Novel nonsteroidal inhibitors of the human 11-beta hydroxysteroid dehydrogenase type 1 enzyme for the treatment of obesity and metabolic syndrome

Novel nonsteroidal inhibitors of the human 11-beta hydroxysteroid dehydrogenase type 1 enzyme for the treatment of obesity and metabolic syndrome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Novel nonsteroidal inhibitors of the human 11-beta hydroxysteroid dehydrogenase type 1 enzyme for the treatment of obesity and metabolic syndrome Pablo González, Cristian A. Carvajal, Alejandra Tapia-Castillo, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7933515/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Nontumoral cortisol dysregulation in obese individuals is associated with many facets of metabolic syndrome, including central adiposity, diabetes mellitus (T2DM), dyslipidemia, and hypertension. Glucocorticoid availability and function at the cell/tissue level are classically regulated by 11-beta hydroxysteroid dehydrogenase type (11β-HSD) enzymes. The 11β-HSD1 enzyme is expressed primarily in the liver and adipose tissue (AT) where cortisone in converted into its active form, cortisol. 11β-HSD1 expression in AT promotes adipocyte proliferation and hypertension, leading to the development of abdominal obesity and comorbidities. The 11β-HSD1 enzyme is a key therapeutic target for modulating obesity and associated metabolic disorders. In response to this need, our research aimed to design and characterize a family of nonsteroidal compounds displaying specific and selective inhibition of the 11β-HSD1 enzyme. For this purpose, we designed, synthetized, and characterized a family of adamantyloxadiazole compounds to selectively inhibit the human 11β-HSD1 enzyme that are henceforth designated sequentially from A to N (14 compounds). Our newly synthesized compounds were designed in silico and synthesized via retrosynthesis. We tested the following properties of our novel compounds: ( 1 ) their biopharmaceutical properties, ( 2 ) their inhibitory potency (IC50) over 11β-HSD1 reductase activity in cell-free assays, and ( 3 ) their relative inhibitory potency and IC50 in human adipocytes. Biopharmaceutical characterization of the compounds revealed high transcellular permeability and no interaction with P-glycoprotein, a known efflux pump that decreases oral systemic and central exposure, for Compounds J and L . In vitro studies of the inhibition of the 11β-HSD1 enzyme via cell-free and microsome-based assays indicated significant inhibitory potency, with optimal specificity and selectivity observed at the nanomolar level, highlighting both the IC50 values of Compound J (11,8 nM) and Compound L (3,9 nM), which also preserve 11b-HSD oxidase activities (> 90%). In human adipocytes, 1 µM Compounds E , J and L demonstrated a high potency of 11β-HSD1 inhibition, near 40–60%, compared to 1 µM inhibitor carbenoxolone, which showed approximately a 90% inhibition. The preclinical evaluation of these adamantyloxadiazole derivatives revealed their potential as effective inhibitors of the 11β-HSD1 enzyme, with Compounds E , J and L showing particularly relevant performance in vitro . These findings support the progression of in vivo studies to further explore their therapeutic potential in treating obesity and associated metabolic disorders. Biological sciences/Biochemistry Health sciences/Diseases Biological sciences/Drug discovery 11β-Hydroxysteroid dehydrogenase type 1 11β-HSD1 inhibitor metabolic syndrome adamantyloxadiazole compounds Figures Figure 1 Figure 2 Figure 3 1. Introduction Obesity has become a major public health concern worldwide and is characterized by the excessive accumulation of body fat that significantly increases the risk of developing a range of serious health conditions, including cardiovascular disease, diabetes, and hypertension. The hormone cortisol, a glucocorticoid produced primarily by the adrenal glands and involved in various metabolic processes, is central to the pathophysiology of obesity ( 1 ). Cortisol levels in peripheral tissues, such as the liver and adipose (fat) tissue, are regulated by the enzyme 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1). This enzyme converts the inactive form of cortisone into active cortisol ( 2 , 3 ), thereby influencing local cortisol concentrations. Elevated 11β-HSD1 activity has been implicated in the development of obesity, as increased local cortisol levels can promote fat accumulation by stimulating lipogenesis and inhibiting lipolysis. Consequently, 11β-HSD1 plays a key role in the pathogenesis of metabolic disorders associated with obesity, including insulin resistance and central adiposity. The balance between cortisol and its inactive form, cortisone, is tightly controlled by two distinct enzymes: 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) and 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2). 11β-HSD1 is a nicotinamide adenine dinucleotide phosphate (NADPH)-dependent reductase enzyme that converts cortisone into active cortisol and thereby increases local cortisol levels in tissues such as the liver and adipose tissue. This local activation of cortisol is significant in metabolic processes and, when 11β-HSD1 is overexpressed, is linked to obesity and metabolic syndrome. This enzyme is widely distributed throughout the body, with the highest expression observed in the brain, liver, and adipose tissue ( 4 ). In contrast, 11β-HSD2 functions as a dehydrogenase enzyme, converting cortisol back to cortisone. Predominantly expressed in mineralocorticoid target tissues such as the kidneys, colon, and salivary glands, 11β-HSD2 prevents cortisol from binding to mineralocorticoid receptors, thereby modulating its effects. The balance between these two enzymes is essential for maintaining cortisol homeostasis and ensuring that the effects of cortisol are appropriately regulated across different tissues. Over the last two decades, in vitro and in vivo studies have collectively shown the importance of local generation of cortisol via 11β-HSD1 in the liver and fat in mediating many facets of metabolic syndrome, including central adiposity, diabetes mellitus (T2DM), dyslipidemia, and hypertension ( 5 , 6 ). Animal studies have revealed the importance of the 11β-HSD1 enzyme in metabolic disorders in vivo ; in this respect, in mouse models, hepatic overexpression of the HSD11B1 gene results in hypertension and central obesity( 7 ). Similarly, the findings from obese rats (Zucker rats) suggest that obesity is associated with exacerbated 11β-HSD1 activity ( 8 ), and HSD11B1 knockout mice are protected from these metabolic abnormalities ( 9 ). In recent years, interest in the development of 11β-HSD1 inhibitors as potential therapeutic agents for obesity and related metabolic conditions has increased. By targeting and reducing the activity of 11β-HSD1, these inhibitors aim to lower local cortisol levels in adipose tissue, thereby mitigating the adverse metabolic effects associated with elevated cortisol levels ( 5 , 10 – 12 ). Despite significant research efforts, the development of effective 11β-HSD1 inhibitors with the necessary specificity and selectivity remains an active area of investigation. The current study focuses on designing and developing novel, potent, and selective inhibitors of the human 11β-HSD1 enzyme through a combination of in silico and in vitro studies ( 13 , 14 ). 2. METHODS 2.1 Design and synthesis of adamantyloxadiazole as a novel 11β-HSD1 inhibitor We identified a novel family of potent and selective nonsteroidal 11β-HSD1 inhibitors based on a previous study by our group and a pharmacophoric structure designed in silico ( 10 ). We further designed and synthesized 15 novel compounds derived from specific substitutions of 1-adamantylamidoxime compounds ( 13 ). 2.2 IN VITRO CELL-FREE ASSAYS a. Determination of 11β-HSD1 reductase activity by calculating the IC50 Stock solutions of Compounds A - N were prepared in DMSO (10 mM), followed by serial dilutions. The recombinant 11β-HSD1 enzyme (Cayman Chemical, MI, USA; catalog number 10007815) was diluted in 20 mM Tris buffer containing 5 mM EDTA (pH 6.0) at various dilutions. First, we determined the appropriate enzyme concentration for assessing the effects of a compound’s biological activity on the synthesis of cortisol from cortisone via homogeneous time-resolved fluorescence (HTRF) with a commercial Cortisol Detection Kit (Cisbio, MA, USA; Cat no. 62CRTPEG). Briefly, 11β-HSD1 enzyme was added to an HTRF plate containing 266 nM cortisone and 333 µM NADPH in Tris buffer at a 4:1 ratio and incubated for 2 hours at 37°C. After the incubation, reagents from the cortisol kit—cortisol d2 and cortisol cryptate—were added to the samples at a 2:1:1 ratio (sample, cortisol d2, and cortisol cryptate) and incubated for 1 hour at room temperature, followed by fluorescence measurements at 665 and 620 nm. Once the appropriate enzyme concentration was determined, we assessed the half maximal inhibitory concentration (IC50) of Compounds A - N by incubating the reaction buffer, the recombinant 11β-HSD1 enzyme, and the compounds in a 3:1:1 ratio at 37°C for 2 hours. After the incubation, the cortisol levels were quantified with an HTRF Cortisol Detection Kit. b. Determination of 11β-HSD1 oxidase activity Recombinant 11β-HSD1 enzyme dilutions were prepared in 20 mM Tris buffer containing 5 mM EDTA, pH 6.0. Initially, the enzyme concentration was determined by preparing a plate for HTRF with Tris buffer containing 100 nM cortisol and 200 mM NADP + and incubating it with the enzyme at a 4:1 ratio at 37°C for 2 hours. The cortisol kit reagents cortisol d2 and cortisol cryptate (Cisbio, MA, USA; Cat no. 62CRTPEG) were then added, followed by an incubation at room temperature for 1 hour and fluorescence measurements at 665 and 620 nm. Once the enzyme concentration was determined, an HTRF plate was set up by adding the reaction buffer, recombinant 11β-HSD1 enzyme, and test compounds at a 3:1:1 ratio and incubated at 37°C for 2 hours. After the incubation, the reagents from the cortisol kit were added, followed by an incubation at room temperature for 1 hour, and the fluorescence was measured at 665 and 620 nm. c. Determination of 11β-HSD2 oxidase activity in human liver microsomes The analysis of this activity involved assessing the cortisone concentration produced in reactions with and without our novel compounds using the Cortisol Kit (Cisbio, MA, USA; Cat no. 62CRTPEG). The selected Compounds A to N were reconstituted in DMSO to a 10 mM stock, followed by serial dilutions to construct the efficacy curve. Donor human liver microsomes (BioReclamation-lVT Inc.) were prepared in 20 mM Tris buffer containing 5 mM EDTA, pH 6.0, to determine the IC50. The assay was conducted in HTRF plates containing Tris buffer, 100 nM cortisol, and 200 mM NAD+. The enzymes were added at a 4:1 ratio to the corresponding wells and incubated for 2 hours at 37°C. For controls, wells with only Tris buffer were used. After the incubation, the reagents from the cortisol kit were added to the sample, with cortisol d2 and cortisol cryptate added at a 2:1:1 ratio. For the negative controls, cortisol d2 was replaced with reconstitution buffer from the kit. The plate was incubated for 1 hour at room temperature before the fluorescence was measured at 665 and 620 nm. Once the enzyme concentration was determined, the protocol for the cortisol kit was used to establish an efficacy curve. In an HTRF plate, reaction buffer, microsomes (5 mg/mL), and the test compounds were added at a 3:1:1 ratio to each well. The controls included reaction buffer without cortisol (negative), reaction buffer without the compound (positive), and reaction buffer only (kit controls). After a 2-hour incubation, the reagents from the cortisol kit were added, and the samples were incubated at room temperature for 1 hour before the fluorescence was measured at 665 and 620 nm. 2.3 IN VITRO ASSAYS IN CELLS a. Inhibitory potency of novel compounds in SW872 adipocytes The human liposarcoma-derived SW872 preadipocyte line (HTB-92, ATCC, Manassas, VA, USA) was grown in 10% fetal bovine serum (FBS)-supplemented DMEM/F12 at 37°C in a 5% CO 2 atmosphere. SW872 cells at 90% confluence were treated with a differentiation cocktail composed of 1 µM dexamethasone, 0.5 mM IBMX, 1 µM rosiglitazone, and 10 µg/mL insulin for adipocyte differentiation. The differentiation of SW872 cells was confirmed after 7 days of treatment by morphological changes and lipid droplet formation using Oil Red O staining and optical microscopy, as shown in Fig. 1 (See details in the SUPPLEMENTARY INFORMATION). SW872 adipocytes were treated with 500 nM Compounds A to N and 500 nM carbenoxolone (CBX), a known potent inhibitor of 11β-HSD1. The treatment medium for both assays, including the cell lines and primary cultures, contained 333 µM NADPH and 266 nM cortisone. After 24 hours of treatment, the medium was collected, kept cold, and divided into aliquots for the cortisol determination by LC‒MS/MS using an Agilent 1200 Series HPLC unit coupled to an ABSciex 4500 QTrap mass spectrometer. Protein and total RNA were also obtained for assessments of mRNA and protein expression. RNA was extracted with 500 µL of TRIzol, while protein was extracted with 250 µL of RIPA buffer supplemented with a protease inhibitor cocktail (Roche). All the treatments were conducted in technical triplicates. b. Inhibitory potency of novel compounds in adipocyte primary cell culture (APCC) Primary cell cultures were generated from tissue obtained from patients undergoing bariatric surgery. Samples of visceral adipose tissue containing stromal cells were obtained, cleaned, minced into small pieces (5–10 mg), rinsed twice with PBS and treated with collagenase for 1 h at 37°C ( 15 ). The cells were subsequently seeded in culture plates and differentiated into adipocytes by stimulation with a differentiation cocktail for 10 days, which contained 1% FBS-supplemented DMEM-F12, 33 µM biotin, 17 µM pantothenate, 500 mM insulin, 2 mM triiodothyronine, 10 µg/µL transferrin, 1 µM dexamethasone, 0.6 mg/ml rosiglitazone and 0.5 mM IBMX. Cell differentiation was confirmed after 10 days by observing morphological changes via optical microscopy and lipid droplet formation using Oil Red O staining. After differentiation, the cells were treated with our compounds. Adipocyte primary cell cultures (APCCs) were treated with 1 µM each of Compounds A to N . Methanol was used as a vehicle, and 1 µM carbenoxolone was used as a positive control for inhibition. The treatment media used in both methods contained 333 µM NADPH and 266 nM cortisone. After 24 hours of treatment, the medium was collected, kept cold, and divided into aliquots. APCCs were also lysed with 500 µL of TRIzol® for RNA extraction or 250 µL of RIPA buffer and protease inhibitor cocktail (Roche) for protein extraction. All the treatments were conducted in technical triplicates. c. IC50 values of novel compounds in SW872 cells and adipocyte primary cell cultures (APCCs) Inhibitory potency of compounds E , J, L and M was assessed by determining the IC50 values in differentiated adipocytes, using either SW872 cells or APCCs. Concentration of the compounds ranging from 0.5 µM to 30 µM were applied in 3 mL of differentiation medium containing 333 µM NADPH and 266 nM cortisone per well. The IC50 was calculated from a four-parameter logistic curve or 4PL curve. After 24 hours, 3 mL of medium from each well was collected and chilled, while the cells were lysed with 250 mL of RIPA lysis buffer supplemented with a protease inhibitor cocktail (Roche). The aliquots of medium and cell lysate were stored at -80°C for subsequent analysis. 