The kinase domain of RIPK3 tunes its scaffolding functions

The kinase domain of RIPK3 tunes its scaffolding functions | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The kinase domain of RIPK3 tunes its scaffolding functions Shene Chiou , Komal M. Patel , Adele Preaudet , James A. Rickard , Christopher R. Horne , Samuel N. Young , Sarah E. Garnish , Anne Hempel , Cathrine Hall , Joanne M. Hildebrand , Andrew J. Kueh , Tracy L. Putoczki , Edwin D. Hawkins , Andre L. Samson , View ORCID Profile James M. Murphy doi: https://doi.org/10.1101/2025.04.29.651198 Shene Chiou 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Komal M. Patel 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Adele Preaudet 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site James A. Rickard 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 3 Royal Melbourne Hospital , Parkville, VIC 3052, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christopher R. Horne 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia 4 Drug Discovery Biology, Monash Institute of Pharmaceutical Sciences, Monash University , Parkville, VIC 3052, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Samuel N. Young 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sarah E. Garnish 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Anne Hempel 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Cathrine Hall 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Joanne M. Hildebrand 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Andrew J. Kueh 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia 5 Olivia Newton-John Cancer Research Institute , Heidelberg, Melbourne, Australia 6 School of Cancer Medicine, La Trobe University , Bundoora, Melbourne, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tracy L. Putoczki 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Edwin D. Hawkins 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: hawkins.e{at}wehi.edu.au samson.a{at}wehi.edu.au jamesm{at}wehi.edu.au Andre L. Samson 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: hawkins.e{at}wehi.edu.au samson.a{at}wehi.edu.au jamesm{at}wehi.edu.au James M. Murphy 1 Walter and Eliza Hall Institute of Medical Research , Parkville, VIC 3052, Australia 2 Department of Medical Biology, University of Melbourne , Parkville, VIC 3010, Australia 4 Drug Discovery Biology, Monash Institute of Pharmaceutical Sciences, Monash University , Parkville, VIC 3052, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for James M. Murphy For correspondence: hawkins.e{at}wehi.edu.au samson.a{at}wehi.edu.au jamesm{at}wehi.edu.au Abstract Full Text Info/History Metrics Supplementary material Preview PDF ABSTRACT The pro-inflammatory programmed cell death pathway, necroptosis, relies on phosphorylation of the terminal effector, MLKL, by RIPK3. RIPK3-deficient mice or those harboring the kinase-inactivating mutation, RIPK3 K51A , are ostensibly normal in the absence of challenge, indicating that RIPK3 and its kinase activity are dispensable for development. However, another kinase-inactivating mutation, RIPK3 D161N , results in embryonic lethality in mice due to widespread apoptosis. As a result, the RIPK3 D161N mutation is thought to confer a toxic gain-of-function. Here, to further explore the impacts of RIPK3 inactivation, we compared the stability and cellular interactions of RIPK3 D161N and RIPK3 K51A to a third previously-uncharacterized kinase-dead variant, RIPK3 D143N . Here, we show that RIPK3 K51A was unstable and did not associate with RIPK1, RIPK3 D161N was unstable but interacted with RIPK1, whereas RIPK3 D143N was stable and bound RIPK1 in a manner comparable to wild-type RIPK3. Thus, all three variants scaffold differently, suggesting that the assembly of cell death machinery by RIPK3 is finely tuned, not just by its kinase activity, but also by the conformation of its kinase domain. Physiologically, Ripk3 D143N/D143N mice exhibited a partially penetrant lethality in utero . However, once born, Ripk3 D143N/D143N mice were fertile and phenotypically indistinguishable from wild-type mice in the absence of challenge, with RIPK3 D143N mutation protecting mice lacking intestinal epithelial Caspase-8 from necroptotic ileitis. Our studies support the idea that RIPK3 is a nexus between apoptotic and necroptotic signaling, and highlight the importance of considering kinase domain conformation in RIPK3 inhibitor development. Introduction Necroptosis is a caspase-independent, pro-inflammatory programmed cell death modality that has been implicated in the pathology of a wide range of diseases. Lysis caused by necroptotic cell death releases damage-associated molecular patterns (DAMPs) into the extracellular milieu 1 . DAMP release, in turn, provokes an immune response, which reflects the likely origins of the pathway as an altruistic cell death mode that combats pathogens 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 . Over the past decade, intense interest has centred on the role of dysregulated necroptosis in disease pathologies, particularly in ischemic injury and inflammatory diseases in the kidney, lung, gut and skin 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 . Necroptotic signaling is initiated by ligation of death receptors, such as TNF Receptor 1 by TNF, or pathogen receptors, such as Toll-like receptors and the intracellular sensor protein, ZBP1, by microbial ligands. Under specific contexts, for example when the cellular inhibitors of apoptosis proteins (cIAP) E3 Ubiquitin ligase family and pro-apoptotic caspases are depleted, necroptosis can ensue by prompting assembly of a cytosolic signaling platform known as the necrosome. This megadalton complex is nucleated by the Receptor-interacting serine/threonine protein kinases (RIPKs), RIPK1 and RIPK3 22 , 23 . RIPK1 and RIPK3 assemble into hetero-oligomers through the functional amyloid-forming RIP homotypic interaction motif (RHIM) within the sequence C-terminal to each kinase domain 24 , 25 , 26 . Autophosphorylation of both RIPK1 and RIPK3 is essential for necroptotic signaling, with autophosphorylation within the RIPK3 kinase domain C-lobe (T224/S227 in human RIPK3 27 , 28 , 29 ; T231/S232 in mouse RIPK3 30 ) essential for facilitating binding to, and recruitment of, the terminal pathway effector, the MLKL (mixed lineage kinase domain-like) pseudokinase, to the necrosome 29 , 31 . Subsequent phosphorylation of MLKL’s pseudokinase domain by RIPK3 is the critical trigger in promoting MLKL disengagement from the necrosome, oligomerization, trafficking to the plasma membrane, and assembly into lytic hotspots where membrane permeabilization occurs 27 , 32 , 33 , 34 , 35 , 36 , 37 . Because RIPK3-mediated phosphorylation of MLKL is a pivotal step in necroptotic signaling 29 , 31 , several mouse models have been established to probe the functions of RIPK3 38 , 39 , 40 , 41 , 42 , 43 . Deletion of RIPK3 does not compromise mouse viability and, in the absence of challenge, these mice are largely indistinguishable from wild-type counterparts 39 , 40 . In comparison, many pathological processes are influenced by RIPK3 deficiency 20 , 44 , although distinguishing whether these effects stem from RIPK3’s catalytic or non-enzymatic functions remains challenging. With the aim of deconvoluting this issue, three kinase-dead RIPK3 mouse strains have been generated: 1) The Ripk3 K51A/K51A mouse strain harbors a mutation in the N-lobe of the kinase domain that eliminates canonical ATP-binding. Like Ripk3 −/− mice, this strain is phenotypically normal under basal conditions 38 ; 2) The Ripk3 D161N/D161N mouse strain carries a substitution in an