Structural basis for loading of Transcription Repair-Coupling factor Mfd onto stalled elongation complexes

Structural basis for loading of Transcription Repair-Coupling factor Mfd onto stalled elongation complexes | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Structural basis for loading of Transcription Repair-Coupling factor Mfd onto stalled elongation complexes View ORCID Profile Joshua Brewer , Eliza Llewellyn , James Chen , View ORCID Profile Elizabeth A. Campbell , View ORCID Profile Seth A. Darst doi: https://doi.org/10.1101/2025.09.05.674597 Joshua Brewer 1 Laboratory of Molecular Biophysics, The Rockefeller University , New York, NY 10065 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Joshua Brewer Eliza Llewellyn 1 Laboratory of Molecular Biophysics, The Rockefeller University , New York, NY 10065 Find this author on Google Scholar Find this author on PubMed Search for this author on this site James Chen 1 Laboratory of Molecular Biophysics, The Rockefeller University , New York, NY 10065 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Elizabeth A. Campbell 2 Laboratory of Molecular Pathogenesis, The Rockefeller University , New York, NY 10065 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Elizabeth A. Campbell Seth A. Darst 1 Laboratory of Molecular Biophysics, The Rockefeller University , New York, NY 10065 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Seth A. Darst For correspondence: darst{at}rockefeller.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Transcription-coupled repair (TCR) is a nucleotide excision repair sub-pathway that preferentially removes lesions from the DNA template-strand stalling RNA polymerase (RNAP) elongation complexes (ECs). In bacteria, the superfamily 2 Mfd translocase mediates TCR by displacing stalled ECs and recruiting Uvr(A)B. Using cryo-electron microscopy, we previously visualized seven Mfd-EC complexes spanning the ATP-dependent Mfd loading and EC displacement pathway [L1 -> L2(ADP) -> C1(ATP) -> C2(ATP) -> C3(ADP) -> C4(ADP) -> C5(ATP)]. The first intermediate (L1) was poorly resolved (4.1 Å nominal resolution) due to low particle occupancy. The pathway is characterized by very large Mfd structural transitions, notably the L1 -> L2 transition. Here, we pre-loaded Mfd with ATP in the presence of the γ -phosphate mimic, BeF 3 − , limiting rounds of ATP hydrolysis. The resulting accumulation of early intermediates allowed us to resolve the L1 intermediate to 3.5 Å nominal resolution, revealing bound ADP-BeF 3 − . We also identified a new intermediate between L1 and L2, L1.5, providing further insight into Mfd conformational changes during loading. Download figure Open in new tab Introduction DNA template strand (t-strand) lesions that block elongation by RNA polymerase (RNAP) are targeted for preferential repair in a process called transcription-coupled repair (TCR) [ 1 – 3 ]. UV-induced cyclobutane dimers are the most common lesions that induce TCR [ 4 , 5 ]. In TCR, the stalled RNAP elongation complex (EC) serves as an efficient detector of t-strand lesions that then becomes a privileged entry point into the nucleotide excision repair (NER) pathway, mediated by a transcription repair coupling factor (TRCF). The superfamily 2 (SF2) Mfd translocase [ 6 ] has been shown in vitro and in vivo to be a bacterial TRCF [ 7 – 11 ]. In its apo form, Mfd is autoinhibited, inactive in binding to or translocating along DNA, binding to NER factor UvrA, or hydrolyzing ATP [ 6 , 12 , 13 ]. This is attributed to the compact inactive conformation of apo-Mfd, where the UvrA-interacting module is occluded by Mfd domain 7 [D7; [ 14 ]]. Stable association of Mfd with the EC requires many rounds of ATP hydrolysis [ 15 ]. After engaging with the EC, Mfd translocase activity can overwind the upstream region of the EC transcription bubble, facilitating displacement of the RNA transcript and transcription bubble reannealing [ 6 , 12 , 15 – 21 ]. After disruption of the EC, the Mfd-RNAP complex remains on the DNA and continues to slowly translocate in the downstream direction processively over thousands of base pairs [ 18 , 22 , 23 ]. The Mfd-RNAP complex rapidly dissociates from the DNA once it is intercepted by UvrA 2 B [ 24 , 25 ]. Previously, we used cryo-electron microscopy (cryo-EM) to visualize the ATP-dependent pathway for Mfd engaging with and attempting to displace the EC [ 15 ]. We visualized seven distinct Mfd-EC complexes in both ATP and ADP-bound states spanning the Mfd loading and EC displacement pathway: In this earlier study, the first Mfd-EC loading intermediate (L1) was poorly populated, yielding a relatively low-resolution structure (4.1 Å nominal resolution) in which the nucleotide occupancy of the Mfd active site was unclear. The pathway is characterized by very large Mfd structural transitions, most notably the L1 -> L2 transition, where the RecG-like SF2 translocase domains (TDs) translocate at least 7 base pairs along the upstream duplex DNA of the EC, rotating ∼258° about the DNA and undergoing an overall translation of ∼63 Å while hydrolyzing at least 7 molecules