2.4 Biopharmaceutical characterization a. Determination of the partition coefficients for Compounds J and L Compounds J and L (Table 1 ) were dissolved in n-octanol (n = 3) (5 mg/ml) and mixed with aqueous solutions buffered at pH 4.5, 6.4 and 7.4 under vigorous shaking at 37°C for 48 h, followed by 48 h of rest. Samples were collected from the aqueous and organic phases, diluted, and analyzed via µHPLC‒MS/MS. Distribution coefficients were calculated as the log of the ratio between concentrations in the organic and aqueous phases across the pH range studied (LogD); LogP was also calculated from LogD values, and the fraction of un-ionized drug was estimated from the Henderson–Hasselbach acid–base equilibrium (See details in the SUPPLEMENTARY INFORMATION). Table 1 Procedure for the synthesis of compounds from A to N. *C.C: Column chromatography, T.L.C: thin-layer chromatography. Compound and Chem. Structure Mixture Composition Purification A 1-phenyl-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (497 mg, 2.83 mmol), 2 (849 µL, 7.72 mmol), 3-phenylpropanoic acid (425 mg, 2.83 mmol), 3 (500 mg, 2.57 mmol) C.C using 10% ethyl acetate in n-hexane as eluent. Then, T.L.C purification using n-hexane as eluent to provide a colorless gel. B 1-(4-methoxyphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (248 mg, 1.42 mmol), 2 (424 µL, 3.87 mmol), 3- (4-methoxyphenyl) propionic acid (255 mg, 1.42 mmol), 3 (250 mg, 1.29 mmol) C.C using 10% ethyl acetate in n-hexane as eluent. Yielded a white solid. C 1-(4-chlorophenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (497 mg, 2.83 mmol), 2 (849 µL, 7.72 mmol), 3- (4-chlorophenyl) propionic acid (523 mg, 2.83 mmol), 3 (500 mg, 2.57 mmol) C.C using 10% ethyl acetate in n-hexane as eluent, followed by recrystallization from ethanol to provide a white solid. D 1-(4-fluorophenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (248 mg, 1.42 mmol), 2 (424 µL, 3.86 mmol), 3- (4-fluorophenyl) propionic acid (216 mg, 1.29 mmol), 3 (300 mg, 1.54 mmol) C.C using 20% ethyl acetate in n-hexane as eluent. Yielded a white solid. E 1-(4-bromophenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (273 mg, 1.56 mmol), 2 (424 µL, 3.86 mmol), 3- (4-bromophenyl) propionic acid (324 mg, 1.42 mmol), 3 (325 mg, 1.67 mmol) C.C using 10% ethyl acetate in n-hexane as eluent. Yielded a white solid. F 1-(4-methylphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (273 mg, 1.56 mmol), 2 (466 µL, 4.23 mmol), 3- (p-tolyl) propionic (232 mg, 1.42 mmol), 3 (302 mg, 1.56 mmol) C.C using 10% ethyl acetate in n-hexane as eluent, followed by recrystallization from ethanol to provide a white solid. G 1-(4-hydroxyphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (237 mg, 1.56 mmol), Nmet (466 µL, 4.25 mmol), 3- (4-hydroxyphenyl) propionic (235 mg, 1.42 mmol), 3 (302 mg, 1.56 mmol) C.C using 20% ethyl acetate in n-hexane as eluent, yielding a pale-yellow gel. H 1-(3-methoxypenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (268 mg, 1.53 mmol), 2 (458 µL, 4.16 mmol), 3- (3-methoxyphenyl) propionic acid (250 mg, 1.39 mmol), 3 (296 mg, 1.53 mmol) C.C using 20% ethyl acetate in n-hexane as eluent, yielding a colorless gel. I 1-(4-pyridyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (319 mg, 1.82 mmol), 2 (546 µL, 4.96 mmol), 3- (4-pyridyl) propionic (250 mg, 1.65 mmol), 3 (354 mg, 1.82 mmol) C.C using 40% ethyl acetate in n-hexane as eluent. Then, T.L.C using n-hexane as eluent, yielding a yellow solid. J 1-(3-methylphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (276 mg, 1.57 mmol), 2 (472 µL, 4.29 mmol), 3-(3-methylphenyl) propionic acid (235 mg, 1.43 mmol), 3 (333 mg, 1.71 mmol) C.C using 30% ethyl acetate in n-hexane as eluent. Then, T.L.C purification using n-hexane as eluent, yielding a colorless gel. K 1-(4-tert-butylphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (234 mg, 1.33 mmol), 2 (400 µL, 3.64 mmol), 3-(4-tert-butylphenyl) propionic acid (250 mg, 1.21 mmol), 3 (282 mg, 1.45 mmol) C.C using 10% ethyl acetate in n-hexane as eluent, followed by recrystallization from ethanol to provide a white solid. L 1-(3-pyridyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (226 mg, 1.29 mmol), 2 (386 µL, 3.51 mmol), 3-(3-pyridyl) propionic acid (177 mg, 1.17 mmol), 3 (250 mg, 1.29 mmol) C.C using 40% ethyl acetate in n-hexane as eluent. Then, T.L.C purification using n-hexane as eluent to provide a yellow gel. M 1-(2-pyridyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (226 mg, 1.17 mmol), 2 (386 µL, 3.51 mmol), 3- (2- pyridyl) propionic (177 mg, 1.17 mmol), 3 (250 mg, 1.287 mmol) C.C using 60% ethyl acetate in n-hexane as eluent. Then, T.L.C purification using n-hexane as eluent to provide a yellow gel. N 1-(4-nitrophenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane 1 (226 mg, 1.29 mmol), 2 ( 386 µL, 3.51 mmol), 3- (4-nitrophenyl) propionic (228 mg, 1.17 mmol), 3 (250 mg, 1.29 mmol) C.C using 20% ethyl acetate in n-hexane as eluent. Yielded a white solid. b. Plasma protein binding capacity of Compound J and L The plasma protein binding capacity of Compound J and L was determined using the commercial Transil XL PPB Binding Kit, v2 (Sovicell, Germany), in accordance with the manufacturer's guidelines. Briefly, 80 µM Compound J was incubated for 12 h at 37°C, followed by bead removal and supernatant sampling (n = 2). Afterward, the samples were centrifuged, diluted, and analyzed via LC‒MS/MS. c. Transepithelial permeability experiments Madin–Darby canine kidney (MDCK) cells stably transfected with human P-glycoprotein (hMDR1/P-gp) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), an antibiotic/antimycotic solution, nonessential amino acids (NEAA) and sodium pyruvate, as previously described ( 16 ). The cell culture medium was changed every two days, and the cells were passaged every 4 days or until 90% confluence was reached. The experiments were typically conducted between the 7th and 10th days after seeding, after which the monocellular integrity was verified using 100 µM atenolol (Papp < 0.5x10-6 cm/s), 10 µM minoxidil, and 100 µM ketoprofen as quality controls. MDCK-hMDR1 cells were seeded onto Transwell® inserts (1.12 cm 2 ), and bidirectional transport experiments were conducted at 37°C and 50 rpm by adding the donor solution to the apical (A-B) or basolateral (B-A) compartment while the receiver compartment was filled with drug-free Hank’s balanced salt solution (HBSS). Stock solutions containing either Compound J or Compound L in DMSO were dissolved in HBSS supplemented with 10 mM HEPES at pH 6.8 to a compound concentration of 3 µM, maintaining DMSO < 1% (donor solution). After 120 min of incubation, samples were collected from the donor and receiver compartments, diluted, and measured via µHPLC-MS/MS (see below). The permeability (P app ) of our compounds can be obtained from mass transport analysis as follows: $$\:\frac{dMr}{dt*A}=j={C}_{d}\times\:{P}_{app}$$ where the variable j, in this context, is the flux (nmol/cm 2 *s), representing the mass of our compounds (dMr) that diffused through surface A (cm 2 ) over the time interval dt (s). P app (cm/s) is then defined as the proportionality coefficient between j and the concentration in the donor compartment Cd (µM). The efflux ratio (ER) was calculated as the ratio of basolateral-to-apical (P app,B−A ) permeability to apical-to-basolateral permeability (P app,A−B ), where values greater than 2 can be interpreted as a relevant effect of the P-gp mediated–mediated efflux contribution to the transepithelial mass transport of our compound. The quenching solution was added to each sample at the proper time to stop the reaction. The resulting samples were centrifuged at 3220 RCF for 20 min, and the compounds in the supernatant were quantified by LC‒MS/MS. Stability is reported as microsomal clearance, defined as the rate of compound disappearance over time. 2.5 ANALYTICAL METHODS a. Tandem µHPLC‒MS/MS Tandem µHPLC-MS/MS (Triple Quad 4500, AB Sciex Instruments) methods for determining Compounds J and L were developed by optimizing the ionization parameters through a direct infusion of 1 µg/mL solutions in a 50:50 acetonitrile (ACN)/water mixture. The mass spectrometer was operated in multiple reaction monitoring (MRM) positive ion mode using specific transitions for quantification, including those for minoxidil and atenolol as markers. The chromatographic analysis was conducted using Ekspert ultraLC 100-XL equipment (Eksigent Technologies) with a C18 column, an injection volume of 10 µL, and a flow rate of 0.5 mL/min. The mobile phase consisted of water with 10 mM ammonium formate (pH 5.0) and acetonitrile (ACN). The elution gradients for each compound are detailed in Table 1 . The methods underwent partial validation, assessing specificity, range, linearity, precision, and accuracy. Standard solutions of Compounds J and L were prepared at concentrations ranging from 0.1 to 1000 ppb and evaluated in triplicate, with and without minoxidil and atenolol markers. The methods exhibited specificity for each compound, a linear range of at least 3 orders of magnitude, coefficients of determination (R 2 ) of at least 0.984, coefficients of variation below 1.6%, and accuracies exceeding 93%. (See details in the SUPPLEMENTARY INFORMATION). b. Quantitative real-time PCR Total RNA was extracted from the SW872 cell line and an adipocyte primary cell culture (APCC) with TRIzol reagent (Invitrogen, San Diego, CA). The expression of the 11β-HSD1 and 11β-HSD2 mRNAs was quantified by real-time polymerase chain reaction (qRT‒PCR) on a RotorGene-6000 instrument (Corbett Research, Sydney, Australia) using fluorescent SYBR Green technology (K0222, Thermo Scientific). The primers used were 11β-HSD1 (forward: CAGGAAAGCTCATGGGAGGAC, reverse: GCCAGAGAGGAGACGACAA) and 11β-HSD2 (forward: ACATTAGCCGCGTGCTAGAGTTCA, reverse: ATTCACCTCCATGCAGCTACGGAA). The annealing temperature was set at 60°C. The results are presented as relative units (RU) with respect to the 18S housekeeping gene. c. Western blot analysis of the 11β-HSD1 protein Protein lysates from adipocyte primary cell cultures (APCCs) were separated on SDS–PAGE gels (Bio-Rad Laboratories), transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories) and blocked with 5% skim milk in phosphate-buffered saline containing 0.1% Tween-20 (PBST). After blocking, the membranes were blotted with the 11β-HSD1 polyclonal primary antibody (anti-11b-HSD1 antibody, 1:2000, PA5-21586 rabbit, Invitrogen, USA) and a secondary antibody, anti-IgG-HRP (Cell Signaling, anti-rabbit-HRP 7074, USA). The level of 11β-HSD1 in adipocytes challenged with vehicle or Compound J was detected using enhanced chemiluminescence (ECL Western blotting substrate reagent, Pierce, USA). d. Data analysis Data are presented as the means with the SDs of the means for continuous variables and percentages for categorical variables. Normality was assessed using the Kolmogorov–Smirnov test. In situations where a variable was not normally distributed, comparisons were performed using the Mann‒Whitney or Kruskal‒Wallis test. Nonnormally distributed variables are reported as medians and interquartile ranges ([Q1–Q3]). A p value of 0.05 was considered statistically significant. Analyses were performed using SPSS 20 and GraphPad Prism v9.0 software. 3. RESULTS 3.1 Design and synthesis of adamantyloxadiazole as a novel 11β-HSD1 inhibitor A solution of 2-chloro-4,6-dimethoxy-1,3,5-triazine in 1,4-dioxane (10 mL) was prepared, referred to in Table 1 as Compound 1 , to synthesize and characterize each novel compound from A to N . N-Methylmorpholine, referred to in Table 1 as Compound 2 , was added dropwise and stirred for 5 minutes at RT. A solution of the needed type of propionic acid in 1,4-dioxane (5 mL) was subsequently added, and the mixture was stirred for 30 minutes at RT. A solution of the precursor adamantylamidoxime compound, referred to in Table 1 as Compound 3 , in 1,4-dioxane (5 mL) was subsequently added. The resulting mixture was vigorously stirred under reflux for 3 h. The progress of the reaction was monitored by thin layer chromatography (TLC). After 3 h, the mixture was cooled to RT, and a 5% sodium carbonate solution was added. The product was extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate, and the solvent was removed under vacuum. The type of propionic acid needed, along with its concentration, volume, and purification process for each compound, is detailed in Table 1 . 3.2 IN VITRO CELL-FREE ASSAYS a. Determination of 11β-HSD1 reductase activity by calculating the IC50 and remaining oxidase activity of the 11β-HSD1 and 11β-HSD2 enzymes The inhibitory concentrations (IC50) of the adamantyloxadiazole-derived compounds were detected in the nanomolar (nM) range (1.1 nM to 147 nM) and are shown in Table 2 . We also determined the remaining oxidase activity of the enzyme 11β-HSD1 using 100 nM of each compound and obtained values ranging from 83 to 110% for the remaining oxidase activity. Similarly, the remaining oxidase activity of the enzyme 11β-HSD2 observed when 100 nM of each compound was added ranged from 40 to 114% (Table 2 ). Only Compounds J and L had lower IC50 values (11.8 and 3.9 nM, respectively), and the remaining 11β-HSD oxidase activities were nearly 100% (Table 2 ). Table 2 Inhibitory activity of the compounds derived from adamantyloxadiazoles against the oxidase activity of the 11β-HSD1 enzyme and its selectivity with respect to isoforms 11β-HSD1 and 11β-HSD2. Compound 11β-HSD1reductase IC50 (nM) 11β-HSD1oxidase 100 nM (% remanent activity) 11β-HSD2 oxidase 100 nM (% remanent activity) M 1,1 97% 70% G 1,1 110% 58% L 3,9 107% 114% C 9,2 107% 59% E 9,9 91% 80% J 11,8 92% 98% N 24 105% 62% B 95,4 104% 60% I 97 89% 59% H 102 88% 62% K 102 86% 50% F 102 110% 40% D 104 109% 69% A 147 86% 55% 3.3 IN VITRO ASSAYS IN CELLS a. 11β-HSD1 and 11β-HSD2 gene expression in SW872 cells and primary adipocytes We confirmed the expression of the 11β-HSD1 and 11β-HSD2 mRNAs in the adipocyte SW872 cell line and in adipocyte primary cell cultures (APCCs). We observed a trend toward higher 11β-HSD1 expression in differentiated adipocytes than in preadipocytes (8.9 vs. 1.0 RU; p = 0.4) in SW872 cells, and a higher 11β-HSD1 expression was observed for differentiated adipocytes compared with preadipocytes in APCCs (11.3 vs. 0.6 RU; p < 0.05) (Fig. 2 A). Similarly, 11β-HSD2 expression showed a similar pattern in adipocytes and preadipocytes derived from SW872 cells (4.2 vs. 1.2 RU; p = 0.2) (Fig. 2 B) and very low and almost undetectable (ND) in adipocytes and preadipocytes in APCCs (0.2 vs. 0.02 RU; p NS), respectively (Fig. 2 B). In APCCs, the immunowesternblot confirmed the presence of 11β-HSD1 (35 kDa) in differentiated adipocytes challenged with either vehicle or Compound J for 24 hrs (Fig. 2 C). b. Inhibitory potency and IC50 values of novel compounds in SW872 adipocytes Since compounds E, J, L, M , and N exhibited the highest potency and 11β-HSD1/11β-HSD2 oxidase activity (Table 2 ), we decided to continue further cell assays with these compounds. In SW872 cells, the cortisol concentration was measured via HPLC‒MS/MS after 24 hours of treatment with 500 nM of E, J, L, M , and N compounds, or 500 nM carbenoxolone (a known inhibitor of 11β-HSD1). We observed a reduction in cortisol synthesis in SW872 cells compared with cells treated with the vehicle (~ 10–30%) and 500 nM carbenoxolone (~ 45%). In SW872 cells, Compounds J (~ 10%), L (~ 22%), E (~ 14%), M (~ 29%), and N (~ 19%) inhibited 11β-HSD1 reductase activity (See details in the SUPPLEMENTARY INFORMATION). Additionally, we calculated the IC50 of 8.4 µM for Compound J in SW872 cells. c. Inhibitory potency and IC50 values of novel compounds in adipocyte primary cell culture (APCC) In the adipocyte primary cell culture, after treatment with 1 µM of each compound for 24 hours, the cortisol concentrations in the culture medium of adipocytes revealed that our compounds significantly reduced the cortisol levels (~ 50%) in the APCCs (Fig. 3 ). All the compounds had similar inhibitory effects on 11β-HSD1 reductase activity in APCCs: Compounds J (~ 52%), E (~ 58%), M (~ 54%), and L (~ 53%). Carbenoxolone consistently had the greatest inhibitory effect (~ 90% at 1 µM and ~ 99% at 30 µM). The IC50 value calculated for Compound J in APCCs was 2.1 µM (Fig. 3 ). 3.4 Biopharmaceutical characterization a. In vitro characterization of the metabolism, distribution parameters and plasma protein binding capacity Plasma protein binding and microsomal metabolism were characterized in vitro for both Compounds J and L (Table 3 ). While 89.3% of the former compound bound to plasma proteins, 49.4% of the latter compound bound to plasma proteins. These values are consistent with the LogD values reported in this study and with the alkaline nature of Compound L . Additionally, the stability of these compounds in mouse and human liver microsomes was measured (Table 3 ), and they were more stable in human microsomes than in mouse microsomes. Table 3 Physicochemical and biochemical characterization of our novel compounds. Property Compound J Compound L Units LogD pH 4.5 5.18 3.44 - LogD pH 6.4 3.72 4.02 - LogD pH 7.4 3.99 4.18 - Plasma protein binding 89.3 ± 0.1 49.4 ± 26.2 % microsomal intrinsic Cl (human) 83 203 µL/min/mg microsomal intrinsic Cl (mouse) > 71 422 µL/min/mg b. In vitro transepithelial permeability The apparent permeability values for Compounds J and L , which ranged from 0.5-1.4x10 − 5 cm/s, are shown in Table 4 . These values were greater than the Papp of the high-permeability marker (1–5x10 − 6 cm/s) and comparable to those of the complete absorption marker ketoprofen (P app >5x10 − 6 cm/s). The Efflux Ratio (ER) values were 0.4 and 1.5 for Compounds J and L , respectively. Table 4 Transepithelial permeability of novel compounds across MDCK-hMDR1 cells (n = 3). P app,A−B [cm/s] P app,B−A [cm/s] Efflux Ratio Compound J 5.4 x10 − 6 1.9 x10 − 6 0.4 Compound L 1.2 x10 − 5 1.8 x10 − 5 1.5 4. Discussion c. Inhibitory potency and IC50 values of novel compounds in adipocyte primary cell culture (APCC) In the adipocyte primary cell culture, after treatment with 1 µM of each compound for 24 hours, the cortisol concentrations in the culture medium of adipocytes revealed that our compounds significantly reduced the cortisol levels (~ 50%) in the APCCs (Fig. 3 ). All the compounds had similar inhibitory effects on 11β-HSD1 reductase activity in APCCs: Compounds J (~ 52%), E (~ 58%), M (~ 54%), and L (~ 53%). Carbenoxolone consistently had the greatest inhibitory effect (~ 90% at 1 µM and ~ 99% at 30 µM). The IC50 value calculated for Compound J in APCCs was 2.1 µM (Fig. 3 ). 