCATAACCTCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTTGATGGCCTTGGTAATGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVEGFA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e人\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCGAGTACATCTTCAAGCCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTGAGGTTTGATCCGCATAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eANG-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e人\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATATCACACATGACGGGTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGGAAAGTGTTTTTCTGGGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e人\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGGCACCCAGCACAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGGCCGGACTCGTCATAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrl8a2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e小鼠\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAACCTCACTTCTGGGCACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGAGCAGCCATTCTCTCCTGTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVEGFA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e小鼠\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCTGTAACGATGAAGCCCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTGTAGGAAGCTCATCTCTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eANG-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e小鼠\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACATAGGGTGCAGCAACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGTCGTGTTCTGGAAGAATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e小鼠\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATTGCTGACAGGATGCAGAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCTGGAAGGTGGACAGTGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Western blot\u003c/h2\u003e \u003cp\u003eThe tissues were placed in the lysate buffer (Shanghai Beyotime) and cryo-milled, the supernatant was collected to measure the protein concentration by a BCA kit (Nanjing Vazyme). The remaining proteins were denatured at 100\u0026deg;C. Then proteins were separated by SDS-PAGE electrophoresis, transferred onto PVDF membranes, and blocked in 5% no-fat milk. Then the membranes were incubated with the first antibody at 4℃ overnight and washed 3 times with TBST. Finally, the membranes were incubated with the corresponding second antibody at room temperature for 1 h and scanned. The primary antibodies were as follows: PRL (Abclonal, A1618, 1:1000), Prl8a2 (self-made by Xiamen University, 1:1000), VEGFA (Proteintech, 19003-1-AP, 1:1000), ANG-1 (Proteintech, 23302-1-AP, 1:700), VEGFR2 (Proteintech, 26415-1-AP, 1:2000), TIE2 (Proteintech, 19157-1-AP, 1:500), Vinculin (Proteintech, 66305-1-Ig, 1:1000), β-Actin (Proteintech, 1:3000). The secondary antibodies were as follows: Anti-mouse IgG (H\u0026thinsp;+\u0026thinsp;L) (CST, 5470), Anti-rabbit IgG(H\u0026thinsp;+\u0026thinsp;L) (CST, 5151).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe comparison between the two groups was analyzed using Graphpad Prism 8.0 statistical software by independent sample t test, and the results were expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Each experiment was repeated at least 3 times, and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Comparison of basic data of clinical samples\u003c/h2\u003e \u003cp\u003eA total of 14 clinical samples were included in this study, including 5 cases in the normal control group, 4 cases in the normal UA group, and 5 cases in the high UA group. There were no significant differences in age, days of gestation, and pre-pregnancy BMI among the three groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). There were no statistically significant differences in fasting blood glucose, urea nitrogen, and creatinine levels between the normal UA group and the high UA group (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and only the UA level was significantly higher in the high UA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Construction of animal models\u003c/h2\u003e \u003cp\u003eWhile collecting clinical samples, we also constructed a pregnant mouse model with high UA using ICR mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). To exclude the interference of metabolic syndrome that may associated with high UA, we also compared the changes in body weight of mice before and after modeling (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) and the fasting blood glucose level of mice after modeling (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), which were no significant differences (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). In addition, after the completion of modeling, the serum UA level in the HUA group was significantly higher than that in the CON group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while other renal indicators were not affected (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), suggesting that the modeling was successful. After