Inhibition of NLRP3 oligomerization (active conformation) mediated by RACK1 ameliorates acute respiratory distress syndrome

preprint OA: closed
Full text JSON View at publisher
Full text 186,178 characters · extracted from preprint-html · click to expand
Inhibition of NLRP3 oligomerization (active conformation) mediated by RACK1 ameliorates acute respiratory distress syndrome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Inhibition of NLRP3 oligomerization (active conformation) mediated by RACK1 ameliorates acute respiratory distress syndrome Yinan Zhang, Jian Cui, Meng Yang, Chengli Yu, Haidong Zhang, Yuan Gong, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4659521/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aberrant activation of the NACHT, LRR, and PYD domain-containing protein 3 (NLRP3) inflammasome contributes to the pathogenesis of fatal and perplexing pulmonary diseases. Although pharmacologically inhibiting NLRP3 inflammasome brings potent therapeutic effects in several clinical trials and preclinical models, the molecular chaperones and transition detail in the formation of active oligomer from an auto-suppressed state remain controversial. Here, we showed that sesquiterpene bigelovin inhibited NLRP3 inflammasome activation and release of the downstreaming pro-inflammatory cytokines by canonical, noncanonical, and alternative pathways at nanomolar ranges. Chemoproteomic target identification disclosed that bigelovin covalently bound to the cysteine 168 of RACK1 and blocked the interaction between RACK1 and NLRP3 monomer, thereby interfering NLRP3 inflammasome oligomerization in vitro and in vivo . Treatment by bigelovin significantly alleviated the severity of NLRP3-related pulmonary disorders in murine models, such as LPS-induced ARDS and silicosis. These results consolidated the intricate role of RACK1 in transiting the NLRP3 state and provided a new anti-inflammatory lead and therapy for NLRP3-driven diseases. Biological sciences/Immunology/Inflammation/Inflammasome Biological sciences/Drug discovery/Pharmacology/Pharmacodynamics Biological sciences/Immunology/Innate immune cells/Monocytes and macrophages/Alveolar macrophages bigelovin ARDS NLRP3 inflammasome RACK1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Acute respiratory distress syndrome (ARDS), characterized by acute hypoxemia, diffuse lung inflammation, and edema, is the primary cause of respiratory failure with more than 40% mortality ( 1 , 2 ). Few therapeutic modalities are presented to alleviate this deadly condition. The disorder is associated with excessive alveolar capillary permeability and diffuse damage. Most ARDS cases initiate in patients exposed to pathogen-associated molecular patterns (such as LPS or RNA) during bacterial and viral types of pneumonia ( 3 ). There is growing evidence of the involvement of innate immunityduring ARDS pathogenesis, in which alveolar macrophages detect the presence of infections or injuries and trigger pyroptosis characterized by rapid cytolysis and the release of proinflammatory cytokines ( 4 , 5 ). Based on our and other groups’ study, an overproduction of IL-1β caused by macrophage pyroptosis in the development of ARDS is essential for activating the host’s immune system ( 6 , 7 ). Therefore, targeting the production of IL-1β might be beneficial to ARDS. As the core signaling to drive IL-1β activation and release, inflammasomes assembled by multiple proteins play a crucial role in inflammation response to infection and tissue damage. Inflammasome complexes generally consist of pattern recognition receptors (PRRs), the adaptor protein apoptosis-associated speck-like protein containing a CARD (ASC), and the inflammatory proteases caspase-1 ( 8 ). The best-studied PRRs- NLRP3 inflammasome, is an intracellular sensor for infectious and sterile stress signals, in particular, involved in various inflammation responses and cell pyroptosis ( 9 ). Its activation primarily depends on the priming step, typically via TLR-induced NF-κB-dependent signaling pathways, enabling the expression of Nlrp3 , which in turn facilitates its activation. Additionally, direct LPS treatment could also prime NLRP3 in a non-transcriptional way. In the activation step, NLRP3 is activated by diverse stimuli ranging from bacterial toxins to particulates that often converge to ionic changes such as K + efflux or Ca 2+ influx ( 10 , 11 ). A number of NLRP3-binding proteins have been learned to promote NLRP3 inflammasome translocation and assembly ( 12 ). For example, SCAP and SREBP2 interact with the NACHT domain and help NLRP3 transfer to the Golgi apparatus ( 13 ); post-phosphorylation at S293 of NLRP3 by protein kinase D allows the release from the Golgi and the formation of cytosolic inflammasome ( 14 ); deficiency of another mediator HDAC6 traps NLRP3 as small speckles at the trans-Golgi network and stops its transportation to the centrosome where assembly takes place ( 15 ). On the other hand, NEK7 is the most-studied mediator to trigger the final formation of NLRP3 machinery ( 16 ), in which structural analysis of NLRP3-NEK7 complex shows that NEK7 bridges adjacent subunits in the process of NLRP3 oligomerization ( 17 ). Next, the receptor for activated protein C kinase (RACK1) interacts with NLRP3 and NEK7, leading NLRP3 into an “active” conformation in response to stimuli and subsequent inflammasome assembly. Since NLRP3 inflammasome and its regulatory role have emerged as a promising therapeutic target, the development of direct NLRP3 inhibitors is vigorously progressing in the preclinical and clinical stages. However, whether these partner proteins are related to the inflammasome structure and posttranslational modification remains unclear. Our group previously identified EZH2-promoted expression of autophagy-related protein 5 as a novel NLRP3 degradation pathway and flavonoid lonicerin served as an EZH2 inhibitor to alleviate over-inflammation in the ulcerative colitis model ( 18 ). In our search for other natural products involved in the interaction of NLRP3 inflammasome and its mediators, we resolved sesquiterpene bigelovin as the first covalent binder that blocks RACK1-mediated NLRP3 oligomerization (active conformation) by using an isoTOP-ABPP chemoproteomic approach ( 19 ). Here, we report the discovery of a class of RACK1 inhibitors that exert NLRP3 inflammasome antognistic activity in vitro and in vivo . Mechanistically, sesquiterpene lactone bigelovin covalently binds to a cysteine residue of RACK1 and blocks NLRP3 oligomerization (active conformation), inhibiting the assembly of NLRP3 inflammasome, caspase-1 activation, and IL-1β production, and reducing ARDS severity. Results Sesquiterpene lactone contained in Inula helianthus-aquatica reduces LPS-induced ARDS in mice During the COVID-19 pandemic outbreak, ARDS emerged as the predominant syndrome and the leading cause of death among severe COVID-19 patients ( 20 ). Both clinical and preclinical studies have delineated the effectiveness of traditional Chinese medicine (TCM) in treating COVID-19 and its associated complications ( 21 ). The TCM formulae containing the flowers of Inula helianthus-aquatica have been traditionally used in the prescriptions of lung diseases, such as asthma, chronic bronchitis ( 22 ). However, the defining components of Inula helianthus-aquatica have yet to be proven for its anti-inflammatory properties. To pinpoint the active components in the plant, we initially employed an activity-guided isolation approach to refine the fractions derived from crude extraction. Mice received two doses of the fractions on consecutive days prior to a single intraperitoneal injection of 7.5 mg/kg LPS (Fig. S1 B). We evaluated pulmonary inflammation by measuring the mRNA levels of pro-inflammatory cytokines in the lungs at 12 and 24 hours after LPS delivery. The results showed that the fraction containing sesquiterpene lactones bigelovin, ergolide, and 8-epi-helenalin (Fig. S1 A), significantly decreased the expression of IL-1β in the lungs at both 1 mg/kg and 0.1 mg/kg doses, while had a lesser impact on IL-6 and TNF-α (Fig. S1 C-G). To confirm our results, we assessed whether the same fraction could attenuate the LPS-induced release of pro-inflammatory cytokines (Fig. S1 H). Consistent with the preventative remedy, post-LPS challenge administration also markedly reduced lung inflammation at 1 mg/kg compared to dexamethasone at 5 mg/kg (Fig. S1 I-M). These findings suggest that sesquiterpene lactones present in the extract of Inula helianthus aquatica may mitigate the severity of ARDS and reduce pulmonary inflammation. Aberrant activation of macrophage-NLRP3 inflammasome activation is associated with ARDS The NLRP3 inflammasome is pivotal in the innate immune system's response to escalating inflammatory stimuli. To figure out the expression profile of the NLRP3 inflammasome in ARDS, we commenced by analyzing single-cell RNA sequencing data from peripheral blood mononuclear cells (PBMCs) of thirteen ARDS patients and six healthy donors, as reported by Sawitzki et al ( 23 ). The Human Protein Atlas single-cell database showed that NLPR3 was primarily expressed in myeloid cells (Fig. S2 A). Quantification analysis revealed an increased density of monocyte/macrophage density in ARDS patients (Fig. 1A-B). In comparison to the peripheral blood from healthy donors, levels of NLRP3 and IL-1β were markedly higher in ARDS patients (Fig. 1C, Fig. S2 B). Given that ARDS is characterized by lung inflammation arising from activation of the innate immune system. We next examined the expression patterns of NLRP3 and IL-1β through scRNA-seq analysis of bronchoalveolar lavage fluid (BALF) cells obtained from individuals with severe ARDS. Our findings reveal that the expression of NLRP3 and IL-1β genes is predominantly observed in classical and intermediate monocytes in BALF(Fig. 1D-E). Further analysis of specific gene expression in BALF was conducted. Notably, the single-cell RNA sequencing of BALF also disclosed an elevated expression of NLRP3 and IL-1β in monocytes of severe ARDS compared to those with moderate ARDS and healthy controls (Fig. 1F-G). To corroborate these findings, we assessed the activation of the NLRP3 inflammasome in ARDS patients directly, as well as in an LPS-induced ARDS mouse model. The data indicated a direct correlation between IL-1β serum levels and the severity of the condition (Fig. 1H, Table 1). Specifically, the LPS-induced ARDS murine model demonstrated a similar trend in IL-1β secretion in both serum and lung tissue (Fig. 1I-J). Western blotting analyses of caspase-1 signaling indicated pronounced cleavage and activation of pro-caspase-1 in the ARDS model (Fig. 1K, Fig. S2 C), validating the aberrant activation of NLRP3 inflammasome in ARDS. Bigelovin specifically abrogates NLRP3 inflammasome activation in vitro and in vivo In the lung, NLPR3 was particularly expressed in macrophages (Fig. S2 D-E). Subsequently, we explored the inhibitory effect of bigelovin, ergolide, and 8-epi-helenalin on IL-1β production in mouse bone marrow-derived macrophages (BMDMs) and human monocytic THP-1-derived macrophages at non-toxic concentrations. The results showed that bigelovin exerted the most potent suppression of IL-1β production at a concentration of 1 µM in these LPS/ATP-stimulated cells, compared to the other sesquiterpene lactones (Fig. 2A, S3A-B). The IC50 values for bigelovin were determined at 46.0 nM and 396.8 nM in BMDM and THP-1, respectively (Fig. S3 C-D). Within the effective range, bigelovin did not affect the levels of other pro-inflammatory cytokines such as TNF-α and IL-6, suggesting its specific inhibition to the NLRP3 pathway (Fig. 2B-C, S3E-G). In addition to IL-1β maturation, caspase-1 activation is also implicated in cell pyroptosis and subsequent release of lactate dehydrogenase (LDH) during the activation of NLRP3 inflammasome. Bigelovin dose-dependently inhibited caspase-1 cleave and LDH release (Fig. 2D-E, S3H-I). This inhibitory effect on IL-1β production and caspase-1 activation was consistent across BMDMs and human macrophages when challenged with various NLRP3 inflammasome activators, including nigericin and monosodium urate crystals (MSU) (Fig. 2F-I, S3J-O). To further elucidate the inhibitory mechanism of bigelovin, we examined its effect on noncanonical NLRP3 inflammasome activation induced by intracellular LPS. In line with our previous observations, bigelovin significantly reduced IL-1β production and caspase-1 activation in Pam3CSK4-primed BMDMs challenged with LPS (Fig. 2J-K, S3P-Q). In monocytes, LPS alone can trigger NLRP3 inflammasome signaling. We also observed that bigelovin decreased thesecretion of IL-1β in PBMCs induced by LPS in a dose-dependent manner (Fig. 2L, S3R), illustrating its broad-spectrum NLRP3 inhibitory effect across different cell types. To further validate the role of bigelovin in inflammasome activation in vivo , we employed the murine silicosis model, an NLPR3-dominant disease model ( 24 ) (Fig. 3A). Our result revealed that administering bigelovin at a dosage of 1 mg/kg dramatically enhanced survival rates, from 62.5–87.5%; whereas the positive control nintedanib was less effective, even at a higher dosage of 100 mg/kg (Fig. 3B). In the measurement of pro-inflammation cytokines, it was evident that IL-1β levels were markedly reduced in the bigelovin-treated cohorts (Fig. 3C). Histopathological analysis of alveolar tissues from the model and treatment groups revealed less lung tissue damage, characterized by reduced infiltration of septal mononuclear cells, lymphocytes, alveolar macrophages, neutrophils, and diminished alveolar edema (Fig. 3D-E). Furthermore, bigelovin effectively curtailed collagen accumulation, as indicated by the staining of α-SMA and collagen I (Fig. 3F-G). Immunoblotting analysis for caspase-1 corroborated these observations, illustrating that bigelovin significantly impeded the cleavage of caspase-1, and activation of the NLRP3 inflammasome in a dose-dependent manner (Fig. 3H, Fig. S4 A). Besides, we also determined the NLRP3 inflammasome inhibitory role in dextran sulfate sodium (DSS)-induced colitis. In our results, bigelovin markedly inhibited the weight loss and DAI of mice induced by DSS in a dose-dependent manner (Fig. 3I, Fig. S4 B). In addition, colon shortening was also inhibited by bigelovin (Fig. 3J). Histological analysis and qRT-PCR analysis also revealed that bigelovin treatment reduced the destruction of the intestinal epithelium and infiltration of immune cells (Fig. 3K, Fig. S4 C-E). To date, the level of IL-1β in the colon was also decreased by bigelovin, suggesting the inhibitory effect of bigelovin on the NLRP3 inflammasome in vivo (Fig. 3L). Collectively, these findings exhibited that bigelovin could block the activation of NLRP3 inflammasome in vivo and mitigate the severity of silicotic and colitis mice. Bigelovin reduces LPS-induced acute respiratory distress syndrome Considering the pivotal role of the NLRP3 inflammasome in ARDS, we next focused on whether bigelovin could prevent or mitigate ARDS in mice. Prior studies have shown that LPS administration could trigger the production of pro-inflammation cytokines such as IL-1β, IL-6, and TNF-α, and the recruitment of inflammatory cells like macrophages and neutrophils into the lungs, which further leads to damage to the pulmonary vascular endothelium, interstitial edema, recruitment of into innate immune cell the septa and alveolar space, resulting in the thickening of alveolar walls and secondary collagen deposition. In our study, mice were given vehicle or two different doses of bigelovin (0.01 and 0.1 mg/kg) via intraperitoneal injection for three days with the final dose administrated half an hour prior to the LPS challenge. Our observations indicated the treated groups showed a dose-dependent reduction in septal thickening and infiltration of monocytic cells into the bronchioles, vascular bed, and lung parenchyma. Notably, a dosage of as low as 0.1 mg/kg was sufficient to confer robust protection (Fig. 4A-C, S5A-G). Furthermore, this treatment approach significantly decreased the levels of caspase-1 (Fig. 4D, S5L). In our continued investigation of the therapeutic potential of bigelovin, we administered the same dosages (0.1 and 1 mg/kg) into the LPS-induced ARDS mice at 30 minutes and 24 hours post-LPS challenge. It was found that both respiratory symptoms and pro-inflammatory cytokine levels were alleviated, matching the efficacy of prophylactic treatment (Fig. 4E-I, S5H-I). To account for the differences in the administrative routes, we further examined the preventive effect of bigelovin orally. While a dose of 0.1 mg/kg yielded a modest protective effect, increasing the dose to 1 mg/kg significantly enhanced protection compared to the injection method (Fig. 4J-L, S5J-K). These data together demonstrated that bigelovin treatment can prevent and mitigate LPS-induced ARDS in mice. Further assessment of bigelovin's biosafety, up to 10 mg/kg dosage i.g. for thirty days indicated no toxic side effects in mice (Fig. S6 A-F). Bigelovin prevents the assembly of NLRP3 inflammasome induced by the oligomerization of NLRP3 In the selective analysis, we assessed bigelovin's inhibitory effects on other inflammasomes, such as AIM2 and NLRP1. The result showed that bigelovin did not impact the activation of AIM2 inflammasome induced by poly(dA:dT) and NLRP1 inflammasome activated by MDP, suggesting that bigelovin specifically inhibited NLRP3 inflammasome activation (Fig. 5A-B). We then shift our attention to the inhibitory mechanism of bigelovin on the NLRP3 inflammasome by detecting the priming and activation stage of the NLRP3 inflammasome complex. The results showed that bigelovin could not inhibit NF-κB activation and LPS-induced transcription of Nlrp3 , Il1b , Tnfa , and Il6 at valid concentrations (0.03–0.3 µM) in BMDMs before LPS treatment (Fig. 5C, Fig. S7 A-F). Additionally, bigelovin did not affect the expression of the components of the NLRP3 inflammasome machinery (Fig. 5C, Fig. S7 B). Bigelovin strongly inhibited the IL-1β production in BMDMs regardless of the sequence of the LPS challenge, whereas had a minor effect on TNF-α production (Fig. 5D-E). Collectively, these results illustrated that bigelovin did not affect Toll-like receptor signaling or NLRP3 priming at the doses. Since bigelovin was ineffective in the upstream event leading to NLRP3 inflammasome activation, such as K + efflux and Ca 2+ influx, the damage to lysosome and mitochondria (Fig. 5F-J), we questioned whether it acted potential role in the assembly of NLRP3 inflammasome. Initial assessments of bigelovin's impact on the oligomerization of ASC and NLRP3 revealed a strong inhibition of this process at a concentration of 0.3 µM in ATP-stimulated BMDMs (Fig. 6A-B). Furthermore, immunoprecipitation studies showed that bigelovin significantly blocked the endogenous interaction between NLRP3 and its partners NEK7/ASC (Fig. 6C-F). To characterize its specific role within the NLRP3 inflammasome assembly, we examined the ATP-induced exogenous interaction between NLRP3 and NEK7/ASC, as well as the self-interaction of ASC and NLRP3 in HEK293T cells. Treatment with 0.3 µM bigelovin did not alter the exogenous interaction between NLRP3 and NEK7/ASC, nor the self-interaction of ASC. However, it significantly blocked the self-oligomerization of NLRP3 in HEK293T cells (Fig. 6G-N). These findings suggested that bigelovin disrupted the assembly of NLRP3 inflammasome by specifically targeting the oligomerization of NLRP3. Bigelovin directly binds to the RACK1 protein Due to the presence of α,β-unsaturated lactone/ketone in the structure of bigelovin, we suspect the compound may form a covalent bond with a potential target related to the process of NLRP3 assembly. To find a proper position for installing the pull-down tag, we screened the inhibitory effect on IL-1β among various bigelovin analogs. The results showed a significant reduction in potency when the α,β-unsaturated lactone at C 12 -C 14 position, was reduced, pointing to covalent inhibition at a cysteine residue containing in its molecular target. Removal and substitution of the acetyl group at the C 6 position also deteriorated the inhibitory activity (Fig. S8 A-B). Unfortunately, the introduction of a click chemistry handle to compound 5 resulted in a more than 10-fold drop in its activity (46 nM vs. 627 nM, Fig. S3 C and S7C), hindering the progress of our target identification efforts using the AfBPP method. Consequently, we decided to use the isoTOP-ABPP analysis, a cysteine-specific chemoproteomic approach for the target search ( 19 ) (Fig. 7A). In the cysteinome of BMDM cells, we identified 1657 bigelovin-modified cysteines presented across three biological replicates. Only cysteines belonging to four proteins (RACK1, SASH1, GBP4, AGFG2) met the threshold according to the literature, exhibiting a more than twofold increase in the ratio between the control and bigelovin-treated groups, with a p -value of less than 0.1 (Fig. 7B). To refine our target search, we utilized CETSA to verify the interaction between bigelovin and specific proteins. The thermostability of SASH1, GBP4, and AGFG2 proteins remained unchanged in the presence of bigelovin (Fig. 7C-D, S9A-C). In contrast, the RACK1 protein, which significantly degraded at 49℃, exhibited increased thermostability when treated with bigelovin in BMDMs (Fig. 7F, S9E). Strikingly, bigelovin maintained the stability of RACK1 in a dose-dependently manner (Fig. 7E, Fig. S9 