3.4 Biopharmaceutical characterization a. In vitro characterization of the metabolism, distribution parameters and plasma protein binding capacity Plasma protein binding and microsomal metabolism were characterized in vitro for both Compounds J and L (Table 3 ). While 89.3% of the former compound bound to plasma proteins, 49.4% of the latter compound bound to plasma proteins. These values are consistent with the LogD values reported in this study and with the alkaline nature of Compound L . Additionally, the stability of these compounds in mouse and human liver microsomes was measured (Table 3 ), and they were more stable in human microsomes than in mouse microsomes. Table 3 Physicochemical and biochemical characterization of our novel compounds. Property Compound J Compound L Units LogD pH 4.5 5.18 3.44 - LogD pH 6.4 3.72 4.02 - LogD pH 7.4 3.99 4.18 - Plasma protein binding 89.3 ± 0.1 49.4 ± 26.2 % microsomal intrinsic Cl (human) 83 203 µL/min/mg microsomal intrinsic Cl (mouse) > 71 422 µL/min/mg b. In vitro transepithelial permeability The apparent permeability values for Compounds J and L , which ranged from 0.5-1.4x10 − 5 cm/s, are shown in Table 4 . These values were greater than the Papp of the high-permeability marker (1–5x10 − 6 cm/s) and comparable to those of the complete absorption marker ketoprofen (P app >5x10 − 6 cm/s). The Efflux Ratio (ER) values were 0.4 and 1.5 for Compounds J and L , respectively. Table 4 Transepithelial permeability of novel compounds across MDCK-hMDR1 cells (n = 3). P app,A−B [cm/s] P app,B−A [cm/s] Efflux Ratio Compound J 5.4 x10 − 6 1.9 x10 − 6 0.4 Compound L 1.2 x10 − 5 1.8 x10 − 5 1.5 4. Discussion The current study achieved the standardization of a family of adamantylamidoxime derivatives, adamantyloxadiazoles, with the aim of obtaining compounds with significant inhibitory potency against the human 11β-HSD1 enzyme at the nanomolar level. Our study presents a series of adamantyloxadiazole compounds that exhibit high selectivity and specificity for the reductase activity of the enzyme 11β-HSD1 over its isoform 11β-HSD2, highlighting Compounds J and L (Table 2 ). The synthesis of 1-adamantylamidoxime ( 13 ) provides the foundational structure for the development of adamantyloxadiazole derivatives. Key modifications include the introduction of various substituents on the phenyl ring, such as methoxy, chloro, fluoro, bromo, and pyridyl groups, as well as adjustments in the linker length and flexibility. These modifications improve the binding affinity and selectivity, favoring the reductase activity of 11β-HSD1 while minimizing interactions with its oxidase activity and 11β-HSD2. The adamantyl structure provides rigidity and bulkiness, contributing to binding affinity, whereas the specific substituents enhance isoform specificity by preventing binding to the narrower active site of 11β-HSD2 ( 17 ). The selective inhibition of 11β-HSD1 reductase activity is achieved through precise molecular design ( 14 ), allowing the compounds to fit snugly into the reductase active site without affecting the oxidase site, as confirmed by the high FRET signal in oxidase activity assays shown in Table 2 . In this respect, Chuanxin et al in 2020 ( 18 ) emphasized the structural importance of the amino acid residues Tyr183 and Ser170 in the binding site of 11β-HSD1, which are critical for enzyme specificity and activity. They demonstrated that compounds such as KR-66344 achieve high selectivity for 11β-HSD1 by forming hydrogen bonds with these residues, resulting in potent inhibition with minimal effects on 11β-HSD2 ( 18 ). Similarly, our adamantyloxadiazoles likely interact with these key residues, ensuring high specificity and efficacy against 11β-HSD1 reductase activity without significantly affecting the oxidase activity of either isoform. Scott et al. ( 19 ) discussed the discovery of a selective inhibitor, AZD4017, and highlighted the importance of designing molecules that are selective for 11β-HSD1 over 11β-HSD2 to avoid complications such as hypertension associated with 11β-HSD2 isoform inhibition ( 19 ). Our adamantyloxadiazoles share some structural features with AZD4017. Both classes of inhibitors exhibit specific interactions within the active site of 11β-HSD1 that confer high selectivity. For example, the hydrogen bonds and hydrophobic interactions crucial for AZD4017 binding are mirrored in our adamantyloxadiazoles, which likely explains their selective inhibition. The selectivity of our adamantyloxadiazoles may be attributed to their unique structures, allowing them to fit precisely into the reductase active site of 11β-HSD1 while avoiding the oxidase active site and 11β-HSD2. This structural design strategy underscores the importance of detailed molecular modifications in the development of selective enzyme inhibitors, as demonstrated by both our compounds and those reported in the literature ( 18 , 19 ). The compounds chosen as comparative elements were extracted from an extensive review of 11β-HSD1 inhibitors ( 20 ) with similar methodologies employed in our studies, including detailed protocols for enzyme inhibition, selectivity assays, and cell culture models, which align well with those used in the reviewed studies. This alignment validates our approach, reinforces the reliability of our findings and provides insights into the efficacy, selectivity, and potential therapeutic benefits of our compounds. Our studies, which employed enzyme activity assays and cell culture models, revealed that Compounds J and L demonstrated superior inhibitory potency and selectivity for 11β-HSD1. Specifically, Compounds J and L presented IC50 values of 11.8 nM and 3.9 nM, indicating strong inhibition of 11β-HSD1 at low concentrations (Table 2 ). In comparison, AZD4017 has been reported to have an IC50 value of 7 nM ( 21 ), demonstrating potent inhibition similar to Compound L . The hydrogen bonds and hydrophobic interactions crucial for the binding of AZD4017 are mirrored in our adamantyloxadiazoles, potentially explaining their selective inhibition. Our analysis revealed a remaining 11β-HSD1oxidase enzyme activities of 92.1% for Compound J and 107% for Compound L at 100 nM, highlighting their specificity for the reductase activity of 11β-HSD1 (Table 2 ). Comparison of Compounds J and L with UI-1499, which was evaluated using enzyme inhibition assays and cell culture studies, exhibited better selectivity and specificity. UI-1499 has an IC50 value of 1.3 nM ( 22 ), which is comparable to that of Compound L . Likewise, the inhibitory effects of SKI2852 revealed an IC50 of 4.4 nM for 11β-HSD1 ( 23 ), which is in the range of inhibitory efficacy of our compounds (Table 2 ). The impact on cortisol levels was consistently effective, especially in APCC, indicating their potential as superior inhibitors, as shown in Fig. 3 . The translation from biologically active compounds in vitro to promising drug candidates demands not only high affinities for the desired target protein but also adequate features that ensure that the drug will reach the site of action. Therefore, the promising candidates, Compounds J and L , were characterized for their biopharmaceutical properties to assess whether these compounds have the potential to reach later stages of drug development. Both Compounds J and L were distributed in n-octanol at levels approximately 10 4 times greater than in the aqueous phase, regardless of the pH value (Table 3 ). A certain degree of lipophilicity (LogP > 2) is desired for molecular partitioning at the epithelial membrane, which is the first step in the intestinal absorption of the drug. However, when LogP values are greater than 5, the high affinity for membrane phospholipids may prevail over passive diffusion, thus hindering the absorption process ( 24 ). Although some partition values reported here are closer to the upper limit, in vitro transepithelial permeability studies confirmed that both candidates may be highly absorbed in the intestine after oral administration. Moreover, the efflux ratio suggested a negligible contribution of the efflux pump Pgp (Table 4 ). This observation further supports the eventual favorable oral absorption of our novel compounds, as hMDR1 is one of the most abundant transporters throughout the gastrointestinal tract ( 25 ). Nonetheless, the elevated LogD and LogP values reported here suggest that even larger quantities of our novel compounds should be distributed into fat tissue when our novel compounds are administered in vivo . Considering the favorable expression of 11β-HSD1 in visceral fat, our findings suggest that high concentrations can be reached in the target tissue. Our novel compounds were also evaluated in two human adipose cell lines, a human liposarcoma-derived SW cell line and an adipocyte primary cell culture (APCC) from VAT explants. In SW872 cells, at a concentration of 500 nM, our novel compounds slightly inhibited (10–30%) 11β-HSD1 activity but were comparable to 500 nM carbenoxolone (CBX) to some extent. Compared with 1 µM CBX, 1 µM doses of our compounds inhibited 11β-HSD1 activity by nearly 50%. Preliminary assays of the IC50 for Compound J indicated an IC50 of 2.1 µM in APCCs, which is similar to that of other previous preclinical inhibitors under similar conditions ( 20 ). Despite the promising results, a few limitations of the study must be considered. A discrepancy in IC₅₀ values was observed between the cell-free recombinant enzyme assays and cellular models. For example, the IC₅₀ for compound J increased from 11.8 nM in cell-free assays to 8.4 µM and 2.1 µM in SW872 cells and adipocyte primary cell cultures, respectively. This highlights that factors such as compound permeability, metabolism, and the overall cellular environment can significantly influence efficacy. Another limitation was the use of liver microsomes to assess 11β-HSD2 activity, as this enzyme is not naturally expressed in the liver. In conclusion, we designed, synthesized and performed a preclinical evaluation of a novel family of adamantyloxadiazole-derived compounds that have inhibitory effects on the human 11β-HSD1 enzyme. We highlight the success of Compounds J and L , which showed relevant biopharmaceutical performance, in both cell-free assays and cell assays, and support further in vivo studies in animals to evaluate their toxic effects, safety profiles, pharmacokinetics, distributions and efficacy. The current study achieved the standardization of a family of adamantylamidoxime derivatives, adamantyloxadiazoles, with the aim of obtaining compounds with significant inhibitory potency against the human 11β-HSD1 enzyme at the nanomolar level. Our study presents a series of adamantyloxadiazole compounds that exhibit high selectivity and specificity for the reductase activity of the enzyme 11β-HSD1 over its isoform 11β-HSD2, highlighting Compounds J and L (Table 2 ). The synthesis of 1-adamantylamidoxime ( 13 ) provides the foundational structure for the development of adamantyloxadiazole derivatives. Key modifications include the introduction of various substituents on the phenyl ring, such as methoxy, chloro, fluoro, bromo, and pyridyl groups, as well as adjustments in the linker length and flexibility. These modifications improve the binding affinity and selectivity, favoring the reductase activity of 11β-HSD1 while minimizing interactions with its oxidase activity and 11β-HSD2. The adamantyl structure provides rigidity and bulkiness, contributing to binding affinity, whereas the specific substituents enhance isoform specificity by preventing binding to the narrower active site of 11β-HSD2 ( 17 ). The selective inhibition of 11β-HSD1 reductase activity is achieved through precise molecular design ( 14 ), allowing the compounds to fit snugly into the reductase active site without affecting the oxidase site, as confirmed by the high FRET signal in oxidase activity assays shown in Table 2 . In this respect, Chuanxin et al in 2020 ( 18 ) emphasized the structural importance of the amino acid residues Tyr183 and Ser170 in the binding site of 11β-HSD1, which are critical for enzyme specificity and activity. They demonstrated that compounds such as KR-66344 achieve high selectivity for 11β-HSD1 by forming hydrogen bonds with these residues, resulting in potent inhibition with minimal effects on 11β-HSD2 ( 18 ). Similarly, our adamantyloxadiazoles likely interact with these key residues, ensuring high specificity and efficacy against 11β-HSD1 reductase activity without significantly affecting the oxidase activity of either isoform. Scott et al. ( 19 ) discussed the discovery of a selective inhibitor, AZD4017, and highlighted the importance of designing molecules that are selective for 11β-HSD1 over 11β-HSD2 to avoid complications such as hypertension associated with 11β-HSD2 isoform inhibition ( 19 ). Our adamantyloxadiazoles share some structural features with AZD4017. Both classes of inhibitors exhibit specific interactions within the active site of 11β-HSD1 that confer high selectivity. For example, the hydrogen bonds and hydrophobic interactions crucial for AZD4017 binding are mirrored in our adamantyloxadiazoles, which likely explains their selective inhibition. The selectivity of our adamantyloxadiazoles may be attributed to their unique structures, allowing them to fit precisely into the reductase active site of 11β-HSD1 while avoiding the oxidase active site and 11β-HSD2. This structural design strategy underscores the importance of detailed molecular modifications in the development of selective enzyme inhibitors, as demonstrated by both our compounds and those reported in the literature ( 18 , 19 ). The compounds chosen as comparative elements were extracted from an extensive review of 11β-HSD1 inhibitors ( 20 ) with similar methodologies employed in our studies, including detailed protocols for enzyme inhibition, selectivity assays, and cell culture models, which align well with those used in the reviewed studies. This alignment validates our approach, reinforces the reliability of our findings and provides insights into the efficacy, selectivity, and potential therapeutic benefits of our compounds. Our studies, which employed enzyme activity assays and cell culture models, revealed that Compounds J and L demonstrated superior inhibitory potency and selectivity for 11β-HSD1. Specifically, Compounds J and L presented IC50 values of 11.8 nM and 3.9 nM, indicating strong inhibition of 11β-HSD1 at low concentrations (Table 2 ). In comparison, AZD4017 has been reported to have an IC50 value of 7 nM ( 21 ), demonstrating potent inhibition similar to Compound L . The hydrogen bonds and hydrophobic interactions crucial for the binding of AZD4017 are mirrored in our adamantyloxadiazoles, potentially explaining their selective inhibition. Our analysis revealed a remaining 11β-HSD1oxidase enzyme activities of 92.1% for Compound J and 107% for Compound L at 100 nM, highlighting their specificity for the reductase activity of 11β-HSD1 (Table 2 ). Comparison of Compounds J and L with UI-1499, which was evaluated using enzyme inhibition assays and cell culture studies, exhibited better selectivity and specificity. UI-1499 has an IC50 value of 1.3 nM ( 22 ), which is comparable to that of Compound L . Likewise, the inhibitory effects of SKI2852 revealed an IC50 of 4.4 nM for 11β-HSD1 ( 23 ), which is in the range of inhibitory efficacy of our compounds (Table 2 ). The impact on cortisol levels was consistently effective, especially in APCC, indicating their potential as superior inhibitors, as shown in Fig. 3 . The translation from biologically active compounds in vitro to promising drug candidates demands not only high affinities for the desired target protein but also adequate features that ensure that the drug will reach the site of action. Therefore, the promising candidates, Compounds J and L , were characterized for their biopharmaceutical properties to assess whether these compounds have the potential to reach later stages of drug development. Both Compounds J and L were distributed in n-octanol at levels approximately 10 4 times greater than in the aqueous phase, regardless of the pH value (Table 3 ). A certain degree of lipophilicity (LogP > 2) is desired for molecular partitioning at the epithelial membrane, which is the first step in the intestinal absorption of the drug. However, when LogP values are greater than 5, the high affinity for membrane phospholipids may prevail over passive diffusion, thus hindering the absorption process ( 24 ). Although some partition values reported here are closer to the upper limit, in vitro transepithelial permeability studies confirmed that both candidates may be highly absorbed in the intestine after oral administration. Moreover, the efflux ratio suggested a negligible contribution of the efflux pump Pgp (Table 4 ). This observation further supports the eventual favorable oral absorption of our novel compounds, as hMDR1 is one of the most abundant transporters throughout the gastrointestinal tract ( 25 ). Nonetheless, the elevated LogD and LogP values reported here suggest that even larger quantities of our novel compounds should be distributed into fat tissue when our novel compounds are administered in vivo . Considering the favorable expression of 11β-HSD1 in visceral fat, our findings suggest that high concentrations can be reached in the target tissue. Our novel compounds were also evaluated in two human adipose cell lines, a human liposarcoma-derived SW cell line and an adipocyte primary cell culture (APCC) from VAT explants. In SW872 cells, at a concentration of 500 nM, our novel compounds slightly inhibited (10–30%) 11β-HSD1 activity but were comparable to 500 nM carbenoxolone (CBX) to some extent. Compared with 1 µM CBX, 1 µM doses of our compounds inhibited 11β-HSD1 activity by nearly 50%. Preliminary assays of the IC50 for Compound J indicated an IC50 of 2.1 µM in APCCs, which is similar to that of other previous preclinical inhibitors under similar conditions ( 20 ). Despite the promising results, a few limitations of the study must be considered. A discrepancy in IC₅₀ values was observed between the cell-free recombinant enzyme assays and cellular models. For example, the IC₅₀ for compound J increased from 11.8 nM in cell-free assays to 8.4 µM and 2.1 µM in SW872 cells and adipocyte primary cell cultures, respectively. This highlights that factors such as compound permeability, metabolism, and the overall cellular environment can significantly influence efficacy. Another limitation was the use of liver microsomes to assess 11β-HSD2 activity, as this enzyme is not naturally expressed in the liver. In conclusion, we designed, synthesized and performed a preclinical evaluation of a novel family of adamantyloxadiazole-derived compounds that have inhibitory effects on the human 11β-HSD1 enzyme. We highlight the success of Compounds J and L , which showed relevant biopharmaceutical performance, in both cell-free assays and cell assays, and support further in vivo studies in animals to evaluate their toxic effects, safety profiles, pharmacokinetics, distributions and efficacy. Declarations Acknowledgment. We appreciate the valuable help provided by the Corbio-Q team during this research, such as help with writing and proof reading. ETHICAL STATEMENT: Ethics approval and consent to participate: This study did not involve human participants, animal subjects, or any personal data. Consent for publication: This study does not contain any individual person's data. Competing interests : The authors have no relevant financial or non-financial interests to disclose. Funding: This work was partially supported by grants from ANID-FONDECYT 1212006 and 11251675, ICM-ANID ICN2021_045, ANID-FONDEQUIP (EQM150023), SOCHED 2024-06, CETREN-UC and Thani Biotechnologies. Author Contributions: All authors contributed to the conception and design of the study. Material preparation and data collection were carried out by Gonzalo Recabarren, Benjamín Diethelm, Eduardo Riquelme, Mauricio A. García, and Fidel A. Allende. Data analysis was performed by Cristian A. Carvajal, Alejandra Tapia-Castillo, Pablo González, Andrea Vecchiola, Sandra Solari, René Baudrand, and Jorge A. Pérez. The first draft of the manuscript was written by Pablo González, Cristian A. Carvajal, and Alejandra Tapia-Castillo, and all authors provided comments on previous versions of the manuscript. All authors read and approved the final version of the manuscript. Acknowledgment. We appreciate the valuable help provided by the Corbio-Q team during this research, such as help with writing and proof reading. Data Availability Statement: The datasets generated and/or analyzed during the current study are not publicly available due to commercial interests and the existence of an granted patent but are available from the corresponding author on reasonable request. References Kadmiel M, Cidlowski JA. Glucocorticoid receptor signaling in health and disease. Trends Pharmacol Sci . 