the successful verification of the model, the pregnant uterus of mice were dissected. The uterus of the HUA group was slightly smaller than that of the CON group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). However there was no significant difference in the number of points of implantation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE) and the weight of the pregnant uterus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) between the two groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.3 High UA levels impair endometrial decidualization levels\u003c/h2\u003e \u003cp\u003eOur preliminary findings suggest that the harm of high serum UA to pregnancy is especially manifested in early pregnancy before 12 weeks, and this period is the key period of endometrial decidualization before placenta formation. To verify the adverse effect of high serum UA on endometrial decidualization during pregnancy, we analyzed the expression of PRL in human decidua. The results of both Real-time PCR and Western blot showed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, C) that compared with a normal control group and normal UA group, high UA could significantly reduce the mRNA and protein expression levels of decidualization marker PRL. Similarly, we also found reduced mRNA and protein expression levels of Prl8a2, a PRL-related protein in the decidua/ trophoblastic layer in the pregnant uterus of D7.5 mice in the HUA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.4 High UA levels impair endometrial angiogenesis\u003c/h2\u003e \u003cp\u003eThe previous data suggest that high UA leads to impaired endometrial decidualization. In the process of endometrial decidualization, the blood sinuses and vascular networks established by angiogenesis are crucial for later normal pregnancy. The abnormal expression of VEGF and ANG seems to be involved in the development of spontaneous abortion. To confirm the level of angiogenesis in each sample, CD34, a microvascular marker, was first selected for immunohistochemical staining of clinical decidua (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) and mouse pregnancy uterus samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) of each group to compare the differences in microvascular diameter and blood vessel density. We found that in clinical samples, microvascular lumen diameter and vascular density in the HUA group were smaller than those in the normal control group and normal UA group. This phenomenon has also been confirmed in the uterus of pregnant mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAngiogenesis in endometrium is mainly regulated by two key pathways, VEGFA and its receptor VEGFR2 and ANG-1 and its receptor TIE2. Consequently, our analysis focused on these pathways, VEGFA and ANG-1. Real-time PCR analyse of decidual tissue from clinical patients showed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) that the mRNA expression level of ANG-1 in the high UA group was significantly lower than that in the normal UA group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, no statistically significant difference was observed between the normal control group and either of the other two groups. Western blot analysis revealed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE) that the protein expression of VEGFA was significantly reduced in the high UA group compared to the normal UA group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and there was no difference in the protein expression of VEGFR2, ANG-1 and its receptor TIE2. Similarly, the above results have been confirmed in the uterus of pregnant mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, F). So we therefore concluded that high UA levels can cause disturbances in the level of endometrial angiogenesis.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003ePRL is produced by stromal cells after decidualization\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e and is one of the widely used markers of decidualization in human endometrial studies\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. In mice, Prl8a2 (also known as Dtprp) from the PRL family is commonly used as a marker of decidualization. When we targeted the patients with high UA in early pregnancy, we found that PRL mRNA and protein levels in the decidua of patients with high UA were significantly down-regulated compared with the week-matched normal pregnancy groups and normal UA groups. The mRNA and protein levels of Prl8a2 in the uterus of D7.5 pregnancy of high UA mice were also significantly decreased compared with the control group, so we concluded that high circulating UA levels can cause impaired endometrial decidualization which in turn leads to adverse pregnancy outcomes. A study by Zhu YY et al\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e concluded that monosodium urate (MSU) crystals could induce endometrial decidualization in stromal cells of mice by triggering aseptic inflammation and significantly up-regulated expression of Prl8a2 was observed in the MSU treated group. However, needle-like, immune-stimulating MSU crystals precipitated only when serum UA levels exceed 480 \u0026micro;mol/L\u003csup\u003e21\u003c/sup\u003e, a level rarely reached in women of reproductive age. In addition, Zhu YY et al.