of ATP. Other domains of Mfd undergo similarly large motions. The rotation of the Mfd TDs around the DNA, combined with rearrangements of other Mfd domains, result in a conformation in which Mfd is topologically wrapped around the upstream duplex DNA. This persistently ‘wrapped’ arrangement of the Mfd-RNAP complex was proposed to be the source of its high processivity on DNA [ 15 , 18 , 22 , 23 ]. While the endpoints of the initial structural transition (L1 and L2) were resolved, the detailed pathway of Mfd domain motions during the transition was unclear. Here, we pre-loaded Mfd with ATP in the presence of BeF 3 − , allowing Mfd to undergo a limited number of ATP hydrolysis cycles before being trapped by BeF 3 − binding prior to ADP release. The resulting accumulation of particles in the early steps of the pathway allowed us to resolve the L1 intermediate to 3.5 Å nominal resolution, revealing nucleotide occupancy. We also identified an additional loading intermediate between L1 and L2 (L1.5) that clarifies the rearrangements undertaken by Mfd during loading. Materials and Methods Key Resource Table []. Lead Contact and Materials Availability All unique/stable reagents generated in this study are available without restriction from the Lead Contact, Seth A. Darst ( darst{at}rockefeller.edu ). Experimental Model and Subject Details RNAP core (α 2 ββ’ω) and Mfd are proteins found in Eco . For protein expression, Eco BL21(DE3) [ Eco str. B F − ompT gal dcm lon hsdS B ( r B – m B – ) λ(DE3 [ lacI lacUV5 - T7p07 ind1 sam7 nin5 ]) [ malB + ] K-12 (λ S )] was used. Method Details Structural biology software was accessed through the SBGrid consortium [ 26 ]. No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. Protein expression and purification Eco core RNAP and α 70 were separately overexpressed and purified as previously described [ 15 , 27 ]. Eco Mfd was overexpressed and purified as previously described [ 15 ]. Mfd-EC Displacement Assay 50 picomoles of forward primer (5’ cggaacattacgaacgatgg 3’ IDT), used later for PCR amplification of pAR1707 [ 28 ], was combined with 50 picomoles of γ - 32 P-ATP, 2 µL of T4 polynucleotide kinase (10,000 U/mL), and T4 buffer (New England Biolabs). Radiolabeling reactions ran for 45 min at 37°C. After a 20-minute heat treatment at 65°C, radiolabeled primers were purified using a NucAway spin column (Invitrogen AM10070). PCR reactions were performed with radiolabeled forward primers and unlabeled reverse primers from pAR1707 template (Thermo Scientific Phusion High-Fidelity DNA polymerase F-530XL). Amplicons were run on an SDS polyacrylamide gel and the purified band was cut out and dissolved in Crush/Soak elution buffer (1 M Na-acetate, pH 5.5, 1 mM EDTA) before being spin filtered in an Ultra-free MC tube (Millipore UFC30VV00) and precipitated in 100% ethanol, washed with 70% ethanol, and finally resuspended in RNase free 10 mM Tris-HCl, pH 8.0 (Invitrogen AM9855G). Eco RNAP holoenzyme (E α 70 ) was reconstituted by incubating core RNAP (E) (10 nM final) with σ 70 (50 nM final) at 37°C for 15 min. E α 70 was incubated with radiolabeled DNA fragments (0.4 nM) for 10 minutes at 37°C to form transcription initiation complexes. Transcription was then initiated by adding ApU (200 uM), ATP (2 mM), CTP (50 uM), GTP (50 uM), 3’-deoxy-UTP chain terminator (100 μ M) (all NTPs: TriLink Biotechnologies) and heparin (10 μ g/ml; Sigma-Aldrich H3149) at 37°C for 10 min in transcription buffer (100 mM Tris-HCl, pH 8.0, 500 mM KCl, 100 mM MgCl 2 , 1 mM EDTA, 10 mM dithiothreitol, 50 μg/mL BSA). In conditions where a non-hydrolyzable NTP analog was used to halt Mfd activity, either 20 mM Na-orthovanadate (VO 4 3− ; Sigma-Aldrich 450243), 13.95 mM Aluminum trifluoride (AlF 3 ; Sigma-Aldrich 449268), or 25 mM Beryllium trifluoride (BeF 3 1− ; Sigma-Aldrich AA1610414) were added to the transcription reaction simultaneously with other NTPs and heparin. Finally, Mfd (250 nM) was added to the reaction and time points were taken by adding samples directly to the running gel. Native gels were cast using 4.5% polyacrylamide [(37.5:1) acrylamide/bis-acrylamide (2.7% crosslinker), 0.15% TEMED (Thermo Scientific 17919), and 1% APS (Sigma-Aldrich A3678). Gels were run at 4°C at 24 mA for approximately 19 hours. Gels were mounted onto Whatman filter paper and placed into a gel dryer for 30 min at 40°C. Gels were exposed to a phosphor screen for 6 hrs at 4°C and imaged using a Typhoon (Cytiva). Band intensities were quantified using ImageJ. Stall intensity % was calculated as follows: (Stall band intensity)/(Stall band intensity + DNA band intensity) using background-subtracted values. Preparation of Mfd-EC complexes for cryo-EM Eco core RNAP (0.5 mL of 5 mg/mL protein) was injected into a 10/300 Superose 6 Increase column (Cytiva) equilibrated with 10 mM Tris-HCl, pH 8.0, 100 mM KCl, 5 mM MgCl 2 , and 2.5 mM dithiothreitol (DTT). The peak fractions of the eluted protein were concentrated by centrifugal filtration (EMD-Millipore-30K MWCO) to 25 µM protein concentration. The above steps were also performed for purified Mfd. ECs were reconstituted