activation loop residue that is required for Mg 2+ binding. This strain has a fully penetrant embryonic lethal phenotype driven by errant Caspase-8-mediated apoptosis 41 ; 3) The Ripk3 S165D/T166E mouse strain harbors two mutations in RIPK3’s activation loop that impair kinase activity and produces a phenotype similar to, albeit less severe than, Ripk3 D161N/D161N mice 42 . Why these kinase-inactivating mutations in RIPK3 yield different phenotypes remains unclear. It may indicate that the RIPK3 K51A mutation prevents both RIPK3’s necroptotic and apoptotic actions, whereas the RIPK3 D161N and RIPK3 S165D/T166E variants solely perturb necroptotic signaling. Understanding how RIPK3’s kinase domain regulates cell death remains a topic of great interest given that selective small inhibitors of RIPK3, while preventing necroptosis, also trigger on-target apoptosis 38 . To further examine the role of RIPK3’s kinase domain in the necroptosis-to-apoptosis switch, we generated another knock-in strain harboring a conservative Asp-to-Asn substitution at residue 143 within the catalytic loop of RIPK3’s kinase domain, herein referred to as Ripk3 D143N/D143N mice. In contrast to other kinase-dead RIPK3 variants, Ripk3 D143N/D143N mice were born at a sub-Mendelian ratio due to the partial loss of homozygotes during embryogenesis. However, once born, Ripk3 D143N/D143N mice were viable, fertile and developmentally normal into adulthood. The distinct phenotypes of the various kinase-inactivating mutations could be attributed to differences in their protein stability and binding repertoires. We observed that RIPK3 D143N was more stable than RIPK3 K51A and RIPK3 D161N , and only RIPK3 D143N bound both RIPK1 and Caspase-8 in the presence of a caspase inhibitor. Overall, our data support the concept that the conformation of RIPK3’s kinase domain tightly regulates the higher-order assembly of a RIPK1- and Caspase-8-containing complex. RESULTS The kinase domain of RIPK3 controls apoptosis RIPK3 catalytic activity is essential for necroptotic signaling because of its ability to phosphorylate and activate MLKL 29 , 31 . RIPK3’s kinase activity relies on three active site residues: the ATP-positioning lysine within the β3 strand of the N-lobe (K51 in mouse RIPK3); the catalytic Asp of the catalytic loop HRD motif (D143); and the Mg 2+ cofactor binding Asp of the DFG motif in the activation loop (D161) ( Fig. 1a ). To compare the functional impact of kinase-inactivating mutations at these sites, we stably transduced Ripk3 −/− mouse dermal fibroblasts (MDFs) with lentiviral vectors encoding doxycycline-inducible wild-type RIPK3 (RIPK3 WT ), RIPK3 K51A , RIPK3 D 143 N and RIPK3 D 161 N . A concentration of 10 ng/mL doxycycline (dox) was chosen to reconstitute RIPK3 expression to endogenous levels ( Supp. Fig. 1A ). Unlike with RIPK3 WT , reconstitution with RIPK3 K51A , RIPK3 D 143 N and RIPK3 D 161 N mutants, did not restore sensitivity to the necroptotic stimulus, TNF/Smac mimetic/IDN-6556 (TSI; Fig. 1Bi ), verifying that the mutants were catalytically inactive. Download figure Open in new tab Fig. 1. Cells expressing different kinase-dead RIPK3 mutants exhibit distinct sensitivities to apoptotic stimuli. A Richardson (Ribbons) diagram of the mouse RIPK3 kinase domain structure (PDB, 4M66) 62 in which the three catalytic residues targeted for kinase dead mutations are shown as red sticks. B Death of Ripk3 −/− MDFs without or with doxycycline to express RIPK3 WT , RIPK3 K51A , RIPK3 D143N or RIPK3 D161N in the presence of the stipulated stimuli. Treatments: (i) TNF, Smac mimetic and IDN-6556 (TSI); (ii) vehicle, DMSO; (iii) IDN-6556; (iv) TNF and Smac mimetic (TS); (v) GSK′843; (vi) GSK′843, IDN-6556. Mean±SEM for one experiment and representative of data from 2 independent experiments. Cell death calculated as the percentage of propidium iodide + cells relative to the number of SPY700 + cells. C Immunofluorescence of Ripk3 −/− MDF cells without or with doxycycline to express RIPK3 WT , RIPK3 K51A , RIPK3 D143N or RIPK3 D161N . Data representative of two independent experiments. Red, Hoechst nuclear stain. White, RIPK3 immunosignal. In the absence of an external stimulus, the reconstitution of Ripk3 −/− MDF cells with RIPK3 WT or the RIPK3 K51A , RIPK3 D143N and RIPK3 D161N mutants yielded different cell fates. RIPK3 K51A did not induce death, RIPK3 WT and RIPK3 D143N produced mild death, whereas RIPK3 D161N caused extensive death ( Fig. 1Bii ). These constitutive death responses were due to RIPK3-mediated apoptosis as they were prevented by the pan-Caspase inhibitor, IDN-6556 ( Fig. 1Biii ). Thus, consistent with prior reports 38 , 41 , we found that RIPK3 D 161 N is a stimulus-independent trigger for apoptosis, whereas the other kinase-dead variants of RIPK3 were comparatively less toxic. We next studied the role of RIPK3 mutation on TNF-induced apoptosis. Interestingly, RIPK3 WT and RIPK3 D 143 N , but not RIPK3 K51A , increased the rate of apoptosis caused by TNF/Smac mimetic compared to cells in which exogene expression was not induced by dox (TS; Fig. 1Biv ). Due to constitutive killing activity of RIPK3 D 161 N , the impact of RIPK3 D 161 N on TNF-induced apoptosis could not be assessed. Thus, RIPK3’s role in TNF-induced apoptosis is blocked by the RIPK3 K51A mutation, but largely unaffected by the RIPK3 D 143 N mutation. To further explore RIPK3’s apoptotic scaffolding function, we used GSK′843 – a selective RIPK3 inhibitor that targets the RIPK3 active site and induces Caspase-8-dependent apoptosis 38 . GSK′843 induced high levels of apoptosis in cells expressing RIPK3 WT and RIPK3 K51A , but was well-tolerated by cells reconstituted with RIPK3 D143N ( Fig. 1Bv-vi ). Again, the influence of RIPK3 D161N on GSK′843-induced apoptosis could not be distinguished from its inherent toxicity. Thus, in contrast to TNF-induced apoptosis, RIPK3’s role in GSK′843-induced apoptosis is unaffected by the RIPK3 K51A mutation, but attenuated by the RIPK3 D143N mutation. Notably, the ability of RIPK3 D161N and GSK′843 to trigger apoptosis was reflected by their shared propensity to drive RIPK3 into large cytoplasmic puncta ( Fig. 1C and Supp. Fig. 1B ). Together, our data suggest that RIPK3’s kinase domain conformation finely tunes its apoptotic scaffolding function, with RIPK3 D 161 N constitutively inducing apoptosis, RIPK3 K51A obviating RIPK3’s involvement in TNF-induced apoptosis, and RIPK3 D 143 N attenuating GSK′843-induced apoptosis. Catalytically-dead RIPK3 D143N retains stability and RIPK1-Caspase-8-binding We hypothesized that conformational differences among the three kinase-dead versions of RIPK3 underlies their variable stability and scaffolding properties. To address this possibility, we expressed each exogene in Ripk3 −/− MDF cells, subjected each to a thermal gradient and examined RIPK3’s solubility by immunoblot. This assay was chosen on the basis that pro-apoptotic signaling by GSK′843 involves enhanced RIPK3 thermal stability ( Supp. Fig. 1C ). Interestingly, RIPK3 D 143 N was the only mutant that exhibited thermal stability comparable to wild-type RIPK3 ( Fig. 2A-B ), with the destabilization of RIPK3 K51A and RIPK3 D 161 N implying each is conformationally labile. These differences in the stability of RIPK3 had no bearing on the stability of endogenous MLKL ( Fig. 2A-B ), prompting us to examine which other interactions are modulated by RIPK3 mutation. Accordingly, we reconstituted Ripk3 −/− MDF cells with RIPK3 WT or the kinase-dead mutants in the presence of IDN-6556 to prevent caspase-mediated cleavage of RIPK3 43 , 45 , followed by a brief treatment with TSI to allow TNF-induced