D). Mass spectrometry data confirmed that bigelovin directly binds to the Cys168 residue of RACK1. This was further substantiated by overexpressing WT-RACK1 and the RACK1 (C168A) mutant in HEK293T cells, where bigelovin stabilized the WT-RACK1 protein but not the mutant form (Fig. 7G-H). Moreover, this binding was consistent in peritoneal macrophages from mice treated with bigelovin (0.1 mg/kg), showing similar stabilization effects (Fig. 7I, S9F). To quantify the interaction of between bigelovin and RACK1, surface plasmon resonance (SPR) analysis was conducted, revealing a K D value of 0.22 µM (Fig. 7J). Computational docking of bigelovin with RACK1 further supported the formation of a covalent bond at the Cys168 residue, in which surrounding residues (Ser152, Ser167, and Val166) may stabilize the molecule-protein complex through non-covalent interactions (Fig. 7K). Bigelovin blocks NLRP3 inflammasome activation mainly via inhibition of RACK1 Considering RACK1's necessity for maintaining the active conformation of NLRP3 ( 25 ), we hypothesized that bigelovin inactivated NLRP3 inflammasome by targeting RACK1. Consistent with our hypothesis, bigelovin treatment prevented NLRP3 antibodies from fully precipitating RACK1 in BMDMs (Fig. 8A-B). A similar inhibitory result was observed in HEK293T cells using GFP and FLAG-tagged proteins (Fig. 8C-D). To determine whether the covalent binding of bigelovin to RACK1 was responsible for the inhibition of NLRP3 activation, wild-type and C168A-mutated RACK1 were co-transfected with NLRP3 into HEK293T cells, respectively. Immunoprecipitation showed that while both forms of RACK1 interacted with NLRP3, the mutant RACK1-NLRP3 interaction remained unaffected by bigelovin (Fig. 8E-F). Moreover, bigelovin treatment blocked NLRP3 oligomerization mediated by wild-type RACK1 but had a minimal impact on the NLRP3-NLRP3 interaction mediated by mutant RACK1 (Fig. 8G-H). In our final experiment, we utilized an LPS-induced ARDS model to elucidate the connection between RACK1 inhibition and NLRP3 inflammasome activation. By administering a siRNA cocktail via tail vein injection using the jetPET system, we observed that si- Rack1 treatment led to a decrease in RACK1 expression in the lungs, which correspondingly mitigated the severity of ARDS (Fig. 8I-K, Fig. S10 A-D). Specifically, si- Rack1 remarkably suppressed the expression of activated caspase-1 and the production of IL-1β in the lung compared to si-control groups, indicating an inhibition of NLRP3 inflammasome activation (Fig. 8I, Fig. S10 D). In contrast, the production of IL-6 was not affected in all groups (Fig. 8J). Consistently, the secretion of IL-1β was not alter by bigelovin treatment in the si- Rack1 group but diminished by bigelovin treatment alone (Fig. 8K, Fig. S10 D). These findings collectively indicate that bigelovin serves as a covalent inhibitor of RACK1, thereby preventing the activation of the NLRP3 inflammasome mediated by RACK1 in vivo . Discussion ARDS is a prevalent and severe clinical condition that develops high mortality but lacks of effective therapy in facing infectious pandemics such as COVID-19 ( 26 ). Recent studies, including our work herein, have recognized the abnormal accumulations of IL-1β and its producer NLRP3 inflammasome in the collected samples from ARDS patients ( 27 , 28 ). Although antagonistic therapy of IL-1β and its receptor have been entered the clinic for decades, the overall efficacy could be compromised because multiple pro-inflammatory mediators except IL‑1β could be over-produced by NLRP3 ( 29 , 30 ). On the other hand, side effects such as high risks of upper respiratory infection and pneumonia are common in the patients administrated with IL-1β antagonists. Thus, pharmacological inhibition of NLRP3 inflammasome activation may provide potent therapeutic effects in diseases with over-inflammatory responses, including ARDS. Several heterocyclic candidates including MCC950 ( 31 ) and OLT1177 ( 32 ), as well as a series of phytochemicals such as oridonin ( 33 ), costunolide ( 34 ), arglabin ( 35 ), were found directly targeting NLRP3. For example, MCC950 directly binds to the Walker B motif within the NACHT domain and blocks ATP hydrolysis ( 31 , 36 ), OLT1177 also directly targets NLRP3 NACHT domain and inhibits its ATPase activity; while oridonin covalently binds with the cysteine 279 in NACHT domain of NLRP3 to inhibit the binding of NLRP3 and NEK7, thereby blocking its assembly and activation. However, the clinical advancement of MCC950 and OLT1177 has been suspended, due to the unexpected side-effect ( 36 ) and less efficacy in phase 2 trials ( 37 ), respectively. The absence of approved drugs casts doubt on the viability of strategies that target NLRP3 directly. It was remarkable that phytochemicals inhibiting of NLRP3 activation possessed a common α -methylene- γ -lactone motif, rendering us question whether other natural sesquiterpene lactones exhibit similar pharmacological activities ( 34 ). Inula helianthus-aquatica , known to enrich such a structure, was identified as the major component in TCM decoctions used to treat respiratory disorders such as bronchitis and asthma ( 22 ). In vivo models of ARDS demonstrated that three sesquiterpene lactones found in the plant, bigelovin, ergolide, and 8epi-helenalin, showed potent preventive and therapeutic effects. Although previous research have also reported their anti-inflammation activity, the mechanisms remained uncertain ( 38 , 39 ). Our research here defined that these compounds inhibit NLRP3 inflammasome activation at nanomolar concentrations, with bigelovin showing the most potent activity in both mouse and human macrophages. According to our results, bigelovin selectively inhibits various forms of NLRP3 inflammasome activation—canonical, noncanonical, and alternative—without impacting other inflammasomes like AIM2 and NLRP1. Two salient insights regarding its anti-inflammatory mechanism featured further notes. (i) The anti-inflammatory activity of bigelovin is concentration-dependent. Figures 2 and 4 illustrate that the concentration required to inhibit NLRP3 inflammasome activation and the subsequent release of IL-1β is significantly lower than that affecting IL-6 and TNF-α production, which is mediated transcriptionally via the NF-κB pathway. This aligns with prior findings that bigelovin suppresses NF-κB activation and pro-inflammatory cytokine production starting at a concentration of 2 µM ( 40 ). Notably, our in vivo model also verified that IL-1β levels were more significantly reduced than IL-6 at equivalent dosages (Fig. 4). (ii) The method and timing of administration influence the therapeutic outcomes in the ARDS mice. While oral administration yielded positive results, pre-LPS challenge injection proved to be the optimal approach for acute inflammation, indicating that the bioavailability of bigelovin is unsatisfactory. Consequently, we infer that administering a low dosage of bigelovin via injection or employing advanced pharmaceutical technologies to target lung tissue, could amplify its therapeutic benefits and minimize side effects in treating NLRP3-related inflammatory lung conditions. This will be the focus of our subsequent lead optimization efforts. In addition, the upstream events in the process of NLRP3 activation, such as K + efflux or Ca 2+ influx, mitochondrial damage and lysosome damage were not interfered by bigelovin intervention. Importantly, our results showed that bigelovin could block the interaction of NLRP3 and NEK7 as well as the interaction of NLRP3 and ASC, and the oligomerization of NLRP3 and the assembly of ASC specks, which are indispensable for NLRP3 inflammasome assembly and activation. Subsequently, we determined that bigelovin inhibited the self-association of NLRP3 by conducting the overexpression experiment in HEK293T cells, revealing that NLRP3 activation mainly through regulation NLRP3 oligomerization at low concentrations. During the activation of the NLRP3 inflammasome, the NACHT domain of NLRP3 plays a pivotal role in its oligomerization and subsequent activation. Although recent cryo-electron microscopy structure studies revealed that NLRP3 was segregated into two distinct oligomeric states, the smaller complex is largely lack of activity. There is no doubt that PAMPs or DAMPs stimuli induce NLRP3 from a closed, auto-inhibited conformation to an active ‘‘open’’ conformation that coincides with its oligomerization ( 41 ). Recent studies using cryo-electron microscopy have revealed that the NACHT domain of NLRP3, also known as NOD, transitions from a closed, auto-inhibited, ADP-bound inactive state to an open, ATP-bound active state before its oligomerization and subsequent activation ( 9 ). NEK7 was successfully identified as a chaperones inserts into the leucine-rich repeat (LRR) domain, releasing the nucleotide-binding domain (NBD) and facilitating nucleotide exchange. However, NEK7 alone is not sufficient to conduct such large conformational changes, as ADP remains bound to the NBD in the NLRP3-NEK7 complex ( 41 ). RACK1, was discovered to be another binding partner interacts wih the NLRP3-NEK7 complex at the NACHT region, independently of its activated protein kinase C (PKC) kinase activity. Although further structural insights into the conformational changes are required, knockdown and bioluminescence resonance energy transfer (BRET) experiments have helped delineate the conformational transition of NLRP3 in response to RACK1. Our study is the first to illustrate that bigelovin acts as a Michael receptor, forming a covalent bond with Cys168 on RACK1, which significantly inhibits its interaction with NLRP3, thereby hindering activation. Wild-type or mutant RACK1 revealed that cysteine 168 is the key residue in the interaction between RACK1 and NLRP3, providing structural insight into how RACK1 mediated the self-interaction of NLRP3. We also sought to corroborate the mechanism of biglovin in the ARDS mouse model. Despite the fact that that complete deletion of RACK1 is lethal for early embryonic development, treatment with siRNA showed that Rack1 knockdown remarkably attenuated caspase-1 activation and IL-1β secretion in the lung tissue, whereas the production of IL-6 was less affected. Following our finding, the secretion of IL-1β in alveolar macrophages in vivo was no longer altered by bigelovin administration in the Rack1 knockdown group, which validated the molecular mechanism of RACK1 and NLRP3 activation as well as the accuracy of cysteinomic ABPP method in the target identification. Indeed, tail vein injection of siRNA by the jetPET system is generalized to reduce target protein. We could not exclude that RACK1 inhibition in the cells other than alveolar macrophage took effect in reducing over-inflammation. Finally, covalent inhibitors have been confronted with safety concerns due to the presence of Michael acceptor. However, bigelovin only tackled four different proteins with statistical significance in the cysteinome of BMDMs, illustrating the structure may be stable to most bioactive cysteine residues in the concentration range effective to Rack1. The in vivo study also proved bigelovin exhibited no toxicity at a 100-fold dose (10 mg/kg, i.g.) compared to its positive dose in mice (0.1 mg/kg, ig). Materials and Methods Mice C57BL/6J mice (male, 6–8 weeks) were purchased from Gempharmatech Co., Ltd. (Nanjing, Jiangsu, China). All mice experiments were conducted following the Guide for the Care and Use of Laboratory Animals (Ministry of Science and Technology of China, 2006) and were approved by the Animal Ethics Committee of Nanjing University of Chinese Medicine. Cell culture Human Peripheral Blood Mononuclear Cell (PBMCs) were isolated from healthy volunteers this study were approved by the Institutional Research Ethics Committee of Jiangsu Provincial Hospital of Chinese Medicine (Approved Number: 2021NL-095-02). Bone marrow-derived macrophages (BMDMs) were cultured in RPMI 1640 medium supplemented with 20% L929 supernatant. PBMCs, L929 cells (ATCC), THP-1 cells (ATCC) were cultured in RPMI 1640 and HEK293T cells (ATCC) were cultured in DMEM, all medium were supplemented with 10% fetal bovine serum, and 1% Penicillin/Streptomycin. And cells were cultured in a constant humidity incubator with 5% CO 2 at 37°C. Antibodies and reagents Anti-NLRP3 (Adipogen, AG-20B-0014-c100), Anti-Caspase-1 + p10 + p12 (Abcam, ab179515), Anti-IL-1β + p17 (Abcam, ab234437), Anti-Asc (Adipogen, AG-25B-0006-c100), Anti-Phospho-NF-kappaB p65 (Abmart, TP56372F), Anti-NF-кB p65 (Abmart, T55034F), Anti-β-actin (Abmart, T401045), Anti-GAPDH (Abmart, P60037), Anti-β-tublin (Abmart, M20005), Anti-FLAG (Abmart, M20008), Anti-HA (Abmart, M20003), Anti-GFP (Santa Cruz, sc-9996), Anti-RACK1 (Huabio, ET7109-04), Anti-SASH1 (Bioss, bs-6099R), Anti-AGFG2 (UpingBio, YP-Ab-04108), Anti-GBP4 (Abmart, PA5012), Anti-FITC-ly6G (Biolegend, 127605), Anti-APC-F4/80 (Biolegend, 123116), Anti-Collagen Type Ⅰ (Proteintech, 14695-1-AP), Anti-Smooth muscle actin (Proteintech, 14395-1-AP), Goat anti-mouse IgG (Abbkine, A21010), Goat anti-rabbit IgG (Abbkine, A21020). Recommended concentrations were used for all antibodies. Lipopolysaccharides (LPS, Sigma, L4391), Adenosine triphosphate (ATP, Aladdin, A100885), Uric acid sodium salt (MSU, Sigma, U2B75), Nigericin (Shanghai Yuanye Bio-Technology, S25116), Pam3CSK4 (Invitrogen, tlrl-pms), Muramyl Dipeptide (MDP, Absin, abs45126715), Poly(dA:dT) (Invitrogen, tlrl-patn), PMA (Sigma, P1585), MCC950 (TargetMOI, XSD20220316-00020), Dexamethasone (Dex, Sigma, D4902), Nintedanib (Meilunbio, MB7360). Chemistry The dried flowers of Inula helianthus aquatilis C. Y. Wu ex Y. Ling were added to 10 times the amount of 70% ethanol and cold-soaked for 2 h, followed by 3 rounds of reflux extraction for 2 h each. The filtrate was then combined and subjected to column chromatography using macroporous resin D101 with a gradient elution of 30%-90% ethanol. The components were tracked by HPLC, enriching the sesquiterpene lactone fraction, which was then quantified for subsequent activity evaluation. The dried flowers of Inula helianthus aquatilis C. Y. Wu ex Y. Ling (300 g) were extracted under reflux with PE (3 L × 2 h, three times). After removal of the PE in vacuo, the combined extract (15 g) was subjected to silica gel column chromatography (PE/EA, 200:1→2:1), monitoring by thin layer chromatography. The extract was chromatographically separated on a silica gel column and eluted with PE-EA to obtain ergolide (430 mg), bigelovin (153 mg), and 8-epi-helenalin (150 mg). Single-cell RNA Sequencing (scRNA-seq) analysis PBMC Sample A dataset of scRNA-seq (GSE175450) was collected from the Tumor Immune Single-cell Hub (TISCH) database ( 42 ). The standard workflow for processing scRNA-seq data was performed using the R package “Seurat V4" ( 43 ). We used the Uniform Manifold Approximation and Projection (UMAP) coordinates and annotation information provided by TISCH and visualized them with the "plot1cell" package ( 44 ). The expression of genes and gene signatures was described by the “scRNAtoolVis” package( 45 ). BALF Sample Using cell type-specific marker gene expression analysis, cell types were distinguished from the scRNA-seq data. The R packages ‘celldex’ and ‘SingleR’ were used to classify the immune cell populations, including but not limited to T cells, B cells, natural killer cells, dendritic cells, and monocytes. Each immune cell type was identified based on its known marker genes and characterized by its distinct gene expression signature using the ‘MonacoImmuneData’ reference index, which contains normalized expression values of 114 bulk RNA-seq samples derived from sorted immune cell populations, enabling high-resolution profiling of immune cell transcriptome ( 46 ). Inflammasome stimulation ( 47 ) Canonical NLRP3 inflammasome was activated as follows: BMDMs were primed with LPS (100 ng/mL) for 3 h and treated with bigelovin for 1 h, followed by ATP (5 mM) for 45 min, nigericin (5 µM) for 45 min, and MSU (500 µg/mL) for 12 h. For noncanonical NLRP3 activation, the cells were primed with Pam3CSK4 (500 ng/mL) for 3 h and treated with bigelovin for 1 h. After that, LPS (2 µg) were transfected into BMDMs using Lipofectamine 3000 (Invitrogen, L3000015) for 24 h. For alternative NLRP3 activation, PBMCs were treated with bigelovin for 1 h and then stimulated with LPS (100 ng/mL) for 16 h. Other inflammasomes were stimulated as follows: For NLRP1 inflammasome activation, BMDMs were primed with LPS (100 ng/mL) for 3 h and treated with bigelovin for 1 h. Subsequently, the cells were stimulated with MDP (10 µg/mL) for 24 h. AIM2 inflammasome activation was obtained by transfection of 2 µg poly(dA:dT) using Lipofectamine 3000 (Invitrogen, L3000015) for 6 h. THP-1 cells were primed with PMA (500 nM) for 3 h and then treated with bigelovin for 1 h after stimulated with LPS (100 ng/mL) for 3 h. Subsequently, the cells were stimulated with ATP (5 mM) for 45 min. Enzyme-linked immunosorbent assay (ELISA) The ELISA experiments producure has been described previously( 18 ). Cell counting kit 8 (CCK-8) The CCK-8 assasy has been described previously( 18 ) . Lactate dehydrogenase assay (LDH) BMDMs were seeded in 24-well plates overnight and stimulated with 100 ng/mL LPS for 3 h, treated with bigelovin at the indicated concentrations for 1 h. After that, stimulated with 5 mM ATP for 45 min, LDH release was detected by the LDH Cytotoxicity Assay Kit (Beyotime, C0016) following the manufacturer’s instructions. Western blot and co-immunoprecipitation The protocols for immunoprecipitation and co-immunoprecipitation assay has been described previously( 48 , 49 ) Quantitative real-time PCR ( qRT-PCR ) The protocols for qRT-PCR has been described previously( 48 ). The primer sequences used in the study were described below: Gapdh MusFor: CATCACTGCCACCCAGAAGACTG Gapdh MusRev: ATGCCAGTGAGCTICCCGITCAG Il1b MusFor: TGGACCTTCCAGGATGAGGACA Il1b MusRev: GTTCATCTCGGAGCCTGTAGTG Il6 MusFor: TACCACTTCACAAGTCGGAGGC Il6 Mus Rev: CTGCAAGTGCATCATCGTIGTTC Tnfa MusFor: CGTGCCTATGTCTCAGCCTCTT Tnfa MusRev: GCCATAGAACTGATGAGAGGGAG Rack1 MusFor: TCCTCTGATGGTCAGTTTGCCC Rack1 MusRev: CACGCTCAACACATCCTTGGTG ASC oligomerization assay The assay for ASC oligomerization has been described previously ( 18 ). NLRP3 oligomerization assay ( 50 ) BMDMs were stimulated by ATP (5 mM) as described above. The cells were collected and resuspended in HEPES, subjected to 20 strokes of homogenization using a syringe, followed by centrifugation at 4°C, 900 g for 8 minutes to remove cell nucleus and unbroken cells. After centrifugation at 6200 g for 8 min, supernatants were discarded and the pellets were resuspended in 200 µL of HEPES. DSS (2 mM) was incubated at room temperature for 1 h for cross-linking and then was dissolved in the sample buffer. And Western blotting was performed for detection of NLRP3 oligomerization. Intracellular Ca 2+ and K + measurement BMDMs after stimulation were washed with PBS. After digestion by pancreatic enzymes, the cells were centrifuged and washed again. Subsequently, BMDMs were incubated with Fluo-4 AM (2 µM) (Beyotime, S1060) for 30 min at 37°C. After centrifugation, the samples were resuspended in 300 µL PBS and incubated for 30 min at 37°C once more and subsequently analyzed by flow cytometry on Beckman Coulter Gallios. BMDMs were incubated with ION Potassium Green-2 AM (10 µM) (Abcam, ab142806) for 15 min at 37°C and then stimulated with 5 mM ATP for 45 min. The levels of intracellular K + were determined by flow cytometry on Beckman Coulter Gallios. Measurement of lysosome rupture BMDMs after stimulation were washed with RPMI 1640 medium once. The cells were loaded with Lyso-Tracker Red (1 µM) (Solarbio, L8010) for 30 min at 37°C. After that, the cells were digested by pancreatic enzymes before centrifugation and washed with PBS once. The samples were analyzed by flow cytometry after resuspending in 200 µL PBS. Measurement of mtROS BMDMs were stimulated by ATP as previously described. Then, the cells were washed twice with PBS and incubated with DCFH-DA (10 µM) (Beyotime, S0033) for 30 min at 37°C. After centrifugation, the samples were resuspended in 200 µL PBS after rinsing and subsequently analyzed by flow cytometry. Confocal microscopy BMDMs after stimulation were incubated with Mito-Tracker Red CMXRos (200 nM) (Beyotime, C0135) for 30 min before sample collection. The cells were washed twice with PBS and fixed with 4% PFA for 30 min at room temperature. Then, the cells were washed three times by PBST and stained with DAPI (Beyotime, C1005) for 10 min. Subsequently, the cells were washed three times by PBST again. Confocal microscopy analysis was analyzed by fluorescence microscope on Lecia TCS SP8. Plasmid transfection Plasmids of FLAG-NLRP3, GFP-NLRP3, FLAG-NEK7, FLAG-ASC, GFP-ASC, GFP-Vector, GFP-RACK1, GFP-RACK1 C168A were manufactured by General Biotechnology (Hefei, China). DNA of plasmids were transfected to HEK293T using Lipofectamine 3000 for 24 h, then cells were treated with bigelovin for another 24 h for co-immunoprecipitation assays. isoTOP-ABPP Cysteine Chemoproteomic Profiling The BMDMs were with (100 ng/mL) LPS for 3 h, then 1 µM bigelovin or the corresponding concentration of the DMSO was added. Cells steady at 37℃ for 1 h before lysis with PBS. Protein concentration was determined with BCA assay and the concentration was adjusted to 1 µg/µL with PBS. For biological replicates, two aliquots of 1 mL cell lysates were prepared. Each aliquot was treated with 100 µM