by hybridizing RNA with t-strand DNA (stepwise decreasing temperature from 95°C) before adding E. coli RNAP (RNAP:DNA ratio of 1:1.1) at room temperature for 15 minutes. Nt-strand DNA was finally added for 10 minutes at room temperature. ATP (2 mM), BeF 3 − (25 mM), 24.872 uM Mfd, and 12.422 uM EC (final concentrations) were all combined in Cryo-EM buffer (150 mM KCl, 20 mM Tris pH 8.0, 10 mM MgCl 2 , 10 mM DTT). The sample was incubated for 15 min at 37°C, then 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO) was added to a final concentration of 8 mM [ 29 ], and the sample was kept at room temperature prior to grid preparation. Cryo-EM grid preparation C-flat holey carbon grids (CF-1.2/1.3-4Au; Protochips) were glow-discharged for 20 s before the application of 3.5 μL of the sample described above. After blotting for 3–4.5 s, the grids were plunge-frozen in liquid ethane using an FEI Vitrobot Mark IV (FEI) with 100% chamber humidity at 37°C. Cryo-EM data acquisition and processing Grids were imaged using a 300-keV Titan Krios (FEI) equipped with a K3 Summit direct electron detector (Gatan). Images were recorded with Leginon [ 30 ] in counting mode with a pixel size of 1.0825 Å (our 2 nd dataset was collected with a pixel size of 1.03Å and subsequently binned to 1.0825Å) and a defocus range of -1 to -2.5 μm. Data were collected with a dose rate of 28 e - per Å 2 per s. Images were recorded over a 2 s exposure with 0.05 s frames (40 total frames) to give a total dose of 51.2 e - /Å 2 (2 nd dataset had a total dose of 68.2 e - /Å 2 ). Dose-fractionated videos were gain-normalized, drift-corrected, summed, and dose-weighted using MotionCor2 [ 31 ]. The contrast transfer function (CTF) was estimated for each summed image using the Patch CTF module in cryoSPARC2 (CS2) [ 32 ]. Particles were picked and extracted from the dose-weighted images with a box size of 256 px using CS2 Blob Picker and Particle Extraction. Coordinates pointing to particles of ice were extracted as faux particles and used to generate an initial decoy 3D model in CS2 (ab initio reconstruction) in order to remove junk particles from initial particle stacks during the ‘decoy’ procedure. Multiple rounds of CS2 Hetero Refinement of all blob-picked particles used multiple 3D decoys along with an Eco core RNAP 3D template (PDB 6ALH) with all nucleic acids removed (low pass filtered to 60 Å resolution), to perform initial de-junking. The original purpose for the 2 nd data collection was to identify more particles of L1.5 to improve map resolution; however, no additional L1.5 particles could be successfully identified, whereas additional L1 particles were identified. Both L1 and L1.5 were classified from their respective parent particle stacks via focused 3D classification in Relion3 [ 33 ]. Both classes were subjected to two rounds of successive Bayesian Polishing in Relion3. Finally, CS2 non-uniform (NU) refinements were performed for each resulting class, yielding two different structures: L1 (96,588 p, 3.5 Å nominal resolution) and L1.5 (13,101 p, 4.3 Å nominal resolution). The heatmap distribution of particle orientations and half-map FSCs were calculated using CS2. 3D Fourier shell correlation (3dFSC) calculations were performed using 3DFSC [ 34 ]. Local-resolution calculations were performed using blocres and maps were locally filtered using blocfilt (Bsoft package) [ 35 ]. Model building and refinement L1 . The initial model for L1 was derived from PDB 6X26 [ 15 ]. The model was manually fit into the cryo-EM density maps using ChimeraX [ 36 ] and rigid-body and real-space refined using PHENIX real-space-refine [ 37 , 38 ]. For real-space refinement, rigid-body refinement was followed by all-atom and B factor refinement with Ramachandran and secondary structure restraints. Models were inspected and modified using COOT [ 39 ]. L1 . 5 . The initial model for L1.5 was derived from PDB 6X50 [ 40 ]. Data and code availability The cryo-EM density maps have been deposited in the EMDataBank under accession codes EMD-48776 [L1(ADP-BeF 3 )] and EMD-48802 [L1.5]. The atomic coordinates have been deposited in the Protein Data Bank under accession codes 9N07 [L1(ADP-BeF 3 )] and 9N11 (L1.5). Results Mfd activity is sensitive to γ -phosphate mimics ATP hydrolysis is required for Mfd loading to achieve a stable Mfd-EC complex (Kang et al. 2021). For example, incubating a stalled EC with transition state analog ADP + vanadate (VO 4 3− ) [ 41 ] does not support Mfd-EC complex formation, but ATP + VO 4 3− does [ 15 ]. Although ATP + VO 4 3− supports Mfd-EC complex formation, it does not support EC displacement, indicating that multiple rounds of ATP hydrolysis are required for EC displacement [ 15 ]. Similarly, ATP with ground state analogs AlF 3 − or BeF 3 − also do not support EC displacement ( Figures 1b and 1c , Figure 1-figure supplement 1). Thus, pre-loading Mfd with ATP in the presence of γ -phosphate mimics VO 4 3− , AlF 3 − , or BeF 3 − allows Mfd to undergo a limited number of ATP hydrolysis cycles, which are obligate for Mfd-EC complex formation, but not enough cycles to complete