2013;34(9):518-530. Yuan X, Li H, Bai H, Su Z, Xiang Q, Wang C, Zhao B, Zhang Y, Zhang Q, Chu Y, Huang Y. Synthesis of novel curcumin analogues for inhibition of 11beta-hydroxysteroid dehydrogenase type 1 with anti-diabetic properties. Eur J Med Chem . 2014;77:223-230. Gathercole LL, Lavery GG, Morgan SA, Cooper MS, Sinclair AJ, Tomlinson JW, Stewart PM. 11beta-Hydroxysteroid dehydrogenase 1: translational and therapeutic aspects. Endocrine reviews . 2013;34(4):525-555. Tomlinson JW, Walker EA, Bujalska IJ, Draper N, Lavery GG, Cooper MS, Hewison M, Stewart PM. 11beta-hydroxysteroid dehydrogenase type 1: a tissue-specific regulator of glucocorticoid response. Endocrine reviews . 2004;25(5):831-866. Walker BR. Cortisol--cause and cure for metabolic syndrome? Diabet Med . 2006;23(12):1281-1288. Tomlinson JW, Finney J, Gay C, Hughes BA, Hughes SV, Stewart PM. Impaired glucose tolerance and insulin resistance are associated with increased adipose 11beta-hydroxysteroid dehydrogenase type 1 expression and elevated hepatic 5alpha-reductase activity. Diabetes . 2008;57(10):2652-2660. Masuzaki H, Yamamoto H, Kenyon CJ, Elmquist JK, Morton NM, Paterson JM, Shinyama H, Sharp MG, Fleming S, Mullins JJ, Seckl JR, Flier JS. Transgenic amplification of glucocorticoid action in adipose tissue causes high blood pressure in mice. The Journal of clinical investigation . 2003;112(1):83-90. Livingstone DE, Jones GC, Smith K, Jamieson PM, Andrew R, Kenyon CJ, Walker BR. Understanding the role of glucocorticoids in obesity: tissue-specific alterations of corticosterone metabolism in obese Zucker rats. Endocrinology . 2000;141(2):560-563. Morton NM, Paterson JM, Masuzaki H, Holmes MC, Staels B, Fievet C, Walker BR, Flier JS, Mullins JJ, Seckl JR. Novel adipose tissue-mediated resistance to diet-induced visceral obesity in 11 beta-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes . 2004;53(4):931-938. Lagos CF, Vecchiola A, Allende F, Fuentes CA, Tichauer JE, Valdivia C, Solari S, Campino C, Tapia-Castillo A, Baudrand R, Villarroel P, Cifuentes M, Owen GI, Carvajal CA, Fardella CE. Identification of novel 11β-HSD1 inhibitors by combined ligand- and structure-based virtual screening. Molecular and Cellular Endocrinology . 2014;384(1):71-82. Wake DJ, Walker BR. 11 beta-hydroxysteroid dehydrogenase type 1 in obesity and the metabolic syndrome. Mol Cell Endocrinol . 2004;215(1-2):45-54. Morgan SA, Sherlock M, Gathercole LL, Lavery GG, Lenaghan C, Bujalska IJ, Laber D, Yu A, Convey G, Mayers R, Hegyi K, Sethi JK, Stewart PM, Smith DM, Tomlinson JW. 11beta-hydroxysteroid dehydrogenase type 1 regulates glucocorticoid-induced insulin resistance in skeletal muscle. Diabetes . 2009;58(11):2506-2515. Diethelm B, Lagos CF, Recabarren-Gajardo G. 1-Adamantylamidoxime. Molbank . 2018;2018(2):M992. Farman N, Bocchi B. Mineralocorticoid selectivity: molecular and cellular aspects. Kidney Int . 2000;57(4):1364-1369. Carswell KA, Lee MJ, Fried SK. Culture of isolated human adipocytes and isolated adipose tissue. Methods in molecular biology . 2012;806:203-214. Garcia MA, Contreras D, Gonzalez PM. Metformin Transport in Native MDCK-Wt and MDCK-II Monolayers Unveils Functional Inter-Strains Differences Influencing Drug Permeability. Pharm Res . 2020;37(7):121. Meli R, Morris GM, Biggin PC. Scoring Functions for Protein-Ligand Binding Affinity Prediction using Structure-Based Deep Learning: A Review. Front Bioinform . 2022;2. Chuanxin Z, Shengzheng W, Lei D, Duoli X, Jin L, Fuzeng R, Aiping L, Ge Z. Progress in 11beta-HSD1 inhibitors for the treatment of metabolic diseases: A comprehensive guide to their chemical structure diversity in drug development. Eur J Med Chem . 2020;191:112134. Scott JS, Bowker SS, Deschoolmeester J, Gerhardt S, Hargreaves D, Kilgour E, Lloyd A, Mayers RM, McCoull W, Newcombe NJ, Ogg D, Packer MJ, Rees A, Revill J, Schofield P, Selmi N, Swales JG, Whittamore PR. Discovery of a potent, selective, and orally bioavailable acidic 11beta-hydroxysteroid dehydrogenase type 1 (11beta-HSD1) inhibitor: discovery of 2-[(3S)-1-[5-(cyclohexylcarbamoyl)-6-propylsulfanylpyridin-2-yl]-3-piperidyl]acetic acid (AZD4017). J Med Chem . 2012;55(12):5951-5964. Silvestre CACMS. Inhibitors of 11β-Hydroxysteroid Dehydrogenase Type 1 as Potential Drugs for Type 2 Diabetes Mellitus—A Systematic Review of Clinical and In Vivo Preclinical Studies. Scientia Pharmaceutica . 2021;89(1). Scott JS, Bowker SS, deSchoolmeester J, Gerhardt S, Hargreaves D, Kilgour E, Lloyd A, Mayers RM, McCoull W, Newcombe NJ, Ogg D, Packer MJ, Rees A, Revill J, Schofield P, Selmi N, Swales JG, Whittamore PRO. Discovery of a Potent, Selective, and Orally Bioavailable Acidic 11β-Hydroxysteroid Dehydrogenase Type 1 (11β-HSD1) Inhibitor: Discovery of 2-[(3S)-1-[5-(Cyclohexylcarbamoyl)-6-propylsulfanylpyridin-2-yl]-3-piperidyl]acetic Acid (AZD4017). Journal of Medicinal Chemistry . 2012;55(12):5951-5964. Byun SY, Shin YJ, Nam KY, Hong SP, Ahn SK. A novel highly potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, UI-1499. Life Sciences . 2015;120:1-7. Ryu JH, Lee JA, Kim S, Shin YA, Yang J, Han HY, Son HJ, Kim YH, Sa JH, Kim J-S, Lee J, Lee J, Park H-g. Discovery of 2-((R)-4-(2-Fluoro-4-(methylsulfonyl)phenyl)-2-methylpiperazin-1-yl)-N-((1R,2s,3S,5S,7S)-5-hydroxyadamantan-2-yl)pyrimidine-4-carboxamide (SKI2852): A Highly Potent, Selective, and Orally Bioavailable Inhibitor of 11β-Hydroxysteroid Dehydrogenase Type 1 (11β-HSD1). Journal of Medicinal Chemistry . 2016;59(22):10176-10189. Lipinski CA. Drug-like properties and the causes of poor solubility and poor permeability. J Pharmacol Toxicol Methods . 2000;44(1):235-249. Drozdzik M, Groer C, Penski J, Lapczuk J, Ostrowski M, Lai Y, Prasad B, Unadkat JD, Siegmund W, Oswald S. Protein abundance of clinically relevant multidrug transporters along the entire length of the human intestine. Mol Pharm . 2014;11(10):3547-3555. Additional Declarations No competing interests reported. Supplementary Files SUPLEMENTARYINFORMATIONLenovoJorge.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7933515","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":537964162,"identity":"e74f3dd7-71a1-476b-a4c9-0cf66e67e872","order_by":0,"name":"Pablo González","email":"","orcid":"","institution":"Innovation and Biopharmaceutical Evaluation Center","correspondingAuthor":false,"prefix":"","firstName":"Pablo","middleName":"","lastName":"González","suffix":""},{"id":537964163,"identity":"f6d42810-6e8f-493b-93b6-48990d445619","order_by":1,"name":"Cristian A. Carvajal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAqklEQVRIiWNgGAWjYPACNgZ+MF1AihbJBhBtQIo9BgeI1cLffvjZZ54avmjjG8kPGH4Qo0XiTJrxbJ5jbLnbbqQZMPYQo8VAgsGYcQYbSEsOAzNRDjOQYP/MOOMfW+7mGcRr4TFm+NjGlrtBglgtEmdyihk+9rHlzjjzzOAgUX7hbz++mSHh27Hc/vbkhw9+VBChBQqOgckDxGtgYKghRfEoGAWjYBSMNAAA06owBSeNQ/8AAAAASUVORK5CYII=","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":true,"prefix":"","firstName":"Cristian","middleName":"A.","lastName":"Carvajal","suffix":""},{"id":537964164,"identity":"30e5c4ff-43c3-443d-8ebb-0fcdef6dd0e8","order_by":2,"name":"Alejandra Tapia-Castillo","email":"","orcid":"","institution":"Centro Traslacional de Endocrinología UC (CETREN-UC)","correspondingAuthor":false,"prefix":"","firstName":"Alejandra","middleName":"","lastName":"Tapia-Castillo","suffix":""},{"id":537964165,"identity":"3716cdd4-d3bd-490a-9751-1dbe0962af8f","order_by":3,"name":"Gonzalo Recabarren","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Gonzalo","middleName":"","lastName":"Recabarren","suffix":""},{"id":537964166,"identity":"55d7ce5d-933c-4aac-ae5f-622f5f2f6e5c","order_by":4,"name":"Benjamín Diethelm","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Benjamín","middleName":"","lastName":"Diethelm","suffix":""},{"id":537964167,"identity":"9b43c9d1-2630-4344-ba2b-0f0da8a97d72","order_by":5,"name":"Eduardo Riquelme","email":"","orcid":"","institution":"Merken Biotech","correspondingAuthor":false,"prefix":"","firstName":"Eduardo","middleName":"","lastName":"Riquelme","suffix":""},{"id":537964168,"identity":"1cf6a246-3631-4051-90ee-e9054881c021","order_by":6,"name":"Mauricio A. García","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Mauricio","middleName":"A.","lastName":"García","suffix":""},{"id":537964170,"identity":"78879d98-1c18-4f44-ae5f-68823b14333f","order_by":7,"name":"Andrea Vecchiola","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Andrea","middleName":"","lastName":"Vecchiola","suffix":""},{"id":537964171,"identity":"e728e5c5-f05f-409e-82df-f5d51479cdbd","order_by":8,"name":"Fidel A. Allende","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Fidel","middleName":"A.","lastName":"Allende","suffix":""},{"id":537964172,"identity":"981dd688-1fc7-42a4-bd2a-2646bde91c1b","order_by":9,"name":"Jorge A. Pérez","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Jorge","middleName":"A.","lastName":"Pérez","suffix":""},{"id":537964173,"identity":"a1cf2f7a-f36f-4d9e-a4b4-7b90e96e8e7f","order_by":10,"name":"Sandra Solari","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Sandra","middleName":"","lastName":"Solari","suffix":""},{"id":537964174,"identity":"7f2164fa-f744-4967-986d-9b60cc34ad2a","order_by":11,"name":"René Baudrand","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"René","middleName":"","lastName":"Baudrand","suffix":""},{"id":537964175,"identity":"229c5763-9220-42c5-a776-1b441ea2356a","order_by":12,"name":"Carlos E. Fardella","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Carlos","middleName":"E.","lastName":"Fardella","suffix":""}],"badges":[],"createdAt":"2025-10-23 15:08:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7933515/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7933515/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":95267460,"identity":"f75625c4-ca26-4b50-b592-65e4009097f0","added_by":"auto","created_at":"2025-11-06 06:21:45","extension":"tiff","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1063564,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/6632a491efd20e4a82bb8f26.tiff"},{"id":95267463,"identity":"a05f525a-1e8c-4e53-ac99-ce5e60ee7e95","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6526777,"visible":true,"origin":"","legend":"","description":"","filename":"vfarticuloAdamantyloxadiazoles05082025ATCcc4postEDsinabstractgrficoyconfiguras.docx","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/5d6f9733380ac7a46426a0e8.docx"},{"id":95313747,"identity":"bf96091c-f62e-4151-8947-5c6477385b73","added_by":"auto","created_at":"2025-11-06 15:51:56","extension":"tiff","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3892582,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/2be2ef2d4ac2d73ec0784e3c.tiff"},{"id":95313452,"identity":"c4d21bce-d39b-4c3f-b441-df90e050620f","added_by":"auto","created_at":"2025-11-06 15:51:27","extension":"tiff","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1436148,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/666af966a3a73a19640cdb91.tiff"},{"id":95267462,"identity":"44ffb17c-7446-4cbf-af5a-b4f392c2177d","added_by":"auto","created_at":"2025-11-06 06:21:45","extension":"json","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14350,"visible":true,"origin":"","legend":"","description":"","filename":"49035c0ab3ed4c6aa99a76f5b760fcf5.json","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/44e7865e8134ac7fa71e8740.json"},{"id":95267464,"identity":"2cc1339b-28bb-4878-8206-b5e6bdef98cb","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":56569,"visible":true,"origin":"","legend":"","description":"","filename":"SUPLEMENTARYINFORMATIONLenovoJorge.docx","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/52edd86143601f6e72f7f061.docx"},{"id":95313247,"identity":"46943186-368e-47e6-89c6-3b3063ea67df","added_by":"auto","created_at":"2025-11-06 15:51:09","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119919,"visible":true,"origin":"","legend":"","description":"","filename":"49035c0ab3ed4c6aa99a76f5b760fcf51enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/401ba736442bd34eb6530ce9.xml"},{"id":95267465,"identity":"91825b59-c04b-4fd5-8c86-e852a17ad0bc","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"tiff","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1063564,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/496d831734d2da1d80f7fce0.tiff"},{"id":95313097,"identity":"f79a4512-4b30-4651-83d8-051413147090","added_by":"auto","created_at":"2025-11-06 15:50:53","extension":"tiff","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3892582,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/397c3d406c892f3683a837bd.tiff"},{"id":95267476,"identity":"2066cae8-6cd8-49e3-ba61-9f4048de9ccf","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"tiff","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1436148,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/66e78c2bf4c20e2441da68d3.tiff"},{"id":95313159,"identity":"cda4e742-8646-4f68-8529-03438096cbca","added_by":"auto","created_at":"2025-11-06 15:51:00","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1063564,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/8c9581d3086cfd7bb3d5fb1a.jpeg"},{"id":95313754,"identity":"9158723e-d8e6-42e8-8f6c-b06796292f3c","added_by":"auto","created_at":"2025-11-06 15:51:57","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3892582,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/ea6ee4b2eaf57f0f72344fa5.jpeg"},{"id":95313734,"identity":"ac573da1-0482-4fca-aa13-db4f6ef14c01","added_by":"auto","created_at":"2025-11-06 15:51:55","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1436148,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/5c09153ceb86d6668aea2b05.jpeg"},{"id":95313511,"identity":"f2c4d203-7a81-4768-bcec-2220ddade21c","added_by":"auto","created_at":"2025-11-06 15:51:35","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41341,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/f0a545540c0aa1129bdf7ca1.png"},{"id":95267472,"identity":"6c001fa5-8da7-48a9-82e9-d9c25b8dabe8","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16532,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/15ce93fc2b00afebb4fabdf2.png"},{"id":95267479,"identity":"4cf311a5-1e3c-4515-997e-74fbf7bb51a1","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9450,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/2b394a3996012ddce7cbf425.png"},{"id":95267469,"identity":"9bb4ded4-8fc2-4a71-a05e-f9605e96fe64","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41341,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/b9b5dd22628bcbf830dd5c26.png"},{"id":95313556,"identity":"26556683-ef32-40b4-a7f7-1e840e924e5f","added_by":"auto","created_at":"2025-11-06 15:51:41","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16532,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/5a8872e2c553451b4cb655c8.png"},{"id":95267475,"identity":"dc3cb800-1efe-4c16-81ba-a1f730d4090b","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9450,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/6cff707ef729dd71481e4b14.png"},{"id":95313521,"identity":"c109d7b7-1088-43ca-8bc6-5a3979f387d6","added_by":"auto","created_at":"2025-11-06 15:51:36","extension":"xml","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122161,"visible":true,"origin":"","legend":"","description":"","filename":"49035c0ab3ed4c6aa99a76f5b760fcf51structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/52c4a0464e03944fc95db919.xml"},{"id":95267480,"identity":"a5d4450b-9152-4de0-a31e-04fb951a76e7","added_by":"auto","created_at":"2025-11-06 06:21:46","extension":"html","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136578,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/f04149a8daeeefb47012c737.html"},{"id":95267457,"identity":"199835bd-3c37-4e52-96ec-1a7b03498c32","added_by":"auto","created_at":"2025-11-06 06:21:45","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":81282,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdipocyte differentiation progression from preadipocytes.