death complexes to form ( Fig. 2C ). Critically, the interactions of RIPK3 D 143 N resembled that of wild-type RIPK3, where it bound phospho-RIPK1 and Caspase-8 following necroptotic stimulation with TSI. On the other hand, RIPK3 K51A bound neither RIPK1 nor Caspase-8, which aligns with its inability to mediate TNF-driven cell death. While RIPK3 D 161 N was able to retain phospho-RIPK1 binding, it no longer precipitated with Caspase-8, which may underlie its constitutive killing activity. More broadly, these data imply that the stability and conformation of RIPK3’s kinase domain, in addition to its catalytic activity, is a key determinant of apoptotic and necroptotic signaling. Download figure Open in new tab Fig. 2. RIPK3 D143N retains stability and ability to bind to Caspase-8 and RIPK1. A-B Immunoblots (Panel A) and quantitation (Panel B) of cellular thermal stability assay of RIPK3 WT , RIPK3 K51A , RIPK3 D143N and RIPK3 D161N . Representative of n=4 for RIPK3 WT , RIPK3 K51A , RIPK3 D143N , and n=1 for RIPK3 D161N . Mean±SEM. C Immunoblot of input and co-immunoprecipitations (FLAG-IP) of reconstituted RIPK3 WT , RIPK3 K51A , RIPK3 D143N and RIPK3 D161N in Ripk3 −/− MDFs in the presence of IDN-6556 ± overnight doxycycline (DOX), then 2 hours of necroptotic stimuli (TSI). Data representative of n=2. Adult Ripk3 D143N/D143N mice are viable, fertile and ostensibly normal In contrast to RIPK3 K51A and RIPK3 D161N mutants, RIPK3 D143N retains RIPK3 WT -like stability and cellular interactions, making it an ideal kinase-dead mutant to explore RIPK3’s non-necroptotic actions in vivo . Accordingly, we generated a mouse harboring a RIPK3 D143N -encoding mutation within exon 3 of the mouse Ripk3 gene using CRISPR/Cas9 editing ( Fig. 3A ). Ripk3 D143N/D143N mice were viable, fertile homozygous knock-in animals ( Fig. 3B ) that developed normally into adulthood ( Supp. Fig. 2A-G ). Intriguingly, while heterozygous matings produced a Mendelian distribution of genotypes at embryonic day 10 (E10.5), Ripk3 D143N/D143N mice were slightly but significantly under-represented at weaning ( Fig. 3C ; ξ 2 test for goodness of fit showed p=0.88 at E10.5 and p=0.02 at weaning). This observation suggests that Ripk3 D143N/D143N mice are partially sensitized to the same peripartum checkpoint that causes lethality in Ripk3 D161N/D161N mice and Ripk3 S 165 D/T166E mice 41 , 42 . In unchallenged adult Ripk3 D143N/D143N mice, RIPK3 D 143 N was expressed and distributed comparably to wild-type RIPK3 in all examined tissues ( Fig. 3D and Supp. Fig. 3), consistent with the stability of exogenous RIPK3 D 143 N observed in our cellular studies. Importantly, MDF cells and bone marrow-derived macrophages from Ripk3 D143N/D143N mice confirmed that the endogenously-expressed RIPK3 D 143 N was catalytically inactive because these cells were completely protected from TNF-induced necroptotic death yet could still undergo TNF-induced apoptosis ( Fig. 3E-F ). Collectively, these data show that endogenous RIPK3 D 143 N , despite conferring a transient and partial toxicity in utero , is stable and well-tolerated in mouse cells and tissues. Download figure Open in new tab Fig. 3. Ripk3 D143N/D143N mice resemble Ripk3 WT/WT littermates in the absence of challenge. A CRISPR gene editing strategy for the generation of Ripk3 D143N/D143N mice. B Ripk3 WT/WT and Ripk3 D143N/D143N littermates at 4 months-of-age. C Genotype distribution at E10.5 or at weaning from heterozygous Ripk3 D143N/WT matings. Statistical test to compare observed versus expected genotype ratios: ξ 2 test for goodness of fit showed p=0.88 at E10.5 and p= 0.02 at weaning. D Immunoblot of organ homogenates of littermates, n=2 per genotype. E Quantitation of the death of mouse dermal fibroblasts (MDF) and bone marrow derived macrophages (BMDM) from Ripk3 WT/WT and Ripk3 D143N/D143N mice. Cells were untreated (UT) or stimulated with TNF+Smac mimetic (TS) or TS+IDN-6556 (TSI). Cell death was measured by the uptake of SYTOX Green. BMDM death was calculated as the percentage of SYTOX Green + cells relative to the number of SPY620 + cells. MDF data representative of two independent experiments across three independent cell lines. BMDM data representative of one experiment. F Micrographs of Ripk3 WT/WT and Ripk3 D143N/D143N MDFs after 19 hours of treatment. Scale bars represents 200 µm. RIPK3 D143N protects mice from MLKL-dependent intestinal inflammation We next sought to determine whether endogenous RIPK3 D143N protects from in vivo necroptosis. To this end, we established a colony of Villin 1000 –Cre Casp8 fl/fl mice (herein referred to as Casp8 IEC mice) where the Villin promoter drives Cre expression to delete Caspase-8 from intestinal epithelial cells, which in turn triggers RIPK1-RIPK3-MLKL-dependent Paneth cell loss and intestinal inflammation 20 , 21 , 46 . We confirmed that Villin 1000 –driven Cre activity was on-target ( Fig. S4A ; mild off-target Cre activity was found in the liver) and induced selective and complete deletion of Caspase-8 from the intestinal epithelia in Casp8 IEC mice ( Supp. Fig. 4B ). Consistent with prior reports 20 , 21 , 46 , Casp8 IEC mice developed endoscopically-apparent colitis ( Fig. 4A-B ), with a significant proportion of the Lyzozyme + and MPTX2 + Paneth cells lost by 6 months-of-age ( Fig. 4C-D and Supp. Fig. 5A-B ). Beyond these manifestations, Casp8 IEC mice in our facility exhibited a mild phenotype without impacts on survival ( Supp. Fig. 5C ), weight ( Supp. Fig. 5D ), or Goblet cell numbers ( Fig. 4E-F ). Importantly, crossing Casp8 IEC mice onto the Ripk3 D143N/D143N background completely prevented Paneth cell loss ( Fig. 4C-D ). Similarly, Casp8 IEC Mlkl IEC mice with conditional deletion of both caspase-8 and MLKL were fully protected from Paneth cell loss ( Fig. 4C-D ). Altogether, these data show, for the first time, that cell-intrinsic necroptosis is solely responsible for Paneth cell loss in the Casp8 IEC model. Why Paneth cells, which express low levels of RIPK3 under basal conditions 14 , are the only intestinal epithelial population that succumbs to Caspase-8-deficiency remains unclear. Interestingly, intestinal epithelial RIPK3 expression was increased in Casp8 IEC mice, but remained at basal levels in Casp8 IEC Ripk3 D143N/D143N and Casp8 IEC Mlkl IEC mice ( Fig. 4G ). Because intestinal RIPK3 levels increase with inflammation 14 , this finding indicates that Paneth cell necroptosis is the precipitating event that promotes downstream intestinal inflammation. More broadly, our study shows that the Ripk3 D143N mouse model is an elegant way of preventing necroptosis in vivo , and provides definitive support for the crucial interplay of Caspase-8 and the necroptotic machinery in provoking gut inflammation. Download figure Open in new tab Fig. 4. Caspase-8-deficient Paneth cells survive in Ripk3 D143N/D143N mice. A Endoscopy images of a healthy wild-type ( Casp8 WT ) mouse and a Casp8 IEC mouse with colitis. Red arrow points to the loss of vasculature and black arrow points to a loose stool. B Murine endoscopic index of colitis severity (MEICS) scores for Casp8 WT and Casp8 IEC mice. Each dot represents the score from a mouse during their monthly endoscopy session between 6-24 weeks-of-age. Line indicates mean. ***p<0.001 from unpaired non-parametric t-test with Mann-Whitney correction. Casp8 WT n=13 mice. Casp8 IEC n=12 mice. C Periodic Acid-Schiff (PAS; magenta) staining. Scale bars are 20 µm. Images representative of Casp8 WT n =5, Casp8 IEC n =6, Casp8 IEC Mlkl IEC n =4, and Casp8 IEC Ripk3 D143N/D143N n =3 mice. D PAS + cells as a percentage of total cells. Same cohort as in Panel E. An average