EC displacement. Download figure Open in new tab Figure 1. Non-hydrolyzable ATP analogs inhibit Mfd-mediated displacement of stalled ECs ( a ) Schematic depicting native gel-shift experiments used to monitor Mfd-mediated displacement of stalled ECs. Eco holoenzyme was added to a radiolabeled linear dsDNA fragment containing the strong T7A1 promoter (Figure 1-figure supplement 1a). Stalled ECs were formed via the introduction of dinucleotide primter (ApU, 200 uM final concentration), a subset of NTP substrates (ATP, 2 mM: CTP, 50 uM; GTP, 50 uM) and a chain terminator (3’-deoxy-UTP, 100 μ M). The γ -phosphate mimics Sample-dependent non-hydrolyzable ATP-analog was introduced prior to Mfd [ NaVO 4 3− (20 mM final concentration), or AlF 3 (14 mM), or BeF 3 − (25 mM)]. Mfd hydrolyzes ATP to displace, translocate, and ultimately dissociate the stalled EC from the DNA fragment. ( b ) The left panel shows the effect of Mfd-mediated removal of the stalled EC via native electrophoretic mobility shift analysis; after 1 to 2 minutes of incubation with Mfd and ATP, the low mobility EC (‘stalled complex’) is disrupted. The right panel shows the inhibitory effect of BeF 3 − . ( c ) Quantification of Mfd-mediated removal of stalled ECs from the linear DNA fragment and the potent inhibitory effects of all three tested γ -phosphate mimics. Error bars denote standard deviation of n=3 measurements. Representative gels for AlF 3 and VO 4 3− analyses are shown in Figure 1-figure supplement 1b and 1c). Two structures early in the Mfd loading pathway We reasoned that limiting the number of ATP hydrolysis cycles that Mfd could complete by using ATP and a γ -phosphate mimic would enrich Mfd-EC complexes early in the loading pathway. We incubated stalled ECs with Mfd pre-loaded with ATP [Mfd(ATP)] in the presence of 25 mM BeF 3 − ( Figures 1b,1c , and 2a ), then analyzed the resulting complexes by single particle cryo-EM ( Figure 2 , Figure 2-figure supplement 1). Steps of maximum-likelihood classification [ 42 ] revealed two predominant Mfd-EC structures. As expected, the sample was highly enriched in L1 (88% of the particles; Figure 2b , Figure 2-figure supplement 1). Unexpectedly, the remainder of the particles (12%) defined a new structural class between L1 and L2 that we term L1.5 ( Figure 2c , Figure 2-figure supplement 1). Download figure Open in new tab Figure 2. Two structure early in the Mfd loading pathway. ( a ) Schematic for reconstituting the stalled EC employed in cryo-EM experiments. To assemble complexes enriched for early intermediates in the Mfd loading pathway, we annealed partially complementary RNA to t-strand DNA, added core RNAP, then finally nt-strand DNA [with partial complementarity to the t-strand, resulting in a bubble resistant to annealing [ 15 ]]. The subsequent addition of Mfd, ATP (2 mM final concentration), and BeF 3 − (25 mM) allowed formation of early intermediates via limited rounds of ATP hydrolysis before BeF 3 − can associate with Mfd to inhibit further activity. ( b ) Local-resolution filtered [ 35 ] cryo-EM density for L1 intermediate with associated resolution and % particle contribution to overall population observed. Color legend for domains of RNAP and Mfd shown. ( c ) Local-resolution filtered [ 35 ] cryo-EM density for L1.5 intermediate with associated resolution and % particle contribution to overall population observed. Color legend for domains of RNAP and Mfd shown. The upstream duplex DNA (t-strand and nt-strand) is labeled. The RNA transcript present in the compexes is not visible in these views. High-resolution L1 structure confirms ATP in the Mfd active site L1 was proposed to be the first stable intermediate on the Mfd-EC loading pathway [ 15 ]. The nucleotide state of the Mfd active site was previously unresolved due to the poor resolution of the structure [4.1 Å nominal resolution; [ 15 ]]. By limiting the number of Mfd ATP hydrolysis cycles in our current study, the population of particles in the L1 state was enriched, giving rise to a much better resolved structure (3.5 Å nominal resolution; Figures 2b and 3 , Figure 2-figure supplement 1). The previous L1 model (4.1 Å nominal resolution) and the current L1 model (3.5 Å resolution) are very similar in overall architecture (1.18 Å root-mean-square deviation over 3,731 α -carbons), but the new model clearly resolves ADP•BeF 3 − in the Mfd active site ( Figure 3 ). BeF 3 − is a ground-state analog, suggesting that the L1 state contains Mfd(ATP) during the normal ATP hydrolysis condition. Download figure Open in new tab Figure 3. High resolution structure of L1 confirms presence of bound ADP-BeF 3 − in Mfd active site. The L1 intermediate is shown on the left [local-resolution filtered cryo-EM map [ 35 ] for RNAP and nucleic acids, with transparent molecular surface of Mfd colored according to key (top). DNA stands and RNAP subunits are individually labelled and distinguished by color. Cryo-EM difference density (zoomed in rightmost panel) shows clear density corresponding to the presence of ADP-BeF 3 − (shown in red with model fit into difference density). ATP