\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e injected UA solutions with concentrations of 0.002 mg/mL (11.9\u0026micro;mol/L) and 0.02 mg/mL (119\u0026micro;mol/L) into the uterine corners of mice to observe their decidualization, but no significant changes in expression of Prl8a2 mRNA were observed. We believe that there may be several reasons for this difference in results: (1) UA is a weak acid with low solubility, and the concentration of UA solution used in this experiment has not reached the normal serum UA level in women of childbearing age; (2) We did not use the experimental design in which the UA solution was in direct contact with the endometrium, but rather simulated the pathology of high serum UA in clinical patients and constructed a mouse model of circulating high UA, which may lead to the change of endometrium decidualization through other pathways; (3) We used a natural pregnancy mouse model, which may be different from artificially induced decidualization mouse.\u003c/p\u003e \u003cp\u003eIn the process of decidualization, angiogenesis is an extremely critical part. The successful establishment of blood sinuses and vascular network systems lays a solid foundation for the maintenance of the following pregnancy\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. We used CD34 to stain human decidua and mouse pregnant uterus and found that the blood sinus size and microvascular density of the high UA group were significantly smaller than that of the control group. Endometrial angiogenesis is mainly regulated by VEGFA and ANG-1 and their receptors, among which VEGFA is a key molecule in regulating decidua angiogenesis and spiral artery remodeling\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. In our results, high UA disrupted the expression of relevant angiogenic pathways, leading to a significant downregulation of ANG-1 at the level of mRNA and a significant reduction of VEGFA at the level of protein.VEGFA is a major endogenous driver of angiogenesis\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. In the research model of ischemic stroke, UA treatment can reduce the level of VEGFA and thus inhibit endothelial cell angiogenesis\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. In addition, studies have pointed out that when VEGFA is in action, ANG-1 does not participate in the process of stimulating the proliferation of vascular endothelial cells thereby triggering the process of angiogenesis and remodeling\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Therefore, we hypothesized that it is the high UA level that down-regulates the protein expression of VEGFA and thus inhibits the proliferation of vascular endothelial cells, leading to the impairment of decidualized angiogenesis. The up-regulation of the mRNA of ANG-1 occurs as a result of the body's compensation. Therefore, we suggest that high UA levels mainly act on the VEGFA-dominated pathway, which leads to insufficient angiogenesis of decidua in early pregnancy. It is now known that PI3K/Akt pathway is a classical VEGFA-induced downstream signaling pathway of VEGFR2, which is particularly important for normal blood vessel growth\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Endothelial nitric oxide synthases (eNOS) as one of its downstream targets are mainly responsible for regulating the diameter of blood vessels\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. In animal models, activation of the PI3K/Akt/eNOS pathway promotes endometrial angiogenesis\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Currently, in vitro studies have confirmed that high levels of UA can induce vascular endothelial cell dysfunction through the PI3K/Akt/eNOS pathway\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. During the process of endometrial decidualization, whether high serum UA levels can cause angiogenesis disorder by acting on the PI3K/Akt/eNOS pathway is the next question we want to solve.