of 70,000 cells were measured per mouse with each dot representing the mean value from one mouse. Bars indicate group mean ±SD. n.s. indicates p>0.05 by ordinary one-way ANOVA with Tukey’s correction. E Immunohistochemistry (brown) signals for lysozyme. Scale bars are 20 µm. Images representative of Casp8 WT n=3, Casp8 IEC n=4, Casp8 IEC Mlkl IEC n=3, and Casp8 IEC Ripk3 D143N/D143N n=4 mice. F Lysozyme + cells as a percentage of total cells. Same cohort as in Panel C. An average of 35,000 cells were measured per mouse with each dot representing the mean value from one mouse. Bars indicate group mean ±SD. *p<0.05 and **p<0.01 by ordinary one-way ANOVA with Tukey’s correction. G Immunohistochemistry signals for RIPK3 in the ileum of Casp8 WT , Casp8 IEC , Casp8 IEC Mlkl IEC , and Casp8 IEC Ripk3 D143N/D143N mice; representative of n =3, 5, 3, and 4 mice. Scale bars are 100 µm. DISCUSSION Until recently, observations that RIPK3 inhibition can promote apoptosis have raised concerns about RIPK3’s viability as a therapeutic target 38 , 41 . However, subsequent findings indicate that RIPK3 inhibitors are well-tolerated in animals 47 , 48 , 49 , suggesting RIPK3 kinase domain conformation, rather than loss of catalytic activity, is likely to underpin the previously reported Caspase-8-driven toxicity. Here, we tested this idea by generating a knock-in mouse strain harboring the RIPK3 D143N kinase-dead mutant. The resulting Ripk3 D143N homozygote mice were viable, fertile, with no detectable pathology or hematopoietic defects in the absence of challenge, unlike the embryonic lethality found in Ripk3 D161N strain 41 . Collectively, our data support the idea that RIPK3 D143N is akin to RIPK3 WT in interactions and stability, leading us to propose that Ripk3 D143N/D143N mice should be adopted as the preferred model for studying the non-catalytic roles of RIPK3 in vivo . We demonstrate the utility of the Ripk3 D143N/D143N strain as a model for studying necroptosis in vivo by showing protection from the ileitis caused by intestinal epithelial cell knockout of Casp8 . The protection conferred by the RIPK3 D143N mutation was phenocopied by deletion of Mlkl specifically within intestinal epithelial cells, indicating that blockade of necroptosis within intestinal epithelial cells, rather than infiltrating cells, confers protection. While adult Ripk3 D143N/D143N mice grossly resembled wild-type counterparts, we observed a partially-penetrant embryonic lethality manifesting in sub-Mendelian ratio of homozygotes at weaning. Because embryonic lethality was previously observed for the Ripk3 D161N strain 41 and Ripk3 S165D/T166E strain 42 , but not Ripk3 K51A mice 38 , it was known that loss of RIPK3 catalytic activity itself is not deleterious to development. Here, our findings with the Ripk3 D143N knock-in mouse support this assertion, and instead indicate that the conformation of the RIPK3 kinase domain is a crucial determinant of cell, and organism viability. Much emphasis has been placed on the role of the RIPK1 and RIPK3 RHIMs in assembling the necrosome. Whilst it has been long-established that RIPK1 autophosphorylation of S166 within its kinase domain is crucial to propagation of necroptotic signals 18 , 50 , 51 , our data support a model in which the conformation of the RIPK3 kinase domain allosterically influences RIPK3’s interaction with RIPK1, which in turn influences downstream cell death signaling ( Fig. 5 ). How this allosteric regulation extends to Caspase-8 sequestration and activation, and impacts the stoichiometry and connectivity of RIPK3-containing complexes, remains a major focus for future investigation. Download figure Open in new tab Fig. 5. Working model for the cellular interactions of wild-type RIPK3 and its kinase-dead mutants. Star indicates mutant form of RIPK3. RIP homotypic interaction motif (RHIM), Death Effector Domain (DED), Death Domain (DD). METHODS Mice Mice were housed at the Walter and Eliza Hall Institute of Medical Research (WEHI), Australia. Animal experiments were approved by the WEHI Animal Ethics Committee (2022.085) in accordance with the Prevention of Cruelty to Animals Act (1986) and the Australian National Health and Medical Research Council Code of Practice for the Care and Use of Animals for Scientific Purposes (1997). Mice were housed in a temperature and humidity controlled specific pathogen free facility with a 12 hour:12 hour day night cycle. Villin.cre1000 mice were purchased from Jackson Laboratories (Jackson Laboratories, Maine, United States; Strain #021504). The floxed Casp 8 mouse strain 52 , the floxed Mlkl mouse strain 31 and the Rosa26 Ai9 Cre reporter mouse strain 53 have been reported previously. All mice in this study were maintained on a C57BL/6 J background. Co-housed littermate mice, rather than randomized cohorts, were preferentially used for the Casp8 IEC model. Unless stipulated, mice in the Casp8 IEC model were harvested at 5-6 months of age. Generation and genotyping of the Ripk3 D143N/D143N mouse strain Ripk3 D143N/D143N mice on C57BL/6J background were generated with CRISPR/Cas9 by the Melbourne Advanced Genome Editing Centre (MAGEC) laboratory. The Ripk3 gene on mouse chromosome 14 was targeted to induce the D143N mutation. One sgRNA of the sequence TGTTAGAGGGCTTGAGGTCC was used to create double stranded breaks within the Ripk3 locus to stimulate homologous recombination. An oligonucleotide donor with the sequence CCTGCTGCAGGAAGTGGTGCTGGGGATGTGCTACCTACACAGCTTGAACCCTCCGCT CCTGCACCGGAATCTCAAGCCCTCTAACATTCTGCTGGATCCAGAGCTCCACGCCAA GGTTAGTCCATCTACA was used to introduce the D143N mutation. To detect the integration of the donor, mice were genotyped using the forward primer GGGACAGGTACTCAACATGGTC and the reverse primer TTTCGGCGTGTAGGAAGAAG, with sequencing overhangs attached. The PCR conditions for genotyping were: 95°C 2 minutes, (95°C 30 seconds, 60°C 30 seconds, 72°C 30 seconds) x 35, 72°C 5 minutes. F0 mice were backcrossed with wildtype C57BL/6J mice for at least 2 generations to breed out any potential off-target mutations. Immunoblotting Cells/tissues were lysed in ice-cold RIPA buffer (10 mM Tris-HCl pH 8.0, 1 mM EGTA, 2 mM MgCl 2 , 0.5% v/v Triton X-100, 0.1% w/v sodium deoxycholate, 0.5% w/v sodium dodecyl sulfate (SDS), and 90 mM NaCl) supplemented with 1× Protease and Phosphatase Inhibitor Cocktail (Cell Signaling Technology Cat#5872) and 100 U/mL Benzonase (Sigma-Aldrich Cat#E1014) to a concentration of 50 mg/mL (w/v) with a stainless-steel bead using a Qiagen TissueLyser II (1 minute at 30 Hz). Homogenates were boiled for 10 minutes in 1 × SDS sample buffer (126 mM Tris-HCl, pH 8, 20% v/v glycerol, 4% w/v SDS, 0.02% w/v bromophenol blue, 5% v/v 2-mercaptoethanol) and ran on 1.5 mm NuPAGE 4–12% Bis-Tris gels (ThermoFisher Scientific NP0335BOX) in MES Running Buffer (ThermoFisher Scientific NP000202) at 150 V for 60 minutes. Gels were transferred to a polyvinylidene difluoride membrane (Merck Cat# IPVH00010) at 100 V for 60 minutes and then blocked in 5% w/v skim milk powder in TBS-T (50 mM TrisHCl pH 7.4, 0.15 M NaCl, 0.1 v/v Tween-20). After transfer, gels were stained with SimplyBlue SafeStain (ThermoFisher Scientific LC6065) and membranes were probed with the following antibodies: RIPK3 (clone 8G7; ref. 8 ; produced in-house; available from Millipore as MABC1595), RIPK3 (clone 1H12; ref. 54 ; produced in-house), MLKL (clone 3H1; ref. 31 ; produced in-house; available from Millipore as MABC604), Caspase-8 (clone F5K9P; Cell Signaling Technology), RIPK1 pS166 (Cat#31122; Cell Signaling Technology), RIPK1 (clone D94C12; Cell Signaling Technology), RIPK3 pS231pS232 (clone E7S1R; Cell Signaling Technology), RIPK3 (clone D4G2A; Cell Signaling Technology), horseradish peroxidase (HRP)-conjugated Actin (Santa Cruz Biotechnology, Cat# sc-47778), and GAPDH (Millipore MAB374). Primary antibodies produced in-house were used at 1 μg/mL for immunoblot, and all other primary antibodies were used at a 1:1000-2000 dilution in Tris-Balanced Salt Solution containing 0.1% Tween 20 (TBS+T) supplemented with 5% w/v cow’s skim milk powder and 0.01% w/v sodium azide. Primary antibody probes were performed overnight at 4 °C on a rocker before washing twice in TBS+T, then membranes were probed with a 1:10000 dilution of HRP-conjugated secondary antibody: goat anti-rat immunoglobulin (Ig; Southern BioTech Cat#3010-05), goat anti-rabbit Ig (Southern BioTech Cat#4010-05), and goat anti-mouse Ig (Southern BioTech Cat#1010-05). Membranes were washed four times in TBS+T and signals revealed by enhanced chemiluminescence (Merck Cat#WBLUF0100) on a ChemiDoc Touch Imaging System (Bio-Rad). Between probing with primary antibodies from the same species, membranes were incubated in stripping buffer (200 mM glycine pH 2.9, 1% w/v SDS, 0.5 mM TCEP) for 30 minutes at room temperature and then re-blocked. Uncropped immunoblots are included as a Supplemental Data file. Immunohistochemistry (IHC) Mice were euthanized via gradual carbon dioxide asphyxiation, with bipedal and orbital reflexes checked to ensure death. Tissues were harvested and immediately placed in 10% Neutral-Buffered Formalin at a 1:10 tissue:formalin ratio at room temperature. Formalin fixed tissues were paraffin embedded using the standard 8-hour auto-processing protocol of Tissue-Tek VIP® 6 AI Tissue Processor (Sakura Finetek USA) within 1-2 days of harvest. Four-micron-thick sections of paraffin-embedded tissues were cut onto adhesive slides (Menzel Gläser Superfrost PLUS). IHC and image acquisition of sections stained for Caspase-8, RIPK1, RIPK3 and cleaved Caspase-3 followed protocols described previously 55 ; staining for lysozyme (Abcam, Cat#108508) and for MPTX2 (Abcam, Cat#EPR20920-19; marker of Paneth cells 56 ) followed the protocols detailed in Supplementary Table 1. Cellular thermal stability assay Ripk3 −/− mouse dermal fibroblasts with doxycycline-inducible expression constructs for RIPK3 WT , RIPK3 K51A , RIPK3 D143N or RIPK3 D161N were seeded to ∼50% confluency. After 2 hours, cells were treated with 10 ng/mL doxycycline and 5 μM IDN-6556. The next day, cells were trypsinized, pelleted (700 ξ g , 5 minutes, room temperature), then resuspended in dPBS supplemented with cOmplete EDTA-free protease inhibitor (Merck, Cat#04693132001) and PhosSTOP phosphatase inhibitor (Merck, Cat#4906837001). 100 μL of 2×10 6 cells/mL were aliquoted into PCR tubes and incubated across a gradient of 8 temperatures (45-57°C) for 3 minutes, then at 21°C for 3 minutes, then at 12°C for 1 minute. Samples were immediately frozen at −80°C, thawed on ice, pelleted (20000 ξ g , 20 minutes, 4°C) and 35 μL of supernatant analyzed via immunoblot. Immunoblot signals were quantified with Image Lab v6.1 (Bio-Rad) using the raw full-resolution .scn Chemidoc files. Immunoprecipitation Ripk3 −/− mouse dermal fibroblasts with doxycycline-inducible expression constructs for RIPK3 WT , RIPK3 K51A , RIPK3 D143N or RIPK3 D161N were seeded into 6-well plates at 2×10 5 cells/well. 2 hours later, cells were treated with 5 μM IDN-6556 and ± 10 ng/mL doxycycline. The next day, cells were treated with 100 ng/mL tumor necrosis factor, 500 nM Smac mimetic Compound A and 5 µM IDN-6556. 90 minutes later, cells were washing with PBS, then lysed with 1 mL/well of lysis buffer (50 mM Tris-HCl, pH 7.4, 1 % v/v Triton X-100, 150 mM NaCl, cOmplete EDTA-free protease inhibitor (Merck, Cat#04693132001), PhosSTOP phosphatase inhibitor (Merck, Cat#4906837001) and 100 U/mL Benzonase (Sigma #E1014). Lysates were freeze-thawed and a 70 µL aliquot kept aside as the “input”. The remainder of each lysate was supplemented with 20 µL/sample of anti-HA magnetic beads (ThermoFisher Scientific Cat#88837), samples rotated (30 minutes, 4°C), beads pelleted and discarded, 120 µL/tube of anti-Flag magnetic beads (Merck, Cat#M8823) was added to the supernatant, samples rotated (90 minutes, 4°C), beads pelleted and washed three times with 0.5 mL of lysis buffer, beads pelleted, resuspended in 75 µL of 2xSDS loading buffer, incubated (10 minutes, 100°C), beads pelleted and the supernatant analyzed via immunoblot. Assessments of colitis severity Colonoscopies on mice were performed every four weeks from 6-24 weeks of age using established method 57 , 58 . Briefly, mice were anaesthetized via the gradual increase of isoflurane (0.5-5% v/v), pedal reflex was checked to ensure deep anesthesia, the endoscope probe inserted into the rectum (Coloview miniendoscopic system including Endovision Tricam (Karl Storz Cat#20212001-020); Xenon 175 light source with anti-fog pump (Karl Storz Cat#20134001); HOPKINS straight Forward Telescope (Karl Storz Cat#64301A); Endoscopic Sheath (total diameter 3 mm; Kalr Stroz Cat#61029C); Fibre Optic Light Cable (Kalr Stroz Cat#69495ND)) and then a video recorded with computer and media player software (Apple Inc., iMovie). Colonoscopy videos were scored using the murine endoscopic index of colitis severity (MEICS) rubric 57 in a blinded fashion. Mouse dermal fibroblasts and bone marrow derived macrophages culturing Mouse dermal fibroblasts (MDFs) were prepared from the skin of mouse tails then immortalized via stable lentiviral transduction with SV40 large T antigen as described previously 31 and maintained in DMEM + 8% fetal calf serum. Bone marrow-derived macrophages (BMDMs) were generated from the marrow harvested of mice femurs. Harvested cells were maintained in DMEM supplemented with 20% L929 conditioned media and 8% fetal calf serum for at least 7 days before experimentation. All cells were maintained at 37℃ under humidified conditions and 10% v/v carbon dioxide. Induction and quantification of cell death MDFs and BMDMs were seeded at 20,000 cells/well and 120,000 cells/well in 48-well plates, respectively. The next day, cells were treated with stimuli in DMEM supplemented with 1:20000 SYTOX Green (Invitrogen, Cat#S7020) ± 1:1000 SPY620-DNA (Spirochrome, Cat#SC401) or in DMEM supplemented with 1:2000 propidium iodide (ThermoFisher Scientific; Cat#P3566) ± 1:2000 SPY700-DNA (Spirochrome, Cat#SC601). The stimuli used were: 10 ng/mL doxycycline, 5 μM IDN-6556, 10 μM GSK′843, 100 ng/mL tumour necrosis factor, 500 nM Smac mimetic compound A. Directly after stimulation, cells were moved into an IncuCyte SX5 System (Essen Bioscience) and imaged using the 10x objective over time using the default bright-field, green, red and far-red channel settings. SYTOX Green + or propidium iodide + dead cells were quantified using IncuCyte SX5 v2022B software (Essen Bioscience). Immunofluorescence and image acquisition Ripk3 −/− mouse dermal fibroblasts with doxycycline-inducible expression constructs for RIPK3 WT , RIPK3 K51A , RIPK3 D143N or RIPK3 D161N were seeded at 15,000 cells/well into 8-well chamber slides (Ibidi Cat#80826). 2 hours later cells were treated with 10 ng/mL doxycycline and 5 μm IDN-6556, then 9 hours later cells were treated ± 10 μM GSK′843. 