loading of Mfd in conjunction with BeF 3 − traps the Mfd-EC complex in a new intermediate The ATP-dependent transition from L1 to L2 involves dramatic conformational changes in the positioning of Mfd domains. In L1, the Mfd TDs engage with the upstream duplex DNA of the EC far upstream, centered at about -30 with respect to the 3’-end of the RNA in the EC. In L2, the Mfd TDs are centered at about -21 on the upstream duplex DNA and rotated around the DNA about 258° [ 15 ]. Thus, in the L1->L2 transition, the Mfd TDs translocate on the upstream duplex DNA in the downstream direction (i.e. towards the RNAP) while the RNAP and the RNAP-bound Mfd-D4(RID) remain stationary. During this process, a long helix (the Relay Helix) connecting Mfd D4(RID) to D5(TD1) unfolds and wraps around the DNA, imparting the translocating Mfd-EC complex its striking processivity [ 15 , 24 ]. It was proposed in Kang et al. (2021) that the Mfd D1-D3 structural module disengages from the Mfd-EC complex, opening a path for the TDs to corkscrew around the DNA to reach their position in L2. D1-D3 was proposed to subsequently rebind in a different position, forming L2 [ 15 , 24 ]. In our new cryo-EM dataset, most particles (88%) have undergone one (or at most, a few) rounds of ATP hydrolysis, generating L1 ( Figures 2b and 3 ). However, a smaller population of particles (12%) has successively hydrolyzed a limited number of ATP molecules prior to associating with BeF 3 − , moving beyond L1 but not yet achieving L2, revealing a new intermediate, L1.5 ( Figures 2c and 4 , Figure 2-figure supplement 1). In L1.5, the Mfd TDs are centered at about -25 and rotated around the DNA about 181° (with respect to L1), approximately half-way between L1 and L2 ( Figure 4 ). Download figure Open in new tab Figure 4. L1.5 structure illustrates pathway for transition from L1 to L2. Mfd-EC complexes L1 (left, this work), L1.5 (middle, this work), and L2 [right, 6X2F; [ 15 ]] illustrate rearrangements of Mfd structural elements to accomplish loading. The complexes are shown as molecular surfaces (RNAP subunits and Mfd domains color-coded as shown), aligned via the RNAP, and viewed from the upstream duplex DNA direction. The Mfd RecG-like motor domains (D5, yellow; D6, green] corkscrew around the upstream dsDNA in the clockwise direction while hydrolyzing ATP. The relay helix (D4-D5 Mfd linker, labeled in L2) gradually wraps around the upstream duplex DNA as motor domains circle around the DNA and the RNAP-Interacting-Domain [D4(RID)] remains attached to the RNAP (highlighted in rightmost complex shown). D1-D3 appear to temporarily dissociate from the other Mfd domains as motor domains circle the upstream duplex DNA and rebind in a different overall conformation (L1.5) that persists (with minor repositioning relative to the motor domains) until the final formation of L2 where Mfd has achieved loading. Discussion In Kang et al. (2021), Mfd was visualized undergoing its complete ATP hydrolysis cycle, engaging with and attempting to disrupt an EC. The ECs were stalled by nucleotide deprivation on a nucleic acid scaffold containing a non-complementary transcription bubble that could not rewind (Figure 2 - figure supplement 1a). Thus, despite undergoing cycles of ATP hydrolysis, Mfd was unable to efficiently disrupt the ECs, facilitating the visualization of intermediates. Seven distinct Mfd-EC complexes were visualized and placed in a pathway, providing a structural basis for understanding the extensive remodeling of Mfd upon its engagement and disruption of the EC. The presence of ATP throughout the sample preparation allowed multiple rounds of ATP hydrolysis, driving the complexes through the pathway, explaining why the early intermediates (L1 and L2) were poorly populated; L1 and L2 contained 4% and 5% of the particles, respectively. The small number of particles gave rise to relatively low-resolution cryo-EM maps (L1, 4.1 Å nominal resolution; L2, 4.0 Å nominal resolution). As a result, the nucleotide occupancy of the Mfd active site in L1 was not able to be determined. In this current study we populated complexes early in the pathway by incubating the stalled EC with Mfd, ATP, plus a γ -phosphate mimic, BeF 3 − . Following ATP hydrolysis by Mfd, BeF 3 − can substitute for the leaving inorganic phosphate before ADP has been released [ 43 , 44 ], trapping the complex after one or only a few rounds of ATP hydrolysis. In this way, the sample was heavily shifted towards populating early complexes. L1 contained 88% of the particles, giving rise to a 3.5 Å reconstruction ( Figures 2b and 3 , Figure 2 - figure supplement 1). The better resolution of the L1 cryo-EM map revealed that ADP-BeF 3 − occupied the Mfd active site ( Figure 3 ), consistent with biochemical findings that ATP hydrolysis was required to reach L1 [ 15 ]. In addition to increasing the population of L1, a new complex between L1 and L2, L1.5, was populated (12% of the particles). In the presence of BeF 3 − , L2 and subsequent states were not populated at all (Figure 2 - figure supplement 1). In L1.5, the Mfd-TDs translocating (corkscrewing) on