\u003c/strong\u003e Adipocyte cells differentiate by 7-10 days increasing lipid accumulation, 11bHSD1 expression and local cortisol synthesis. Either SW-872 or primary preadipocyte cells can differentiate and accumulate lipids. Oil-Red-O stain lipids in differentiated SW872 or APCC.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/4391875dad56f6064c1d5165.jpg"},{"id":95267456,"identity":"1d362d07-2ae8-4550-8a9e-6e748177a124","added_by":"auto","created_at":"2025-11-06 06:21:45","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":64765,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene expression of 11β-HSD1 and isoform 11β-HSD2 in SW872 cells and APCC. \u003c/strong\u003eA) Relative expression of 11β-HSD1 and 11β-HSD2 in preadipocyte and differentiated adipocyte cell line SW872. B) Relative expression of 11β-HSD1 and 11β-HSD2 in primary cultures of preadipocytes and adipocytes from primary cell culture. ND; non-detected. C) Western blot of 11β-HSD1 in APCC with vehicle and compound \u003cem\u003eJ\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/b6c3e299484bfd10c077652f.jpg"},{"id":95267459,"identity":"e5ccffec-6070-4204-9682-dde63a68a6fe","added_by":"auto","created_at":"2025-11-06 06:21:45","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":40544,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibition of 11β-HSD1 by novel compounds in differentiated adipocyte from APCC cells. \u003c/strong\u003eA) Absolute cortisol concentration was measured by HPLC after 24 hours from treatment with the compounds at 1 uM (\u003cem\u003eE, J, L \u003c/em\u003eand\u003cem\u003e M\u003c/em\u003e ) and 1 uM carbenoxolone in differentiated adipocytes APCC. On right side, percentage of relative inhibition of 11β-HSD1 reductase activity caused by the compounds \u003cem\u003eE, J, L \u003c/em\u003eand\u003cem\u003e M\u003c/em\u003e at a concentration of 1 uM for a period of 24 hours in differentiated APCC. CBX: carbenoxolone. * p \u0026lt; 0.05 respect to Vehicle.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/f175d0d576f1faf466c0567b.jpg"},{"id":96367663,"identity":"10c770bd-083f-4ccf-9493-2ecc786d2164","added_by":"auto","created_at":"2025-11-20 10:14:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2150904,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/4cd9ef0c-acdb-419a-b0fb-f96fa6a70142.pdf"},{"id":95267458,"identity":"057120d7-5119-4ca8-a954-f3624ae6b4c2","added_by":"auto","created_at":"2025-11-06 06:21:45","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":56569,"visible":true,"origin":"","legend":"","description":"","filename":"SUPLEMENTARYINFORMATIONLenovoJorge.docx","url":"https://assets-eu.researchsquare.com/files/rs-7933515/v1/3a93e26062e5bdade3580d69.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Novel nonsteroidal inhibitors of the human 11-beta hydroxysteroid dehydrogenase type 1 enzyme for the treatment of obesity and metabolic syndrome","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eObesity has become a major public health concern worldwide and is characterized by the excessive accumulation of body fat that significantly increases the risk of developing a range of serious health conditions, including cardiovascular disease, diabetes, and hypertension. The hormone cortisol, a glucocorticoid produced primarily by the adrenal glands and involved in various metabolic processes, is central to the pathophysiology of obesity (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Cortisol levels in peripheral tissues, such as the liver and adipose (fat) tissue, are regulated by the enzyme 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1). This enzyme converts the inactive form of cortisone into active cortisol (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e), thereby influencing local cortisol concentrations.\u003c/p\u003e\u003cp\u003eElevated 11β-HSD1 activity has been implicated in the development of obesity, as increased local cortisol levels can promote fat accumulation by stimulating lipogenesis and inhibiting lipolysis. Consequently, 11β-HSD1 plays a key role in the pathogenesis of metabolic disorders associated with obesity, including insulin resistance and central adiposity.\u003c/p\u003e\u003cp\u003eThe balance between cortisol and its inactive form, cortisone, is tightly controlled by two distinct enzymes: 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) and 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2). 11β-HSD1 is a nicotinamide adenine dinucleotide phosphate (NADPH)-dependent reductase enzyme that converts cortisone into active cortisol and thereby increases local cortisol levels in tissues such as the liver and adipose tissue. This local activation of cortisol is significant in metabolic processes and, when 11β-HSD1 is overexpressed, is linked to obesity and metabolic syndrome. This enzyme is widely distributed throughout the body, with the highest expression observed in the brain, liver, and adipose tissue (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). In contrast, 11β-HSD2 functions as a dehydrogenase enzyme, converting cortisol back to cortisone. Predominantly expressed in mineralocorticoid target tissues such as the kidneys, colon, and salivary glands, 11β-HSD2 prevents cortisol from binding to mineralocorticoid receptors, thereby modulating its effects. The balance between these two enzymes is essential for maintaining cortisol homeostasis and ensuring that the effects of cortisol are appropriately regulated across different tissues.\u003c/p\u003e\u003cp\u003eOver the last two decades, \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e studies have collectively shown the importance of local generation of cortisol via 11β-HSD1 in the liver and fat in mediating many facets of metabolic syndrome, including central adiposity, diabetes mellitus (T2DM), dyslipidemia, and hypertension (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Animal studies have revealed the importance of the 11β-HSD1 enzyme in metabolic disorders \u003cem\u003ein vivo\u003c/em\u003e; in this respect, in mouse models, hepatic overexpression of the HSD11B1 gene results in hypertension and central obesity(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Similarly, the findings from obese rats (Zucker rats) suggest that obesity is associated with exacerbated 11β-HSD1 activity (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e), and HSD11B1 knockout mice are protected from these metabolic abnormalities (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn recent years, interest in the development of 11β-HSD1 inhibitors as potential therapeutic agents for obesity and related metabolic conditions has increased. By targeting and reducing the activity of 11β-HSD1, these inhibitors aim to lower local cortisol levels in adipose tissue, thereby mitigating the adverse metabolic effects associated with elevated cortisol levels (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e–\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Despite significant research efforts, the development of effective 11β-HSD1 inhibitors with the necessary specificity and selectivity remains an active area of investigation.\u003c/p\u003e\u003cp\u003eThe current study focuses on designing and developing novel, potent, and selective inhibitors of the human 11β-HSD1 enzyme through a combination of \u003cem\u003ein silico\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e studies (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e"},{"header":"2. METHODS","content":"\u003cp\u003e\u003cb\u003e2.1 Design and synthesis of adamantyloxadiazole as a novel 11β-HSD1 inhibitor\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe identified a novel family of potent and selective nonsteroidal 11β-HSD1 inhibitors based on a previous study by our group and a pharmacophoric structure designed \u003cem\u003ein silico\u003c/em\u003e (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). We further designed and synthesized 15 novel compounds derived from specific substitutions of 1-adamantylamidoxime compounds (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003e2.2\u003c/b\u003e \u003cb\u003eIN VITRO\u003c/b\u003e \u003cb\u003eCELL-FREE ASSAYS\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ea. Determination of 11β-HSD1 reductase activity by calculating the IC50\u003c/b\u003e\u003c/p\u003e\u003cp\u003eStock solutions of Compounds \u003cem\u003eA\u003c/em\u003e-\u003cem\u003eN\u003c/em\u003e were prepared in DMSO (10 mM), followed by serial dilutions. The recombinant 11β-HSD1 enzyme (Cayman Chemical, MI, USA; catalog number 10007815) was diluted in 20 mM Tris buffer containing 5 mM EDTA (pH 6.0) at various dilutions. First, we determined the appropriate enzyme concentration for assessing the effects of a compound’s biological activity on the synthesis of cortisol from cortisone via homogeneous time-resolved fluorescence (HTRF) with a commercial Cortisol Detection Kit (Cisbio, MA, USA; Cat no. 62CRTPEG). Briefly, 11β-HSD1 enzyme was added to an HTRF plate containing 266 nM cortisone and 333 µM NADPH in Tris buffer at a 4:1 ratio and incubated for 2 hours at 37°C. After the incubation, reagents from the cortisol kit—cortisol d2 and cortisol cryptate—were added to the samples at a 2:1:1 ratio (sample, cortisol d2, and cortisol cryptate) and incubated for 1 hour at room temperature, followed by fluorescence measurements at 665 and 620 nm. Once the appropriate enzyme concentration was determined, we assessed the half maximal inhibitory concentration (IC50) of Compounds \u003cem\u003eA\u003c/em\u003e-\u003cem\u003eN\u003c/em\u003e by incubating the reaction buffer, the recombinant 11β-HSD1 enzyme, and the compounds in a 3:1:1 ratio at 37°C for 2 hours. After the incubation, the cortisol levels were quantified with an HTRF Cortisol Detection Kit.\u003c/p\u003e\u003ch2\u003eb. Determination of 11β-HSD1 oxidase activity\u003c/h2\u003e\u003cp\u003eRecombinant 11β-HSD1 enzyme dilutions were prepared in 20 mM Tris buffer containing 5 mM EDTA, pH 6.0. Initially, the enzyme concentration was determined by preparing a plate for HTRF with Tris buffer containing 100 nM cortisol and 200 mM NADP + and incubating it with the enzyme at a 4:1 ratio at 37°C for 2 hours. The cortisol kit reagents cortisol d2 and cortisol cryptate (Cisbio, MA, USA; Cat no. 62CRTPEG) were then added, followed by an incubation at room temperature for 1 hour and fluorescence measurements at 665 and 620 nm. Once the enzyme concentration was determined, an HTRF plate was set up by adding the reaction buffer, recombinant 11β-HSD1 enzyme, and test compounds at a 3:1:1 ratio and incubated at 37°C for 2 hours. After the incubation, the reagents from the cortisol kit were added, followed by an incubation at room temperature for 1 hour, and the fluorescence was measured at 665 and 620 nm.\u003c/p\u003e\u003ch3\u003ec. Determination of 11β-HSD2 oxidase activity in human liver microsomes\u003c/h3\u003e\u003cp\u003eThe analysis of this activity involved assessing the cortisone concentration produced in reactions with and without our novel compounds using the Cortisol Kit (Cisbio, MA, USA; Cat no. 62CRTPEG). The selected Compounds \u003cem\u003eA\u003c/em\u003e to \u003cem\u003eN\u003c/em\u003e were reconstituted in DMSO to a 10 mM stock, followed by serial dilutions to construct the efficacy curve. Donor human liver microsomes (BioReclamation-lVT Inc.) were prepared in 20 mM Tris buffer containing 5 mM EDTA, pH 6.0, to determine the IC50. The assay was conducted in HTRF plates containing Tris buffer, 100 nM cortisol, and 200 mM NAD+. The enzymes were added at a 4:1 ratio to the corresponding wells and incubated for 2 hours at 37°C. For controls, wells with only Tris buffer were used. After the incubation, the reagents from the cortisol kit were added to the sample, with cortisol d2 and cortisol cryptate added at a 2:1:1 ratio. For the negative controls, cortisol d2 was replaced with reconstitution buffer from the kit. The plate was incubated for 1 hour at room temperature before the fluorescence was measured at 665 and 620 nm. Once the enzyme concentration was determined, the protocol for the cortisol kit was used to establish an efficacy curve. In an HTRF plate, reaction buffer, microsomes (5 mg/mL), and the test compounds were added at a 3:1:1 ratio to each well. The controls included reaction buffer without cortisol (negative), reaction buffer without the compound (positive), and reaction buffer only (kit controls). After a 2-hour incubation, the reagents from the cortisol kit were added, and the samples were incubated at room temperature for 1 hour before the fluorescence was measured at 665 and 620 nm.\u003c/p\u003e\u003cp\u003e\u003cb\u003e2.3\u003c/b\u003e \u003cb\u003eIN VITRO\u003c/b\u003e \u003cb\u003eASSAYS IN CELLS\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ea. Inhibitory potency of novel compounds in SW872 adipocytes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe human liposarcoma-derived SW872 preadipocyte line (HTB-92, ATCC, Manassas, VA, USA) was grown in 10% fetal bovine serum (FBS)-supplemented DMEM/F12 at 37°C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere. SW872 cells at 90% confluence were treated with a differentiation cocktail composed of 1 µM dexamethasone, 0.5 mM IBMX, 1 µM rosiglitazone, and 10 µg/mL insulin for adipocyte differentiation. The differentiation of SW872 cells was confirmed after 7 days of treatment by morphological changes and lipid droplet formation using Oil Red O staining and optical microscopy, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e (See details in the SUPPLEMENTARY INFORMATION).\u003c/p\u003e\u003cp\u003eSW872 adipocytes were treated with 500 nM Compounds \u003cem\u003eA\u003c/em\u003e to \u003cem\u003eN\u003c/em\u003e and 500 nM carbenoxolone (CBX), a known potent inhibitor of 11β-HSD1. The treatment medium for both assays, including the cell lines and primary cultures, contained 333 µM NADPH and 266 nM cortisone. After 24 hours of treatment, the medium was collected, kept cold, and divided into aliquots for the cortisol determination by LC‒MS/MS using an Agilent 1200 Series HPLC unit coupled to an ABSciex 4500 QTrap mass spectrometer. Protein and total RNA were also obtained for assessments of mRNA and protein expression. RNA was extracted with 500 µL of TRIzol, while protein was extracted with 250 µL of RIPA buffer supplemented with a protease inhibitor cocktail (Roche). All the treatments were conducted in technical triplicates.\u003c/p\u003e\u003ch3\u003eb. Inhibitory potency of novel compounds in adipocyte primary cell culture (APCC)\u003c/h3\u003e\u003cp\u003ePrimary cell cultures were generated from tissue obtained from patients undergoing bariatric surgery. Samples of visceral adipose tissue containing stromal cells were obtained, cleaned, minced into small pieces (5–10 mg), rinsed twice with PBS and treated with collagenase for 1 h at 37°C (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). The cells were subsequently seeded in culture plates and differentiated into adipocytes by stimulation with a differentiation cocktail for 10 days, which contained 1% FBS-supplemented DMEM-F12, 33 µM biotin, 17 µM pantothenate, 500 mM insulin, 2 mM triiodothyronine, 10 µg/µL transferrin, 1 µM dexamethasone, 0.6 mg/ml rosiglitazone and 0.5 mM IBMX. Cell differentiation was confirmed after 10 days by observing morphological changes via optical microscopy and lipid droplet formation using Oil Red O staining. After differentiation, the cells were treated with our compounds. Adipocyte primary cell cultures (APCCs) were treated with 1 µM each of Compounds \u003cem\u003eA\u003c/em\u003e to \u003cem\u003eN\u003c/em\u003e. Methanol was used as a vehicle, and 1 µM carbenoxolone was used as a positive control for inhibition. The treatment media used in both methods contained 333 µM NADPH and 266 nM cortisone. After 24 hours of treatment, the medium was collected, kept cold, and divided into aliquots. APCCs were also lysed with 500 µL of TRIzol® for RNA extraction or 250 µL of RIPA buffer and protease inhibitor cocktail (Roche) for protein extraction. All the treatments were conducted in technical triplicates.\u003c/p\u003e\u003ch3\u003ec. IC50 values of novel compounds in SW872 cells and adipocyte primary cell cultures (APCCs)\u003c/h3\u003e\u003cp\u003eInhibitory potency of compounds \u003cem\u003eE\u003c/em\u003e, \u003cem\u003eJ, L\u003c/em\u003e and \u003cem\u003eM\u003c/em\u003e was assessed by determining the IC50 values in differentiated adipocytes, using either SW872 cells or APCCs. Concentration of the compounds ranging from 0.5 µM to 30 µM were applied in 3 mL of differentiation medium containing 333 µM NADPH and 266 nM cortisone per well. The IC50 was calculated from a four-parameter logistic curve or 4PL curve. After 24 hours, 3 mL of medium from each well was collected and chilled, while the cells were lysed with 250 mL of RIPA lysis buffer supplemented with a protease inhibitor cocktail (Roche). The aliquots of medium and cell lysate were stored at -80°C for subsequent analysis.\u003c/p\u003e\u003cp\u003e\u003cb\u003e2.4 Biopharmaceutical characterization\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ea. Determination of the partition coefficients for Compounds\u003c/b\u003e \u003cb\u003eJ\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eL\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCompounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were dissolved in n-octanol (n = 3) (5 mg/ml) and mixed with aqueous solutions buffered at pH 4.5, 6.4 and 7.4 under vigorous shaking at 37°C for 48 h, followed by 48 h of rest. Samples were collected from the aqueous and organic phases, diluted, and analyzed via µHPLC‒MS/MS. Distribution coefficients were calculated as the log of the ratio between concentrations in the organic and aqueous phases across the pH range studied (LogD); LogP was also calculated from LogD values, and the fraction of un-ionized drug was estimated from the Henderson–Hasselbach acid–base equilibrium (See details in the SUPPLEMENTARY INFORMATION).