IA-alkyne at room temperature (RT) for 1 h The click reaction reagent containing 60 µL 0.9 mg/mL TBTA (in 4:1 tBuOH/DMSO), 20 µL 12.5 mg/mL CuSO 4 (in H 2 O), 20 µL 13 mg/mL TCEP (in H 2 O) and 20 µL 5 mM light isoDTB tags (DMSO) or heavy isoDTB tags (bigelovin) were prepared. Samples were treated with 120 µL click reaction reagent at RT for 1 h. After incubation, the light and heavy labeled samples were combined and precipitated with cold acetone. Protein precipitates were washed with methanol and dissolved followed by enrichment with streptavidin agarose beads. After reduction and alkylation, on-bead digestion was performed with 10 ng/µL trypsin at 37℃ overnight. The beads were washed and then peptides attached to the beads were eluted with 0.1% formic acid in 50% acetonitrile in water. Peptides were analyzed on a Q Exactive Plus with an EASY-nLC 1200 system. Samples were separated at a flow rate of 300 nL/min using the following gradient: 2–5% buffer B (80% acetonitrile with 0.1% formic acid in H 2 O) in buffer A (0.1% formic acid in H 2 O) for 2 min, followed by a gradient from 5%-32% B for 76 min, 32%-45% buffer B for 5 min, 45%-100% B for 2 min and holding at 100% B for 2 min. Column temperature was maintained at 50℃. The scan range of MS1 was 300-1,700 m/z with a resolution of 70,000 (at 200 m/z), with an AGC target of 3×10 6 and a maximum injection time of 50 ms. The top 20 precursors were selected for MS/MS analysis with a resolution at 17,500 (at 200 m/z), AGC target 1×10 5 , and a maximum injection time of 100 ms. The isolation window of precursors was 2 m/z. Normalized collision energy was set at 27 eV with a 30 s dynamic exclusion window. Data analysis for the isoTOP-ABPP assay was carried out as described previously ( 19 ). Cellular thermal shift assay (CETSA) ( 49 ) The BMDMs were incubated with bigelovin (300 µM) or DMSO for 1 h. Harvested cells were frozen and thawed three times by liquid nitrogen. The proteins were separated from cells by centrifuging at 15,000 g for 10 min at 4 ℃. Subsequently, the supernatant was equally divided into 6 parts and heated for 3 min at different temperatures and detected protein level by immublotting. C57BL/6 mice were injected intraperitoneally bigelovin (0.1 mg/kg) for three consecutive days, and then peritoneal macrophages were harvested to CETSA in vivo . Surface Plasmon Resonance (SPR) The binding affinity between bigelovin and recombinant human RACK1 protein (Biorbyt, orb754920) was assayed using a GE Biacore T200 instrument. RACK1 protein was loaded to the CM5 sensor chip (Cytiva, 2205-4643-AE). The concentration gradient bigelovin was prepared with running buffer (1×PBS-P, 5% DMSO), and flowed over the chip. The parameters of SPR used in the study were described below: flow rate, 30 µL/min; temperature, 25°C; association time, 60 s; disassociation time, 120 s. The equilibrium dissociation constant ( K D ) was calculated using Biacore T200 Evaluation Software. Molecular docking The protein structure of RACK1 (UniProt ID: D6RBD0) was derived from the AlphaFold Protein Structure Database ( https://alphafold.ebi.ac.uk/ ) and prepared by Schrödinger 2019 protein wizard module. The amino acid sequence in D6RBD0 was renumbered based on the sequence utilized in the constructed plasmid transfected into the cells. Bigelovin was processed using the LigPrep module and docked using the covalent dock module in the Schrödinger 2019. During the setup process, the reaction type was selected as Michael addition and the scoring function was set to Extra Precision. LPS-induced mice ( 51 ) To assess the preventive effect, C57BL/6J mice were injected intraperitoneally fractions (0.1 or 1 mg/kg), bigelovin (10 or 100 µg/kg), vehicle, dexamethasone (5 mg/kg) for three consecutive days. Thirty minutes after the last dose, 7.5 mg/kg LPS (Sigma, L2630) was injected intraperitoneally. The serum, BALF and lung tissues were collected after 12 h, and inflammatory cytokines were measured by qRT-PCR or ELISA. The number of cells in the BALF was counted, and the number of macrophages (F4/80 + cells) and neutrophils (Ly6G + cells) in the BALF were analyzed by flow cytometry. Lung samples were collected 24 h after LPS administration and fixed in 4% paraformaldehyde for histopathological evaluation. The prophylactic effect of oral bigelovin (0.1 or 1 mg/kg) administration was evaluated as described above. To study the therapeutic effect, the mice were injected intraperitoneally 7.5 mg/kg LPS. After 30 minutes, the mice were injected intraperitoneally fractions (0.1 or 1 mg/kg), bigelovin (10 or 100 µg/kg), vehicle, and dexamethasone (5 mg/kg). The mice were euthanized 24 h later. At the experimental endpoint, serum and lungs were collected for detection of mRNA, protein, or pathological damage. Biosafety evaluation C57BL/6J mice were intragastric administration of bigelovin (1 mg/kg, 10 mg/kg) for thirty consecutive days. The weight and overall condition of the mice were monitored throughout the experiment. On day 30, the mice were euthanized, and liver, heart, spleen, lung, kidney, and colon tissues were collected for subsequent analysis. RACK1 knockdown in vivo ( 25 ) The siRNAs (si Control : 5´-UUCUCCGAACGUGUCACGUTT-3´; si RACK1 : 5´-GUAGAUGAAUUGAAGCAAGTT-3´) were synthesized by General Biotechnology (Hefei, China). C57BL/6J mice were intravenously injected with siRNA (80 µg per mouse) using in vivo -jetPEI (Polyplus, 101000030), followed by intraperitoneal injection of 7.5 mg/kg LPS 48 h later, and then the mice were injected intraperitoneally bigelovin for 12 h. The lung tissues were collected for the further assay. SiO 2 -induced mice ( 52 ) C57BL/6J mice were randomly divided into five groups, including normal, model, bigelovin (intraperitoneal injection of 0.1 mg/kg, 1 mg/kg), and positive control group treated with nintedanib (intragastric administration of 100 mg/kg). The SiO 2 (Sigma, S5631) suspension (300 mg/kg) was injected into the trachea of mice, and the control group was injected with physiological saline. Seven days after SiO 2 treatment, mice were injected intraperitoneally with bigelovin or given nintedanib by gavage for 14 consecutive days. On day 21, the mice were euthanized for subsequent analysis. DSS-induced colitis Colitis in mice was induced by 2.5% DSS in drinking water for 7 consecutive days followed by a 2-day tapwater period, according to previous research ( 49 ). The bigelovin at the dose of 0.01, 0.1 mg/kg was given intraperitoneally once a day for 7 days during DSS administration. The solvent was given intraperitoneally to both sham and model groups as vehicle control. Immunohistochemistry Formalin-fixed, paraffin-embedded tissues from mice were stained with Anti-Collagen Type Ⅰ antibody and Anti-Smooth muscle actin as previously described ( 48 ). Statistical analysis Statistical analyses were performed using GraphPad Prism 8.0.1. All data were analyzed by two-tailed t -tests or one-way ANOVA (clinical samples) as appropriate, and p < 0.05 was considered statistically significant. Declarations Data availability The raw data and search files have been deposited to the iProX and can be accessed with the dataset identifier PXD053000. Conflicts of interest The authors have no conflicts of interest. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (82204401, U2102201, 82073719), the Key Industrial and Research Program of Jiangsu Provincial “333 Talent” (No. 2022-2-245), the Research Projects of Jiangsu Higher Education (No.22KJB3310012), the support project of the National Natural Science Foundation of China from Nanjing University of Chinese Medicine (XPT82204401), Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX21_1787). Author contributions JC, MY and L-H H conceived the research; JC, MY , C-L Y, Y-N Z and L-H H designed the methodology; JC and MY, YG, AP, Q-X Y, X-M P and A-Y W performed the experiments; JC, MY, Y-N Z wrote the original draft of the manuscript; JC, Y-NZ and L-H H reviewed and edited the manuscript; JC, Y-NZ and L-H H were involved in acquiring funding; JC, H-D Z, Y H, YW H, and QW were involved in obtaining resources; Y W and J-P L were involved in single cell sequencing analysis, Z-C J contributed to molecular docking, JC, Y-NZ and L-H H supervised the study. All authors gave final approval of the submitted and published versions of the manuscript. References N. J. Meyer, L. Gattinoniand, C. S. Calfee, Acute respiratory distress syndrome. Lancet. 398, 622–637 (2021). L. D. J. Bosand, L. B. Ware, Acute respiratory distress syndrome: causes, pathophysiology, and phenotypes. Lancet. 400, 1145–1156 (2022). M. A. Matthay, R. L. Zemans, G. A. Zimmerman, Y. M. Arabi, J. R. Beitler, A. Mercat, M. Herridge, A. G. Randolphand, C. S. Calfee, Acute respiratory distress syndrome. Nat Rev Dis Primers. 5, 18 (2019). N. SinhaandA, K. Thakur, Likelihood of amyloid formation in COVID-19-induced ARDS. Trends Microbiol. 29, 967–969 (2021). S. Nye, R. J. Whitleyand, M. Kong, Viral infection in the development and progression of pediatric acute respiratory distress syndrome. Front Pediatr. 4, 128 (2016). K. Peukert, M. Fox, S. Schulz, C. Feuerborn, S. Frede, C. Putensen, H. Wrigge, B. M. Kummerer, S. David, B. Seeliger, T. Welte, E. Latz, D. Klinman, C. Wilhelm, F. Steinhagenand, C. Bode, Inhibition of caspase-1 with tetracycline ameliorates acute lung injury. Am J Respir Crit Care Med. 204, 53–63 (2021). A. C. Ferreira, V. C. Soares, I. G. de Azevedo-Quintanilha, S. D. S. G. Dias, N. Fintelman-Rodrigues, C. Q. Sacramento, M. Mattos, C. S. de Freitas, J. R. Temerozo, L. Teixeira, H. E. Damaceno, E. A. Barreto, CRR Pao, L. Palhinha, M. Miranda, D. C. Bou-Habib, F. A. Bozza, P. T. Bozzaand, T. M. L. Souza, SARS-CoV-2 engages inflammasome and pyroptosis in human primary monocytes. Cell Death Discov. 7, 43 (2021). Q. Ma, Pharmacological inhibition of the NLRP3 inflammasome: structure, molecular activation, and inhibitor-NLRP3 interaction. Pharmacol Rev. 75, 487–520 (2023). L. Xiao, V. G. Magupalliand, H. Wu, Cryo-EM structures of the active NLRP3 inflammasome disc. Nature. 613, 595–600 (2023). T. Tang, X. Lang, C. Xu, X. Wang, T. Gong, Y. Yang, J. Cui, L. Bai, J. Wang, W. Jiangand, R. Zhou, CLICs-dependent chloride efflux is an essential and proximal upstream event for NLRP3 inflammasome activation. Nat Commun. 8, 202 (2017). G. S. Lee, N. Subramanian, A. I. Kim, I. Aksentijevich, R. Goldbach-Mansky, D. B. Sacks, R. N. Germain, D. L. Kastnerand, J. J. Chae, The calcium-sensing receptor regulates the NLRP3 inflammasome through Ca 2+ and cAMP. Nature. 492, 123–127 (2012). A. Akbal, A. Dernst, M. Lovotti, M. S. J. Mangan, R. M. McManus, E. Latz, How location and cellular signaling combine to activate the NLRP3 inflammasome. Cell Mol Immunol. 19, 1201–1214 (2022). C. Guo, Z. Chi, D. Jiang, T. Xu, W. Yu, Z. Wang, S. Chen, L. Zhang, Q. Liu, X. Guo, X. Zhang, W. Li, L. Lu, Y. Wu, B. L. Songand, D. Wang, Cholesterol homeostatic regulator SCAP-SREBP2 integrates NLRP3 inflammasome activation and cholesterol biosynthetic signaling in macrophages. Immunity. 49, 842–856 (2018). Z. R. Zhang, G. Meszaros, W. T. He, Y. F. Xu, H. d. F. Magliarelli, L. Mailly, M. Mihlan, Y. S. Liu, M. P. Gamez, A. Goginashvili, A. Pasquier, O. Bielska, B. Neven, P. Quartier, R. Aebersold, T. F. Baumert, P. Georgel, J. H. Han, R. Ricci, Protein kinase D at the Golgi controls NLRP3 inflammasome activation. J Exp Med. 214, 2671–2693 (2017). V. G. Magupalli, R. Negro, Y. Tian, A. V. Hauenstein, G. D. Caprio, W. Skillern, Q. Deng, P. Orning, H. B. Alam, Z. Maliga, H. Sharif, J. J. Hu, C. L. Evavold, J. C. Kagan, F. I. Schmidt, K. A. Fitzgerald, T. Kirchhausen, Y. Liand, H. Wu, HDAC6 mediates an aggresome-like mechanism for NLRP3 and pyrin inflammasome activation. Science. 369, eaas8995 (2020). Y. He, M. Y. Zeng, D. Yang, B. Motroand, G. Nunez, NEK7 is an essential mediator of NLRP3 activation downstream of potassium efflux. Nature. 530, 354–357 (2016). K. Nozakiand, E. A. Miao, A licence to kill during inflammation. Nature. 570, 316–317 (2019). Q. Lv, Y. Xing, J. Liu, D. Dong, Y. Liu, H. Qiao, Y. Zhangand, L. Hu, Lonicerin targets EZH2 to alleviate ulcerative colitis by autophagy-mediated NLRP3 inflammasome inactivation. Acta Pharm Sin B. 11, 2880–2899 (2021). P. R. A. Zanon, L. Lewaldand, S. M. Hacker, Isotopically labeled desthiobiotin azide (isoDTB) tags enable global profiling of the bacterial cysteinome. Angew Chem Int Ed Engl. 59, 2829–2836 (2020). C. L. Huang, Y. M. Wang, X. W. Li, L. L. Ren, J. P. Zhao, Y. Hu, L. Zhang, G. H. Fan, J. Y. Xu, X. Y. Gu, Z. S. Cheng, T. Yu, J. A. Xia, Y. Wei, W. J. Wu, X. L. Xie, W. Yin, H. Li, M. Liu, Y. Xiao, H. Gao, L. Guo, J. G. Xie, G. F. Wang, R. M. Jiang, Z. C. Gao, Q. Jin, J. W. Wang, B. Cao, Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 395, 497–506 (2020). M. Lyu, G. Fan, G. Xiao, T. Wang, D. Xu, J. Gao, S. Ge, Q. Li, Y. Ma, H. Zhang, J. Wang, Y. Cui, J. Zhang, Y. Zhuand, B. Zhang, Traditional Chinese medicine in COVID-19. Acta Pharm Sin B. 11, 3337–3363 (2021). K. W. Nam, G. T. Oh, E. K. Seo, K. H. Kim, U. Koo, S. J. Leeand, W. Mar, Nuclear factor kappaB-mediated down-regulation of adhesion molecules: possible mechanism for inhibitory activity of bigelovin against inflammatory monocytes adhesion to endothelial cells. J Ethnopharmacol. 123, 250–256 (2009). P. Georg, R. Astaburuaga-Garcia, L. Bonaguro, S. Brumhard, L. Michalick, L. J. Lippert, T. Kostevc, C. Gabel, M. Schneider, M. Streitz, V. Demichev, I. Gemund, M. Barone, P. Tober-Lau, E. T. Helbig, D. Hillus, L. Petrov, J. Stein, H. P. Dey, D. Paclik, C. Iwert, M. Mulleder, S. K. Aulakh, S. Djudjaj, R. D. Bulow, H. E. Mei, A. R. Schulz, A. Thiel, S. Hippenstiel, A. E. Saliba, R. Eils, I. Lehmann, M. A. Mall, S. Stricker, J. Rohmel, V. M. Corman, D. Beule, E. Wyler, M. Landthaler, B. Obermayer, S. von Stillfried, P. Boor, M. Demir, H. Wesselmann, N. Suttorp, A. Uhrig, H. Muller-Redetzky, J. Nattermann, W. M. Kuebler, C. Meisel, M. Ralser, J. L. Schultze, A. C. Aschenbrenner, C. Thibeault, F. Kurth, L. E. Sander, N. Bluthgenand, B. Sawitzki, Complement activation induces excessive T cell cytotoxicity in severe COVID-19. Cell. 185, 493–512 (2022). V. Hornung, F. Bauernfeind, A. Halle, E. O. Samstad, H. Kono, K. L. Rock, K. A. Fitzgeraldand, E. Latz, Silica crystals and aluminum salts activate the NALP3 inflammasome through phagosomal destabilization. Nat Immunol. 9, 847–856 (2008). Y. Duan, L. Zhang, D. Angosto-Bazarra, P. Pelegrin, G. Nunezand, Y. He, RACK1 mediates NLRP3 inflammasome activation by promoting NLRP3 active conformation and inflammasome assembly. Cell Rep. 33, 108405 (2020). G. Bellani, J. G. Laffey, T. Pham, E. Fan, L. Brochard, A. Esteban, L. Gattinoni, F. van Haren, A. Larsson, D. F. McAuley, M. Ranieri, G. Rubenfeld, B. T. Thompson, H. Wrigge, A. S. Slutsky, A. Pesenti, Epidemiology, patterns of care, and mortality for patients with acute respiratory distress syndrome in Intensive Care Units in 50 Countries. JAMA, 315, 788–800 (2016). S. S. Mahalingam, S. Jayaraman, A. Arunkumar, H. M. Dudley, D. D. Anthony, C. L. Shive, J. M. Jacobsonand, P. Pandiyan, Distinct SARS-CoV-2 specific NLRP3 and IL-1beta responses in T cells of aging patients during acute COVID-19 infection. Front Immunol. 14, 1231087 (2023). P. Pan, M. M. Shen, Z. Y. Yu, W. W. Ge, K. Chen, M. F. Tian, F. Xiao, Z. W. Wang, J. Wang, Y. L. Jia, W. B. Wang, P. Wan, J. Zhang, W. J. Chen, Z. W. Lei, X. Chen, Z. Luo, Q. W. Zhang, M. Xu, G. Li, Y. K. Liand, J. G. Wu, SARS-CoV-2 N protein promotes NLRP3 inflammasome activation to induce hyperinflammation. Nat Commun, 12, 4664 (2021). 4664. C. A. Dinarelloand, J. W. van der Meer, Treating inflammation by blocking interleukin-1 in humans. Semin Immunol. 25, 469–484 (2013). H. J. Lachmann, I. Kone-Paut, J. B. Kuemmerle-Deschner, K. S. Leslie, E. Hachulla, P. Quartier, X. Gitton, A. Widmer, N. Pateland, P. N. Hawkins, Use of canakinumab in the cryopyrin-associated periodic syndrome. N Engl J Med. 360, 2416–2425 (2009). R. C. Coll, A. A. Robertson, J. J. Chae, S. C. Higgins, R. Munoz-Planillo, M. C. Inserra, I. Vetter, L. S. Dungan, B. G. Monks, A. Stutz, D. E. Croker, M. S. Butler, M. Haneklaus, C. E. Sutton, G. Nunez, E. Latz, D. L. Kastner, K. H. Mills, S. L. Masters, K. Schroder, M. A. Cooperand, L. A. O'Neill, A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nat Med. 21, 248–255 (2015). C. Marchetti, B. Swartzwelter, F. Gamboni, C. P. Neff, K. Richter, T. Azam, S. Carta, I. Tengesdal, T. Nemkov, A. D'Alessandro, C. Henry, G. S. Jones, S. A. Goodrich, J. P. St. Laurent, T. M. Jones, C. L. Scribner, R. B. Barrow, R. D. Altman, D. B. Skouras, M. Gattorno, V. Grau, S. Janciauskiene, A. Rubartelli, L. A. B. Joostenand, C. A. Dinarello, OLT1177, a beta-sulfonyl nitrile compound, safe in humans, inhibits the NLRP3 inflammasome and reverses the metabolic cost of inflammation. Proc Natl Acad Sci U S A . 115, E1530-E1539 (2018). H. He, H. Jiang, Y. Chen, J. Ye, A. Wang, C. Wang, Q. Liu, G. Liang, X. Deng, W. Jiangand, R. Zhou, Oridonin is a covalent NLRP3 inhibitor with strong anti-inflammasome activity. Nat Commun. 9, 2550 (2018). H. Xu, J. Chen, P. Chen, W. Li, J. Shao, S. Hong, Y. Wang, L. Chen, W. Luoand, G. Liang, Costunolide covalently targets NACHT domain of NLRP3 to inhibit inflammasome activation and alleviate NLRP3-driven inflammatory diseases. Acta Pharm Sin B. 13, 678–693 (2023). A. Abderrazak, D. Couchie, D. F. Mahmood, R. Elhage, C. Vindis, M. Laffargue, V. Mateo, B. Buchele, M. R. Ayala, M. E. Gaafary, T. Syrovets, M. N. Slimane, B. Friguet, T. Fulop, T. Simmet, K. E. Hadri, M. Rouis, Anti-inflammatory and antiatherogenic effects of the NLRP3 inflammasome inhibitor arglabin in ApoE2.Ki mice fed a high-fat diet. Circulation. 131, 1061–1070 (2015). I. V. Hochheiser, M. Pilsl, G. Hagelueken, J. Moecking, M. Marleaux, R. Brinkschulte, E. Latz, C. Engeland, M. Geyer, Structure of the NLRP3 decamer bound to the cytokine release inhibitor CRID3. Nature. 604, 184–189 (2022). V. Kluck, T. L. T. A. Jansen, M. Janssen, A. Comarniceanu, M. Efde, I. W. Tengesdal, K. Schraa, M. C. P. Cleophas, C. L. Scribner, D. B. Skouras, C. Marchetti, C. A. Dinarelloand, L. A. B. Joosten, Dapansutrile, an oral selective NLRP3 inflammasome inhibitor, for treatment of gout flares: an open-label, dose-adaptive, proof-of-concept, phase 2a trial. Lancet Rheumatol. 2, e270-e280 (2020). H. J. Whan, L. B. Gon, K. Y. Kee, Y. J. Woo, J. H. Kyoung, S. Hong, L. H. Young, L. K. Roand, L. H. Woo, Ergolide, sesquiterpene lactone from Inula britannica, inhibits inducible nitric oxide synthase and cyclo-oxygenase-2 expression in RAW 264.7 macrophages through the inactivation of NF-kappaB. Br J Pharmacol. 133, 503–512 (2001). G. Lyss, T. J. Schmidt, I. Merfortand, H. L. Pahl, Helenalin, an anti-inflammatory sesquiterpene lactone from Arnica, selectively inhibits transcription factor NF-kappaB. Biol Chem. 378, 951–961 (1997). K. W. Nam, G. T. Oh, E. K. Seo, K. H. Kim, U. Koo, S. J. Lee, W. Mar, Nuclear factor kappaB-mediated down-regulation of adhesion molecules: possible mechanism for inhibitory activity of bigelovin against inflammatory monocytes adhesion to endothelial cells. J Ethnopharmacol. 123, 250–256 (2009). W. L. Vandeand, M. Lamkanfi, Drugging the NLRP3 inflammasome: from signalling mechanisms to therapeutic targets. Nat Rev Drug Discov. 23, 43–66 (2024). P. Georg, R. Astaburuaga-Garcia, L. Bonaguro, S. Brumhard, L. Michalick, L. J. Lippert, T. Kostevc, C. Gabel, M. Schneider, M. Streitz, V. Demichev, I. Gemund, M. Barone, P. Tober-Lau, E. T. Helbig, D. Hillus, L. Petrov, J. Stein, H. P. Dey, D. Paclik, C. Iwert, M. Mulleder, S. K. Aulakh, S. Djudjaj, R. D. Bulow, H. E. Mei, A. R. Schulz, A. Thiel, S. Hippenstiel, A. E. Saliba, R. Eils, I. Lehmann, M. A. Mall, S. Stricker, J. Rohmel, V. M. Corman, D. Beule, E. Wyler, M. Landthaler, B. Obermayer, S. von Stillfried, P. Boor, M. Demir, H. Wesselmann, N. Suttorp, A. Uhrig, H. Muller-Redetzky, J. Nattermann, W. M. Kuebler, C. Meisel, M. Ralser, J. L. Schultze, A. C. Aschenbrenner, C. Thibeault, F. Kurth, L. E. Sander, N. Bluthgen, B. Sawitzki, Complement activation induces excessive T cell cytotoxicity in severe COVID-19. Cell. 185, 493–512.e25 (2022). C. Chen, C. Wang, R. Pang, H. Liu, W. Yin, J. Chen, L. Tao, Comprehensive single-cell transcriptomic and proteomic analysis reveals NK cell exhaustion and unique tumor cell evolutionary trajectory in non-keratinizing nasopharyngeal carcinoma. J Transl Med. 21, 278 (2023). Y. Muto, E.E. Dixon, Y. Yoshimura, H. Wu, K. Omachi, N. Ledru, P.C. Wilson, A.J. King, N. Eric Olson, M.G. Gunawan, J.J. Kuo, J.H. Cox, J.H. Miner, S.L. Seliger, O.M. Woodward, P.A. Welling, T.J. Watnick, B.D. Defining cellular complexity in human autosomal dominant polycystic kidney disease by multimodal single cell analysis. Nat Commun. 13, 6497 (20221). Y. Qin, G. Yan, Y. Qiao, D. Wang, C. Tang, Identification of hub genes based on integrated analysis of single-cell and microarray transcriptome in patients with pulmonary arterial hypertension, BMC Genomics.24, 788 (2023). G. Monaco, B. Lee, W. Xu, S. Mustafah, Y. Y. Hwang, C. Carre, N. Burdin, L. Visan, M. Ceccarelli, M. Poidinger, A. Zippelius, De Magalhaes J. Pedro, A. Larbi, RNA-Seq signatures normalized by mRNA abundance allow absolute deconvolution of human immune cell types. Cell Rep. 26, 1627–1640.e7 (2019). H. Sharif, L. Wang, W. L. Wang, V. G. Magupalli, L. Andreeva, Q. Qiao, A. V. Hauenstein, Z. Wu, G. Nunez, Y. Mao, H. Wu, Structural mechanism for NEK7-licensed activation of NLRP3 inflammasome. Nature. 