the upstream duplex DNA towards the RNAP were trapped approximately half-way between L1 and L2 ( Figure 4 ), confirming and elaborating the proposed L1 -> L2 transition pathway [ 15 ]. The ability of cryo-EM to visualize mixtures of biological macromolecules in relatively native environments allows the analysis of complex assembly or activity pathways in vitro , revealing unprecedented insights [ 15 , 45 – 47 ]. By their nature, active biological pathways lead to extreme heterogeneity. In the case of NTPase-driven processes, the use of γ -phosphate mimics to allow limited rounds of ATP hydrolysis can reduce the heterogeneity and stabilize transient states that otherwise would not be populated, providing insight into NTP-hydrolysis driven pathways difficult to obtain in other ways. Supplementary data Supplementary Data are available online. Author contributions Conceptualization; J.B., E.A.C., S.A.D. Cloning, protein purification, biochemistry: J.B., E.L. Cryo-EM specimen preparation, data collection, and processing: J.B., E.L., J.C. Model building and structural analysis: J.B., E.A.C., S.A.D. Funding acquisition and supervision: E.A.C., S.A.D. Manuscript first draft: J.B., S.A.D. All authors contributed to finalizing the written manuscript. Conflict of interest The authors declare there are no competing interests. Funding Data Availability The data underlying this article are available in the article and in its online supplementary material. Acknowledgments We thank members of the Darst and Campbell Laboratories for helpful discussions, and M. Ebrahim, J. Sotiris, and H. Ng at The Rockefeller University Evelyn Gruss Lipper Cryo-Electron Microscopy Resource Center for help with cryo-EM data collection and analysis. Some of the work reported here was conducted at the Simons Electron Microscopy Center (SEMC) and the National Resource for Automated Molecular Microscopy (NRAMM) located at the New York Structural Biology Center, supported by grants from the NIH National Institute of General Medical Sciences (P41 GM103310), NYSTAR, the Simons Foundation (SF349247), the NIH Common Fund Transformative High Resolution Cryo-Electron Microscopy program (U24 GM129539) and NY State Assembly Majority. This work was supported by NIH R35 GM118130 to S.A.D. Funder Information Declared National Institute of General Medical Sciences, https://ror.org/04q48ey07 , P41 GM103310 , R35 GM118130 Simons Foundation, https://ror.org/01cmst727 , SF349247 NIH Common Fund, https://ror.org/001d55x84 , U24 GM129539 References 1. ↵ Hanawalt PC , Spivak G. Transcription-coupled DNA repair: two decades of progress and surprises . Nat Rev Mol Cell Biol . 2008 ; 9 ( 12 ): 958 – 970 . doi: 10.1038/nrm2549 OpenUrl CrossRef PubMed Web of Science 2. Mellon I , Hanawalt PC . Induction of the Escherichia coli lactose operon selectively increases repair of its transcribed DNA strand . Nature . 1989 ; 342 ( 6245 ): 95 – 98 . doi: 10.1038/342095a0 OpenUrl CrossRef PubMed Web of Science 3. ↵ Mellon I , Spivak G , Hanawalt PC . Selective removal of transcription-blocking DNA damage from the transcribed strand of the mammalian DHFR gene . Cell . 1987 ; 51 ( 2 ): 241 – 249 . doi: 10.1016/0092-8674(87)90151-6 OpenUrl CrossRef PubMed Web of Science 4. ↵ Bohr VA , Smith CA , Okumoto DS , Hanawalt PC . DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more efficient than in the genome overall . Cell . 1985 ; 40 ( 2 ): 359 – 369 . doi: 10.1016/0092-8674(85)90150-3 OpenUrl CrossRef PubMed Web of Science 5. ↵ Witkin EM . Radiation-induced mutations and their repair . Science . 1966 ; 152 ( 3727 ): 1345 – 1353 . doi: 10.1126/science.152.3727.1345 OpenUrl FREE Full Text 6. ↵ Smith AJ , Szczelkun MD , Savery NJ . Controlling the motor activity of a transcription-repair coupling factor: autoinhibition and the role of RNA polymerase . Nucleic Acids Res . 2007 ; 35 ( 6 ): 1802 – 1811 . doi: 10.1093/nar/gkm019 OpenUrl CrossRef PubMed Web of Science 7. ↵ Kunala S , Brash DE . Excision repair at individual bases of the Escherichia coli lacI gene: relation to mutation hot spots and transcription coupling activity . Proc Natl Acad Sci U S A . 1992 ; 89 ( 22 ): 11031 – 11035 . doi: 10.1073/pnas.89.22.11031 OpenUrl Abstract / FREE Full Text 8. Oller AR , Fijalkowska IJ , Dunn RL , Schaaper RM . Transcription-repair coupling determines the strandedness of ultraviolet mutagenesis in Escherichia coli . Proc Natl Acad Sci U S A . 1992 ; 89 ( 22 ): 11036 – 11040 . doi: 10.1073/pnas.89.22.11036 OpenUrl Abstract / FREE Full Text 9. Selby CP , Witkin EM , Sancar A. Escherichia coli mfd mutant deficient in “mutation frequency decline” lacks strand-specific repair: in vitro complementation with purified coupling factor . Proc Natl Acad Sci U S A . 1991 ; 88 ( 24 ): 11574 – 11578 . doi: 10.1073/pnas.88.24.11574 OpenUrl Abstract / FREE Full Text 10. Selby CP , Sancar A. Gene- and strand-specific repair in vitro: partial purification of a transcription-repair coupling factor . Proc Natl Acad Sci U S A . 1991 ; 88 ( 18 ): 8232 – 8236 . doi: 10.1073/pnas.88.18.8232 OpenUrl Abstract / FREE Full Text 11. ↵ Selby CP , Sancar A. Molecular mechanism of transcription-repair coupling . Science . 