\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eProcedure for the synthesis of compounds from A to N. *C.C: Column chromatography, T.L.C: thin-layer chromatography.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCompound and\u003c/p\u003e\u003cp\u003eChem. Structure\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMixture Composition\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePurification\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eA\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-phenyl-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (497 mg, 2.83 mmol), \u003cb\u003e2\u003c/b\u003e (849 µL, 7.72 mmol), 3-phenylpropanoic acid (425 mg, 2.83 mmol), \u003cb\u003e3\u003c/b\u003e (500 mg, 2.57 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 10% ethyl acetate in n-hexane as eluent. Then, T.L.C purification using n-hexane as eluent to provide a colorless gel.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eB\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-methoxyphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (248 mg, 1.42 mmol), \u003cb\u003e2\u003c/b\u003e (424 µL, 3.87 mmol), 3- (4-methoxyphenyl) propionic acid (255 mg, 1.42 mmol), \u003cb\u003e3\u003c/b\u003e (250 mg, 1.29 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 10% ethyl acetate in n-hexane as eluent. Yielded a white solid.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eC\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-chlorophenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (497 mg, 2.83 mmol), \u003cb\u003e2\u003c/b\u003e (849 µL, 7.72 mmol), 3- (4-chlorophenyl) propionic acid (523 mg, 2.83 mmol), \u003cb\u003e3\u003c/b\u003e (500 mg, 2.57 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 10% ethyl acetate in n-hexane as eluent, followed by recrystallization from ethanol to provide a white solid.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eD\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-fluorophenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (248 mg, 1.42 mmol), \u003cb\u003e2\u003c/b\u003e (424 µL, 3.86 mmol), 3- (4-fluorophenyl) propionic acid (216 mg, 1.29 mmol), \u003cb\u003e3\u003c/b\u003e (300 mg, 1.54 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 20% ethyl acetate in n-hexane as eluent. Yielded a white solid.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eE\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-bromophenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (273 mg, 1.56 mmol), \u003cb\u003e2\u003c/b\u003e (424 µL, 3.86 mmol), 3- (4-bromophenyl) propionic acid (324 mg, 1.42 mmol), \u003cb\u003e3\u003c/b\u003e (325 mg, 1.67 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 10% ethyl acetate in n-hexane as eluent. Yielded a white solid.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-methylphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (273 mg, 1.56 mmol), \u003cb\u003e2\u003c/b\u003e (466 µL, 4.23 mmol), 3- (p-tolyl) propionic (232 mg, 1.42 mmol), \u003cb\u003e3\u003c/b\u003e (302 mg, 1.56 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 10% ethyl acetate in n-hexane as eluent, followed by recrystallization from ethanol to provide a white solid.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eG\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-hydroxyphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (237 mg, 1.56 mmol), Nmet (466 µL, 4.25 mmol), 3- (4-hydroxyphenyl) propionic (235 mg, 1.42 mmol), \u003cb\u003e3\u003c/b\u003e (302 mg, 1.56 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 20% ethyl acetate in n-hexane as eluent, yielding a pale-yellow gel.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eH\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(3-methoxypenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (268 mg, 1.53 mmol), \u003cb\u003e2\u003c/b\u003e (458 µL, 4.16 mmol), 3- (3-methoxyphenyl) propionic acid (250 mg, 1.39 mmol), \u003cb\u003e3\u003c/b\u003e (296 mg, 1.53 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 20% ethyl acetate in n-hexane as eluent, yielding a colorless gel.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eI\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-pyridyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (319 mg, 1.82 mmol), \u003cb\u003e2\u003c/b\u003e (546 µL, 4.96 mmol), 3- (4-pyridyl) propionic (250 mg, 1.65 mmol), \u003cb\u003e3\u003c/b\u003e (354 mg, 1.82 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 40% ethyl acetate in n-hexane as eluent. Then, T.L.C using n-hexane as eluent, yielding a yellow solid.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eJ\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(3-methylphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (276 mg, 1.57 mmol), \u003cb\u003e2\u003c/b\u003e (472 µL, 4.29 mmol), 3-(3-methylphenyl) propionic acid (235 mg, 1.43 mmol), \u003cb\u003e3\u003c/b\u003e (333 mg, 1.71 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 30% ethyl acetate in n-hexane as eluent. Then, T.L.C purification using n-hexane as eluent, yielding a colorless gel.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eK\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-tert-butylphenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (234 mg, 1.33 mmol), \u003cb\u003e2\u003c/b\u003e (400 µL, 3.64 mmol), 3-(4-tert-butylphenyl) propionic acid (250 mg, 1.21 mmol), \u003cb\u003e3\u003c/b\u003e (282 mg, 1.45 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 10% ethyl acetate in n-hexane as eluent, followed by recrystallization from ethanol to provide a white solid.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eL\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(3-pyridyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (226 mg, 1.29 mmol), \u003cb\u003e2\u003c/b\u003e (386 µL, 3.51 mmol), 3-(3-pyridyl) propionic acid (177 mg, 1.17 mmol), \u003cb\u003e3\u003c/b\u003e (250 mg, 1.29 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 40% ethyl acetate in n-hexane as eluent. Then, T.L.C purification using n-hexane as eluent to provide a yellow gel.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eM\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(2-pyridyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (226 mg, 1.17 mmol), \u003cb\u003e2\u003c/b\u003e (386 µL, 3.51 mmol), 3- (2- pyridyl) propionic (177 mg, 1.17 mmol), \u003cb\u003e3\u003c/b\u003e (250 mg, 1.287 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 60% ethyl acetate in n-hexane as eluent. Then, T.L.C purification using n-hexane as eluent to provide a yellow gel.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eN\u003c/b\u003e\u003c/p\u003e\u003cp\u003e1-(4-nitrophenyl)-2-(3-adamantyl-1,2,4-oxadiazol-5-yl)ethane\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e (226 mg, 1.29 mmol), \u003cb\u003e2 (\u003c/b\u003e386 µL, 3.51 mmol), 3- (4-nitrophenyl) propionic (228 mg, 1.17 mmol), \u003cb\u003e3\u003c/b\u003e (250 mg, 1.29 mmol)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eC.C using 20% ethyl acetate in n-hexane as eluent. Yielded a white solid.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003cb\u003eb. Plasma protein binding capacity of Compound\u003c/b\u003e \u003cb\u003eJ and L\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe plasma protein binding capacity of Compound \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e was determined using the commercial Transil XL PPB Binding Kit, v2 (Sovicell, Germany), in accordance with the manufacturer's guidelines. Briefly, 80 µM Compound \u003cem\u003eJ\u003c/em\u003e was incubated for 12 h at 37°C, followed by bead removal and supernatant sampling (n = 2). Afterward, the samples were centrifuged, diluted, and analyzed via LC‒MS/MS.\u003c/p\u003e\u003ch2\u003ec. Transepithelial permeability experiments\u003c/h2\u003e\u003cp\u003eMadin–Darby canine kidney (MDCK) cells stably transfected with human P-glycoprotein (hMDR1/P-gp) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), an antibiotic/antimycotic solution, nonessential amino acids (NEAA) and sodium pyruvate, as previously described (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). The cell culture medium was changed every two days, and the cells were passaged every 4 days or until 90% confluence was reached. The experiments were typically conducted between the 7th and 10th days after seeding, after which the monocellular integrity was verified using 100 µM atenolol (Papp \u0026lt; 0.5x10-6 cm/s), 10 µM minoxidil, and 100 µM ketoprofen as quality controls. MDCK-hMDR1 cells were seeded onto Transwell® inserts (1.12 cm\u003csup\u003e2\u003c/sup\u003e), and bidirectional transport experiments were conducted at 37°C and 50 rpm by adding the donor solution to the apical (A-B) or basolateral (B-A) compartment while the receiver compartment was filled with drug-free Hank’s balanced salt solution (HBSS).\u003c/p\u003e\u003cp\u003eStock solutions containing either Compound \u003cem\u003eJ\u003c/em\u003e or Compound \u003cem\u003eL\u003c/em\u003e in DMSO were dissolved in HBSS supplemented with 10 mM HEPES at pH 6.8 to a compound concentration of 3 µM, maintaining DMSO \u0026lt; 1% (donor solution). After 120 min of incubation, samples were collected from the donor and receiver compartments, diluted, and measured via µHPLC-MS/MS (see below). The permeability (P\u003csub\u003eapp\u003c/sub\u003e) of our compounds can be obtained from mass transport analysis as follows:\u003c/p\u003e\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:\\frac{dMr}{dt*A}=j={C}_{d}\\times\\:{P}_{app}$$\u003c/div\u003e\u003c/div\u003e\u003cp\u003ewhere the variable j, in this context, is the flux (nmol/cm\u003csup\u003e2\u003c/sup\u003e*s), representing the mass of our compounds (dMr) that diffused through surface A (cm\u003csup\u003e2\u003c/sup\u003e) over the time interval dt (s). P\u003csub\u003eapp\u003c/sub\u003e (cm/s) is then defined as the proportionality coefficient between j and the concentration in the donor compartment Cd (µM). The efflux ratio (ER) was calculated as the ratio of basolateral-to-apical (P\u003csub\u003eapp,B−A\u003c/sub\u003e) permeability to apical-to-basolateral permeability (P\u003csub\u003eapp,A−B\u003c/sub\u003e), where values greater than 2 can be interpreted as a relevant effect of the P-gp mediated–mediated efflux contribution to the transepithelial mass transport of our compound.\u003c/p\u003e\u003cp\u003eThe quenching solution was added to each sample at the proper time to stop the reaction. The resulting samples were centrifuged at 3220 RCF for 20 min, and the compounds in the supernatant were quantified by LC‒MS/MS. Stability is reported as microsomal clearance, defined as the rate of compound disappearance over time.\u003c/p\u003e\u003cp\u003e\u003cb\u003e2.5 ANALYTICAL METHODS\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ea. Tandem µHPLC‒MS/MS\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTandem µHPLC-MS/MS (Triple Quad 4500, AB Sciex Instruments) methods for determining Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e were developed by optimizing the ionization parameters through a direct infusion of 1 µg/mL solutions in a 50:50 acetonitrile (ACN)/water mixture. The mass spectrometer was operated in multiple reaction monitoring (MRM) positive ion mode using specific transitions for quantification, including those for minoxidil and atenolol as markers. The chromatographic analysis was conducted using Ekspert ultraLC 100-XL equipment (Eksigent Technologies) with a C18 column, an injection volume of 10 µL, and a flow rate of 0.5 mL/min. The mobile phase consisted of water with 10 mM ammonium formate (pH 5.0) and acetonitrile (ACN). The elution gradients for each compound are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The methods underwent partial validation, assessing specificity, range, linearity, precision, and accuracy. Standard solutions of Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e were prepared at concentrations ranging from 0.1 to 1000 ppb and evaluated in triplicate, with and without minoxidil and atenolol markers. The methods exhibited specificity for each compound, a linear range of at least 3 orders of magnitude, coefficients of determination (R\u003csup\u003e2\u003c/sup\u003e) of at least 0.984, coefficients of variation below 1.6%, and accuracies exceeding 93%. (See details in the SUPPLEMENTARY INFORMATION).\u003c/p\u003e\u003ch3\u003eb. Quantitative real-time PCR\u003c/h3\u003e\u003cp\u003eTotal RNA was extracted from the SW872 cell line and an adipocyte primary cell culture (APCC) with TRIzol reagent (Invitrogen, San Diego, CA). The expression of the 11β-HSD1 and 11β-HSD2 mRNAs was quantified by real-time polymerase chain reaction (qRT‒PCR) on a RotorGene-6000 instrument (Corbett Research, Sydney, Australia) using fluorescent SYBR Green technology (K0222, Thermo Scientific). The primers used were 11β-HSD1 (forward: CAGGAAAGCTCATGGGAGGAC, reverse: GCCAGAGAGGAGACGACAA) and 11β-HSD2 (forward: ACATTAGCCGCGTGCTAGAGTTCA, reverse: ATTCACCTCCATGCAGCTACGGAA). The annealing temperature was set at 60°C. The results are presented as relative units (RU) with respect to the 18S housekeeping gene.\u003c/p\u003e\u003ch2\u003ec. Western blot analysis of the 11β-HSD1 protein\u003c/h2\u003e\u003cp\u003eProtein lysates from adipocyte primary cell cultures (APCCs) were separated on SDS–PAGE gels (Bio-Rad Laboratories), transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories) and blocked with 5% skim milk in phosphate-buffered saline containing 0.1% Tween-20 (PBST). After blocking, the membranes were blotted with the 11β-HSD1 polyclonal primary antibody (anti-11b-HSD1 antibody, 1:2000, PA5-21586 rabbit, Invitrogen, USA) and a secondary antibody, anti-IgG-HRP (Cell Signaling, anti-rabbit-HRP 7074, USA). The level of 11β-HSD1 in adipocytes challenged with vehicle or Compound \u003cem\u003eJ\u003c/em\u003e was detected using enhanced chemiluminescence (ECL Western blotting substrate reagent, Pierce, USA).\u003c/p\u003e\u003ch2\u003ed. Data analysis\u003c/h2\u003e\u003cp\u003eData are presented as the means with the SDs of the means for continuous variables and percentages for categorical variables. Normality was assessed using the Kolmogorov–Smirnov test. In situations where a variable was not normally distributed, comparisons were performed using the Mann‒Whitney or Kruskal‒Wallis test. Nonnormally distributed variables are reported as medians and interquartile ranges ([Q1–Q3]). A p value of 0.05 was considered statistically significant. Analyses were performed using SPSS 20 and GraphPad Prism v9.0 software.\u003c/p\u003e"},{"header":"3. RESULTS","content":"\u003cp\u003e\u003cb\u003e3.1 Design and synthesis of adamantyloxadiazole as a novel 11β-HSD1 inhibitor\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA solution of 2-chloro-4,6-dimethoxy-1,3,5-triazine in 1,4-dioxane (10 mL) was prepared, referred to in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e as Compound \u003cb\u003e1\u003c/b\u003e, to synthesize and characterize each novel compound from \u003cem\u003eA\u003c/em\u003e to \u003cem\u003eN\u003c/em\u003e. N-Methylmorpholine, referred to in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e as Compound \u003cb\u003e2\u003c/b\u003e, was added dropwise and stirred for 5 minutes at RT. A solution of the needed type of propionic acid in 1,4-dioxane (5 mL) was subsequently added, and the mixture was stirred for 30 minutes at RT. A solution of the precursor adamantylamidoxime compound, referred to in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e as Compound \u003cb\u003e3\u003c/b\u003e, in 1,4-dioxane (5 mL) was subsequently added. The resulting mixture was vigorously stirred under reflux for 3 h. The progress of the reaction was monitored by thin layer chromatography (TLC). After 3 h, the mixture was cooled to RT, and a 5% sodium carbonate solution was added. The product was extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate, and the solvent was removed under vacuum. The type of propionic acid needed, along with its concentration, volume, and purification process for each compound, is detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.2\u003c/b\u003e \u003cb\u003eIN VITRO\u003c/b\u003e \u003cb\u003eCELL-FREE ASSAYS\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ea. Determination of 11β-HSD1 reductase activity by calculating the IC50 and remaining oxidase activity of the 11β-HSD1 and 11β-HSD2 enzymes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe inhibitory concentrations (IC50) of the adamantyloxadiazole-derived compounds were detected in the nanomolar (nM) range (1.1 nM to 147 nM) and are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. We also determined the remaining oxidase activity of the enzyme 11β-HSD1 using 100 nM of each compound and obtained values ranging from 83 to 110% for the remaining oxidase activity. Similarly, the remaining oxidase activity of the enzyme 11β-HSD2 observed when 100 nM of each compound was added ranged from 40 to 114% (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Only Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e had lower IC50 values (11.8 and 3.9 nM, respectively), and the remaining 11β-HSD oxidase activities were nearly 100% (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eInhibitory activity of the compounds derived from adamantyloxadiazoles against the oxidase activity of the 11β-HSD1 enzyme and its selectivity with respect to isoforms 11β-HSD1 and 11β-HSD2.