570, 338–343 (2019). J. Cui, W. Huang, B. Wu, J. Jin, L. Jing, W. P. Shi, Z. Y. Liu, L. Yuan, D. Luo, L. Li, Z. N. Chen, J. L. Jiang, N-glycosylation by N-acetylglucosaminyltransferase V enhances the interaction of CD147/basigin with integrin beta1 and promotes HCC metastasis. J Pathol. 245, 41–52 (2018). Y. Li, N. N. Liu, Y. Qian, C. Y. Jiao, J. S. Yang, X. B. Meng, Y. Sun, Q. Xu, W. Liu, J. Cuiand, W. J. Guo, Targeting 14-3-3zeta by a small-molecule compound AI-34 maintains epithelial barrier integrity and alleviates colitis in mice via stabilizing beta-catenin. J Pharmacol Sci.152, 210–219 (2023). G. M. Ren, J. Li, X. C. Zhang, Y. Wang, Y. Xiao, X. Y. Zhang, X. Liu, W. Zhang, W. B. Ma, J. Zhang, Y. T. Li, S. S. Tao, T. Wang, K. Liu, H. Chen, Y. Q. Zhan, M. Yu, C. Y. Li, C. H. Ge, B. X. Tian, G. F. Dou, X. M. Yangand, R. H. Yin, Pharmacological targeting of NLRP3 deubiquitination for treatment of NLRP3-associated inflammatory diseases. Sci Immunol. 6, eabe2933 (2021). H. Xian, Y. Liu, N. A. Rundberg, R. Gatchalian, T. R. Crother, W. G. Tourtellotte, Y. Zhang, G. R. Aleman-Muench, G. Lewis, W. Chen, S. Kang, M. Luevanos, D. Trudler, S. A. Lipton, P. Soroosh, J. Teijaro, J. C. de la Torre, M. Arditi, M. Karinand, E. Sanchez-Lopez, Metformin inhibition of mitochondrial ATP and DNA synthesis abrogates NLRP3 inflammasome activation and pulmonary inflammation. Immunity. 54, 1463–1477 (2021). H. Tao, H. Zhao, A. Mo, L. Shao, D. Ge, J. Liu, W. Hu, K. Xu, Q. Ma, W. Wang, W. Wang, H. Cao, M. Mu, X. Taoand, J. Wang, VX-765 attenuates silica-induced lung inflammatory injury and fibrosis by modulating alveolar macrophages pyroptosis in mice. Ecotoxicol Environ Saf. 249, 114359 (2023). Additional Declarations (Not answered) Supplementary Files supplymentalfigure.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4659521","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":321693130,"identity":"b838040f-62a9-4501-99f2-0aed6b20ed90","order_by":0,"name":"Yinan Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYDACZjB5AMQ6wCABETMgVgtbApFaGOBaeOAq8WsxOM578HPBnzvy5vxrvj2wbLOLZmBv3ibBUHMHt5bDfMnSM3ieGe6c8Xa7gWRbcm4Dz7EyCYZjz/Bo4TGQ5pE4zLjhxtltEpJtB3IbJHLMJBgbDuPTYvybx+Cw/YYbZ55BtMi/IajFTJon4XDihvM9bFBbePBrkQRqseY5cDh5ww02MwmJc8m5bTxpxRYJx3Br4Tt/xvg2z5/DthvOH34mLVFml9vPfnjjjQ81uLUoHICxJBIYmEFRyQbiJODUwMAg3wBj8R9gYPyAR+UoGAWjYBSMXAAAkIlXCiJEus0AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-0362-1473","institution":"Jiangsu Key Laboratory for Functional Substance of Chinese Medicine, School of Pharmacy, Nanjing University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Yinan","middleName":"","lastName":"Zhang","suffix":""},{"id":321693131,"identity":"119d5a4a-0441-4abd-8da4-2ac5ab8d2246","order_by":1,"name":"Jian Cui","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Cui","suffix":""},{"id":321693132,"identity":"4bba5a2d-0164-43e8-9c7d-fdb1b8cbf505","order_by":2,"name":"Meng Yang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Meng","middleName":"","lastName":"Yang","suffix":""},{"id":321693133,"identity":"c92d5659-35a1-456f-b2f7-715f2de1f39d","order_by":3,"name":"Chengli Yu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chengli","middleName":"","lastName":"Yu","suffix":""},{"id":321693134,"identity":"5895a384-93ff-4e12-8355-5f1d02a35b4f","order_by":4,"name":"Haidong Zhang","email":"","orcid":"","institution":"Jiangsu Province Hospital of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Haidong","middleName":"","lastName":"Zhang","suffix":""},{"id":321693135,"identity":"fd7ac090-45a2-42bb-b8e8-de6210fdc1cd","order_by":5,"name":"Yuan Gong","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuan","middleName":"","lastName":"Gong","suffix":""},{"id":321693136,"identity":"8859a71b-49fd-4ba8-9bfb-47bf1cee8018","order_by":6,"name":"Yang Hu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Hu","suffix":""},{"id":321693137,"identity":"f141530b-a684-469f-b8fa-5f925841500e","order_by":7,"name":"Yue Wang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Wang","suffix":""},{"id":321693138,"identity":"abbd55ec-b9ea-4637-aa7b-9b60b3bc1a8f","order_by":8,"name":"Qingxin Yuan","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qingxin","middleName":"","lastName":"Yuan","suffix":""},{"id":321693139,"identity":"3b983407-3a76-4f24-9768-a0e6592b2ce8","order_by":9,"name":"An Pan","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"An","middleName":"","lastName":"Pan","suffix":""},{"id":321693140,"identity":"0077c3d8-794e-405c-b95e-5fc1a45be051","order_by":10,"name":"Jiepin Li","email":"","orcid":"","institution":"Jiangsu Province Hospital of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jiepin","middleName":"","lastName":"Li","suffix":""},{"id":321693141,"identity":"7050d12a-5a9c-41eb-8923-8e79056e5ac9","order_by":11,"name":"Yaowen Hu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yaowen","middleName":"","lastName":"Hu","suffix":""},{"id":321693142,"identity":"90fa1489-b0aa-4cac-ad2c-d0671e39ebd9","order_by":12,"name":"Zecheng Jin","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zecheng","middleName":"","lastName":"Jin","suffix":""},{"id":321693143,"identity":"b497390e-f163-4f62-a67d-2791344a3d41","order_by":13,"name":"Xuemei Peng","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xuemei","middleName":"","lastName":"Peng","suffix":""},{"id":321693144,"identity":"0d67249e-5fef-490f-95a3-44462bd28637","order_by":14,"name":"Anyuan Wu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Anyuan","middleName":"","lastName":"Wu","suffix":""},{"id":321693145,"identity":"ddda0309-b299-4a46-a19d-32c89a13099d","order_by":15,"name":"Junwei Wang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Junwei","middleName":"","lastName":"Wang","suffix":""},{"id":321693146,"identity":"4625b9a2-3263-4f6e-ba3d-2b2d7d9414f0","order_by":16,"name":"Qian Wang","email":"","orcid":"","institution":"Jiangsu Province Hospital of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Wang","suffix":""},{"id":321693147,"identity":"5a056041-52e6-4dde-8a00-00b6a01f7d31","order_by":17,"name":"Lihong Hu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lihong","middleName":"","lastName":"Hu","suffix":""}],"badges":[],"createdAt":"2024-06-29 13:35:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4659521/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4659521/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60979169,"identity":"8c8dbda0-3874-465a-83ef-f6f4f34ec6e4","added_by":"auto","created_at":"2024-07-24 08:46:46","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2512847,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAberrant activation of NLRP3 inflammasome in macrophages during ARDS pathogenesis. (A) \u003c/strong\u003eUniform Manifold Approximation and Projection (UMAP) plot showing immune cell from GSE175450. \u003cstrong\u003e(B) \u003c/strong\u003eThe proportion of each cell type in PBMCs from healthy donors and ARDS patients in single-cell data (GSE175450). (\u003cstrong\u003eC\u003c/strong\u003e) UMAP plots show the expression of NLRP3 and IL-1B in PBMCs from healthy donors and ARDS patients (GSE175450). The redder the color, the higher the expression levels are. \u003cstrong\u003e(D-E) \u003c/strong\u003eExpression of \u003cem\u003eNLRP3\u003c/em\u003e and \u003cem\u003eIL1B \u003c/em\u003ein BALF in each immune cell type among severe ARDS (GSE145926). \u003cstrong\u003e(F-G) \u003c/strong\u003eExpression of \u003cem\u003eNLRP3\u003c/em\u003e and \u003cem\u003eIL1B\u003c/em\u003e in BALF macrophages cells among healthy controls (n = 3) and patients with mild (n = 3) and severe ARDS (n = 6) patients (GSE145926). The red numbers in the box represent the mean gene expression level. (\u003cstrong\u003eH\u003c/strong\u003e) Concentrations of IL-1β in serum from patients with direct acute respiratory distress syndrome (ARDS). Serum of patients with mild (n = 35) or indirect ARDS (n = 28) and severe ARDS (n = 5) was obtained and analyzed for IL-1β. \u003cstrong\u003e(I-J) \u003c/strong\u003eC57BL/6J mice were challenged with 7.5 mg/kg LPS for 12 h. The levels of IL-1β in serum \u003cstrong\u003e(I) \u003c/strong\u003eor lung tissues \u003cstrong\u003e(J) \u003c/strong\u003efrom mice were measured by ELISA (n = 6). \u003cstrong\u003e(K) \u003c/strong\u003eWestern blotting analysis of caspase-1 (p12) from above mice (n = 4). Data were presented as mean ± SEM and statistical significance was assessed by two-tailed unpaired \u003cem\u003et\u003c/em\u003e test.\u003c/p\u003e","description":"","filename":"fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/f61d1462052bcedda1ed9d14.png"},{"id":60979742,"identity":"f4abb959-7268-4b3a-ae08-9de10e018762","added_by":"auto","created_at":"2024-07-24 08:54:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1911033,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBigelovin potently inhibits inflammasome activation. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) ELISA analysis of IL-1β\u003cem\u003e \u003c/em\u003ein culture supernatants of\u003cstrong\u003e \u003c/strong\u003eLPS-primed\u003cstrong\u003e \u003c/strong\u003eBMDMs or THP-1\u003cstrong\u003e \u003c/strong\u003etreated with 8-epihelenalin, bigelovin, or ergolide (1 μM) before stimulation with ATP (5 mM, 45 min).\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eB-E\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eLPS-primed BMDMs treated with bigelovin before stimulation with ATP (5 mM, 45 min). ELISA analysis of IL-1β (\u003cstrong\u003eB\u003c/strong\u003e) or TNF-α (\u003cstrong\u003eC\u003c/strong\u003e)\u003cem\u003e \u003c/em\u003ein culture supernatants. (\u003cstrong\u003eD\u003c/strong\u003e)Western blotting analysis of IL-1β (p17) and caspase-1 (p12) in culturesupernatants (SN) and pro-IL-1β and pro-caspase-1 in lysates (Lys).\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eE\u003c/strong\u003e)Assay of LDH release in culture supernatants. (\u003cstrong\u003eF-G\u003c/strong\u003e) LPS-primed BMDMs treated with bigelovin before stimulation with Nigericin. (\u003cstrong\u003eF\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eELISA analysis of IL-1β\u003cem\u003e \u003c/em\u003ein culture supernatants. (\u003cstrong\u003eG\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eWestern blotting analysis of IL-1β (p17) and caspase-1 (p12) in culturesupernatants (SN) and pro-IL-1β and pro-caspase-1 in lysates (Lys). (\u003cstrong\u003eH-I\u003c/strong\u003e) LPS-primed BMDMs treated with bigelovin before stimulation with MSU. (\u003cstrong\u003eH\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eELISA analysis of IL-1β\u003cem\u003e \u003c/em\u003ein culture supernatants. (\u003cstrong\u003eI\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eWestern blotting analysis of IL-1β (p17) and caspase-1 (p12) in culturesupernatants (SN) and pro-IL-1β and pro-caspase-1 in lysates (Lys). (\u003cstrong\u003eJ-K\u003c/strong\u003e) BMDMs are primed with Pam3CSK4 and treated with bigelovin before transfected with LPS. (\u003cstrong\u003eJ\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eELISA analysis of IL-1β\u003cem\u003e \u003c/em\u003ein culture supernatants. (\u003cstrong\u003eK\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eWestern blotting analysis of IL-1β (p17) and caspase-1 (p12) in culturesupernatants (SN) and pro-IL-1β and pro-caspase-1 in lysates (Lys). (\u003cstrong\u003eL\u003c/strong\u003e) ELISA analysis of IL-1β in culture supernatants of PBMCs treated with bigelovin and then stimulated with LPS. Data were presented as mean ± SEM and were representative of three independent experiments. Statistical significance was assessed by two-tailed unpaired \u003cem\u003et\u003c/em\u003etest.\u003c/p\u003e","description":"","filename":"fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/7de9b92ccff0882331052eb1.png"},{"id":60979171,"identity":"55432d25-741c-4c66-a2e5-a060a8afb244","added_by":"auto","created_at":"2024-07-24 08:46:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":7580836,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBigelovin inhibits NLRP3 inflammasome activation \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e. (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eSchematic procedure of bigelovin treatment on silicosis mice. (\u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eMice were evaluated for changes in survival treated with bigelovin (0.1 and 1 mg/kg) or nintedanib (100 mg/kg)(n = 8 per group). (\u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eqRT-PCR analysis of \u003cem\u003eIl1b\u003c/em\u003e mRNA expression in lung tissues of mice (n = 5). (\u003cstrong\u003eD-E\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eRepresentative H\u0026amp;E-stained sections (\u003cstrong\u003eD\u003c/strong\u003e) or Masson staining (\u003cstrong\u003eE\u003c/strong\u003e) of lung tissues are shown (scale bar = 40 μm). (\u003cstrong\u003eF-G\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eLung sections from above mice were stained with α-SMA (\u003cstrong\u003eF\u003c/strong\u003e) and Collagen I (\u003cstrong\u003eG\u003c/strong\u003e) antibodies, (scale bar = 40 μm).\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eH\u003c/strong\u003e) Western blotting analysis of caspase-1 (p12) in the lung from above mice. (\u003cstrong\u003eI-L\u003c/strong\u003e) Mice were treated with 2.5% DSS dissolved in the drinking water for 7 days and were then provided normal drinking water for 2 days. Bigelovin (10, 100 μg/kg) or vehicle were intraperitoneal injection daily. The disease activity index (DAI) (\u003cstrong\u003eI\u003c/strong\u003e), and colon length (\u003cstrong\u003eJ\u003c/strong\u003e) were measured. (\u003cstrong\u003eK\u003c/strong\u003e) Sections of paraffin-embedded colon tissues were stained with H\u0026amp;E(Scale bar =100 μm). (\u003cstrong\u003eL\u003c/strong\u003e) Colon IL-1β levels were assessed by ELISA. The data are shown as the mean ± SEM values (n = 6). Data were presented as mean ± SEM and statistical significance was assessed by two-tailed unpaired \u003cem\u003et\u003c/em\u003etest.\u003c/p\u003e","description":"","filename":"fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/aa5e03a2a9f73ed9eebc3bb1.png"},{"id":60979741,"identity":"87301574-566a-4e00-9027-4d282ff290cd","added_by":"auto","created_at":"2024-07-24 08:54:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3826812,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBigelovin improves LPS-induced ARDS. \u003c/strong\u003e(\u003cstrong\u003eA-B\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eMice were prophylactic intraperitoneal injection of bigelovin (10 μg/kg, 100 μg/kg) or dexamethasone (5 mg/kg) then challenged with 7.5 mg/kg LPS for 12 h. IL-1β (\u003cstrong\u003eA\u003c/strong\u003e) and IL-6 (\u003cstrong\u003eB\u003c/strong\u003e) levels of serum from above mice were measured by ELISA (n = 6). (\u003cstrong\u003eC\u003c/strong\u003e) H\u0026amp;E staining of lung tissues from mice that were untreated or pretreated with bigelovin and then challenged with 7.5 mg/kg LPS for 24 h prior tissue collection (scale bar = 20 μm). (\u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eMice were prophylactic intraperitoneal injection of bigelovin (10 μg/kg, 100 μg/kg) or dexamethasone (5 mg/kg) then challenged with 7.5 mg/kg LPS for 12 h. Western blotting analysis of caspase-1 (p12) from above mice (n = 5). (\u003cstrong\u003eE-I\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eMice were treated with 7.5 mg/kg LPS and then injected intraperitoneally bigelovin (10 μg/kg, 100 μg/kg) or dexamethasone (5 mg/kg) for 24 h. IL-1β (\u003cstrong\u003eE\u003c/strong\u003e)and IL-6 (\u003cstrong\u003eF\u003c/strong\u003e)levels of lung tissues from above mice were measured by ELISA (n = 6). IL-1β (\u003cstrong\u003eG\u003c/strong\u003e) and IL-6 (\u003cstrong\u003eH\u003c/strong\u003e)levels of serum were measured by ELISA (n = 6)\u003cem\u003e.\u003c/em\u003e (\u003cstrong\u003eI\u003c/strong\u003e) H\u0026amp;E staining of lung tissues from above mice that were treated with 7.5 mg/kg LPS (scale bar = 20 μm). (\u003cstrong\u003eJ-K\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eMice were prophylactic intragastric administration of bigelovin (0.1 mg/kg, 1 mg/kg) or dexamethasone (5 mg/kg) and then challenged with 7.5 mg/kg LPS for 12 h. IL-1β (\u003cstrong\u003eJ\u003c/strong\u003e) and IL-6 (\u003cstrong\u003eK\u003c/strong\u003e) levels of serum from above mice were measured by ELISA (n = 6). (\u003cstrong\u003eL\u003c/strong\u003e) H\u0026amp;E staining of lung tissues from mice that were prophylactic intragastric administration of bigelovin and then challenged with 7.5 mg/kg LPS for 24 h (scale bar = 20 μm). Data were presented as mean ± SEM and statistical significance was assessed by two-tailed unpaired \u003cem\u003et\u003c/em\u003e test.\u003c/p\u003e","description":"","filename":"fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/3c8719561b3c2f141a4ac1ce.png"},{"id":60979175,"identity":"1825498c-fbca-4dd2-a3b3-4c4edf0fd794","added_by":"auto","created_at":"2024-07-24 08:46:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2250237,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBigelovin specifically inhibits NLRP3 inflammasome activation and does not affect the upstream pathways of the NLRP3 inflammasome \u003c/strong\u003e(\u003cstrong\u003eA-B\u003c/strong\u003e) ELISA analysis of IL-1β from LPS-primed BMDMs treated with bigelovin before stimulation with poly(dA:dT) (\u003cstrong\u003eA\u003c/strong\u003e) or MDP (\u003cstrong\u003eB\u003c/strong\u003e). (\u003cstrong\u003eC\u003c/strong\u003e) Western blotting analysis of p-p65, p65, pro-caspase-1, ASC, NLRP3 and GAPDH in LPS-primed BMDMs pretreated with bigelovin. (\u003cstrong\u003eD-E\u003c/strong\u003e) ELISA analysis of IL-1β (\u003cstrong\u003eD\u003c/strong\u003e) or TNF-α (\u003cstrong\u003eE\u003c/strong\u003e)\u003cem\u003e \u003c/em\u003ein culture supernatants of BMDMs treated with bigelovin before or after LPS challenged and stimulated with ATP. \u003cstrong\u003e(F-I)\u003c/strong\u003e LPS-primed BMDMs were treated with bigelovin and then stimulated with ATP. Flow cytometric analysis of K\u003csup\u003e+ \u003c/sup\u003eefflux (\u003cstrong\u003eF\u003c/strong\u003e), Ca\u003csup\u003e2+\u003c/sup\u003e influx (\u003cstrong\u003eG\u003c/strong\u003e), Lysosome rupture (\u003cstrong\u003eH\u003c/strong\u003e) and mitochondrial reactive oxygen species (\u003cstrong\u003eI\u003c/strong\u003e). (\u003cstrong\u003eJ\u003c/strong\u003e) Confocal immunofluorescence images of LPS-primed BMDMs treated with BMDMs and stimulated with ATP, followed by staining with Mitotracker and DAPI (scale bar = 20 μm). Data were presented as mean ± SEM and were representative of three independent experiments. Statistical significance was assessed by two-tailed unpaired \u003cem\u003et\u003c/em\u003e test.\u003c/p\u003e","description":"","filename":"fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/7e4ccaa5994be5321d525754.png"},{"id":60979172,"identity":"b31ae7ef-e92a-4506-a048-55fddac3f95c","added_by":"auto","created_at":"2024-07-24 08:46:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2676176,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBigelovin inhibits NLRP3 inflammasome assembly by blocking NLRP3-NLRP3 interaction\u003c/strong\u003e. (\u003cstrong\u003eA-F\u003c/strong\u003e) LPS-primed BMDMs were treated with 300 nM bigelovin and then stimulated with ATP. Immunoblot analysis of ASC oligomerization (\u003cstrong\u003eA\u003c/strong\u003e) and NLRP3 oligomerization (\u003cstrong\u003eB\u003c/strong\u003e). Immunoprecipitationanalysis of the interaction between NLRP3 and NEK7 (\u003cstrong\u003eC\u003c/strong\u003e) or ASC (\u003cstrong\u003eD\u003c/strong\u003e). Quantitative analysis of the interaction between NLRP3 and NEK7 (\u003cstrong\u003eE\u003c/strong\u003e) or ASC (\u003cstrong\u003eF\u003c/strong\u003e).(\u003cstrong\u003eG-M\u003c/strong\u003e) Immunoprecipitation analysis of the interaction of between NLRP3 and NEK7 (\u003cstrong\u003eG\u003c/strong\u003e), or ASC (\u003cstrong\u003eI\u003c/strong\u003e), the interaction of ASC and ASC (\u003cstrong\u003eK\u003c/strong\u003e) and the interaction of NLRP3 and NLRP3 (\u003cstrong\u003eM\u003c/strong\u003e) in HEK-293T cells transfected with indicated plasmid and treated with bigelovin (300 nM) for 24 h. Quantitative analysis of the interaction of GFP-NLRP3 and FLAG-NEK7 (\u003cstrong\u003eH\u003c/strong\u003e) described in Fig. 6G, the interaction of GFP-ASC and FLAG-NLRP3 (\u003cstrong\u003eJ\u003c/strong\u003e) described in Fig. 6I, the interaction of GFP-ASC and FLAG-ASC (\u003cstrong\u003eL\u003c/strong\u003e) described in Fig. 6K and the interaction of GFP-NLRP3 and FLAG-NLRP3 (\u003cstrong\u003eN\u003c/strong\u003e) described in Fig. 6M. Data were presented as mean ± SEM and were representative of three independent experiments. Statistical significance was assessed by two-tailed unpaired \u003cem\u003et\u003c/em\u003e test.\u003c/p\u003e","description":"","filename":"fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/0657823e0934347fb6716120.png"},{"id":60980342,"identity":"d532ae63-5af7-45a3-9da8-3ddc64d46057","added_by":"auto","created_at":"2024-07-24 09:02:46","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2649789,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBigelovin targets the RACK1 protein.