1993 ; 260 ( 5104 ): 53 – 58 . doi: 10.1126/science.8465200 OpenUrl Abstract / FREE Full Text 12. ↵ Manelyte L , Kim YIT , Smith AJ , Smith RM , Savery NJ . Regulation and rate enhancement during transcription-coupled DNA repair . Mol Cell . 2010 ; 40 ( 5 ): 714 – 724 . doi: 10.1016/j.molcel.2010.11.012 OpenUrl CrossRef PubMed Web of Science 13. ↵ Murphy MN , Gong P , Ralto K , Manelyte L , Savery NJ , Theis K. An N-terminal clamp restrains the motor domains of the bacterial transcription-repair coupling factor Mfd . Nucleic Acids Res . 2009 ; 37 ( 18 ): 6042 – 6053 . doi: 10.1093/nar/gkp680 OpenUrl CrossRef PubMed Web of Science 14. ↵ Deaconescu AM , Chambers AL , Smith AJ , et al. Structural basis for bacterial transcription-coupled DNA repair . Cell . 2006 ; 124 ( 3 ): 507 – 520 . doi: 10.1016/j.cell.2005.11.045 OpenUrl CrossRef PubMed Web of Science 15. ↵ Kang JY , Llewellyn E , Chen J , et al. Structural basis for transcription complex disruption by the Mfd translocase . Elife . 2021 ; 10 : e62117 . doi: 10.7554/eLife.62117 OpenUrl CrossRef PubMed 16. Chambers AL , Smith AJ , Savery NJ . A DNA translocation motif in the bacterial transcription--repair coupling factor, Mfd . Nucleic Acids Res . 2003 ; 31 ( 22 ): 6409 – 6418 . doi: 10.1093/nar/gkg868 OpenUrl CrossRef PubMed Web of Science 17. Deaconescu AM , Sevostyanova A , Artsimovitch I , Grigorieff N. Nucleotide excision repair (NER) machinery recruitment by the transcription-repair coupling factor involves unmasking of a conserved intramolecular interface . Proc Natl Acad Sci U S A . 2012 ; 109 ( 9 ): 3353 – 3358 . doi: 10.1073/pnas.1115105109 OpenUrl Abstract / FREE Full Text 18. ↵ Howan K , Smith AJ , Westblade LF , et al. Initiation of transcription-coupled repair characterized at single-molecule resolution . Nature . 2012 ; 490 ( 7420 ): 431 – 434 . doi: 10.1038/nature11430 OpenUrl CrossRef PubMed Web of Science 19. Selby CP , Sancar A. Structure and function of transcription-repair coupling factor. I. Structural domains and binding properties . J Biol Chem . 1995 ; 270 ( 9 ): 4882 – 4889 . doi: 10.1074/jbc.270.9.4882 OpenUrl Abstract / FREE Full Text 20. Selby CP , Sancar A. Structure and function of transcription-repair coupling factor. II. Catalytic properties . J Biol Chem . 1995 ; 270 ( 9 ): 4890 – 4895 . doi: 10.1074/jbc.270.9.4890 OpenUrl Abstract / FREE Full Text 21. ↵ Smith AJ , Savery NJ . RNA polymerase mutants defective in the initiation of transcription-coupled DNA repair . Nucleic Acids Res . 2005 ; 33 ( 2 ): 755 – 764 . doi: 10.1093/nar/gki225 OpenUrl CrossRef PubMed Web of Science 22. ↵ Graves ET , Duboc C , Fan J , Stransky F , Leroux-Coyau M , Strick TR . A dynamic DNA-repair complex observed by correlative single-molecule nanomanipulation and fluorescence . Nat Struct Mol Biol . 2015 ; 22 ( 6 ): 452 – 457 . doi: 10.1038/nsmb.3019 OpenUrl CrossRef PubMed 23. ↵ Haines NM , Kim YIT , Smith AJ , Savery NJ . Stalled transcription complexes promote DNA repair at a distance . Proc Natl Acad Sci U S A . 2014 ; 111 ( 11 ): 4037 – 4042 . doi: 10.1073/pnas.1322350111 OpenUrl Abstract / FREE Full Text 24. ↵ Fan J , Leroux-Coyau M , Savery NJ , Strick TR . Reconstruction of bacterial transcription-coupled repair at single-molecule resolution . Nature . 2016 ; 536 ( 7615 ): 234 – 237 . doi: 10.1038/nature19080 OpenUrl CrossRef PubMed 25. ↵ Selby CP . Mfd Protein and Transcription-Repair Coupling in Escherichia coli . Photochem Photobiol . 2017 ; 93 ( 1 ): 280 – 295 . doi: 10.1111/php.12675 OpenUrl CrossRef PubMed 26. ↵ Morin A , Eisenbraun B , Key J , et al. Collaboration gets the most out of software . eLife . 2013 ; 2 : e01456 . doi: 10.7554/eLife.01456 OpenUrl CrossRef PubMed 27. ↵ Chen J , Chiu C , Gopalkrishnan S , et al. Stepwise Promoter Melting by Bacterial RNA Polymerase . Mol Cell . 2020 ; 78 ( 2 ): 275 - 288.e6 . doi: 10.1016/j.molcel.2020.02.017 OpenUrl CrossRef PubMed 28. ↵ Briat JF , Chamberlin MJ . Identification and characterization of a new transcriptional termination factor from Escherichia coli . Proc Natl Acad Sci U S A . 1984 ; 81 ( 23 ): 7373 – 7377 . doi: 10.1073/pnas.81.23.7373 OpenUrl Abstract / FREE Full Text 29. ↵ Chen J , Noble AJ , Kang JY , Darst SA . Eliminating effects of particle adsorption to the air/water interface in single-particle cryo-electron microscopy: Bacterial RNA polymerase and CHAPSO . J Struct Biol X . 2019 ; 1 : 100005 . doi: 10.1016/j.yjsbx.2019.100005 OpenUrl CrossRef 30. ↵ Suloway C , Pulokas J , Fellmann D , et al. Automated molecular microscopy: The new Leginon system . Journal of Structural Biology . 2005 ; 151 ( 1 ): 41 – 60 . doi: 10.1016/j.jsb.2005.03.010 OpenUrl CrossRef PubMed Web of Science 31. ↵ Zheng SQ , Palovcak E , Armache JP , Verba KA , Cheng Y , Agard DA . MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy . Nat Methods . 2017 ; 14 ( 4 ): 331 – 332 . doi: 10.1038/nmeth.4193 OpenUrl CrossRef PubMed 32. ↵ Punjani A , Rubinstein JL , Fleet DJ , Brubaker MA . cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination . Nat Methods . 