90 minutes later, slide was ice-chilled for 3 minutes, then washed in ice-cold dPBS, then fixed for 15 minutes in ice-cold methanol. Cells were washed once in ice-cold dPBS, then blocked in ice-cold Tris-balanced salt solution with 0.05% v/v Triton-×100 (TBS+T) supplemented with 10% v/v donkey serum (Sigma #D9663) for >1 hour. Cells were incubated in 2 μg/mL anti-RIPK3 antibody (clone 1H12; ref. 54 ; produced in-house) overnight at 4 °C in TBS+T with 10% v/v donkey serum. Cells were washed twice in TBS+T then incubated in 1:10000 AlexaFluor488-conjugated donkey anti-rat IgG supplemented with 0.1 μg/mL Hoechst 33342 (ThermoFisher Scientific Cat#H3570) for 3 hours at room temperature with gentle rocking. Cells were washed four times in ice-cold TBS+T then stored at 4 °C until being imaged on an Inverted Axio Observer.Z1 microscope (Zeiss) with the following specifications: Plan-Apochromat 100x/1.4 Oil Ph3 M27 lens, HXP 120 V excitation source, AlexaFluor488 imaged with a λ Excitation = 450–490 nm; λ beamsplitter = 495 nm; λ Emission = 500– 550 nm, Hoechst 33342 imaged with a λ Excitation = 359–371 nm; λ beamsplitter = 395 nm; λ Emission = 397-∞ nm, a sCMOS PCO.edge 4.2 camera, ZEN blue v3.10.103 capture software and ImageJ 1.54p post-acquisition processing software 59 . Typically, for each independent experiment, 5–10 randomly selected fields were captured per treatment group, where only the Hoechst 33342 signal was visualised prior to multi-channel acquisition. To ensure consistent signal intensities across independent experiments, the same excitation, emission and camera settings were used throughout this study. Histopathology of mice Comprehensive full body necropsy, Haematoxylin and eosin (H&E) images, blood analysis reports of wildtype n =3 and Ripk3 D143N n =3 littermates between 7-10 months of age were prepared by veterinary and medical pathologists from Phenomics Australia, Melbourne Victoria. Hematological analysis Submandibular bloods of mice from 2-13 months of age were collected into EDTA-coated tubes (Sarstedt Microvette® 500 EDTA K3E, 500 µL, Order number: 20.1341). Blood samples were diluted by a factor of 1-13-fold in dPBS and blood cells quantified with ADVIA 2120 hematological analyzer on the same day as blood collection. Periodic acid–Schiff stain The manual staining protocol for Periodic acid–Schiff stain (PAS, Sigma-Aldrich, Cat#1090330500) is detailed in Supplementary Table 1. Acquisition of (immuno)histochemistry images Stained slides were scanned on: Olympus VS200 (objective: 20x, numerical aperture 0.8, media dry; software: Olympus VS200 ASW 3.41). Representative full-resolution 8-bit RGB micrographs of tissues were imported into ImageJ 1.53t 59 . Capture settings and post-acquisition image transformations were held constant between any micrographs that were being compared. Assessment of Villin.Cre specificity Fresh frozen tissue sections from ROSA26 Ai9 Villin.Cre1000 mice and wild-type control mice were mounted in DAPI-containing media and imaged on a Vectra Polaris Imaging System (Akoya Biosciences), as described previously 60 . Acquisition software: Vectra Polaris v.1.0. Resolution: 0.5 μm/pixel (20x objective). LED light source. Default filters for DAPI MSI (4 seconds exposure) and Texas Red (150 seconds exposure) were used. Quantification of cells by IHC Full resolution scans of IHC stained tissue sections were opened in QuPATH software v.0.5.1. In brief, a selection tool is used to highlight an area of an average of 50% of Swiss rolls. IHC signal was unmixed from Hematoxylin using the “Color Deconvolution 2” plugin 61 . IHC-stain positive cells were segmented and quantified. Percentage of PAS + cells as total cells were calculated with two scripts, “PAS + cell detection” and “Total cell count”. Percentage of Lysozyme + or MPTX2 + cells were calculated with “Lysozyme + cell detection and total cell count”. “Threshold” for each script was adjusted with each staining batch due to natural variations, and tissue sections from mouse models of IBD were accompanied by wildtype littermate control on the same slide. The scripts are provided in Supplementary Table 2. Statistical analysis The number of independent experiments for each dataset is stipulated in the respective figure legend. The employed statistical tests are stipulated in the respective figure legend and performed using Prism v.10 (GraphPad). DATA AVAILABILITY The uncropped blots from this study are included as Supplementary Data. Other raw data from this study are available from the corresponding authors upon request. MATERIALS AVAILABILITY Any materials from this study that are not commercially available will be provided under Materials Transfer Agreement upon request to the corresponding authors. FUNDING This work was supported by National Health and Medical Research Council of Australia grants (1172929 and 2034104 to JMM, 2008652 to EDH, 2002965 to ALS, 2034044 to CRH; IRIISS 9000719), and by the Victorian State Government Operational Infrastructure Support scheme. TLP is supported by a Viertel Senior Medical Research Fellowship. JMM received research funding from Anaxis Pharma Pty Ltd and AH was funded by Anaxis Pharma Pty Ltd. We acknowledge scholarship support for SC (Australian Government Research Training Program Stipend Scholarship, WEHI Handman PhD Scholarship). AUTHOR CONTRIBUTIONS Conceptualization: SC, EDH, ALS, JMM. Investigation: SC, KMP, AP, JAR, CRH, SNY, SEG, AH, CH, JMH, AJK, ALS; Methodology: SC, KMP, AJK, TLP, ALS. Resources: TLP, EDH, ALS, JMM. Supervision: EDH, ALS, JMM. Funding acquisition: EDH, ALS, JMM. Writing: SC, ALS and JMM co-wrote the paper with input from authors. COMPETING INTERESTS KMP, CRH, SNY, AH, JMH, ALS and JMM contribute to or have contributed to a project developing necroptosis inhibitors in collaboration with Anaxis Pharma. TLP is cofounder and shareholder in Nelcanen Therapeutics. The other authors declare no competing interests. ETHICS DECLARATION All experiments were approved by the WEHI Animal Ethics Committee following the Prevention of Cruelty to Animals Act (1996) and the Australian National Health and Medical Research Council Code of Practice for the Care and Use of Animals for Scientific Purposes (1997). ACKNOWLEDGEMENTS We thank Bruce Rosengarten and Wayne Cawthorne for helpful discussions; WEHI Bioservices, WEHI Histology, the WEHI Monoclonal Antibody Facility for technical assistance; Gary Kasof and Cell Signaling Technology for generously sharing antibodies; Professor Marc Pellegrini for the Casp8 fl/fl strain; and Tina Cardamone and Dr John Finnie from Phenomics Australia Histopathology and Slide Scanning Service for their assistance with phenotyping the Ripk3 D142N/D142N mouse strain. The generation of Ripk3 D143N/D143N mice used in this study was supported by Phenomics Australia and the Australian Government through the National Collaborative Research Infrastructure Strategy (NCRIS) program. Funder Information Declared National Health and Medical Research CouncilNational Health and Medical Research Council, https://ror.org/011kf5r70 , 9000719 , 1172929 , 2034104 , 2008652 , 2002965 , 2034044 Sylvia and Charles Viertel Charitable FoundationSylvia and Charles Viertel Charitable Foundation, https://ror.org/05539km59 , Australian GovernmentAustralian Government, https://ror.org/0314h5y94 , Footnotes ↵ * Co-senior authors REFERENCES 1. ↵ Nakano H , Murai S , Moriwaki K . Regulation of the release of damage-associated molecular patterns from necroptotic cells . Biochem J 2022 , 479 ( 5 ): 677 – 685 . OpenUrl CrossRef PubMed 2. ↵ Fletcher-Etherington A , Nobre L , Nightingale K , Antrobus R , Nichols J , Davison AJ , et al. Human cytomegalovirus protein pUL36: A dual cell death pathway inhibitor . Proc Natl Acad Sci U S A 2020 , 117 ( 31 ): 18771 – 18779 . OpenUrl Abstract / FREE Full Text 3. ↵ Jiao H , Wachsmuth L , Kumari S , Schwarzer R , Lin J , Eren RO , et al. Z-nucleic-acid sensing triggers ZBP1-dependent necroptosis and inflammation . Nature 2020 , 580 ( 7803 ): 391 – 395 . OpenUrl CrossRef PubMed 4. ↵ Kitur K , Wachtel S , Brown A , Wickersham M , Paulino F , Penaloza HF , et al. Necroptosis Promotes Staphylococcus aureus Clearance by Inhibiting Excessive Inflammatory Signaling . Cell Rep 2016 , 16 ( 8 ): 2219 – 2230 . OpenUrl CrossRef PubMed 5. ↵ Liu Z , Nailwal H , Rector J , Rahman MM , Sam R , McFadden G , et al. A class of viral inducer of degradation of the necroptosis adaptor RIPK3 regulates virus-induced inflammation . Immunity 2021 , 54 ( 2 ): 247 – 258 e247. OpenUrl CrossRef PubMed 6. ↵ Newton K , Wickliffe KE , Maltzman A , Dugger DL , Strasser A , Pham VC , et al. RIPK1 inhibits ZBP1-driven necroptosis during development . Nature 2016 , 540 ( 7631 ): 129 – 133 . OpenUrl CrossRef PubMed 7. ↵ Pearson JS , Giogha C , Muhlen S , Nachbur U , Pham CL , Zhang Y , et al. EspL is a bacterial cysteine protease effector that cleaves RHIM proteins to block necroptosis and inflammation . Nat Microbiol 2017 , 2 : 16258 . OpenUrl CrossRef PubMed 8. ↵ Petrie EJ , Sandow JJ , Lehmann WIL , Liang LY , Coursier D , Young SN , et al. Viral MLKL Homologs Subvert Necroptotic Cell Death by Sequestering Cellular RIPK3 . Cell Rep 2019 , 28 ( 13 ): 3309 – 3319 e3305. OpenUrl CrossRef PubMed 9. ↵ Zhang T , Yin C , Boyd DF , Quarato G , Ingram JP , Shubina M , et al. Influenza Virus Z-RNAs Induce ZBP1-Mediated Necroptosis . Cell 2020 , 180 ( 6 ): 1115 – 1129 e1113. OpenUrl CrossRef PubMed 10. ↵ Kolbrink B , von Samson-Himmelstjerna FA , Murphy JM , Krautwald S . Role of necroptosis in kidney health and disease . Nat Rev Nephrol 2023 , 19 ( 5 ): 300 – 314 . OpenUrl CrossRef PubMed 11. ↵ Pefanis A , Ierino FL , Murphy JM , Cowan PJ . Regulated necrosis in kidney ischemia-reperfusion injury . Kidney Int 2019 , 96 ( 2 ): 291 – 301 . OpenUrl CrossRef PubMed 12. ↵ Muller T , Dewitz C , Schmitz J , Schroder AS , Brasen JH , Stockwell BR , et al. Necroptosis and ferroptosis are alternative cell death pathways that operate in acute kidney failure . Cell Mol Life Sci 2017 , 74 ( 19 ): 3631 – 3645 . OpenUrl CrossRef PubMed 13. ↵ Lu Z , Van Eeckhoutte HP , Liu G , Nair PM , Jones B , Gillis CM , et al. Necroptosis Signaling Promotes Inflammation, Airway Remodeling, and Emphysema in Chronic Obstructive Pulmonary Disease . Am J Respir Crit Care Med 2021 , 204 ( 6 ): 667 – 681 . OpenUrl CrossRef PubMed 14. ↵ Chiou S , Al-Ani AH , Pan Y , Patel KM , Kong IY , Whitehead LW , et al. An immunohistochemical atlas of necroptotic pathway expression . EMBO Mol Med 2024 , 16 ( 7 ): 1717 – 1749 . OpenUrl CrossRef PubMed 15. ↵ Pierdomenico M , Negroni A , Stronati L , Vitali R , Prete E , Bertin J , et al. Necroptosis is active in children with inflammatory bowel disease and contributes to heighten intestinal inflammation . Am J Gastroenterol 2014 , 109 ( 2 ): 279 – 287 . OpenUrl CrossRef PubMed 16. ↵ Pang J , Al-Ani AH , Patel KM , Young SN , Kong I , Chen J-j , et al. A necroptotic-to-apoptotic signaling axis underlies inflammatory bowel disease . bioRxiv 2024 : 2024.2011.2013.623307 . 17. ↵ Anderton H , Alqudah S . Cell death in skin function, inflammation, and disease . Biochem J 2022 , 479 ( 15 ): 1621 – 1651 . OpenUrl CrossRef PubMed 18. ↵ Degterev A , Huang Z , Boyce M , Li Y , Jagtap P , Mizushima N , et al. Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury . Nat Chem Biol 2005 , 1 ( 2 ): 112 – 119 . OpenUrl CrossRef PubMed Web of Science 19. ↵ Devos M , Tanghe G , Gilbert B , Dierick E , Verheirstraeten M , Nemegeer J , et al. Sensing of endogenous nucleic acids by ZBP1 induces keratinocyte necroptosis and skin inflammation . J Exp Med 2020 , 217 ( 7 ). 20. ↵ Newton K , Dugger DL , Maltzman A , Greve JM , Hedehus M , Martin-McNulty B , et al. RIPK3 deficiency or catalytically inactive RIPK1 provides greater benefit than MLKL deficiency in mouse models of inflammation and tissue injury . Cell Death Differ 2016 , 23 ( 9 ): 1565 – 1576 . OpenUrl CrossRef PubMed 21. ↵ Schwarzer R , Jiao H , Wachsmuth L , Tresch A , Pasparakis M . FADD and Caspase-8 Regulate Gut Homeostasis and Inflammation by Controlling MLKL- and GSDMD-Mediated Death of Intestinal Epithelial Cells . Immunity 2020 , 52 ( 6 ): 978 – 993 e976. OpenUrl CrossRef PubMed 22. ↵ Cho YS , Challa S , Moquin D , Genga R , Ray TD , Guildford M , et al. Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus-induced inflammation . Cell 2009 , 137 ( 6 ): 1112 – 1123 . OpenUrl CrossRef PubMed Web of Science 23. ↵ He S , Wang L , Miao L , Wang T , Du F , Zhao L , et al. Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha . Cell 2009 , 137 ( 6 ): 1100 – 1111 . OpenUrl CrossRef PubMed Web of Science 24. ↵ Pham CLL , Titaux-Delgado GA , Varghese NR , Polonio P , Wilde KL , Sunde M , et al. NMR characterization of an assembling RHIM (RIP homotypic interaction motif) amyloid reveals a cryptic region for self-recognition . J Biol Chem 2023 , 299 ( 4 ): 104568 . OpenUrl CrossRef PubMed 25. ↵ Wu X , Ma Y , Zhao K , Zhang J , Sun Y , Li Y , et al. The structure of a minimum amyloid fibril core formed by necroptosis-mediating RHIM of human RIPK3 . Proc Natl Acad Sci U S A 2021 , 118 ( 14 ). 26. ↵ Mompean M , Li W , Li J , Laage S , Siemer AB , Bozkurt G , et al. The Structure of the Necrosome RIPK1-RIPK3 Core, a Human Hetero-Amyloid Signaling Complex . Cell 2018 , 173 ( 5 ): 1244 – 1253 e1210. OpenUrl CrossRef PubMed 27. ↵ Meng Y , Davies KA , Fitzgibbon C , Young SN , Garnish SE , Horne CR , et al. Human RIPK3 maintains MLKL in an inactive conformation prior to cell death by necroptosis . Nat Commun 2021 , 12 ( 1 ): 6783 . OpenUrl CrossRef PubMed 28. ↵ Meng Y , Horne CR , Samson AL , Dagley LF , Young SN , Sandow JJ , et al. Human RIPK3 C-lobe phosphorylation is essential for necroptotic signaling . Cell Death Dis 2022 , 13 ( 6 ): 565 . OpenUrl CrossRef PubMed 29. ↵ Sun L , Wang H , Wang Z , He S , Chen S , Liao D , et al. Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase . Cell 2012 , 148 ( 1-2 ): 213 – 227 . OpenUrl CrossRef PubMed Web of Science 30. ↵ Chen W , Zhou Z , Li L , Zhong CQ , Zheng X , Wu X , et al. Diverse sequence determinants control human and mouse receptor interacting protein 3 (RIP3) and mixed lineage kinase domain-like (MLKL) interaction in necroptotic signaling . J Biol Chem 2013 , 288 ( 23 ): 16247 – 16261 . OpenUrl Abstract / FREE Full Text 31. ↵ Murphy JM , Czabotar PE , Hildebrand JM , Lucet IS , Zhang JG , Alvarez-Diaz S , et al. The pseudokinase MLKL mediates necroptosis via a molecular switch mechanism . Immunity 2013 , 39 ( 3 ): 443 – 453 . OpenUrl CrossRef PubMed Web of Science 32. ↵ Garnish SE , Meng Y , Koide A , Sandow JJ , Denbaum E , Jacobsen AV , et al. Conformational interconversion of MLKL and disengagement from RIPK3 precede cell death by necroptosis . Nat Commun 2021 , 12 ( 1 ): 2211 . OpenUrl CrossRef PubMed 33. ↵ Meng Y , Garnish SE , Davies KA , Black KA , Leis AP , Horne CR , et al. Phosphorylation-dependent pseudokinase domain dimerization drives full-length MLKL oligomerization . Nat Commun 2023 , 14 ( 1 ): 6804 . OpenUrl CrossRef PubMed 34. ↵ Petrie EJ , Birkinshaw RW , Koide A , Denbaum E , Hildebrand JM , Garnish SE , et al. Identification of MLKL membrane translocation as a checkpoint in necroptotic cell death using Monobodies . Proc Natl Acad Sci U S A 2020 , 117 ( 15 ): 8468 – 8475 . OpenUrl Abstract / FREE Full Text 35. ↵ Petrie EJ , Sandow JJ , Jacobsen AV , Smith BJ , Griffin MDW , Lucet IS , et al. Conformational switching of the pseudokinase domain promotes human MLKL tetramerization and cell death by necroptosis . Nat Commun 2018 , 9 ( 1 ): 2422 . OpenUrl CrossRef PubMed 36. ↵ Samson AL , Garnish SE , Hildebrand JM , Murphy JM . Location, location, location: A compartmentalized view of TNF-induced necroptotic signaling . Sci Signal 2021 , 14 ( 668 ). 