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Workflow of isoDTB-ABPP experiment. (\u003cstrong\u003eB\u003c/strong\u003e) Bigelovin binding proteins identified by isoDTB-ABPP experiment. (\u003cstrong\u003eC-E\u003c/strong\u003e) LPS-primed BMDMs were incubated with DMSO or bigelovin (300 nM) for 1 h, and cellular thermal shift assays (CETSA) analyzed the thermal stabilization of Agfg2 \u003cstrong\u003e(C)\u003c/strong\u003e, Sash1 (\u003cstrong\u003eC\u003c/strong\u003e), Gbp4 (\u003cstrong\u003eD\u003c/strong\u003e), RACK1 (\u003cstrong\u003eE\u003c/strong\u003e) at different temperatures. (\u003cstrong\u003eF\u003c/strong\u003e) LPS-primed BMDMs were incubated with different concentration of bigelovin for 1 h, then thermal stability of RACK1 protein was evaluated by CESTA at 49 ℃.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eG\u003c/strong\u003e) Mass spectrometry analysis of the binding site of bigelovin to RACK1. (\u003cstrong\u003eH\u003c/strong\u003e) HEK-293T cells transfected with indicated plasmid were incubated with bigelovin (300 nM) for 24 h, then thermal stability of GFP-RACK1\u003cstrong\u003e \u003c/strong\u003eand\u003cstrong\u003e \u003c/strong\u003eGFP-RACK1 (C168A) protein were evaluated by CESTA at different temperature. (\u003cstrong\u003eI\u003c/strong\u003e) Mice were administrated with DMSO or bigelovin (0.1 mg/kg)for 3 days by intraperitoneal injection and then challenged with 1% starch broth solution for 48 h, thermal stability of RACK1 protein in peritoneal macrophages was evaluated by CESTA at different temperature. (\u003cstrong\u003eJ\u003c/strong\u003e) The interaction of bigelovin with RACK1 was measured by SPR. (\u003cstrong\u003eK\u003c/strong\u003e) The interaction between bigelovin and RACK1 was measured by molecular docking. Data were representative of three independent experiments.\u003c/p\u003e","description":"","filename":"fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/e895875d381e1d2a0001ce5b.png"},{"id":60979177,"identity":"dd253d3b-b43e-45c3-8316-eea53ca5540f","added_by":"auto","created_at":"2024-07-24 08:46:46","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2603616,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBigelovin inhibits NLRP3 inflammasome by binding to cysteine 168 of RACK1\u003c/strong\u003e. (\u003cstrong\u003eA-B\u003c/strong\u003e) LPS-primed BMDM was treated with bigelovin and then stimulated with ATP (5 mM, 30 min). Cell lysates were immunoprecipitated and immunoblotted with the indicated antibodies\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e). Quantitative analysis of the interaction of NLRP3-RACK1 described in Fig. 8A (n = 3) (\u003cstrong\u003eB\u003c/strong\u003e). (\u003cstrong\u003eC-D\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eHEK-293T cells were transfected FLAG-NLRP3 with GFP-Vector or GFP-RACK1 and treated with bigelovin(300 nM) for 24 h. Cell lysates were immunoprecipitated and immunoblotted for analysis of the interaction of FLAG-NLRP3 and GFP-RACK1\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eC\u003c/strong\u003e). Quantitative analysis of the interaction of GFP-RACK1-FLAG-NLRP3 described in Fig. 8C (n = 3)\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eD\u003c/strong\u003e). (\u003cstrong\u003eE-F\u003c/strong\u003e) HEK-293T cells were transiently transfected with and either GFP-RACK1 or GFP-RACK1 (C168A) and treated with bigelovin(300 nM) for 24 h. Samples were immunoprecipitated with FLAG and probed for FLAG (NLRP3) and GFP (RACK1 or RACK1 (C168A)\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eE\u003c/strong\u003e). Quantitative analysis of the immunoblot of GFP-RACK1/FLAG-NLRP3 described in Fig. 8E (n = 3) (\u003cstrong\u003eF\u003c/strong\u003e). (\u003cstrong\u003eG-H\u003c/strong\u003e) Immunoprecipitation analysis of NLRP3-NLRP3 interaction in HEK-293T cells transfected with FLAG-NLRP3, GFP-NLRP3, GFP-RACK1 or GFP-RACK1 mutant (C168A) plasmid and treated with bigelovin(300 nM) for 24 h (\u003cstrong\u003eG\u003c/strong\u003e). Quantitative analysis of the interaction GFP-NLRP3-FLAG-NLRP3\u003cstrong\u003e \u003c/strong\u003edescribed in Fig. 8G (n = 3) (\u003cstrong\u003eH\u003c/strong\u003e). (\u003cstrong\u003eI-K\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eMice were\u003cstrong\u003e \u003c/strong\u003eintravenously injected with siRNA (80 μg per mouse) with \u003cem\u003ein vivo\u003c/em\u003e-jetPEI, followed by intraperitoneal injection of 7.5 mg/kg LPS 48 h later, and then injected intraperitoneallybigelovin for 12 h. (\u003cstrong\u003eI\u003c/strong\u003e) Western blotting analysis of RACK1 and caspase-1 (p12) from abovemice (n = 6). (\u003cstrong\u003eJ-K\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eELISA quantification of IL-1β\u003cstrong\u003e \u003c/strong\u003eand IL-6\u003cstrong\u003e \u003c/strong\u003elevels of lung tissues from above mice were measured by (n = 6). Data were presented as mean ± SEM and statistical significance was assessed by two-tailed unpaired \u003cem\u003et\u003c/em\u003e test.\u003c/p\u003e","description":"","filename":"fig.8.png","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/9fe2be2193ee3fe32601aa9e.png"},{"id":61244099,"identity":"735e9497-c2bc-4538-849a-a5e53500123b","added_by":"auto","created_at":"2024-07-28 06:33:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":28149324,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/6d085e20-e6bc-4f2a-9f42-e8dcf852997d.pdf"},{"id":60979178,"identity":"f7d630d5-c0c3-48bb-b942-ee32fa38965f","added_by":"auto","created_at":"2024-07-24 08:46:47","extension":"docx","order_by":21,"title":"","display":"","copyAsset":false,"role":"supplement","size":3099624,"visible":true,"origin":"","legend":"","description":"","filename":"supplymentalfigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-4659521/v1/7dd89f1056aa432e23cda887.docx"}],"financialInterests":"(Not answered)","formattedTitle":"Inhibition of NLRP3 oligomerization (active conformation) mediated by RACK1 ameliorates acute respiratory distress syndrome","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAcute respiratory distress syndrome (ARDS), characterized by acute hypoxemia, diffuse lung inflammation, and edema, is the primary cause of respiratory failure with more than 40% mortality (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Few therapeutic modalities are presented to alleviate this deadly condition. The disorder is associated with excessive alveolar capillary permeability and diffuse damage. Most ARDS cases initiate in patients exposed to pathogen-associated molecular patterns (such as LPS or RNA) during bacterial and viral types of pneumonia (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). There is growing evidence of the involvement of innate immunityduring ARDS pathogenesis, in which alveolar macrophages detect the presence of infections or injuries and trigger pyroptosis characterized by rapid cytolysis and the release of proinflammatory cytokines (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Based on our and other groups\u0026rsquo; study, an overproduction of IL-1β caused by macrophage pyroptosis in the development of ARDS is essential for activating the host\u0026rsquo;s immune system (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Therefore, targeting the production of IL-1β might be beneficial to ARDS.\u003c/p\u003e \u003cp\u003eAs the core signaling to drive IL-1β activation and release, inflammasomes assembled by multiple proteins play a crucial role in inflammation response to infection and tissue damage. Inflammasome complexes generally consist of pattern recognition receptors (PRRs), the adaptor protein apoptosis-associated speck-like protein containing a CARD (ASC), and the inflammatory proteases caspase-1 (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). The best-studied PRRs- NLRP3 inflammasome, is an intracellular sensor for infectious and sterile stress signals, in particular, involved in various inflammation responses and cell pyroptosis (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Its activation primarily depends on the priming step, typically via TLR-induced NF-κB-dependent signaling pathways, enabling the expression of \u003cem\u003eNlrp3\u003c/em\u003e, which in turn facilitates its activation. Additionally, direct LPS treatment could also prime NLRP3 in a non-transcriptional way. In the activation step, NLRP3 is activated by diverse stimuli ranging from bacterial toxins to particulates that often converge to ionic changes such as K\u003csup\u003e+\u003c/sup\u003e efflux or Ca\u003csup\u003e2+\u003c/sup\u003e influx (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). A number of NLRP3-binding proteins have been learned to promote NLRP3 inflammasome translocation and assembly (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). For example, SCAP and SREBP2 interact with the NACHT domain and help NLRP3 transfer to the Golgi apparatus (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e); post-phosphorylation at S293 of NLRP3 by protein kinase D allows the release from the Golgi and the formation of cytosolic inflammasome (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e); deficiency of another mediator HDAC6 traps NLRP3 as small speckles at the trans-Golgi network and stops its transportation to the centrosome where assembly takes place (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). On the other hand, NEK7 is the most-studied mediator to trigger the final formation of NLRP3 machinery (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e), in which structural analysis of NLRP3-NEK7 complex shows that NEK7 bridges adjacent subunits in the process of NLRP3 oligomerization (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Next, the receptor for activated protein C kinase (RACK1) interacts with NLRP3 and NEK7, leading NLRP3 into an \u0026ldquo;active\u0026rdquo; conformation in response to stimuli and subsequent inflammasome assembly.\u003c/p\u003e \u003cp\u003eSince NLRP3 inflammasome and its regulatory role have emerged as a promising therapeutic target, the development of direct NLRP3 inhibitors is vigorously progressing in the preclinical and clinical stages. However, whether these partner proteins are related to the inflammasome structure and posttranslational modification remains unclear. Our group previously identified EZH2-promoted expression of autophagy-related protein 5 as a novel NLRP3 degradation pathway and flavonoid lonicerin served as an EZH2 inhibitor to alleviate over-inflammation in the ulcerative colitis model (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). In our search for other natural products involved in the interaction of NLRP3 inflammasome and its mediators, we resolved sesquiterpene bigelovin as the first covalent binder that blocks RACK1-mediated NLRP3 oligomerization (active conformation) by using an isoTOP-ABPP chemoproteomic approach (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Here, we report the discovery of a class of RACK1 inhibitors that exert NLRP3 inflammasome antognistic activity \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Mechanistically, sesquiterpene lactone bigelovin covalently binds to a cysteine residue of RACK1 and blocks NLRP3 oligomerization (active conformation), inhibiting the assembly of NLRP3 inflammasome, caspase-1 activation, and IL-1β production, and reducing ARDS severity.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSesquiterpene lactone contained in Inula helianthus-aquatica reduces LPS-induced ARDS in mice\u003c/h2\u003e \u003cp\u003eDuring the COVID-19 pandemic outbreak, ARDS emerged as the predominant syndrome and the leading cause of death among severe COVID-19 patients (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Both clinical and preclinical studies have delineated the effectiveness of traditional Chinese medicine (TCM) in treating COVID-19 and its associated complications (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). The TCM formulae containing the flowers of \u003cem\u003eInula helianthus-aquatica\u003c/em\u003e have been traditionally used in the prescriptions of lung diseases, such as asthma, chronic bronchitis (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). However, the defining components of \u003cem\u003eInula helianthus-aquatica\u003c/em\u003e have yet to be proven for its anti-inflammatory properties. To pinpoint the active components in the plant, we initially employed an activity-guided isolation approach to refine the fractions derived from crude extraction. Mice received two doses of the fractions on consecutive days prior to a single intraperitoneal injection of 7.5 mg/kg LPS (Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). We evaluated pulmonary inflammation by measuring the mRNA levels of pro-inflammatory cytokines in the lungs at 12 and 24 hours after LPS delivery. The results showed that the fraction containing sesquiterpene lactones bigelovin, ergolide, and 8-epi-helenalin (Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA), significantly decreased the expression of IL-1β in the lungs at both 1 mg/kg and 0.1 mg/kg doses, while had a lesser impact on IL-6 and TNF-α (Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC-G). To confirm our results, we assessed whether the same fraction could attenuate the LPS-induced release of pro-inflammatory cytokines (Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eH). Consistent with the preventative remedy, post-LPS challenge administration also markedly reduced lung inflammation at 1 mg/kg compared to dexamethasone at 5 mg/kg (Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eI-M). These findings suggest that sesquiterpene lactones present in the extract of \u003cem\u003eInula helianthus aquatica\u003c/em\u003e may mitigate the severity of ARDS and reduce pulmonary inflammation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eAberrant activation of macrophage-NLRP3 inflammasome activation is associated with ARDS\u003c/h2\u003e \u003cp\u003eThe NLRP3 inflammasome is pivotal in the innate immune system's response to escalating inflammatory stimuli. To figure out the expression profile of the NLRP3 inflammasome in ARDS, we commenced by analyzing single-cell RNA sequencing data from peripheral blood mononuclear cells (PBMCs) of thirteen ARDS patients and six healthy donors, as reported by \u003cem\u003eSawitzki et al\u003c/em\u003e (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). The Human Protein Atlas single-cell database showed that NLPR3 was primarily expressed in myeloid cells (Fig.\u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA). Quantification analysis revealed an increased density of monocyte/macrophage density in ARDS patients (Fig.\u0026nbsp;1A-B). In comparison to the peripheral blood from healthy donors, levels of NLRP3 and IL-1β were markedly higher in ARDS patients (Fig.\u0026nbsp;1C, Fig.\u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB). Given that ARDS is characterized by lung inflammation arising from activation of the innate immune system. We next examined the expression patterns of NLRP3 and IL-1β through scRNA-seq analysis of bronchoalveolar lavage fluid (BALF) cells obtained from individuals with severe ARDS. Our findings reveal that the expression of NLRP3 and IL-1β genes is predominantly observed in classical and intermediate monocytes in BALF(Fig.\u0026nbsp;1D-E). Further analysis of specific gene expression in BALF was conducted. Notably, the single-cell RNA sequencing of BALF also disclosed an elevated expression of NLRP3 and IL-1β in monocytes of severe ARDS compared to those with moderate ARDS and healthy controls (Fig.\u0026nbsp;1F-G). To corroborate these findings, we assessed the activation of the NLRP3 inflammasome in ARDS patients directly, as well as in an LPS-induced ARDS mouse model. The data indicated a direct correlation between IL-1β serum levels and the severity of the condition (Fig.\u0026nbsp;1H, Table\u0026nbsp;1). Specifically, the LPS-induced ARDS murine model demonstrated a similar trend in IL-1β secretion in both serum and lung tissue (Fig.\u0026nbsp;1I-J). Western blotting analyses of caspase-1 signaling indicated pronounced cleavage and activation of pro-caspase-1 in the ARDS model (Fig.\u0026nbsp;1K, Fig.\u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC), validating the aberrant activation of NLRP3 inflammasome in ARDS.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBigelovin specifically abrogates NLRP3 inflammasome activation in vitro and in vivo\u003c/h2\u003e \u003cp\u003eIn the lung, NLPR3 was particularly expressed in macrophages (Fig.\u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eD-E). Subsequently, we explored the inhibitory effect of bigelovin, ergolide, and 8-epi-helenalin on IL-1β production in mouse bone marrow-derived macrophages (BMDMs) and human monocytic THP-1-derived macrophages at non-toxic concentrations. The results showed that bigelovin exerted the most potent suppression of IL-1β production at a concentration of 1 \u0026micro;M in these LPS/ATP-stimulated cells, compared to the other sesquiterpene lactones (Fig.\u0026nbsp;2A, S3A-B). The IC50 values for bigelovin were determined at 46.0 nM and 396.8 nM in BMDM and THP-1, respectively (Fig.\u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eC-D). Within the effective range, bigelovin did not affect the levels of other pro-inflammatory cytokines such as TNF-α and IL-6, suggesting its specific inhibition to the NLRP3 pathway (Fig.\u0026nbsp;2B-C, S3E-G). In addition to IL-1β maturation, caspase-1 activation is also implicated in cell pyroptosis and subsequent release of lactate dehydrogenase (LDH) during the activation of NLRP3 inflammasome. Bigelovin dose-dependently inhibited caspase-1 cleave and LDH release (Fig.\u0026nbsp;2D-E, S3H-I). This inhibitory effect on IL-1β production and caspase-1 activation was consistent across BMDMs and human macrophages when challenged with various NLRP3 inflammasome activators, including nigericin and monosodium urate crystals (MSU) (Fig.\u0026nbsp;2F-I, S3J-O). To further elucidate the inhibitory mechanism of bigelovin, we examined its effect on noncanonical NLRP3 inflammasome activation induced by intracellular LPS. In line with our previous observations, bigelovin significantly reduced IL-1β production and caspase-1 activation in Pam3CSK4-primed BMDMs challenged with LPS (Fig.\u0026nbsp;2J-K, S3P-Q). In monocytes, LPS alone can trigger NLRP3 inflammasome signaling. We also observed that bigelovin decreased thesecretion of IL-1β in PBMCs induced by LPS in a dose-dependent manner (Fig.\u0026nbsp;2L, S3R), illustrating its broad-spectrum NLRP3 inhibitory effect across different cell types.\u003c/p\u003e \u003cp\u003eTo further validate the role of bigelovin in inflammasome activation in \u003cem\u003evivo\u003c/em\u003e, we employed the murine silicosis model, an NLPR3-dominant disease model (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e) (Fig.\u0026nbsp;3A). Our result revealed that administering bigelovin at a dosage of 1 mg/kg dramatically enhanced survival rates, from 62.5\u0026ndash;87.5%; whereas the positive control nintedanib was less effective, even at a higher dosage of 100 mg/kg (Fig.\u0026nbsp;3B). In the measurement of pro-inflammation cytokines, it was evident that IL-1β levels were markedly reduced in the bigelovin-treated cohorts (Fig.\u0026nbsp;3C). Histopathological analysis of alveolar tissues from the model and treatment groups revealed less lung tissue damage, characterized by reduced infiltration of septal mononuclear cells, lymphocytes, alveolar macrophages, neutrophils, and diminished alveolar edema (Fig.\u0026nbsp;3D-E). Furthermore, bigelovin effectively curtailed collagen accumulation, as indicated by the staining of α-SMA and collagen I (Fig.\u0026nbsp;3F-G). Immunoblotting analysis for caspase-1 corroborated these observations, illustrating that bigelovin significantly impeded the cleavage of caspase-1, and activation of the NLRP3 inflammasome in a dose-dependent manner (Fig.\u0026nbsp;3H, Fig.\u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003eA). Besides, we also determined the NLRP3 inflammasome inhibitory role in dextran sulfate sodium (DSS)-induced colitis. In our results, bigelovin markedly inhibited the weight loss and DAI of mice induced by DSS in a dose-dependent manner (Fig.\u0026nbsp;3I, Fig.\u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003eB). In addition, colon shortening was also inhibited by bigelovin (Fig.\u0026nbsp;3J). Histological analysis and qRT-PCR analysis also revealed that bigelovin treatment reduced the destruction of the intestinal epithelium and infiltration of immune cells (Fig.\u0026nbsp;3K, Fig.\u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003eC-E). To date, the level of IL-1β in the colon was also decreased by bigelovin, suggesting the inhibitory effect of bigelovin on the NLRP3 inflammasome in \u003cem\u003evivo\u003c/em\u003e (Fig.