2017 ; 14 ( 3 ): 290 – 296 . doi: 10.1038/nmeth.4169 OpenUrl CrossRef PubMed 33. ↵ Zivanov J , Nakane T , Scheres SHW . A Bayesian approach to beam-induced motion correction in cryo-EM single-particle analysis . IUCrJ . 2019 ; 6 ( Pt 1 ): 5 – 17 . doi: 10.1107/S205225251801463X OpenUrl CrossRef PubMed 34. ↵ Tan YZ , Baldwin PR , Davis JH , et al. Addressing preferred specimen orientation in single-particle cryo-EM through tilting . Nat Methods . 2017 ; 14 ( 8 ): 793 – 796 . doi: 10.1038/nmeth.4347 OpenUrl CrossRef PubMed 35. ↵ Cardone G , Heymann JB , Steven AC . One number does not fit all: Mapping local variations in resolution in cryo-EM reconstructions . Journal of Structural Biology . 2013 ; 184 ( 2 ): 226 – 236 . doi: 10.1016/j.jsb.2013.08.002 OpenUrl CrossRef PubMed 36. ↵ Pettersen EF , Goddard TD , Huang CC , et al. UCSF Chimera--a visualization system for exploratory research and analysis . J Comput Chem . 2004 ; 25 ( 13 ): 1605 – 1612 . doi: 10.1002/jcc.20084 OpenUrl CrossRef PubMed Web of Science 37. ↵ Adams PD , Afonine PV , Bunkóczi G , et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution . Acta Crystallogr D Biol Crystallogr . 2010 ; 66 ( Pt 2 ): 213 – 221 . doi: 10.1107/S0907444909052925 OpenUrl CrossRef PubMed Web of Science 38. ↵ Afonine PV , Klaholz BP , Moriarty NW , et al. New tools for the analysis and validation of cryo-EM maps and atomic models . Acta Crystallogr D Struct Biol . 2018 ; 74 ( Pt 9 ): 814 – 840 . doi: 10.1107/S2059798318009324 OpenUrl CrossRef PubMed 39. ↵ Emsley P , Cowtan K. Coot: model-building tools for molecular graphics . Acta Crystallogr D Biol Crystallogr . 2004 ; 60 ( Pt 12 Pt 1 ): 2126 – 2132 . doi: 10.1107/S0907444904019158 OpenUrl CrossRef PubMed Web of Science 40. ↵ Kang JY , Mishanina TV , Bao Y , et al. An ensemble of interconverting conformations of the elemental paused transcription complex creates regulatory options . Proc Natl Acad Sci U S A . 2023 ; 120 ( 8 ): e2215945120 . doi: 10.1073/pnas.2215945120 OpenUrl CrossRef PubMed 41. ↵ Messmore JM , Raines RT . Pentavalent Organo-Vanadates as Transition State Analogues for Phosphoryl Transfer Reactions . J Am Chem Soc . 2000 ; 122 ( 41 ): 9911 – 9916 . doi: 10.1021/ja0021058 OpenUrl CrossRef PubMed Web of Science 42. ↵ Scheres SHW . RELION: Implementation of a Bayesian approach to cryo-EM structure determination . Journal of Structural Biology . 2012 ; 180 ( 3 ): 519 – 530 . doi: 10.1016/j.jsb.2012.09.006 OpenUrl CrossRef PubMed 43. ↵ Oldham ML , Chen J. Snapshots of the maltose transporter during ATP hydrolysis . Proc Natl Acad Sci U S A . 2011 ; 108 ( 37 ): 15152 – 15156 . doi: 10.1073/pnas.1108858108 OpenUrl Abstract / FREE Full Text 44. ↵ Shimizu T , Johnson KA . Presteady state kinetic analysis of vanadate-induced inhibition of the dynein ATPase . J Biol Chem . 1983 ; 258 ( 22 ): 13833 – 13840 . OpenUrl Abstract / FREE Full Text 45. ↵ Abeyrathne PD , Koh CS , Grant T , Grigorieff N , Korostelev AA . Ensemble cryo-EM uncovers inchworm-like translocation of a viral IRES through the ribosome . Elife . 2016 ; 5 : e14874 . doi: 10.7554/eLife.14874 OpenUrl CrossRef PubMed 46. Loveland AB , Demo G , Grigorieff N , Korostelev AA . Ensemble cryo-EM elucidates the mechanism of translation fidelity . Nature . 2017 ; 546 ( 7656 ): 113 – 117 . doi: 10.1038/nature22397 OpenUrl CrossRef PubMed 47. ↵ Saecker RM , Mueller AU , Malone B , et al. Early intermediates in bacterial RNA polymerase promoter melting visualized by time-resolved cryo-electron microscopy . Published online March 14, 2024 . doi: 10.1101/2024.03.13.584744 OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted September 06, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Structural basis for loading of Transcription Repair-Coupling factor Mfd onto stalled elongation complexes Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Structural basis for loading of Transcription Repair-Coupling factor Mfd onto stalled elongation complexes Joshua Brewer , Eliza Llewellyn , James Chen , Elizabeth A. Campbell , Seth A. Darst bioRxiv 2025.09.05.674597; doi: https://doi.org/10.1101/2025.09.05.674597 Share This Article: Copy Citation Tools Structural basis for loading of Transcription Repair-Coupling factor Mfd onto stalled elongation complexes Joshua Brewer , Eliza Llewellyn , James Chen , Elizabeth A. Campbell , Seth A. Darst bioRxiv 2025.09.05.674597; doi: https://doi.org/10.1101/2025.09.05.674597 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Biophysics Subject Areas All Articles Animal Behavior and Cognition (7629) Biochemistry (17660) Bioengineering (13881) Bioinformatics (41911) Biophysics (21436) Cancer Biology (18578) Cell Biology (25482) Clinical Trials (138) Developmental Biology (13371) Ecology (19887) Epidemiology (2067) Evolutionary Biology (24302) Genetics (15599) Genomics (22482) Immunology (17728) Microbiology (40363) Molecular Biology (17163) Neuroscience (88536) Paleontology (666) Pathology (2830) Pharmacology and Toxicology (4821) Physiology (7637) Plant Biology (15129) Scientific Communication and Education (2045) Synthetic Biology (4290) Systems Biology (9817) Zoology (2269)