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCompound\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e11β-HSD1reductase IC50 (nM)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e11β-HSD1oxidase\u003c/p\u003e\u003cp\u003e100 nM (% remanent activity)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e11β-HSD2 oxidase\u003c/p\u003e\u003cp\u003e100 nM (% remanent activity)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eM\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1,1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e97%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e70%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eG\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1,1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e110%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e58%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eL\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e3,9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e107%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e114%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eC\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9,2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e107%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e59%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eE\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9,9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e91%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e80%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eJ\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e11,8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e92%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e98%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eN\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e105%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e62%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eB\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e95,4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e104%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e60%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eI\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e97\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e89%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e59%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e102\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e88%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e62%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eK\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e102\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e86%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e50%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e102\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e110%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e40%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eD\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e104\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e109%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e69%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eA\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e147\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e86%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e55%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003cb\u003e3.3\u003c/b\u003e \u003cb\u003eIN VITRO\u003c/b\u003e \u003cb\u003eASSAYS IN CELLS\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ea. 11β-HSD1 and 11β-HSD2 gene expression in SW872 cells and primary adipocytes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe confirmed the expression of the 11β-HSD1 and 11β-HSD2 mRNAs in the adipocyte SW872 cell line and in adipocyte primary cell cultures (APCCs). We observed a trend toward higher 11β-HSD1 expression in differentiated adipocytes than in preadipocytes (8.9 vs. 1.0 RU; p = 0.4) in SW872 cells, and a higher 11β-HSD1 expression was observed for differentiated adipocytes compared with preadipocytes in APCCs (11.3 vs. 0.6 RU; p \u0026lt; 0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Similarly, 11β-HSD2 expression showed a similar pattern in adipocytes and preadipocytes derived from SW872 cells (4.2 vs. 1.2 RU; p = 0.2) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) and very low and almost undetectable (ND) in adipocytes and preadipocytes in APCCs (0.2 vs. 0.02 RU; p NS), respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003eIn APCCs, the immunowesternblot confirmed the presence of 11β-HSD1 (35 kDa) in differentiated adipocytes challenged with either vehicle or Compound \u003cem\u003eJ\u003c/em\u003e for 24 hrs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\u003ch2\u003eb. Inhibitory potency and IC50 values of novel compounds in SW872 adipocytes\u003c/h2\u003e\u003cp\u003eSince compounds \u003cem\u003eE, J, L, M\u003c/em\u003e, and \u003cem\u003eN\u003c/em\u003e exhibited the highest potency and 11β-HSD1/11β-HSD2 oxidase activity (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), we decided to continue further cell assays with these compounds. In SW872 cells, the cortisol concentration was measured via HPLC‒MS/MS after 24 hours of treatment with 500 nM of \u003cem\u003eE, J, L, M\u003c/em\u003e, and \u003cem\u003eN\u003c/em\u003e compounds, or 500 nM carbenoxolone (a known inhibitor of 11β-HSD1). We observed a reduction in cortisol synthesis in SW872 cells compared with cells treated with the vehicle (~ 10–30%) and 500 nM carbenoxolone (~ 45%). In SW872 cells, Compounds \u003cem\u003eJ\u003c/em\u003e (~ 10%), \u003cem\u003eL\u003c/em\u003e (~ 22%), \u003cem\u003eE\u003c/em\u003e (~ 14%), \u003cem\u003eM\u003c/em\u003e (~ 29%), and \u003cem\u003eN\u003c/em\u003e (~ 19%) inhibited 11β-HSD1 reductase activity (See details in the SUPPLEMENTARY INFORMATION). Additionally, we calculated the IC50 of 8.4 µM for Compound \u003cem\u003eJ\u003c/em\u003e in SW872 cells.\u003c/p\u003e\u003ch2\u003ec. Inhibitory potency and IC50 values of novel compounds in adipocyte primary cell culture (APCC)\u003c/h2\u003e\u003cp\u003eIn the adipocyte primary cell culture, after treatment with 1 µM of each compound for 24 hours, the cortisol concentrations in the culture medium of adipocytes revealed that our compounds significantly reduced the cortisol levels (~ 50%) in the APCCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). All the compounds had similar inhibitory effects on 11β-HSD1 reductase activity in APCCs: Compounds J (~ 52%), \u003cem\u003eE\u003c/em\u003e (~ 58%), \u003cem\u003eM\u003c/em\u003e (~ 54%), and \u003cem\u003eL\u003c/em\u003e (~ 53%). Carbenoxolone consistently had the greatest inhibitory effect (~ 90% at 1 µM and ~ 99% at 30 µM). The IC50 value calculated for Compound \u003cem\u003eJ\u003c/em\u003e in APCCs was 2.1 µM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.4 Biopharmaceutical characterization\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ea.\u003c/b\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003echaracterization of the metabolism, distribution parameters and plasma protein binding capacity\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePlasma protein binding and microsomal metabolism were characterized \u003cem\u003ein vitro\u003c/em\u003e for both Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). While 89.3% of the former compound bound to plasma proteins, 49.4% of the latter compound bound to plasma proteins. These values are consistent with the LogD values reported in this study and with the alkaline nature of Compound \u003cem\u003eL\u003c/em\u003e. Additionally, the stability of these compounds in mouse and human liver microsomes was measured (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), and they were more stable in human microsomes than in mouse microsomes.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePhysicochemical and biochemical characterization of our novel compounds.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eProperty\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCompound \u003cem\u003eJ\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCompound \u003cem\u003eL\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eUnits\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLogD\u003csub\u003epH 4.5\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5.18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3.44\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLogD\u003csub\u003epH 6.4\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3.72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLogD\u003csub\u003epH 7.4\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3.99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePlasma protein binding\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e89.3 ± 0.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e49.4 ± 26.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emicrosomal intrinsic Cl (human)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e83\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e203\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eµL/min/mg\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emicrosomal intrinsic Cl (mouse)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u0026gt; 71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e422\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eµL/min/mg\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003cb\u003eb.\u003c/b\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003etransepithelial permeability\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe apparent permeability values for Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e, which ranged from 0.5-1.4x10\u003csup\u003e− 5\u003c/sup\u003e cm/s, are shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. These values were greater than the Papp of the high-permeability marker (1–5x10\u003csup\u003e− 6\u003c/sup\u003e cm/s) and comparable to those of the complete absorption marker ketoprofen (P\u003csub\u003eapp\u003c/sub\u003e \u0026gt;5x10\u003csup\u003e− 6\u003c/sup\u003e cm/s). The Efflux Ratio (ER) values were 0.4 and 1.5 for Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e, respectively.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eTransepithelial permeability of novel compounds across MDCK-hMDR1 cells (n = 3).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eP\u003csub\u003eapp,A−B\u003c/sub\u003e [cm/s]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eP\u003csub\u003eapp,B−A\u003c/sub\u003e [cm/s]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEfflux Ratio\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCompound\u003c/b\u003e \u003cb\u003eJ\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5.4 x10\u003csup\u003e− 6\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1.9 x10\u003csup\u003e− 6\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.4\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCompound\u003c/b\u003e \u003cb\u003eL\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1.2 x10\u003csup\u003e− 5\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1.8 x10\u003csup\u003e− 5\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1.5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2 name=\"removable\"\u003ec. Inhibitory potency and IC50 values of novel compounds in adipocyte primary cell culture (APCC)\u003c/h2\u003e\u003cp name=\"removable\"\u003eIn the adipocyte primary cell culture, after treatment with 1 µM of each compound for 24 hours, the cortisol concentrations in the culture medium of adipocytes revealed that our compounds significantly reduced the cortisol levels (~ 50%) in the APCCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). All the compounds had similar inhibitory effects on 11β-HSD1 reductase activity in APCCs: Compounds J (~ 52%), \u003cem\u003eE\u003c/em\u003e (~ 58%), \u003cem\u003eM\u003c/em\u003e (~ 54%), and \u003cem\u003eL\u003c/em\u003e (~ 53%). Carbenoxolone consistently had the greatest inhibitory effect (~ 90% at 1 µM and ~ 99% at 30 µM). The IC50 value calculated for Compound \u003cem\u003eJ\u003c/em\u003e in APCCs was 2.1 µM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp name=\"removable\"\u003e\u003cb\u003e3.4 Biopharmaceutical characterization\u003c/b\u003e\u003c/p\u003e\u003cp name=\"removable\"\u003e\u003cb\u003ea.\u003c/b\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003echaracterization of the metabolism, distribution parameters and plasma protein binding capacity\u003c/b\u003e\u003c/p\u003e\u003cp name=\"removable\"\u003ePlasma protein binding and microsomal metabolism were characterized \u003cem\u003ein vitro\u003c/em\u003e for both Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). While 89.3% of the former compound bound to plasma proteins, 49.4% of the latter compound bound to plasma proteins. These values are consistent with the LogD values reported in this study and with the alkaline nature of Compound \u003cem\u003eL\u003c/em\u003e. Additionally, the stability of these compounds in mouse and human liver microsomes was measured (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), and they were more stable in human microsomes than in mouse microsomes.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\" name=\"removable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePhysicochemical and biochemical characterization of our novel compounds.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eProperty\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCompound \u003cem\u003eJ\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCompound \u003cem\u003eL\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eUnits\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLogD\u003csub\u003epH 4.5\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5.18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3.44\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLogD\u003csub\u003epH 6.4\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3.72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLogD\u003csub\u003epH 7.4\u003c/sub\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3.99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePlasma protein binding\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e89.3 ± 0.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e49.4 ± 26.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emicrosomal intrinsic Cl (human)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e83\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e203\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eµL/min/mg\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emicrosomal intrinsic Cl (mouse)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u0026gt; 71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e422\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eµL/min/mg\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp name=\"removable\"\u003e\u003cb\u003eb.\u003c/b\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003etransepithelial permeability\u003c/b\u003e\u003c/p\u003e\u003cp name=\"removable\"\u003eThe apparent permeability values for Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e, which ranged from 0.5-1.4x10\u003csup\u003e− 5\u003c/sup\u003e cm/s, are shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. These values were greater than the Papp of the high-permeability marker (1–5x10\u003csup\u003e− 6\u003c/sup\u003e cm/s) and comparable to those of the complete absorption marker ketoprofen (P\u003csub\u003eapp\u003c/sub\u003e \u0026gt;5x10\u003csup\u003e− 6\u003c/sup\u003e cm/s). The Efflux Ratio (ER) values were 0.4 and 1.5 for Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e, respectively.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\" name=\"removable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eTransepithelial permeability of novel compounds across MDCK-hMDR1 cells (n = 3).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eP\u003csub\u003eapp,A−B\u003c/sub\u003e [cm/s]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eP\u003csub\u003eapp,B−A\u003c/sub\u003e [cm/s]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEfflux Ratio\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCompound\u003c/b\u003e \u003cb\u003eJ\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5.4 x10\u003csup\u003e− 6\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1.9 x10\u003csup\u003e− 6\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.4\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCompound\u003c/b\u003e \u003cb\u003eL\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1.2 x10\u003csup\u003e− 5\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1.8 x10\u003csup\u003e− 5\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1.5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e4. Discussion\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe current study achieved the standardization of a family of adamantylamidoxime derivatives, adamantyloxadiazoles, with the aim of obtaining compounds with significant inhibitory potency against the human 11β-HSD1 enzyme at the nanomolar level. Our study presents a series of adamantyloxadiazole compounds that exhibit high selectivity and specificity for the reductase activity of the enzyme 11β-HSD1 over its isoform 11β-HSD2, highlighting Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe synthesis of 1-adamantylamidoxime (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e) provides the foundational structure for the development of adamantyloxadiazole derivatives. Key modifications include the introduction of various substituents on the phenyl ring, such as methoxy, chloro, fluoro, bromo, and pyridyl groups, as well as adjustments in the linker length and flexibility. These modifications improve the binding affinity and selectivity, favoring the reductase activity of 11β-HSD1 while minimizing interactions with its oxidase activity and 11β-HSD2.