37. ↵ Samson AL , Zhang Y , Geoghegan ND , Gavin XJ , Davies KA , Mlodzianoski MJ , et al. MLKL trafficking and accumulation at the plasma membrane control the kinetics and threshold for necroptosis . Nat Commun 2020 , 11 ( 1 ): 3151 . OpenUrl CrossRef PubMed 38. ↵ Mandal P , Berger SB , Pillay S , Moriwaki K , Huang C , Guo H , et al. RIP3 induces apoptosis independent of pronecrotic kinase activity . Mol Cell 2014 , 56 ( 4 ): 481 – 495 . OpenUrl CrossRef PubMed Web of Science 39. ↵ Newton K , Sun X , Dixit VM . Kinase RIP3 is dispensable for normal NF-kappa Bs, signaling by the B-cell and T-cell receptors, tumor necrosis factor receptor 1, and Toll-like receptors 2 and 4 . Mol Cell Biol 2004 , 24 ( 4 ): 1464 – 1469 . OpenUrl Abstract / FREE Full Text 40. ↵ Tovey Crutchfield EC , Garnish SE , Day J , Anderton H , Chiou S , Hempel A , et al. MLKL deficiency protects against low-grade, sterile inflammation in aged mice . Cell Death Differ 2023 , 30 ( 4 ): 1059 – 1071 . OpenUrl CrossRef PubMed 41. ↵ Newton K , Dugger DL , Wickliffe KE , Kapoor N , de Almagro MC , Vucic D , et al. Activity of protein kinase RIPK3 determines whether cells die by necroptosis or apoptosis . Science 2014 , 343 ( 6177 ): 1357 – 1360 . OpenUrl Abstract / FREE Full Text 42. ↵ Li D , Chen J , Guo J , Li L , Cai G , Chen S , et al. A phosphorylation of RIPK3 kinase initiates an intracellular apoptotic pathway that promotes prostaglandin(2alpha)-induced corpus luteum regression . Elife 2021 , 10 . 43. ↵ Newton K , Wickliffe KE , Maltzman A , Dugger DL , Webster JD , Guo H , et al. Caspase cleavage of RIPK3 after Asp(333) is dispensable for mouse embryogenesis . Cell Death Differ 2024 , 31 ( 2 ): 254 – 262 . OpenUrl CrossRef PubMed 44. ↵ Tovey Crutchfield EC , Garnish SE , Hildebrand JM . The Role of the Key Effector of Necroptotic Cell Death, MLKL, in Mouse Models of Disease . Biomolecules 2021 , 11 ( 6 ). 45. ↵ Tran HT , Kratina T , Coutansais A , Michalek D , Hogan BM , Lawlor KE , et al. RIPK3 cleavage is dispensable for necroptosis inhibition but restricts NLRP3 inflammasome activation . Cell Death Differ 2024 , 31 ( 5 ): 662 – 671 . OpenUrl CrossRef PubMed 46. ↵ Gunther C , Martini E , Wittkopf N , Amann K , Weigmann B , Neumann H , et al. Caspase-8 regulates TNF-alpha-induced epithelial necroptosis and terminal ileitis . Nature 2011 , 477 ( 7364 ): 335 – 339 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Gardner CR , Davies KA , Zhang Y , Brzozowski M , Czabotar PE , Murphy JM , et al. From (Tool)Bench to Bedside: The Potential of Necroptosis Inhibitors . J Med Chem 2023 , 66 ( 4 ): 2361 – 2385 . OpenUrl CrossRef PubMed 48. ↵ Gautam A , Boyd DF , Nikhar S , Zhang T , Siokas I , Van de Velde LA , et al. Necroptosis blockade prevents lung injury in severe influenza . Nature 2024 , 628 ( 8009 ): 835 – 843 . OpenUrl CrossRef PubMed 49. ↵ Xia K , Zhu F , Yang C , Wu S , Lin Y , Ma H , et al. Discovery of a Potent RIPK3 Inhibitor for the Amelioration of Necroptosis-Associated Inflammatory Injury . Front Cell Dev Biol 2020 , 8 : 606119 . OpenUrl CrossRef PubMed 50. ↵ Berger SB , Kasparcova V , Hoffman S , Swift B , Dare L , Schaeffer M , et al. Cutting Edge: RIP1 kinase activity is dispensable for normal development but is a key regulator of inflammation in SHARPIN-deficient mice . J Immunol 2014 , 192 ( 12 ): 5476 – 5480 . OpenUrl Abstract / FREE Full Text 51. ↵ Laurien L , Nagata M , Schunke H , Delanghe T , Wiederstein JL , Kumari S , et al. Autophosphorylation at serine 166 regulates RIP kinase 1-mediated cell death and inflammation . Nat Commun 2020 , 11 ( 1 ): 1747 . OpenUrl CrossRef PubMed 52. ↵ Salmena L , Lemmers B , Hakem A , Matysiak-Zablocki E , Murakami K , Au PY , et al. Essential role for caspase 8 in T-cell homeostasis and T-cell-mediated immunity . Genes Dev 2003 , 17 ( 7 ): 883 – 895 . OpenUrl Abstract / FREE Full Text 53. ↵ Madisen L , Zwingman TA , Sunkin SM , Oh SW , Zariwala HA , Gu H , et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain . Nat Neurosci 2010 , 13 ( 1 ): 133 – 140 . OpenUrl CrossRef PubMed Web of Science 54. ↵ Samson AL , Fitzgibbon C , Patel KM , Hildebrand JM , Whitehead LW , Rimes JS , et al. A toolbox for imaging RIPK1, RIPK3, and MLKL in mouse and human cells . Cell Death Differ 2021 , 28 ( 7 ): 2126 – 2144 . OpenUrl CrossRef PubMed 55. ↵ Chiou S , Al-Ani AH , Pan Y , Patel KM , Kong IY , Whitehead LW , et al. An immunohistochemical atlas of necroptotic pathway expression . EMBO Mol Med 2024 . 56. ↵ Haber AL , Biton M , Rogel N , Herbst RH , Shekhar K , Smillie C , et al. A single-cell survey of the small intestinal epithelium . Nature 2017 , 551 ( 7680 ): 333 – 339 . OpenUrl CrossRef PubMed 57. ↵ Mielke L , Preaudet A , Belz G , Putoczki T . Confocal laser endomicroscopy to monitor the colonic mucosa of mice . J Immunol Methods 2015 , 421 : 81 – 88 . OpenUrl CrossRef PubMed 58. ↵ Ernst M , Preaudet A , Putoczki T . Non-invasive assessment of the efficacy of new therapeutics for intestinal pathologies using serial endoscopic imaging of live mice . J Vis Exp 2015 ( 97 ). 59. ↵ Schindelin J , Arganda-Carreras I , Frise E , Kaynig V , Longair M , Pietzsch T , et al. Fiji: an open-source platform for biological-image analysis . Nat Methods 2012 , 9 ( 7 ): 676 – 682 . OpenUrl CrossRef PubMed Web of Science 60. ↵ Rutlin M , Rastelli D , Kuo WT , Estep JA , Louis A , Riccomagno MM , et al. The Villin1 Gene Promoter Drives Cre Recombinase Expression in Extraintestinal Tissues . Cell Mol Gastroenterol Hepatol 2020 , 10 ( 4 ): 864 – 867 e865. OpenUrl CrossRef PubMed 61. ↵ Landini G , Martinelli G , Piccinini F . Colour deconvolution: stain unmixing in histological imaging . Bioinformatics 2021 , 37 ( 10 ): 1485 – 1487 . OpenUrl CrossRef PubMed 62. ↵ Xie T , Peng W , Yan C , Wu J , Gong X , Shi Y . Structural insights into RIP3-mediated necroptotic signaling . Cell Rep 2013 , 5 ( 1 ): 70 – 78 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted April 29, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The kinase domain of RIPK3 tunes its scaffolding functions Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The kinase domain of RIPK3 tunes its scaffolding functions Shene Chiou , Komal M. Patel , Adele Preaudet , James A. Rickard , Christopher R. Horne , Samuel N. Young , Sarah E. Garnish , Anne Hempel , Cathrine Hall , Joanne M. Hildebrand , Andrew J. Kueh , Tracy L. Putoczki , Edwin D. Hawkins , Andre L. Samson , James M. Murphy bioRxiv 2025.04.29.651198; doi: https://doi.org/10.1101/2025.04.29.651198 Share This Article: Copy Citation Tools The kinase domain of RIPK3 tunes its scaffolding functions Shene Chiou , Komal M. Patel , Adele Preaudet , James A. Rickard , Christopher R. Horne , Samuel N. Young , Sarah E. Garnish , Anne Hempel , Cathrine Hall , Joanne M. Hildebrand , Andrew J. Kueh , Tracy L. Putoczki , Edwin D. Hawkins , Andre L. Samson , James M. Murphy bioRxiv 2025.04.29.651198; doi: https://doi.org/10.1101/2025.04.29.651198 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Areas All Articles Animal Behavior and Cognition (7629) Biochemistry (17660) Bioengineering (13881) Bioinformatics (41911) Biophysics (21436) Cancer Biology (18578) Cell Biology (25482) Clinical Trials (138) Developmental Biology (13371) Ecology (19887) Epidemiology (2067) Evolutionary Biology (24302) Genetics (15599) Genomics (22482) Immunology (17728) Microbiology (40363) Molecular Biology (17163) Neuroscience (88536) Paleontology (666) Pathology (2830) Pharmacology and Toxicology (4821) Physiology (7637) Plant Biology (15129) Scientific Communication and Education (2045) Synthetic Biology (4290) Systems Biology (9817) Zoology (2269)