\u0026nbsp;3L). Collectively, these findings exhibited that bigelovin could block the activation of NLRP3 inflammasome \u003cem\u003ein vivo\u003c/em\u003e and mitigate the severity of silicotic and colitis mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e\u003cem\u003eBigelovin reduces LPS-induced acute respiratory distress syndrome\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eConsidering the pivotal role of the NLRP3 inflammasome in ARDS, we next focused on whether bigelovin could prevent or mitigate ARDS in mice. Prior studies have shown that LPS administration could trigger the production of pro-inflammation cytokines such as IL-1β, IL-6, and TNF-α, and the recruitment of inflammatory cells like macrophages and neutrophils into the lungs, which further leads to damage to the pulmonary vascular endothelium, interstitial edema, recruitment of into innate immune cell the septa and alveolar space, resulting in the thickening of alveolar walls and secondary collagen deposition. In our study, mice were given vehicle or two different doses of bigelovin (0.01 and 0.1 mg/kg) via intraperitoneal injection for three days with the final dose administrated half an hour prior to the LPS challenge. Our observations indicated the treated groups showed a dose-dependent reduction in septal thickening and infiltration of monocytic cells into the bronchioles, vascular bed, and lung parenchyma. Notably, a dosage of as low as 0.1 mg/kg was sufficient to confer robust protection (Fig.\u0026nbsp;4A-C, S5A-G). Furthermore, this treatment approach significantly decreased the levels of caspase-1 (Fig.\u0026nbsp;4D, S5L).\u003c/p\u003e \u003cp\u003eIn our continued investigation of the therapeutic potential of bigelovin, we administered the same dosages (0.1 and 1 mg/kg) into the LPS-induced ARDS mice at 30 minutes and 24 hours post-LPS challenge. It was found that both respiratory symptoms and pro-inflammatory cytokine levels were alleviated, matching the efficacy of prophylactic treatment (Fig.\u0026nbsp;4E-I, S5H-I). To account for the differences in the administrative routes, we further examined the preventive effect of bigelovin orally. While a dose of 0.1 mg/kg yielded a modest protective effect, increasing the dose to 1 mg/kg significantly enhanced protection compared to the injection method (Fig.\u0026nbsp;4J-L, S5J-K). These data together demonstrated that bigelovin treatment can prevent and mitigate LPS-induced ARDS in mice. Further assessment of bigelovin's biosafety, up to 10 mg/kg dosage i.g. for thirty days indicated no toxic side effects in mice (Fig.\u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003eA-F).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eBigelovin prevents the assembly of NLRP3 inflammasome induced by the oligomerization of NLRP3\u003c/h2\u003e \u003cp\u003eIn the selective analysis, we assessed bigelovin's inhibitory effects on other inflammasomes, such as AIM2 and NLRP1. The result showed that bigelovin did not impact the activation of AIM2 inflammasome induced by poly(dA:dT) and NLRP1 inflammasome activated by MDP, suggesting that bigelovin specifically inhibited NLRP3 inflammasome activation (Fig.\u0026nbsp;5A-B). We then shift our attention to the inhibitory mechanism of bigelovin on the NLRP3 inflammasome by detecting the priming and activation stage of the NLRP3 inflammasome complex. The results showed that bigelovin could not inhibit NF-κB activation and LPS-induced transcription of \u003cem\u003eNlrp3\u003c/em\u003e, \u003cem\u003eIl1b\u003c/em\u003e, \u003cem\u003eTnfa\u003c/em\u003e, and \u003cem\u003eIl6\u003c/em\u003e at valid concentrations (0.03\u0026ndash;0.3 \u0026micro;M) in BMDMs before LPS treatment (Fig.\u0026nbsp;5C, Fig.\u003cspan refid=\"MOESM7\" class=\"InternalRef\"\u003eS7\u003c/span\u003eA-F). Additionally, bigelovin did not affect the expression of the components of the NLRP3 inflammasome machinery (Fig.\u0026nbsp;5C, Fig.\u003cspan refid=\"MOESM7\" class=\"InternalRef\"\u003eS7\u003c/span\u003eB). Bigelovin strongly inhibited the IL-1β production in BMDMs regardless of the sequence of the LPS challenge, whereas had a minor effect on TNF-α production (Fig.\u0026nbsp;5D-E). Collectively, these results illustrated that bigelovin did not affect Toll-like receptor signaling or NLRP3 priming at the doses.\u003c/p\u003e \u003cp\u003eSince bigelovin was ineffective in the upstream event leading to NLRP3 inflammasome activation, such as K\u003csup\u003e+\u003c/sup\u003e efflux and Ca\u003csup\u003e2+\u003c/sup\u003e influx, the damage to lysosome and mitochondria (Fig.\u0026nbsp;5F-J), we questioned whether it acted potential role in the assembly of NLRP3 inflammasome. Initial assessments of bigelovin's impact on the oligomerization of ASC and NLRP3 revealed a strong inhibition of this process at a concentration of 0.3 \u0026micro;M in ATP-stimulated BMDMs (Fig.\u0026nbsp;6A-B). Furthermore, immunoprecipitation studies showed that bigelovin significantly blocked the endogenous interaction between NLRP3 and its partners NEK7/ASC (Fig.\u0026nbsp;6C-F). To characterize its specific role within the NLRP3 inflammasome assembly, we examined the ATP-induced exogenous interaction between NLRP3 and NEK7/ASC, as well as the self-interaction of ASC and NLRP3 in HEK293T cells. Treatment with 0.3 \u0026micro;M bigelovin did not alter the exogenous interaction between NLRP3 and NEK7/ASC, nor the self-interaction of ASC. However, it significantly blocked the self-oligomerization of NLRP3 in HEK293T cells (Fig.\u0026nbsp;6G-N). These findings suggested that bigelovin disrupted the assembly of NLRP3 inflammasome by specifically targeting the oligomerization of NLRP3.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBigelovin directly binds to the RACK1 protein\u003c/h2\u003e \u003cp\u003eDue to the presence of α,β-unsaturated lactone/ketone in the structure of bigelovin, we suspect the compound may form a covalent bond with a potential target related to the process of NLRP3 assembly. To find a proper position for installing the pull-down tag, we screened the inhibitory effect on IL-1β among various bigelovin analogs. The results showed a significant reduction in potency when the α,β-unsaturated lactone at C\u003csub\u003e12\u003c/sub\u003e-C\u003csub\u003e14\u003c/sub\u003e position, was reduced, pointing to covalent inhibition at a cysteine residue containing in its molecular target. Removal and substitution of the acetyl group at the C\u003csub\u003e6\u003c/sub\u003e position also deteriorated the inhibitory activity (Fig. \u003cspan refid=\"MOESM8\" class=\"InternalRef\"\u003eS8\u003c/span\u003eA-B). Unfortunately, the introduction of a click chemistry handle to compound 5 resulted in a more than 10-fold drop in its activity (46 nM vs. 627 nM, Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eC and S7C), hindering the progress of our target identification efforts using the AfBPP method. Consequently, we decided to use the isoTOP-ABPP analysis, a cysteine-specific chemoproteomic approach for the target search (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) (Fig.\u0026nbsp;7A). In the cysteinome of BMDM cells, we identified 1657 bigelovin-modified cysteines presented across three biological replicates. Only cysteines belonging to four proteins (RACK1, SASH1, GBP4, AGFG2) met the threshold according to the literature, exhibiting a more than twofold increase in the ratio between the control and bigelovin-treated groups, with a \u003cem\u003ep\u003c/em\u003e-value of less than 0.1 (Fig.\u0026nbsp;7B).\u003c/p\u003e \u003cp\u003eTo refine our target search, we utilized CETSA to verify the interaction between bigelovin and specific proteins. The thermostability of SASH1, GBP4, and AGFG2 proteins remained unchanged in the presence of bigelovin (Fig.\u0026nbsp;7C-D, S9A-C). In contrast, the RACK1 protein, which significantly degraded at 49℃, exhibited increased thermostability when treated with bigelovin in BMDMs (Fig.\u0026nbsp;7F, S9E). Strikingly, bigelovin maintained the stability of RACK1 in a dose-dependently manner (Fig.\u0026nbsp;7E, Fig.\u003cspan refid=\"MOESM9\" class=\"InternalRef\"\u003eS9\u003c/span\u003eD). Mass spectrometry data confirmed that bigelovin directly binds to the Cys168 residue of RACK1. This was further substantiated by overexpressing WT-RACK1 and the RACK1 (C168A) mutant in HEK293T cells, where bigelovin stabilized the WT-RACK1 protein but not the mutant form (Fig.\u0026nbsp;7G-H). Moreover, this binding was consistent in peritoneal macrophages from mice treated with bigelovin (0.1 mg/kg), showing similar stabilization effects (Fig.\u0026nbsp;7I, S9F). To quantify the interaction of between bigelovin and RACK1, surface plasmon resonance (SPR) analysis was conducted, revealing a K\u003csub\u003eD\u003c/sub\u003e value of 0.22 \u0026micro;M (Fig.\u0026nbsp;7J). Computational docking of bigelovin with RACK1 further supported the formation of a covalent bond at the Cys168 residue, in which surrounding residues (Ser152, Ser167, and Val166) may stabilize the molecule-protein complex through non-covalent interactions (Fig.\u0026nbsp;7K).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eBigelovin blocks NLRP3 inflammasome activation mainly via inhibition of RACK1\u003c/h2\u003e \u003cp\u003eConsidering RACK1's necessity for maintaining the active conformation of NLRP3 (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e), we hypothesized that bigelovin inactivated NLRP3 inflammasome by targeting RACK1. Consistent with our hypothesis, bigelovin treatment prevented NLRP3 antibodies from fully precipitating RACK1 in BMDMs (Fig.\u0026nbsp;8A-B). A similar inhibitory result was observed in HEK293T cells using GFP and FLAG-tagged proteins (Fig.\u0026nbsp;8C-D). To determine whether the covalent binding of bigelovin to RACK1 was responsible for the inhibition of NLRP3 activation, wild-type and C168A-mutated RACK1 were co-transfected with NLRP3 into HEK293T cells, respectively. Immunoprecipitation showed that while both forms of RACK1 interacted with NLRP3, the mutant RACK1-NLRP3 interaction remained unaffected by bigelovin (Fig.\u0026nbsp;8E-F). Moreover, bigelovin treatment blocked NLRP3 oligomerization mediated by wild-type RACK1 but had a minimal impact on the NLRP3-NLRP3 interaction mediated by mutant RACK1 (Fig.\u0026nbsp;8G-H).\u003c/p\u003e \u003cp\u003eIn our final experiment, we utilized an LPS-induced ARDS model to elucidate the connection between RACK1 inhibition and NLRP3 inflammasome activation. By administering a siRNA cocktail via tail vein injection using the jetPET system, we observed that si-\u003cem\u003eRack1\u003c/em\u003e treatment led to a decrease in RACK1 expression in the lungs, which correspondingly mitigated the severity of ARDS (Fig.\u0026nbsp;8I-K, Fig.\u003cspan refid=\"MOESM10\" class=\"InternalRef\"\u003eS10\u003c/span\u003eA-D). Specifically, si-\u003cem\u003eRack1\u003c/em\u003e remarkably suppressed the expression of activated caspase-1 and the production of IL-1β in the lung compared to si-control groups, indicating an inhibition of NLRP3 inflammasome activation (Fig.\u0026nbsp;8I, Fig.\u003cspan refid=\"MOESM10\" class=\"InternalRef\"\u003eS10\u003c/span\u003eD). In contrast, the production of IL-6 was not affected in all groups (Fig.\u0026nbsp;8J). Consistently, the secretion of IL-1β was not alter by bigelovin treatment in the si-\u003cem\u003eRack1\u003c/em\u003e group but diminished by bigelovin treatment alone (Fig.\u0026nbsp;8K, Fig.\u003cspan refid=\"MOESM10\" class=\"InternalRef\"\u003eS10\u003c/span\u003eD). These findings collectively indicate that bigelovin serves as a covalent inhibitor of RACK1, thereby preventing the activation of the NLRP3 inflammasome mediated by RACK1 \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eARDS is a prevalent and severe clinical condition that develops high mortality but lacks of effective therapy in facing infectious pandemics such as COVID-19 (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Recent studies, including our work herein, have recognized the abnormal accumulations of IL-1β and its producer NLRP3 inflammasome in the collected samples from ARDS patients (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Although antagonistic therapy of IL-1β and its receptor have been entered the clinic for decades, the overall efficacy could be compromised because multiple pro-inflammatory mediators except IL‑1β could be over-produced by NLRP3 (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). On the other hand, side effects such as high risks of upper respiratory infection and pneumonia are common in the patients administrated with IL-1β antagonists. Thus, pharmacological inhibition of NLRP3 inflammasome activation may provide potent therapeutic effects in diseases with over-inflammatory responses, including ARDS. Several heterocyclic candidates including MCC950 (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e) and OLT1177 (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), as well as a series of phytochemicals such as oridonin (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e), costunolide (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e), arglabin (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e), were found directly targeting NLRP3. For example, MCC950 directly binds to the Walker B motif within the NACHT domain and blocks ATP hydrolysis (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), OLT1177 also directly targets NLRP3 NACHT domain and inhibits its ATPase activity; while oridonin covalently binds with the cysteine 279 in NACHT domain of NLRP3 to inhibit the binding of NLRP3 and NEK7, thereby blocking its assembly and activation. However, the clinical advancement of MCC950 and OLT1177 has been suspended, due to the unexpected side-effect (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e) and less efficacy in phase 2 trials (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e), respectively. The absence of approved drugs casts doubt on the viability of strategies that target NLRP3 directly.\u003c/p\u003e \u003cp\u003eIt was remarkable that phytochemicals inhibiting of NLRP3 activation possessed a common \u003cem\u003eα\u003c/em\u003e-methylene-\u003cem\u003eγ\u003c/em\u003e-lactone motif, rendering us question whether other natural sesquiterpene lactones exhibit similar pharmacological activities (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). \u003cem\u003eInula helianthus-aquatica\u003c/em\u003e, known to enrich such a structure, was identified as the major component in TCM decoctions used to treat respiratory disorders such as bronchitis and asthma (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). \u003cem\u003eIn vivo\u003c/em\u003e models of ARDS demonstrated that three sesquiterpene lactones found in the plant, bigelovin, ergolide, and 8epi-helenalin, showed potent preventive and therapeutic effects. Although previous research have also reported their anti-inflammation activity, the mechanisms remained uncertain (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Our research here defined that these compounds inhibit NLRP3 inflammasome activation at nanomolar concentrations, with bigelovin showing the most potent activity in both mouse and human macrophages.\u003c/p\u003e \u003cp\u003eAccording to our results, bigelovin selectively inhibits various forms of NLRP3 inflammasome activation\u0026mdash;canonical, noncanonical, and alternative\u0026mdash;without impacting other inflammasomes like AIM2 and NLRP1. Two salient insights regarding its anti-inflammatory mechanism featured further notes. (i) The anti-inflammatory activity of bigelovin is concentration-dependent. Figures\u0026nbsp;2 and 4 illustrate that the concentration required to inhibit NLRP3 inflammasome activation and the subsequent release of IL-1β is significantly lower than that affecting IL-6 and TNF-α production, which is mediated transcriptionally via the NF-κB pathway. This aligns with prior findings that bigelovin suppresses NF-κB activation and pro-inflammatory cytokine production starting at a concentration of 2 \u0026micro;M (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Notably, our in vivo model also verified that IL-1β levels were more significantly reduced than IL-6 at equivalent dosages (Fig.\u0026nbsp;4). (ii) The method and timing of administration influence the therapeutic outcomes in the ARDS mice. While oral administration yielded positive results, pre-LPS challenge injection proved to be the optimal approach for acute inflammation, indicating that the bioavailability of bigelovin is unsatisfactory. Consequently, we infer that administering a low dosage of bigelovin via injection or employing advanced pharmaceutical technologies to target lung tissue, could amplify its therapeutic benefits and minimize side effects in treating NLRP3-related inflammatory lung conditions. This will be the focus of our subsequent lead optimization efforts.\u003c/p\u003e \u003cp\u003eIn addition, the upstream events in the process of NLRP3 activation, such as K\u003csup\u003e+\u003c/sup\u003e efflux or Ca\u003csup\u003e2+\u003c/sup\u003e influx, mitochondrial damage and lysosome damage were not interfered by bigelovin intervention. Importantly, our results showed that bigelovin could block the interaction of NLRP3 and NEK7 as well as the interaction of NLRP3 and ASC, and the oligomerization of NLRP3 and the assembly of ASC specks, which are indispensable for NLRP3 inflammasome assembly and activation. Subsequently, we determined that bigelovin inhibited the self-association of NLRP3 by conducting the overexpression experiment in HEK293T cells, revealing that NLRP3 activation mainly through regulation NLRP3 oligomerization at low concentrations. During the activation of the NLRP3 inflammasome, the NACHT domain of NLRP3 plays a pivotal role in its oligomerization and subsequent activation. Although recent cryo-electron microscopy structure studies revealed that NLRP3 was segregated into two distinct oligomeric states, the smaller complex is largely lack of activity. There is no doubt that PAMPs or DAMPs stimuli induce NLRP3 from a closed, auto-inhibited conformation to an active \u0026lsquo;\u0026lsquo;open\u0026rsquo;\u0026rsquo; conformation that coincides with its oligomerization (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecent studies using cryo-electron microscopy have revealed that the NACHT domain of NLRP3, also known as NOD, transitions from a closed, auto-inhibited, ADP-bound inactive state to an open, ATP-bound active state before its oligomerization and subsequent activation (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). NEK7 was successfully identified as a chaperones inserts into the leucine-rich repeat (LRR) domain, releasing the nucleotide-binding domain (NBD) and facilitating nucleotide exchange. However, NEK7 alone is not sufficient to conduct such large conformational changes, as ADP remains bound to the NBD in the NLRP3-NEK7 complex (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). RACK1, was discovered to be another binding partner interacts wih the NLRP3-NEK7 complex at the NACHT region, independently of its activated protein kinase C (PKC) kinase activity. Although further structural insights into the conformational changes are required, knockdown and bioluminescence resonance energy transfer (BRET) experiments have helped delineate the conformational transition of NLRP3 in response to RACK1. Our study is the first to illustrate that bigelovin acts as a Michael receptor, forming a covalent bond with Cys168 on RACK1, which significantly inhibits its interaction with NLRP3, thereby hindering activation. Wild-type or mutant RACK1 revealed that cysteine 168 is the key residue in the interaction between RACK1 and NLRP3, providing structural insight into how RACK1 mediated the self-interaction of NLRP3. We also sought to corroborate the mechanism of biglovin in the ARDS mouse model. Despite the fact that that complete deletion of RACK1 is lethal for early embryonic development, treatment with siRNA showed that \u003cem\u003eRack1\u003c/em\u003e knockdown remarkably attenuated caspase-1 activation and IL-1β secretion in the lung tissue, whereas the production of IL-6 was less affected. Following our finding, the secretion of IL-1β in alveolar macrophages in \u003cem\u003evivo\u003c/em\u003e was no longer altered by bigelovin administration in the \u003cem\u003eRack1\u003c/em\u003e knockdown group, which validated the molecular mechanism of RACK1 and NLRP3 activation as well as the accuracy of cysteinomic ABPP method in the target identification. Indeed, tail vein injection of siRNA by the jetPET system is generalized to reduce target protein. We could not exclude that RACK1 inhibition in the cells other than alveolar macrophage took effect in reducing over-inflammation.\u003c/p\u003e \u003cp\u003eFinally, covalent inhibitors have been confronted with safety concerns due to the presence of Michael acceptor. However, bigelovin only tackled four different proteins with statistical significance in the cysteinome of BMDMs, illustrating the structure may be stable to most bioactive cysteine residues in the concentration range effective to Rack1. The in vivo study also proved bigelovin exhibited no toxicity at a 100-fold dose (10 mg/kg, i.g.) compared to its positive dose in mice (0.1 mg/kg, ig).\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003eC57BL/6J mice (male, 6\u0026ndash;8 weeks) were purchased from Gempharmatech Co., Ltd. (Nanjing, Jiangsu, China). All mice experiments were conducted following the Guide for the Care and Use of Laboratory Animals (Ministry of Science and Technology of China, 2006) and were approved by the Animal Ethics Committee of Nanjing University of Chinese Medicine.