\u003c/p\u003e \u003cp\u003eThere are still some limitations in this study. Due to the presence of uric acid oxidase (UOX) in mice, it is difficult to replicate human chronic hyperuricemia in mice through diet or drugs. Therefore, we selected an acute mouse model of hyperuricemia\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e which only simulates the effect of high UA on endometrium in early pregnancy and it is still necessary to explore a more stable mouse model that is close to the human pathological state for further verification. In addition, we only collected the UA levels of clinical patients before pregnancy for detection and did not further analyze the UA levels after confirming pregnancy. However, it is generally believed that estrogen and progesterone can cause a decrease in UA by accelerating the clearance of UA\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. So UA levels usually decrease during the first 12 weeks of pregnancy\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e and then increase until they reach or exceed pre-pregnancy levels before delivery\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. However, it has also been shown that an increase of UA is observed at 5 to 6 weeks of gestation and a decrease after abortion\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, which may indicate that the increase of UA is associated with the process of decidualization, but the causal relationship still needs to be further explored.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, our findings suggest that high UA can lead to endometrial decidualization injury and angiogenesis disorders in early gestation in both humans and mice, which may be one of the mechanisms of early abortion induced by HUA. Therefore, monitoring the serum UA level of patients before pregnancy and correcting the possible HUA in time have important clinical value in reducing the abortion rate.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to extend our sincere thanks to Haibin Wang team from\u0026nbsp;Medical School of Xiamen University\u0026nbsp;for their primary antibody. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJL: Writing- original draft, Writing- review \u0026amp; editing, Methodology. MMH: Writing- original draft, Writing- review \u0026amp; editing. MH: Writing- original draft. JX: Formal Analysis, Software. LZ: Writing- review \u0026amp; editing. YL: Writing- review \u0026amp; editing. XHZ: Resources, Project administration, Supervision, Writing- review \u0026amp; editing. XS: Conceptualization, Project administration, Supervision, Resources, Writing- original draft, Writing- review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by grants from Jiangsu Provincial Research Hospital (YJXYY202204-YSB44 to XS), Key Laboratory of Reproductive Health Diseases Research and Translation of Ministry of Education from Hainan Medical University (SZLAB202306 to YM), the Society and livelihood Project of Nantong City (MS22022119 to XS), Health Commission of Nantong City (MS2023019 to XS).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe studies involving humans were approved by the Ethics Committee of Nantong University Affiliated Hospital(2024-L099). All experiments on human subjects were performed in accordance with the Declaration of Helsinki for the medical community. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. The animal studies were approved by Institutional Animal Ethical Committee (IAEC) of Nantong University (P20221222-003, Nantong, China). The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eNakagawa, T. et al. Endogenous Fructose Metabolism Could Explain the Warburg Effect and the Protection of SGLT2 Inhibitors in Chronic Kidney Disease. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 694457. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2021.694457\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2021.694457\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu, L. et al. Hyperuricemia and its related diseases: mechanisms and advances in therapy. \u003cem\u003eSignal. Transduct. Target. Ther.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41392-024-01916-y\u003c/span\u003e\u003cspan address=\"10.1038/s41392-024-01916-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, C., Cheng, H., He, X., Tan, X. \u0026amp; Huang, X. Association between serum uric acid and female infertility: a cross-sectional study of National Health and Nutrition Examination Survey (NHANES) 2013\u0026ndash;2018. \u003cem\u003eBMC Womens Health\u003c/em\u003e. \u003cb\u003e23\u003c/b\u003e, 224. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12905-023-02376-2\u003c/span\u003e\u003cspan address=\"10.1186/s12905-023-02376-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho, H. Y. et al. Association of Complement Factor D and H Polymorphisms with Recurrent Pregnancy Loss. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms21010017\u003c/span\u003e\u003cspan address=\"10.3390/ijms21010017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiani, F. et al. Serum uric acid to creatinine ratio and risk of preeclampsia and adverse pregnancy outcomes. \u003cem\u003eJ. Hypertens.\u003c/em\u003e \u003cb\u003e41\u003c/b\u003e, 1333\u0026ndash;1338. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/HJH.0000000000003472\u003c/span\u003e\u003cspan address=\"10.1097/HJH.0000000000003472\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, H., Zhang, X. M., Wang, Y. L. \u0026amp; Liu, B. C. Prevalence of hyperuricemia among Chinese adults: a national cross-sectional survey using multistage, stratified sampling. \u003cem\u003eJ. Nephrol.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e, 653\u0026ndash;658. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s40620-014-0082-z\u003c/span\u003e\u003cspan address=\"10.1007/s40620-014-0082-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng, M. et al. Estrogen receptor beta signaling induces autophagy and downregulates Glut9 expression. \u003cem\u003eNucleosides Nucleotides Nucleic Acids\u003c/em\u003e. \u003cb\u003e33\u003c/b\u003e, 455\u0026ndash;465. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/15257770.2014.885045\u003c/span\u003e\u003cspan address=\"10.1080/15257770.2014.885045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Becker, B., Borghi, C., Burnier, M. \u0026amp; van de Borne, P. Uric acid and hypertension: a focused review and practical recommendations. \u003cem\u003eJ. Hypertens.\u003c/em\u003e \u003cb\u003e37\u003c/b\u003e, 878\u0026ndash;883. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/HJH.0000000000001980\u003c/span\u003e\u003cspan address=\"10.1097/HJH.0000000000001980\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGellersen, B. \u0026amp; Brosens, J. J. Cyclic decidualization of the human endometrium in reproductive health and failure. \u003cem\u003eEndocr. Rev.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, 851\u0026ndash;905. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/er.2014-1045\u003c/span\u003e\u003cspan address=\"10.1210/er.2014-1045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCha, J., Sun, X. \u0026amp; Dey, S. K. Mechanisms of implantation: strategies for successful pregnancy. \u003cem\u003eNat. Med.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 1754\u0026ndash;1767. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nm.3012\u003c/span\u003e\u003cspan address=\"10.1038/nm.3012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBainbridge, S. A. et al. Uric acid attenuates trophoblast invasion and integration into endothelial cell monolayers. \u003cem\u003eAm. J. Physiol. Cell. Physiol.\u003c/em\u003e \u003cb\u003e297\u003c/b\u003e, C440\u0026ndash;450. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpcell.00593.2008\u003c/span\u003e\u003cspan address=\"10.1152/ajpcell.00593.2008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalker, M. et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e5\u003c/b\u003e, e10287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0010287\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0010287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZoccali, C., Maio, R., Mallamaci, F., Sesti, G. \u0026amp; Perticone, F. Uric acid and endothelial dysfunction in essential hypertension. \u003cem\u003eJ. Am. Soc. Nephrol.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 1466\u0026ndash;1471. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1681/ASN.2005090949\u003c/span\u003e\u003cspan address=\"10.1681/ASN.2005090949\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang, D. H., Park, S. K., Lee, I. K. \u0026amp; Johnson, R. J. Uric acid-induced C-reactive protein expression: implication on cell proliferation and nitric oxide production of human vascular cells. \u003cem\u003eJ. Am. Soc. Nephrol.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 3553\u0026ndash;3562. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1681/ASN.2005050572\u003c/span\u003e\u003cspan address=\"10.1681/ASN.2005050572\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong, Q. et al. Hyperuricemia induces endothelial dysfunction via mitochondrial Na+/Ca2\u0026thinsp;+\u0026thinsp;exchanger-mediated mitochondrial calcium overload. \u003cem\u003eCell. Calcium\u003c/em\u003e. \u003cb\u003e51\u003c/b\u003e, 402\u0026ndash;410. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ceca.2012.01.003\u003c/span\u003e\u003cspan address=\"10.1016/j.ceca.2012.01.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, Y. Y. et al. In situ Synthesized Monosodium Urate Crystal Enhances Endometrium Decidualization via Sterile Inflammation During Pregnancy. \u003cem\u003eFront. Cell. Dev. Biol.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 702590. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcell.2021.702590\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2021.702590\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e李瑾然 \u0026amp; 何美华 \u0026amp; 孙晓莉. 血清尿酸水平对冻融胚胎移植妊娠结局影响的研究. 中华生殖与避孕杂志 44, 285\u0026ndash;290 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3760/cma.j.cn101441-20231024-00175\u003c/span\u003e\u003cspan address=\"10.3760/cma.j.cn101441-20231024-00175\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYong, T. et al. Caffeic acid phenethyl ester alleviated hypouricemia in hyperuricemic mice through inhibiting XOD and up-regulating OAT3. \u003cem\u003ePhytomedicine\u003c/em\u003e \u003cb\u003e103\u003c/b\u003e, 154256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phymed.2022.154256\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2022.154256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNg, S. W. et al. Endometrial Decidualization: The Primary Driver of Pregnancy Health. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms21114092\u003c/span\u003e\u003cspan address=\"10.3390/ijms21114092\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrar, A. K. et al. Laminin decreases PRL and IGFBP-1 expression during in vitro decidualization of human endometrial stromal cells. \u003cem\u003eJ. Cell. Physiol.\u003c/em\u003e \u003cb\u003e163\u003c/b\u003e, 30\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcp.1041630105\u003c/span\u003e\u003cspan address=\"10.1002/jcp.1041630105\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1995).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAshcroft, J. A. Alternatives to specific uric acid lowering treatment in gout in patients with cardiovascular disease. \u003cem\u003eBMJ\u003c/em\u003e 362, k3895 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1136/bmj.k3895\u003c/span\u003e\u003cspan address=\"10.1136/bmj.k3895\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAugustin, H. G., Koh, G. Y., Thurston, G. \u0026amp; Alitalo, K. Control of vascular morphogenesis and homeostasis through the angiopoietin-Tie system. \u003cem\u003eNat. Rev. Mol. Cell. Biol.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 165\u0026ndash;177. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrm2639\u003c/span\u003e\u003cspan address=\"10.1038/nrm2639\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato, Y. The vasohibin family: a novel family for angiogenesis regulation. \u003cem\u003eJ. Biochem.\u003c/em\u003e \u003cb\u003e153\u003c/b\u003e, 5\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jb/mvs128\u003c/span\u003e\u003cspan address=\"10.1093/jb/mvs128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVila, E. et al. Uric acid treatment after stroke modulates the Kruppel-like factor 2-VEGF-A axis to protect brain endothelial cell functions: Impact of hypertension. \u003cem\u003eBiochem. Pharmacol.\u003c/em\u003e \u003cb\u003e164\u003c/b\u003e, 115\u0026ndash;128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bcp.2019.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.bcp.2019.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh, T. W., Park, K. H., Jung, H. W. \u0026amp; Park, Y. K. Neuroprotective effect of the hairy root extract of Angelica gigas NAKAI on transient focal cerebral ischemia in rats through the regulation of angiogenesis. \u003cem\u003eBMC Complement. Altern. Med.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 101. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12906-015-0589-4\u003c/span\u003e\u003cspan address=\"10.1186/s12906-015-0589-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, J. et al. Akt1 regulates pathological angiogenesis, vascular maturation and permeability in vivo. \u003cem\u003eNat. Med.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1188\u0026ndash;1196. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nm1307\u003c/span\u003e\u003cspan address=\"10.1038/nm1307\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClaesson-Welsh, L. \u0026amp; Welsh, M. VEGFA and tumour angiogenesis. \u003cem\u003eJ. Intern. Med.\u003c/em\u003e \u003cb\u003e273\u003c/b\u003e, 114\u0026ndash;127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/joim.12019\u003c/span\u003e\u003cspan address=\"10.1111/joim.12019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, Y. et al. ANXA4 promotes trophoblast invasion via the PI3K/Akt/eNOS pathway in preeclampsia. \u003cem\u003eAm. J. Physiol. Cell. Physiol.\u003c/em\u003e \u003cb\u003e316\u003c/b\u003e, C481\u0026ndash;C491. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpcell.00404.2018\u003c/span\u003e\u003cspan address=\"10.1152/ajpcell.00404.2018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing, L. et al. Acupuncture Improves Endometrial Angiogenesis by Activating PI3K/AKT Pathway in a Rat Model with PCOS. \u003cem\u003eEvid Based Complement Alternat Med\u003c/em\u003e 1790041 (2022). (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2022/1790041\u003c/span\u003e\u003cspan address=\"10.1155/2022/1790041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi, Y. J. et al. Uric acid induces endothelial dysfunction by vascular insulin resistance associated with the impairment of nitric oxide synthesis. \u003cem\u003eFASEB J.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e, 3197\u0026ndash;3204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1096/fj.13-247148\u003c/span\u003e\u003cspan address=\"10.1096/fj.13-247148\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruderer, S. G., Bodmer, M., Jick, S. S. \u0026amp; Meier, C. R. Association of hormone therapy and incident gout: population-based case-control study. \u003cem\u003eMenopause\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, 1335\u0026ndash;1342. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/GME.0000000000000474\u003c/span\u003e\u003cspan address=\"10.1097/GME.0000000000000474\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Y. \u0026amp; Charchar, F. J. Establishment of sex difference in circulating uric acid is associated with higher testosterone and lower sex hormone-binding globulin in adolescent boys. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 17323. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-96959-4\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-96959-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson, R. J., Kanbay, M., Kang, D. H., Sanchez-Lozada, L. G. \u0026amp; Feig, D. Uric acid: a clinically useful marker to distinguish preeclampsia from gestational hypertension. \u003cem\u003eHypertension\u003c/em\u003e \u003cb\u003e58\u003c/b\u003e, 548\u0026ndash;549. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/HYPERTENSIONAHA.111.178921\u003c/span\u003e\u003cspan address=\"10.1161/HYPERTENSIONAHA.111.178921\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShakarami, A., Ghafarzadeh, M., Yari, F. \u0026amp; Fathi, L. Association between maternal serum uric acid and preeclampsia. \u003cem\u003eArch. Physiol. Biochem.\u003c/em\u003e \u003cb\u003e128\u003c/b\u003e, 1434\u0026ndash;1437. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/13813455.2020.1773863\u003c/span\u003e\u003cspan address=\"10.1080/13813455.2020.1773863\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Hyperuricemia, Endometrium, angiogenesis, decidualization, Reproduction, Female fertility","lastPublishedDoi":"10.21203/rs.3.rs-5599602/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5599602/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHyperuricemia (HUA) is the second most common metabolic disease after diabetes and refers to a type of disease in which serum uric acid (SUA) levels are excessively high due to excessive production of uric acid (UA) or reduced metabolic capacity. To elucidate the effect of HUA on angiogenesis in endometrial decidualization, the authors investigated endometrial decidualization markers and angiogenesis factors in the decidua after abortion in women with high uric acid levels and the uterus of mice with high uric acid induced by purines on day 7.5 (D7.5) of gestation. Moreover, immunohistochemical staining was used to measure the diameter of the microvascular lumen and the density of the vessels.Real-time PCR and Western blot results showed that the expressions of prolactin (PRL) and decidua/trophoblast PRL-related protein Prl8a2 in the decidua of human decidua and the pregnant uterus of high uric acid mice with D7.5 days of gestation were significantly reduced. Additionally, the diameter and density of the microvascular lumen were decreased by immunohistochemical staining of uterine CD34. The expression of VEGFA in the endometrium was significantly decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). High UA can lead to endometrial decidualization damage and angiogenesis disorders in early pregnancy in humans and mice.\u003c/p\u003e","manuscriptTitle":"The relationship between high serum UA levels and decidualization and angiogenesis in endometrium","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-21 06:02:20","doi":"10.21203/rs.3.rs-5599602/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-01-14T04:59:50+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-01-13T09:40:13+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-01-02T22:35:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"88941144700379956870913409961335776312","date":"2025-01-02T15:31:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"293645870883191388789851433661084539445","date":"2025-01-02T14:46:09+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-12-29T08:11:48+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-12-29T08:00:25+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-12-19T13:51:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-12-18T11:34:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-12-07T15:04:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"192eb6e1-e266-4129-b2e4-292672cff280","owner":[],"postedDate":"December 21st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":41829774,"name":"Health sciences/Endocrinology"},{"id":41829775,"name":"Health sciences/Diseases/Endocrine system and metabolic diseases"},{"id":41829776,"name":"Health sciences/Diseases/Reproductive disorders"}],"tags":[],"updatedAt":"2025-11-10T16:07:44+00:00","versionOfRecord":{"articleIdentity":"rs-5599602","link":"https://doi.org/10.1038/s41598-025-22489-y","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-11-04 15:57:52","publishedOnDateReadable":"November 4th, 2025"},"versionCreatedAt":"2024-12-21 06:02:20","video":"","vorDoi":"10.1038/s41598-025-22489-y","vorDoiUrl":"https://doi.org/10.1038/s41598-025-22489-y","workflowStages":[]},"version":"v1","identity":"rs-5599602","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5599602","identity":"rs-5599602","version":["v1"]},"buildId":"WvIrzKhiLBfengagbw6Ux","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.