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003e Human Peripheral Blood Mononuclear Cell (PBMCs) were isolated from healthy volunteers this study were approved by the Institutional Research Ethics Committee of Jiangsu Provincial Hospital of Chinese Medicine (Approved Number: 2021NL-095-02). Bone marrow-derived macrophages (BMDMs) were cultured in RPMI 1640 medium supplemented with 20% L929 supernatant. PBMCs, L929 cells (ATCC), THP-1 cells (ATCC) were cultured in RPMI 1640 and HEK293T cells (ATCC) were cultured in DMEM, all medium were supplemented with 10% fetal bovine serum, and 1% Penicillin/Streptomycin. And cells were cultured in a constant humidity incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAntibodies and reagents\u003c/h2\u003e \u003cp\u003eAnti-NLRP3 (Adipogen, AG-20B-0014-c100), Anti-Caspase-1\u0026thinsp;+\u0026thinsp;p10\u0026thinsp;+\u0026thinsp;p12 (Abcam, ab179515), Anti-IL-1β\u0026thinsp;+\u0026thinsp;p17 (Abcam, ab234437), Anti-Asc (Adipogen, AG-25B-0006-c100), Anti-Phospho-NF-kappaB p65 (Abmart, TP56372F), Anti-NF-кB p65 (Abmart, T55034F), Anti-β-actin (Abmart, T401045), Anti-GAPDH (Abmart, P60037), Anti-β-tublin (Abmart, M20005), Anti-FLAG (Abmart, M20008), Anti-HA (Abmart, M20003), Anti-GFP (Santa Cruz, sc-9996), Anti-RACK1 (Huabio, ET7109-04), Anti-SASH1 (Bioss, bs-6099R), Anti-AGFG2 (UpingBio, YP-Ab-04108), Anti-GBP4 (Abmart, PA5012), Anti-FITC-ly6G (Biolegend, 127605), Anti-APC-F4/80 (Biolegend, 123116), Anti-Collagen Type Ⅰ (Proteintech, 14695-1-AP), Anti-Smooth muscle actin (Proteintech, 14395-1-AP), Goat anti-mouse IgG (Abbkine, A21010), Goat anti-rabbit IgG (Abbkine, A21020). Recommended concentrations were used for all antibodies.\u003c/p\u003e \u003cp\u003eLipopolysaccharides (LPS, Sigma, L4391), Adenosine triphosphate (ATP, Aladdin, A100885), Uric acid sodium salt (MSU, Sigma, U2B75), Nigericin (Shanghai Yuanye Bio-Technology, S25116), Pam3CSK4 (Invitrogen, tlrl-pms), Muramyl Dipeptide (MDP, Absin, abs45126715), Poly(dA:dT) (Invitrogen, tlrl-patn), PMA (Sigma, P1585), MCC950 (TargetMOI, XSD20220316-00020), Dexamethasone (Dex, Sigma, D4902), Nintedanib (Meilunbio, MB7360).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eChemistry\u003c/h2\u003e \u003cp\u003eThe dried flowers of \u003cem\u003eInula helianthus aquatilis\u003c/em\u003e C. Y. Wu ex Y. Ling were added to 10 times the amount of 70% ethanol and cold-soaked for 2 h, followed by 3 rounds of reflux extraction for 2 h each. The filtrate was then combined and subjected to column chromatography using macroporous resin D101 with a gradient elution of 30%-90% ethanol. The components were tracked by HPLC, enriching the sesquiterpene lactone fraction, which was then quantified for subsequent activity evaluation.\u003c/p\u003e \u003cp\u003eThe dried flowers of \u003cem\u003eInula helianthus aquatilis\u003c/em\u003e C. Y. Wu ex Y. Ling (300 g) were extracted under reflux with PE (3 L \u0026times; 2 h, three times). After removal of the PE in vacuo, the combined extract (15 g) was subjected to silica gel column chromatography (PE/EA, 200:1\u0026rarr;2:1), monitoring by thin layer chromatography. The extract was chromatographically separated on a silica gel column and eluted with PE-EA to obtain ergolide (430 mg), bigelovin (153 mg), and 8-epi-helenalin (150 mg).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eSingle-cell RNA Sequencing (scRNA-seq) analysis\u003c/h2\u003e \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e \u003ch2\u003ePBMC Sample\u003c/h2\u003e \u003cp\u003eA dataset of scRNA-seq (GSE175450) was collected from the Tumor Immune Single-cell Hub (TISCH) database (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). The standard workflow for processing scRNA-seq data was performed using the R package \u0026ldquo;Seurat V4\" (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). We used the Uniform Manifold Approximation and Projection (UMAP) coordinates and annotation information provided by TISCH and visualized them with the \"plot1cell\" package (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). The expression of genes and gene signatures was described by the \u0026ldquo;scRNAtoolVis\u0026rdquo; package(\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eBALF Sample\u003c/h2\u003e \u003cp\u003eUsing cell type-specific marker gene expression analysis, cell types were distinguished from the scRNA-seq data. The R packages \u0026lsquo;celldex\u0026rsquo; and \u0026lsquo;SingleR\u0026rsquo; were used to classify the immune cell populations, including but not limited to T cells, B cells, natural killer cells, dendritic cells, and monocytes. Each immune cell type was identified based on its known marker genes and characterized by its distinct gene expression signature using the \u0026lsquo;MonacoImmuneData\u0026rsquo; reference index, which contains normalized expression values of 114 bulk RNA-seq samples derived from sorted immune cell populations, enabling high-resolution profiling of immune cell transcriptome (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eInflammasome stimulation\u003c/b\u003e (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eCanonical NLRP3 inflammasome was activated as follows: BMDMs were primed with LPS (100 ng/mL) for 3 h and treated with bigelovin for 1 h, followed by ATP (5 mM) for 45 min, nigericin (5 \u0026micro;M) for 45 min, and MSU (500 \u0026micro;g/mL) for 12 h. For noncanonical NLRP3 activation, the cells were primed with Pam3CSK4 (500 ng/mL) for 3 h and treated with bigelovin for 1 h. After that, LPS (2 \u0026micro;g) were transfected into BMDMs using Lipofectamine 3000 (Invitrogen, L3000015) for 24 h. For alternative NLRP3 activation, PBMCs were treated with bigelovin for 1 h and then stimulated with LPS (100 ng/mL) for 16 h.\u003c/p\u003e \u003cp\u003eOther inflammasomes were stimulated as follows: For NLRP1 inflammasome activation, BMDMs were primed with LPS (100 ng/mL) for 3 h and treated with bigelovin for 1 h. Subsequently, the cells were stimulated with MDP (10 \u0026micro;g/mL) for 24 h. AIM2 inflammasome activation was obtained by transfection of 2 \u0026micro;g poly(dA:dT) using Lipofectamine 3000 (Invitrogen, L3000015) for 6 h.\u003c/p\u003e \u003cp\u003eTHP-1 cells were primed with PMA (500 nM) for 3 h and then treated with bigelovin for 1 h after stimulated with LPS (100 ng/mL) for 3 h. Subsequently, the cells were stimulated with ATP (5 mM) for 45 min.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eThe ELISA experiments producure has been described previously(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eCell counting kit 8 (CCK-8)\u003c/h2\u003e \u003cp\u003eThe CCK-8 assasy has been described previously(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) .\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eLactate dehydrogenase assay (LDH)\u003c/h2\u003e \u003cp\u003eBMDMs were seeded in 24-well plates overnight and stimulated with 100 ng/mL LPS for 3 h, treated with bigelovin at the indicated concentrations for 1 h. After that, stimulated with 5 mM ATP for 45 min, LDH release was detected by the LDH Cytotoxicity Assay Kit (Beyotime, C0016) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot and co-immunoprecipitation\u003c/h2\u003e \u003cp\u003eThe protocols for immunoprecipitation and co-immunoprecipitation assay has been described previously(\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e \u003cb\u003eQuantitative real-time PCR (\u003c/b\u003eqRT-PCR\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe protocols for qRT-PCR has been described previously(\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). The primer sequences used in the study were described below:\u003c/p\u003e \u003cp\u003e \u003cem\u003eGapdh\u003c/em\u003eMusFor: CATCACTGCCACCCAGAAGACTG\u003c/p\u003e \u003cp\u003e \u003cem\u003eGapdh\u003c/em\u003eMusRev: ATGCCAGTGAGCTICCCGITCAG\u003c/p\u003e \u003cp\u003e \u003cem\u003eIl1b\u003c/em\u003eMusFor: TGGACCTTCCAGGATGAGGACA\u003c/p\u003e \u003cp\u003e \u003cem\u003eIl1b\u003c/em\u003eMusRev: GTTCATCTCGGAGCCTGTAGTG\u003c/p\u003e \u003cp\u003e \u003cem\u003eIl6\u003c/em\u003eMusFor: TACCACTTCACAAGTCGGAGGC\u003c/p\u003e \u003cp\u003e \u003cem\u003eIl6\u003c/em\u003eMus Rev: CTGCAAGTGCATCATCGTIGTTC\u003c/p\u003e \u003cp\u003e \u003cem\u003eTnfa\u003c/em\u003eMusFor: CGTGCCTATGTCTCAGCCTCTT\u003c/p\u003e \u003cp\u003e \u003cem\u003eTnfa\u003c/em\u003eMusRev: GCCATAGAACTGATGAGAGGGAG\u003c/p\u003e \u003cp\u003e \u003cem\u003eRack1\u003c/em\u003eMusFor: TCCTCTGATGGTCAGTTTGCCC\u003c/p\u003e \u003cp\u003e \u003cem\u003eRack1\u003c/em\u003eMusRev: CACGCTCAACACATCCTTGGTG\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eASC oligomerization assay\u003c/h2\u003e \u003cp\u003eThe assay for ASC oligomerization has been described previously (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eNLRP3 oligomerization assay\u003c/b\u003e (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eBMDMs were stimulated by ATP (5 mM) as described above. The cells were collected and resuspended in HEPES, subjected to 20 strokes of homogenization using a syringe, followed by centrifugation at 4\u0026deg;C, 900 \u003cem\u003eg\u003c/em\u003e for 8 minutes to remove cell nucleus and unbroken cells. After centrifugation at 6200 \u003cem\u003eg\u003c/em\u003e for 8 min, supernatants were discarded and the pellets were resuspended in 200 \u0026micro;L of HEPES. DSS (2 mM) was incubated at room temperature for 1 h for cross-linking and then was dissolved in the sample buffer. And Western blotting was performed for detection of NLRP3 oligomerization.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eIntracellular Ca\u003csup\u003e2+\u003c/sup\u003e and K\u003csup\u003e+\u003c/sup\u003e measurement\u003c/h2\u003e \u003cp\u003eBMDMs after stimulation were washed with PBS. After digestion by pancreatic enzymes, the cells were centrifuged and washed again. Subsequently, BMDMs were incubated with Fluo-4 AM (2 \u0026micro;M) (Beyotime, S1060) for 30 min at 37\u0026deg;C. After centrifugation, the samples were resuspended in 300 \u0026micro;L PBS and incubated for 30 min at 37\u0026deg;C once more and subsequently analyzed by flow cytometry on Beckman Coulter Gallios.\u003c/p\u003e \u003cp\u003eBMDMs were incubated with ION Potassium Green-2 AM (10 \u0026micro;M) (Abcam, ab142806) for 15 min at 37\u0026deg;C and then stimulated with 5 mM ATP for 45 min. The levels of intracellular K\u003csup\u003e+\u003c/sup\u003e were determined by flow cytometry on Beckman Coulter Gallios.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eMeasurement of lysosome rupture\u003c/h2\u003e \u003cp\u003eBMDMs after stimulation were washed with RPMI 1640 medium once. The cells were loaded with Lyso-Tracker Red (1 \u0026micro;M) (Solarbio, L8010) for 30 min at 37\u0026deg;C. After that, the cells were digested by pancreatic enzymes before centrifugation and washed with PBS once. The samples were analyzed by flow cytometry after resuspending in 200 \u0026micro;L PBS.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eMeasurement of mtROS\u003c/h2\u003e \u003cp\u003eBMDMs were stimulated by ATP as previously described. Then, the cells were washed twice with PBS and incubated with DCFH-DA (10 \u0026micro;M) (Beyotime, S0033) for 30 min at 37\u0026deg;C. After centrifugation, the samples were resuspended in 200 \u0026micro;L PBS after rinsing and subsequently analyzed by flow cytometry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eConfocal microscopy\u003c/h2\u003e \u003cp\u003eBMDMs after stimulation were incubated with Mito-Tracker Red CMXRos (200 nM) (Beyotime, C0135) for 30 min before sample collection. The cells were washed twice with PBS and fixed with 4% PFA for 30 min at room temperature. Then, the cells were washed three times by PBST and stained with DAPI (Beyotime, C1005) for 10 min. Subsequently, the cells were washed three times by PBST again. Confocal microscopy analysis was analyzed by fluorescence microscope on Lecia TCS SP8.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid transfection\u003c/h2\u003e \u003cp\u003ePlasmids of FLAG-NLRP3, GFP-NLRP3, FLAG-NEK7, FLAG-ASC, GFP-ASC, GFP-Vector, GFP-RACK1, GFP-RACK1 C168A were manufactured by General Biotechnology (Hefei, China). DNA of plasmids were transfected to HEK293T using Lipofectamine 3000 for 24 h, then cells were treated with bigelovin for another 24 h for co-immunoprecipitation assays.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003eisoTOP-ABPP Cysteine Chemoproteomic Profiling\u003c/h2\u003e \u003cp\u003eThe BMDMs were with (100 ng/mL) LPS for 3 h, then 1 \u0026micro;M bigelovin or the corresponding concentration of the DMSO was added. Cells steady at 37℃ for 1 h before lysis with PBS. Protein concentration was determined with BCA assay and the concentration was adjusted to 1 \u0026micro;g/\u0026micro;L with PBS. For biological replicates, two aliquots of 1 mL cell lysates were prepared. Each aliquot was treated with 100 \u0026micro;M IA-alkyne at room temperature (RT) for 1 h The click reaction reagent containing 60 \u0026micro;L 0.9 mg/mL TBTA (in 4:1 tBuOH/DMSO), 20 \u0026micro;L 12.5 mg/mL CuSO\u003csub\u003e4\u003c/sub\u003e (in H\u003csub\u003e2\u003c/sub\u003eO), 20 \u0026micro;L 13 mg/mL TCEP (in H\u003csub\u003e2\u003c/sub\u003eO) and 20 \u0026micro;L 5 mM light isoDTB tags (DMSO) or heavy isoDTB tags (bigelovin) were prepared. Samples were treated with 120 \u0026micro;L click reaction reagent at RT for 1 h. After incubation, the light and heavy labeled samples were combined and precipitated with cold acetone. Protein precipitates were washed with methanol and dissolved followed by enrichment with streptavidin agarose beads. After reduction and alkylation, on-bead digestion was performed with 10 ng/\u0026micro;L trypsin at 37℃ overnight. The beads were washed and then peptides attached to the beads were eluted with 0.1% formic acid in 50% acetonitrile in water. Peptides were analyzed on a Q Exactive Plus with an EASY-nLC 1200 system. Samples were separated at a flow rate of 300 nL/min using the following gradient: 2\u0026ndash;5% buffer B (80% acetonitrile with 0.1% formic acid in H\u003csub\u003e2\u003c/sub\u003eO) in buffer A (0.1% formic acid in H\u003csub\u003e2\u003c/sub\u003eO) for 2 min, followed by a gradient from 5%-32% B for 76 min, 32%-45% buffer B for 5 min, 45%-100% B for 2 min and holding at 100% B for 2 min. Column temperature was maintained at 50℃. The scan range of MS1 was 300-1,700 m/z with a resolution of 70,000 (at 200 m/z), with an AGC target of 3\u0026times;10\u003csup\u003e6\u003c/sup\u003e and a maximum injection time of 50 ms. The top 20 precursors were selected for MS/MS analysis with a resolution at 17,500 (at 200 m/z), AGC target 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e, and a maximum injection time of 100 ms. The isolation window of precursors was 2 m/z. Normalized collision energy was set at 27 eV with a 30 s dynamic exclusion window. Data analysis for the isoTOP-ABPP assay was carried out as described previously (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCellular thermal shift assay (CETSA)\u003c/b\u003e (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eThe BMDMs were incubated with bigelovin (300 \u0026micro;M) or DMSO for 1 h. Harvested cells were frozen and thawed three times by liquid nitrogen. The proteins were separated from cells by centrifuging at 15,000 \u003cem\u003eg\u003c/em\u003e for 10 min at 4 ℃. Subsequently, the supernatant was equally divided into 6 parts and heated for 3 min at different temperatures and detected protein level by immublotting.\u003c/p\u003e \u003cp\u003eC57BL/6 mice were injected intraperitoneally bigelovin (0.1 mg/kg) for three consecutive days, and then peritoneal macrophages were harvested to CETSA \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSurface Plasmon Resonance (SPR)\u003c/h3\u003e\n\u003cp\u003eThe binding affinity between bigelovin and recombinant human RACK1 protein (Biorbyt, orb754920) was assayed using a GE Biacore T200 instrument. RACK1 protein was loaded to the CM5 sensor chip (Cytiva, 2205-4643-AE). The concentration gradient bigelovin was prepared with running buffer (1\u0026times;PBS-P, 5% DMSO), and flowed over the chip. The parameters of SPR used in the study were described below: flow rate, 30 \u0026micro;L/min; temperature, 25\u0026deg;C; association time, 60 s; disassociation time, 120 s. The equilibrium dissociation constant (\u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003eD\u003c/em\u003e\u003c/sub\u003e) was calculated using Biacore T200 Evaluation Software.\u003c/p\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003eMolecular docking\u003c/h2\u003e \u003cp\u003eThe protein structure of RACK1 (UniProt ID: D6RBD0) was derived from the AlphaFold Protein Structure Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://alphafold.ebi.ac.uk/\u003c/span\u003e\u003cspan address=\"https://alphafold.ebi.ac.uk/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and prepared by Schr\u0026ouml;dinger 2019 protein wizard module. The amino acid sequence in D6RBD0 was renumbered based on the sequence utilized in the constructed plasmid transfected into the cells. Bigelovin was processed using the LigPrep module and docked using the covalent dock module in the Schr\u0026ouml;dinger 2019. During the setup process, the reaction type was selected as Michael addition and the scoring function was set to Extra Precision.\u003c/p\u003e \u003cp\u003e \u003cb\u003eLPS-induced mice\u003c/b\u003e (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eTo assess the preventive effect, C57BL/6J mice were injected intraperitoneally fractions (0.1 or 1 mg/kg), bigelovin (10 or 100 \u0026micro;g/kg), vehicle, dexamethasone (5 mg/kg) for three consecutive days. Thirty minutes after the last dose, 7.5 mg/kg LPS (Sigma, L2630) was injected intraperitoneally. The serum, BALF and lung tissues were collected after 12 h, and inflammatory cytokines were measured by qRT-PCR or ELISA. The number of cells in the BALF was counted, and the number of macrophages (F4/80\u003csup\u003e+\u003c/sup\u003e cells) and neutrophils (Ly6G\u003csup\u003e+\u003c/sup\u003e cells) in the BALF were analyzed by flow cytometry. Lung samples were collected 24 h after LPS administration and fixed in 4% paraformaldehyde for histopathological evaluation. The prophylactic effect of oral bigelovin (0.1 or 1 mg/kg) administration was evaluated as described above. To study the therapeutic effect, the mice were injected intraperitoneally 7.5 mg/kg LPS. After 30 minutes, the mice were injected intraperitoneally fractions (0.1 or 1 mg/kg), bigelovin (10 or 100 \u0026micro;g/kg), vehicle, and dexamethasone (5 mg/kg). The mice were euthanized 24 h later. At the experimental endpoint, serum and lungs were collected for detection of mRNA, protein, or pathological damage.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003eBiosafety evaluation\u003c/h2\u003e \u003cp\u003eC57BL/6J mice were intragastric administration of bigelovin (1 mg/kg, 10 mg/kg) for thirty consecutive days. The weight and overall condition of the mice were monitored throughout the experiment. On day 30, the mice were euthanized, and liver, heart, spleen, lung, kidney, and colon tissues were collected for subsequent analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRACK1 knockdown\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eThe siRNAs (si\u003cem\u003eControl\u003c/em\u003e: 5\u0026acute;-UUCUCCGAACGUGUCACGUTT-3\u0026acute;; si\u003cem\u003eRACK1\u003c/em\u003e: 5\u0026acute;-GUAGAUGAAUUGAAGCAAGTT-3\u0026acute;) were synthesized by General Biotechnology (Hefei, China). C57BL/6J mice were intravenously injected with siRNA (80 \u0026micro;g per mouse) using \u003cem\u003ein vivo\u003c/em\u003e-jetPEI (Polyplus, 101000030), followed by intraperitoneal injection of 7.5 mg/kg LPS 48 h later, and then the mice were injected intraperitoneally bigelovin for 12 h. The lung tissues were collected for the further assay.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSiO\u003c/b\u003e \u003csub\u003e \u003cb\u003e2\u003c/b\u003e \u003c/sub\u003e \u003cb\u003e-induced mice\u003c/b\u003e (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eC57BL/6J mice were randomly divided into five groups, including normal, model, bigelovin (intraperitoneal injection of 0.1 mg/kg, 1 mg/kg), and positive control group treated with nintedanib (intragastric administration of 100 mg/kg). The SiO\u003csub\u003e2\u003c/sub\u003e (Sigma, S5631) suspension (300 mg/kg) was injected into the trachea of mice, and the control group was injected with physiological saline. Seven days after SiO\u003csub\u003e2\u003c/sub\u003e treatment, mice were injected intraperitoneally with bigelovin or given nintedanib by gavage for 14 consecutive days. On day 21, the mice were euthanized for subsequent analysis.\u003c/p\u003e \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e \u003ch2\u003eDSS-induced colitis\u003c/h2\u003e \u003cp\u003eColitis in mice was induced by 2.5% DSS in drinking water for 7 consecutive days followed by a 2-day tapwater period, according to previous research (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). The bigelovin at the dose of 0.01, 0.1 mg/kg was given intraperitoneally once a day for 7 days during DSS administration. The solvent was given intraperitoneally to both sham and model groups as vehicle control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section3\"\u003e \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e \u003cp\u003eFormalin-fixed, paraffin-embedded tissues from mice were stained with Anti-Collagen Type Ⅰ antibody and Anti-Smooth muscle actin as previously described (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec35\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were performed using GraphPad Prism 8.0.1. All data were analyzed by two-tailed \u003cem\u003et\u003c/em\u003e-tests or one-way ANOVA (clinical samples) as appropriate, and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data and search files have been deposited to the iProX and can be accessed with the dataset identifier PXD053000.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the National Natural Science Foundation of China (82204401, U2102201, 82073719), the Key Industrial and Research Program of Jiangsu Provincial \u0026ldquo;333 Talent\u0026rdquo; (No. 2022-2-245), the Research Projects of Jiangsu Higher Education (No.22KJB3310012), the support project of the National Natural Science Foundation of China from Nanjing University of Chinese Medicine (XPT82204401), Postgraduate Research \u0026amp; Practice Innovation Program of Jiangsu Province (KYCX21_1787).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJC, MY and L-H H conceived the research; JC, MY , C-L Y, Y-N Z and L-H H \u0026nbsp;designed the methodology; JC and MY, YG, AP, Q-X Y, X-M P and A-Y W performed the experiments; JC, MY, Y-N Z wrote the original draft of the manuscript; JC, Y-NZ and L-H H reviewed and edited the manuscript; JC, Y-NZ and L-H H were involved in acquiring funding; JC, H-D Z, Y H, YW H, and QW were involved in obtaining resources; Y W and J-P L were involved in single cell sequencing analysis, Z-C J contributed to molecular docking, JC, Y-NZ and L-H H supervised the study. All authors gave final approval of the submitted and published versions of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eN. J. Meyer, L. Gattinoniand, C. S. Calfee, Acute respiratory distress syndrome. Lancet. 398, 622\u0026ndash;637 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. D. J. Bosand, L. B. Ware, Acute respiratory distress syndrome: causes, pathophysiology, and phenotypes. Lancet. 400, 1145\u0026ndash;1156 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. A. Matthay, R. L. Zemans, G. A. Zimmerman, Y. M. Arabi, J. R. Beitler, A. Mercat, M. Herridge, A. G. Randolphand, C. S. Calfee, Acute respiratory distress syndrome. Nat Rev Dis Primers. 5, 18 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eN. SinhaandA, K. Thakur, Likelihood of amyloid formation in COVID-19-induced ARDS. Trends Microbiol. 29, 967\u0026ndash;969 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. Nye, R. J. Whitleyand, M. Kong, Viral infection in the development and progression of pediatric acute respiratory distress syndrome. Front Pediatr. 4, 128 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK. Peukert, M. Fox, S. Schulz, C. Feuerborn, S. Frede, C. Putensen, H. Wrigge, B. M. Kummerer, S. David, B. Seeliger, T. Welte, E. Latz, D. Klinman, C. Wilhelm, F. Steinhagenand, C. Bode, Inhibition of caspase-1 with tetracycline ameliorates acute lung injury. Am J Respir Crit Care Med. 204, 53\u0026ndash;63 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. C. Ferreira, V. C. Soares, I. G. de Azevedo-Quintanilha, S. D. S. G. Dias, N. Fintelman-Rodrigues, C. Q. Sacramento, M. Mattos, C. S. de Freitas, J. R. Temerozo, L. Teixeira, H. E. Damaceno, E. A. Barreto, CRR Pao, L. Palhinha, M. Miranda, D. C. Bou-Habib, F. A. Bozza, P. T. Bozzaand, T. M. L. Souza, SARS-CoV-2 engages inflammasome and pyroptosis in human primary monocytes. Cell Death Discov. 7, 43 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQ. Ma, Pharmacological inhibition of the NLRP3 inflammasome: structure, molecular activation, and inhibitor-NLRP3 interaction. Pharmacol Rev. 75, 487\u0026ndash;520 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. Xiao, V. G. Magupalliand, H. Wu, Cryo-EM structures of the active NLRP3 inflammasome disc. Nature. 613, 595\u0026ndash;600 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT. Tang, X. Lang, C. Xu, X. Wang, T. Gong, Y. Yang, J. Cui, L. Bai, J. Wang, W. Jiangand, R. Zhou, CLICs-dependent chloride efflux is an essential and proximal upstream event for NLRP3 inflammasome activation. Nat Commun. 8, 202 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. S. Lee, N. Subramanian, A. I. Kim, I. Aksentijevich, R. Goldbach-Mansky, D. B. Sacks, R. N. Germain, D. L. Kastnerand, J. J. Chae, The calcium-sensing receptor regulates the NLRP3 inflammasome through Ca\u003csup\u003e2+\u003c/sup\u003e and cAMP. Nature. 492, 123\u0026ndash;127 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. Akbal, A. Dernst, M. Lovotti, M. S. J. Mangan, R. M. McManus, E. Latz, How location and cellular signaling combine to activate the NLRP3 inflammasome. Cell Mol Immunol. 19, 1201\u0026ndash;1214 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. Guo, Z. Chi, D. Jiang, T. Xu, W. Yu, Z. Wang, S. Chen, L. Zhang, Q. Liu, X. Guo, X. Zhang, W. Li, L. Lu, Y. Wu, B. L. Songand, D. Wang, Cholesterol homeostatic regulator SCAP-SREBP2 integrates NLRP3 inflammasome activation and cholesterol biosynthetic signaling in macrophages. Immunity. 49, 842\u0026ndash;856 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZ. R. Zhang, G. Meszaros, W. T. He, Y. F. Xu, H. d. F. Magliarelli, L. Mailly, M. Mihlan, Y. S. Liu, M. P. Gamez, A. Goginashvili, A. Pasquier, O. Bielska, B. Neven, P. Quartier, R. Aebersold, T. F. Baumert, P. Georgel, J. H. Han, R. Ricci, Protein kinase D at the Golgi controls NLRP3 inflammasome activation. J Exp Med. 214, 2671\u0026ndash;2693 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eV. G. Magupalli, R. Negro, Y. Tian, A. V. Hauenstein, G. D. Caprio, W. Skillern, Q. Deng, P. Orning, H. B. Alam, Z. Maliga, H. Sharif, J. J. Hu, C. L. Evavold, J. C. Kagan, F. I. Schmidt, K. A. Fitzgerald, T. Kirchhausen, Y. Liand, H. Wu, HDAC6 mediates an aggresome-like mechanism for NLRP3 and pyrin inflammasome activation. Science. 369, eaas8995 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. He, M. Y. Zeng, D. Yang, B. Motroand, G. Nunez, NEK7 is an essential mediator of NLRP3 activation downstream of potassium efflux. Nature. 530, 354\u0026ndash;357 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK. Nozakiand, E. A. Miao, A licence to kill during inflammation. Nature. 570, 316\u0026ndash;317 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQ. Lv, Y. Xing, J. Liu, D. Dong, Y. Liu, H. Qiao, Y. Zhangand, L. Hu, Lonicerin targets EZH2 to alleviate ulcerative colitis by autophagy-mediated NLRP3 inflammasome inactivation. Acta Pharm Sin B. 11, 2880\u0026ndash;2899 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. R. A. Zanon, L. Lewaldand, S. M. Hacker, Isotopically labeled desthiobiotin azide (isoDTB) tags enable global profiling of the bacterial cysteinome. Angew Chem Int Ed Engl. 59, 2829\u0026ndash;2836 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. L. Huang, Y. M. Wang, X. W. Li, L. L. Ren, J. P. Zhao, Y. Hu, L. Zhang, G. H. Fan, J. Y. Xu, X. Y. Gu, Z. S. Cheng, T. Yu, J. A. Xia, Y. Wei, W. J. Wu, X. L. Xie, W. Yin, H. Li, M. Liu, Y. Xiao, H. Gao, L. Guo, J. G. Xie, G. F. Wang, R. M. Jiang, Z. C. Gao, Q. Jin, J. W. Wang, B. Cao, Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 395, 497\u0026ndash;506 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Lyu, G. Fan, G. Xiao, T. Wang, D. Xu, J. Gao, S. Ge, Q. Li, Y. Ma, H. Zhang, J. Wang, Y. Cui, J. Zhang, Y. Zhuand, B. Zhang, Traditional Chinese medicine in COVID-19. Acta Pharm Sin B. 11, 3337\u0026ndash;3363 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK. W. Nam, G. T. Oh, E. K. Seo, K. H. Kim, U. Koo, S. J. Leeand, W. Mar, Nuclear factor kappaB-mediated down-regulation of adhesion molecules: possible mechanism for inhibitory activity of bigelovin against inflammatory monocytes adhesion to endothelial cells. J Ethnopharmacol. 123, 250\u0026ndash;256 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. Georg, R. Astaburuaga-Garcia, L. Bonaguro, S. Brumhard, L. Michalick, L. J. Lippert, T. Kostevc, C. Gabel, M. Schneider, M. Streitz, V. Demichev, I. Gemund, M. Barone, P. Tober-Lau, E. T. Helbig, D. Hillus, L. Petrov, J. Stein, H. P. Dey, D. Paclik, C. Iwert, M. Mulleder, S. K. Aulakh, S. Djudjaj, R. D. Bulow, H. E. Mei, A. R. Schulz, A. Thiel, S. Hippenstiel, A. E. Saliba, R. Eils, I. Lehmann, M. A. Mall, S. Stricker, J. Rohmel, V. M. Corman, D. Beule, E. Wyler, M. Landthaler, B. Obermayer, S. von Stillfried, P. Boor, M. Demir, H. Wesselmann, N. Suttorp, A. Uhrig, H. Muller-Redetzky, J. Nattermann, W. M. Kuebler, C. Meisel, M. Ralser, J. L. Schultze, A. C. Aschenbrenner, C. Thibeault, F. Kurth, L. E. Sander, N. Bluthgenand, B. Sawitzki, Complement activation induces excessive T cell cytotoxicity in severe COVID-19. Cell. 185, 493\u0026ndash;512 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eV. Hornung, F. Bauernfeind, A. Halle, E. O. Samstad, H. Kono, K. L. Rock, K. A. Fitzgeraldand, E. Latz, Silica crystals and aluminum salts activate the NALP3 inflammasome through phagosomal destabilization. Nat Immunol. 9, 847\u0026ndash;856 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Duan, L. Zhang, D. Angosto-Bazarra, P. Pelegrin, G. Nunezand, Y. He, RACK1 mediates NLRP3 inflammasome activation by promoting NLRP3 active conformation and inflammasome assembly. Cell Rep. 33, 108405 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. Bellani, J. G. Laffey, T. Pham, E. Fan, L. Brochard, A. Esteban, L. Gattinoni, F. van Haren, A. Larsson, D. F. McAuley, M. Ranieri, G. Rubenfeld, B. T. Thompson, H. Wrigge, A. S. Slutsky, A. Pesenti, Epidemiology, patterns of care, and mortality for patients with acute respiratory distress syndrome in Intensive Care Units in 50 Countries. JAMA, 315, 788\u0026ndash;800 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. S. Mahalingam, S. Jayaraman, A. Arunkumar, H. M. Dudley, D. D. Anthony, C. L. Shive, J. M. Jacobsonand, P. Pandiyan, Distinct SARS-CoV-2 specific NLRP3 and IL-1beta responses in T cells of aging patients during acute COVID-19 infection. Front Immunol. 14, 1231087 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. Pan, M. M. Shen, Z. Y. Yu, W. W. Ge, K. Chen, M. F. Tian, F. Xiao, Z. W. Wang, J. Wang, Y. L. Jia, W. B. Wang, P. Wan, J. Zhang, W. J. Chen, Z. W. Lei, X. Chen, Z. Luo, Q. W. Zhang, M. Xu, G. Li, Y. K. Liand, J. G. Wu, SARS-CoV-2 N protein promotes NLRP3 inflammasome activation to induce hyperinflammation. Nat Commun, 12, 4664 (2021). 4664.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. A. Dinarelloand, J. W. van der Meer, Treating inflammation by blocking interleukin-1 in humans. Semin Immunol. 25, 469\u0026ndash;484 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. J. Lachmann, I. Kone-Paut, J. B. Kuemmerle-Deschner, K. S. Leslie, E. Hachulla, P. Quartier, X. Gitton, A. Widmer, N. Pateland, P. N. Hawkins, Use of canakinumab in the cryopyrin-associated periodic syndrome. N Engl J Med. 360, 2416\u0026ndash;2425 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. C. Coll, A. A. Robertson, J. J. Chae, S. C. Higgins, R. Munoz-Planillo, M. C. Inserra, I. Vetter, L. S. Dungan, B. G. Monks, A. Stutz, D. E. Croker, M. S. Butler, M. Haneklaus, C. E. Sutton, G. Nunez, E. Latz, D. L. Kastner, K. H. Mills, S. L. Masters, K. Schroder, M. A. Cooperand, L. A. O'Neill, A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nat Med. 21, 248\u0026ndash;255 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. Marchetti, B. Swartzwelter, F. Gamboni, C. P. Neff, K. Richter, T. Azam, S. Carta, I. Tengesdal, T. Nemkov, A. D'Alessandro, C. Henry, G. S. Jones, S. A. Goodrich, J. P. St. Laurent, T. M. Jones, C. L. Scribner, R. B. Barrow, R. D. Altman, D. B. Skouras, M. Gattorno, V. Grau, S. Janciauskiene, A. Rubartelli, L. A. B. Joostenand, C. A. Dinarello, OLT1177, a beta-sulfonyl nitrile compound, safe in humans, inhibits the NLRP3 inflammasome and reverses the metabolic cost of inflammation. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e. 115, E1530-E1539 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. He, H. Jiang, Y. Chen, J. Ye, A. Wang, C. Wang, Q. Liu, G. Liang, X. Deng, W. Jiangand, R. Zhou, Oridonin is a covalent NLRP3 inhibitor with strong anti-inflammasome activity. Nat Commun. 9, 2550 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. Xu, J. Chen, P. Chen, W. Li, J. Shao, S. Hong, Y. Wang, L. Chen, W. Luoand, G. Liang, Costunolide covalently targets NACHT domain of NLRP3 to inhibit inflammasome activation and alleviate NLRP3-driven inflammatory diseases. Acta Pharm Sin B. 13, 678\u0026ndash;693 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. Abderrazak, D. Couchie, D. F. Mahmood, R. Elhage, C. Vindis, M. Laffargue, V. Mateo, B. Buchele, M. R. Ayala, M. E. Gaafary, T. Syrovets, M. N. Slimane, B. Friguet, T. Fulop, T. Simmet, K. E. Hadri, M. Rouis, Anti-inflammatory and antiatherogenic effects of the NLRP3 inflammasome inhibitor arglabin in ApoE2.Ki mice fed a high-fat diet. Circulation. 131, 1061\u0026ndash;1070 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eI. V. Hochheiser, M. Pilsl, G. Hagelueken, J. Moecking, M. Marleaux, R. Brinkschulte, E. Latz, C. Engeland, M. Geyer, Structure of the NLRP3 decamer bound to the cytokine release inhibitor CRID3. Nature. 604, 184\u0026ndash;189 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eV. Kluck, T. L. T. A. Jansen, M. Janssen, A. Comarniceanu, M. Efde, I. W. Tengesdal, K. Schraa, M. C. P. Cleophas, C. L. Scribner, D. B. Skouras, C. Marchetti, C. A. Dinarelloand, L. A. B. Joosten, Dapansutrile, an oral selective NLRP3 inflammasome inhibitor, for treatment of gout flares: an open-label, dose-adaptive, proof-of-concept, phase 2a trial. Lancet Rheumatol. 2, e270-e280 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. J. Whan, L. B. Gon, K. Y. Kee, Y. J. Woo, J. H. Kyoung, S. Hong, L. H. Young, L. K. Roand, L. H. Woo, Ergolide, sesquiterpene lactone from Inula britannica, inhibits inducible nitric oxide synthase and cyclo-oxygenase-2 expression in RAW 264.7 macrophages through the inactivation of NF-kappaB. Br J Pharmacol. 133, 503\u0026ndash;512 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. Lyss, T. J. Schmidt, I. Merfortand, H. L. Pahl, Helenalin, an anti-inflammatory sesquiterpene lactone from Arnica, selectively inhibits transcription factor NF-kappaB. Biol Chem. 378, 951\u0026ndash;961 (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK. W. Nam, G. T. Oh, E. K. Seo, K. H. Kim, U. Koo, S. J. Lee, W. Mar, Nuclear factor kappaB-mediated down-regulation of adhesion molecules: possible mechanism for inhibitory activity of bigelovin against inflammatory monocytes adhesion to endothelial cells. J Ethnopharmacol. 123, 250\u0026ndash;256 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eW. L. Vandeand, M. Lamkanfi, Drugging the NLRP3 inflammasome: from signalling mechanisms to therapeutic targets. Nat Rev Drug Discov. 23, 43\u0026ndash;66 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. Georg, R. Astaburuaga-Garcia, L. Bonaguro, S. Brumhard, L. Michalick, L. J. Lippert, T. Kostevc, C. Gabel, M. Schneider, M. Streitz, V. Demichev, I. Gemund, M. Barone, P. Tober-Lau, E. T. Helbig, D. Hillus, L. Petrov, J. Stein, H. P. Dey, D. Paclik, C. Iwert, M. Mulleder, S. K. Aulakh, S. Djudjaj, R. D. Bulow, H. E. Mei, A. R. Schulz, A. Thiel, S. Hippenstiel, A. E. Saliba, R. Eils, I. Lehmann, M. A. Mall, S. Stricker, J. Rohmel, V. M. Corman, D. Beule, E. Wyler, M. Landthaler, B. Obermayer, S. von Stillfried, P. Boor, M. Demir, H. Wesselmann, N. Suttorp, A. Uhrig, H. Muller-Redetzky, J. Nattermann, W. M. Kuebler, C. Meisel, M. Ralser, J. L. Schultze, A. C. Aschenbrenner, C. Thibeault, F. Kurth, L. E. Sander, N. Bluthgen, B. Sawitzki, Complement activation induces excessive T cell cytotoxicity in severe COVID-19. Cell. 185, 493\u0026ndash;512.e25 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. Chen, C. Wang, R. Pang, H. Liu, W. Yin, J. Chen, L. Tao, Comprehensive single-cell transcriptomic and proteomic analysis reveals NK cell exhaustion and unique tumor cell evolutionary trajectory in non-keratinizing nasopharyngeal carcinoma. J Transl Med. 21, 278 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Muto, E.E. Dixon, Y. Yoshimura, H. Wu, K. Omachi, N. Ledru, P.C. Wilson, A.J. King, N. Eric Olson, M.G. Gunawan, J.J. Kuo, J.H. Cox, J.H. Miner, S.L. Seliger, O.M. Woodward, P.A. Welling, T.J. Watnick, B.D. Defining cellular complexity in human autosomal dominant polycystic kidney disease by multimodal single cell analysis. Nat Commun. 13, 6497 (20221).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Qin, G. Yan, Y. Qiao, D. Wang, C. Tang, Identification of hub genes based on integrated analysis of single-cell and microarray transcriptome in patients with pulmonary arterial hypertension, BMC Genomics.24, 788 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. Monaco, B. Lee, W. Xu, S. Mustafah, Y. Y. Hwang, C. Carre, N. Burdin, L. Visan, M. Ceccarelli, M. Poidinger, A. Zippelius, De Magalhaes J. Pedro, A. Larbi, RNA-Seq signatures normalized by mRNA abundance allow absolute deconvolution of human immune cell types. Cell Rep. 26, 1627\u0026ndash;1640.e7 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. Sharif, L. Wang, W. L. Wang, V. G. Magupalli, L. Andreeva, Q. Qiao, A. V. Hauenstein, Z. Wu, G. Nunez, Y. Mao, H. Wu, Structural mechanism for NEK7-licensed activation of NLRP3 inflammasome. Nature. 570, 338\u0026ndash;343 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ. Cui, W. Huang, B. Wu, J. Jin, L. Jing, W. P. Shi, Z. Y. Liu, L. Yuan, D. Luo, L. Li, Z. N. Chen, J. L. Jiang, N-glycosylation by N-acetylglucosaminyltransferase V enhances the interaction of CD147/basigin with integrin beta1 and promotes HCC metastasis. J Pathol. 245, 41\u0026ndash;52 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Li, N. N. Liu, Y. Qian, C. Y. Jiao, J. S. Yang, X. B. Meng, Y. Sun, Q. Xu, W. Liu, J. Cuiand, W. J. Guo, Targeting 14-3-3zeta by a small-molecule compound AI-34 maintains epithelial barrier integrity and alleviates colitis in mice via stabilizing beta-catenin. J Pharmacol Sci.152, 210\u0026ndash;219 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. M. Ren, J. Li, X. C. Zhang, Y. Wang, Y. Xiao, X. Y. Zhang, X. Liu, W. Zhang, W. B. Ma, J. Zhang, Y. T. Li, S. S. Tao, T. Wang, K. Liu, H. Chen, Y. Q. Zhan, M. Yu, C. Y. Li, C. H. Ge, B. X. Tian, G. F. Dou, X. M. Yangand, R. H. Yin, Pharmacological targeting of NLRP3 deubiquitination for treatment of NLRP3-associated inflammatory diseases. Sci Immunol. 6, eabe2933 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. Xian, Y. Liu, N. A. Rundberg, R. Gatchalian, T. R. Crother, W. G. Tourtellotte, Y. Zhang, G. R. Aleman-Muench, G. Lewis, W. Chen, S. Kang, M. Luevanos, D. Trudler, S. A. Lipton, P. Soroosh, J. Teijaro, J. C. de la Torre, M. Arditi, M. Karinand, E. Sanchez-Lopez, Metformin inhibition of mitochondrial ATP and DNA synthesis abrogates NLRP3 inflammasome activation and pulmonary inflammation. Immunity. 54, 1463\u0026ndash;1477 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH. Tao, H. Zhao, A. Mo, L. Shao, D. Ge, J. Liu, W. Hu, K. Xu, Q. Ma, W. Wang, W. Wang, H. Cao, M. Mu, X. Taoand, J. Wang, VX-765 attenuates silica-induced lung inflammatory injury and fibrosis by modulating alveolar macrophages pyroptosis in mice. Ecotoxicol Environ Saf. 249, 114359 (2023).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"bigelovin, ARDS, NLRP3 inflammasome, RACK1","lastPublishedDoi":"10.21203/rs.3.rs-4659521/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4659521/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAberrant activation of the NACHT, LRR, and PYD domain-containing protein 3 (NLRP3) inflammasome contributes to the pathogenesis of fatal and perplexing pulmonary diseases. Although pharmacologically inhibiting NLRP3 inflammasome \u0026nbsp;brings potent therapeutic effects in several clinical trials and preclinical models, the molecular chaperones and transition detail in the formation of active oligomer from an auto-suppressed state remain controversial. Here, we showed that sesquiterpene bigelovin inhibited NLRP3 inflammasome activation and release of the downstreaming pro-inflammatory cytokines by canonical, noncanonical, and alternative pathways at nanomolar ranges. Chemoproteomic target identification disclosed that bigelovin covalently bound to the cysteine 168 of RACK1 and blocked the interaction between RACK1 and NLRP3 monomer, thereby interfering NLRP3 inflammasome oligomerization \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Treatment by bigelovin significantly alleviated the severity of NLRP3-related pulmonary disorders in murine models, such as LPS-induced ARDS and silicosis. These results consolidated the intricate role of RACK1 in transiting the NLRP3 state and provided a new anti-inflammatory lead and therapy for NLRP3-driven diseases.\u003c/p\u003e","manuscriptTitle":"Inhibition of NLRP3 oligomerization (active conformation) mediated by RACK1 ameliorates acute respiratory distress syndrome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-24 08:46:41","doi":"10.21203/rs.3.rs-4659521/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4f46d511-a690-44e7-9516-c13495578dbe","owner":[],"postedDate":"July 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":34010106,"name":"Biological sciences/Immunology/Inflammation/Inflammasome"},{"id":34010107,"name":"Biological sciences/Drug discovery/Pharmacology/Pharmacodynamics"},{"id":34010108,"name":"Biological sciences/Immunology/Innate immune cells/Monocytes and macrophages/Alveolar macrophages"}],"tags":[],"updatedAt":"2024-07-28T06:25:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-24 08:46:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4659521","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4659521","identity":"rs-4659521","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00