\u003c/p\u003e\u003cp\u003eThe adamantyl structure provides rigidity and bulkiness, contributing to binding affinity, whereas the specific substituents enhance isoform specificity by preventing binding to the narrower active site of 11β-HSD2 (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). The selective inhibition of 11β-HSD1 reductase activity is achieved through precise molecular design (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e), allowing the compounds to fit snugly into the reductase active site without affecting the oxidase site, as confirmed by the high FRET signal in oxidase activity assays shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. In this respect, Chuanxin et al in 2020 (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) emphasized the structural importance of the amino acid residues Tyr183 and Ser170 in the binding site of 11β-HSD1, which are critical for enzyme specificity and activity. They demonstrated that compounds such as KR-66344 achieve high selectivity for 11β-HSD1 by forming hydrogen bonds with these residues, resulting in potent inhibition with minimal effects on 11β-HSD2 (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Similarly, our adamantyloxadiazoles likely interact with these key residues, ensuring high specificity and efficacy against 11β-HSD1 reductase activity without significantly affecting the oxidase activity of either isoform. Scott et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) discussed the discovery of a selective inhibitor, AZD4017, and highlighted the importance of designing molecules that are selective for 11β-HSD1 over 11β-HSD2 to avoid complications such as hypertension associated with 11β-HSD2 isoform inhibition (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOur adamantyloxadiazoles share some structural features with AZD4017. Both classes of inhibitors exhibit specific interactions within the active site of 11β-HSD1 that confer high selectivity. For example, the hydrogen bonds and hydrophobic interactions crucial for AZD4017 binding are mirrored in our adamantyloxadiazoles, which likely explains their selective inhibition. The selectivity of our adamantyloxadiazoles may be attributed to their unique structures, allowing them to fit precisely into the reductase active site of 11β-HSD1 while avoiding the oxidase active site and 11β-HSD2. This structural design strategy underscores the importance of detailed molecular modifications in the development of selective enzyme inhibitors, as demonstrated by both our compounds and those reported in the literature (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe compounds chosen as comparative elements were extracted from an extensive review of 11β-HSD1 inhibitors (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e) with similar methodologies employed in our studies, including detailed protocols for enzyme inhibition, selectivity assays, and cell culture models, which align well with those used in the reviewed studies. This alignment validates our approach, reinforces the reliability of our findings and provides insights into the efficacy, selectivity, and potential therapeutic benefits of our compounds.\u003c/p\u003e\u003cp\u003eOur studies, which employed enzyme activity assays and cell culture models, revealed that Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e demonstrated superior inhibitory potency and selectivity for 11β-HSD1. Specifically, Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e presented IC50 values of 11.8 nM and 3.9 nM, indicating strong inhibition of 11β-HSD1 at low concentrations (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In comparison, AZD4017 has been reported to have an IC50 value of 7 nM (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), demonstrating potent inhibition similar to Compound \u003cem\u003eL\u003c/em\u003e. The hydrogen bonds and hydrophobic interactions crucial for the binding of AZD4017 are mirrored in our adamantyloxadiazoles, potentially explaining their selective inhibition. Our analysis revealed a remaining 11β-HSD1oxidase enzyme activities of 92.1% for Compound \u003cem\u003eJ\u003c/em\u003e and 107% for Compound \u003cem\u003eL\u003c/em\u003e at 100 nM, highlighting their specificity for the reductase activity of 11β-HSD1 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Comparison of Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e with UI-1499, which was evaluated using enzyme inhibition assays and cell culture studies, exhibited better selectivity and specificity. UI-1499 has an IC50 value of 1.3 nM (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), which is comparable to that of Compound \u003cem\u003eL\u003c/em\u003e. Likewise, the inhibitory effects of SKI2852 revealed an IC50 of 4.4 nM for 11β-HSD1 (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), which is in the range of inhibitory efficacy of our compounds (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The impact on cortisol levels was consistently effective, especially in APCC, indicating their potential as superior inhibitors, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eThe translation from biologically active compounds \u003cem\u003ein vitro\u003c/em\u003e to promising drug candidates demands not only high affinities for the desired target protein but also adequate features that ensure that the drug will reach the site of action. Therefore, the promising candidates, Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e, were characterized for their biopharmaceutical properties to assess whether these compounds have the potential to reach later stages of drug development. Both Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e were distributed in n-octanol at levels approximately 10\u003csup\u003e4\u003c/sup\u003e times greater than in the aqueous phase, regardless of the pH value (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). A certain degree of lipophilicity (LogP \u0026gt; 2) is desired for molecular partitioning at the epithelial membrane, which is the first step in the intestinal absorption of the drug. However, when LogP values are greater than 5, the high affinity for membrane phospholipids may prevail over passive diffusion, thus hindering the absorption process (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Although some partition values reported here are closer to the upper limit, \u003cem\u003ein vitro\u003c/em\u003e transepithelial permeability studies confirmed that both candidates may be highly absorbed in the intestine after oral administration. Moreover, the efflux ratio suggested a negligible contribution of the efflux pump Pgp (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This observation further supports the eventual favorable oral absorption of our novel compounds, as hMDR1 is one of the most abundant transporters throughout the gastrointestinal tract (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eNonetheless, the elevated LogD and LogP values reported here suggest that even larger quantities of our novel compounds should be distributed into fat tissue when our novel compounds are administered \u003cem\u003ein vivo\u003c/em\u003e. Considering the favorable expression of 11β-HSD1 in visceral fat, our findings suggest that high concentrations can be reached in the target tissue.\u003c/p\u003e\u003cp\u003eOur novel compounds were also evaluated in two human adipose cell lines, a human liposarcoma-derived SW cell line and an adipocyte primary cell culture (APCC) from VAT explants. In SW872 cells, at a concentration of 500 nM, our novel compounds slightly inhibited (10–30%) 11β-HSD1 activity but were comparable to 500 nM carbenoxolone (CBX) to some extent. Compared with 1 µM CBX, 1 µM doses of our compounds inhibited 11β-HSD1 activity by nearly 50%. Preliminary assays of the IC50 for Compound \u003cem\u003eJ\u003c/em\u003e indicated an IC50 of 2.1 µM in APCCs, which is similar to that of other previous preclinical inhibitors under similar conditions (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Despite the promising results, a few limitations of the study must be considered. A discrepancy in IC₅₀ values was observed between the cell-free recombinant enzyme assays and cellular models. For example, the IC₅₀ for compound J increased from 11.8 nM in cell-free assays to 8.4 µM and 2.1 µM in SW872 cells and adipocyte primary cell cultures, respectively. This highlights that factors such as compound permeability, metabolism, and the overall cellular environment can significantly influence efficacy. Another limitation was the use of liver microsomes to assess 11β-HSD2 activity, as this enzyme is not naturally expressed in the liver.\u003c/p\u003e\u003cp\u003eIn conclusion, we designed, synthesized and performed a preclinical evaluation of a novel family of adamantyloxadiazole-derived compounds that have inhibitory effects on the human 11β-HSD1 enzyme. We highlight the success of Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e, which showed relevant biopharmaceutical performance, in both cell-free assays and cell assays, and support further \u003cem\u003ein vivo\u003c/em\u003e studies in animals to evaluate their toxic effects, safety profiles, pharmacokinetics, distributions and efficacy.\u003c/p\u003e\u003c/div\u003e\u003cp\u003eThe current study achieved the standardization of a family of adamantylamidoxime derivatives, adamantyloxadiazoles, with the aim of obtaining compounds with significant inhibitory potency against the human 11β-HSD1 enzyme at the nanomolar level. Our study presents a series of adamantyloxadiazole compounds that exhibit high selectivity and specificity for the reductase activity of the enzyme 11β-HSD1 over its isoform 11β-HSD2, highlighting Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe synthesis of 1-adamantylamidoxime (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e) provides the foundational structure for the development of adamantyloxadiazole derivatives. Key modifications include the introduction of various substituents on the phenyl ring, such as methoxy, chloro, fluoro, bromo, and pyridyl groups, as well as adjustments in the linker length and flexibility. These modifications improve the binding affinity and selectivity, favoring the reductase activity of 11β-HSD1 while minimizing interactions with its oxidase activity and 11β-HSD2.\u003c/p\u003e\u003cp\u003eThe adamantyl structure provides rigidity and bulkiness, contributing to binding affinity, whereas the specific substituents enhance isoform specificity by preventing binding to the narrower active site of 11β-HSD2 (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). The selective inhibition of 11β-HSD1 reductase activity is achieved through precise molecular design (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e), allowing the compounds to fit snugly into the reductase active site without affecting the oxidase site, as confirmed by the high FRET signal in oxidase activity assays shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. In this respect, Chuanxin et al in 2020 (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) emphasized the structural importance of the amino acid residues Tyr183 and Ser170 in the binding site of 11β-HSD1, which are critical for enzyme specificity and activity. They demonstrated that compounds such as KR-66344 achieve high selectivity for 11β-HSD1 by forming hydrogen bonds with these residues, resulting in potent inhibition with minimal effects on 11β-HSD2 (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Similarly, our adamantyloxadiazoles likely interact with these key residues, ensuring high specificity and efficacy against 11β-HSD1 reductase activity without significantly affecting the oxidase activity of either isoform. Scott et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) discussed the discovery of a selective inhibitor, AZD4017, and highlighted the importance of designing molecules that are selective for 11β-HSD1 over 11β-HSD2 to avoid complications such as hypertension associated with 11β-HSD2 isoform inhibition (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOur adamantyloxadiazoles share some structural features with AZD4017. Both classes of inhibitors exhibit specific interactions within the active site of 11β-HSD1 that confer high selectivity. For example, the hydrogen bonds and hydrophobic interactions crucial for AZD4017 binding are mirrored in our adamantyloxadiazoles, which likely explains their selective inhibition. The selectivity of our adamantyloxadiazoles may be attributed to their unique structures, allowing them to fit precisely into the reductase active site of 11β-HSD1 while avoiding the oxidase active site and 11β-HSD2. This structural design strategy underscores the importance of detailed molecular modifications in the development of selective enzyme inhibitors, as demonstrated by both our compounds and those reported in the literature (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe compounds chosen as comparative elements were extracted from an extensive review of 11β-HSD1 inhibitors (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e) with similar methodologies employed in our studies, including detailed protocols for enzyme inhibition, selectivity assays, and cell culture models, which align well with those used in the reviewed studies. This alignment validates our approach, reinforces the reliability of our findings and provides insights into the efficacy, selectivity, and potential therapeutic benefits of our compounds.\u003c/p\u003e\u003cp\u003eOur studies, which employed enzyme activity assays and cell culture models, revealed that Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e demonstrated superior inhibitory potency and selectivity for 11β-HSD1. Specifically, Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e presented IC50 values of 11.8 nM and 3.9 nM, indicating strong inhibition of 11β-HSD1 at low concentrations (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In comparison, AZD4017 has been reported to have an IC50 value of 7 nM (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), demonstrating potent inhibition similar to Compound \u003cem\u003eL\u003c/em\u003e. The hydrogen bonds and hydrophobic interactions crucial for the binding of AZD4017 are mirrored in our adamantyloxadiazoles, potentially explaining their selective inhibition. Our analysis revealed a remaining 11β-HSD1oxidase enzyme activities of 92.1% for Compound \u003cem\u003eJ\u003c/em\u003e and 107% for Compound \u003cem\u003eL\u003c/em\u003e at 100 nM, highlighting their specificity for the reductase activity of 11β-HSD1 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Comparison of Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e with UI-1499, which was evaluated using enzyme inhibition assays and cell culture studies, exhibited better selectivity and specificity. UI-1499 has an IC50 value of 1.3 nM (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), which is comparable to that of Compound \u003cem\u003eL\u003c/em\u003e. Likewise, the inhibitory effects of SKI2852 revealed an IC50 of 4.4 nM for 11β-HSD1 (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), which is in the range of inhibitory efficacy of our compounds (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The impact on cortisol levels was consistently effective, especially in APCC, indicating their potential as superior inhibitors, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eThe translation from biologically active compounds \u003cem\u003ein vitro\u003c/em\u003e to promising drug candidates demands not only high affinities for the desired target protein but also adequate features that ensure that the drug will reach the site of action. Therefore, the promising candidates, Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e, were characterized for their biopharmaceutical properties to assess whether these compounds have the potential to reach later stages of drug development. Both Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e were distributed in n-octanol at levels approximately 10\u003csup\u003e4\u003c/sup\u003e times greater than in the aqueous phase, regardless of the pH value (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). A certain degree of lipophilicity (LogP \u0026gt; 2) is desired for molecular partitioning at the epithelial membrane, which is the first step in the intestinal absorption of the drug. However, when LogP values are greater than 5, the high affinity for membrane phospholipids may prevail over passive diffusion, thus hindering the absorption process (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Although some partition values reported here are closer to the upper limit, \u003cem\u003ein vitro\u003c/em\u003e transepithelial permeability studies confirmed that both candidates may be highly absorbed in the intestine after oral administration. Moreover, the efflux ratio suggested a negligible contribution of the efflux pump Pgp (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This observation further supports the eventual favorable oral absorption of our novel compounds, as hMDR1 is one of the most abundant transporters throughout the gastrointestinal tract (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eNonetheless, the elevated LogD and LogP values reported here suggest that even larger quantities of our novel compounds should be distributed into fat tissue when our novel compounds are administered \u003cem\u003ein vivo\u003c/em\u003e. Considering the favorable expression of 11β-HSD1 in visceral fat, our findings suggest that high concentrations can be reached in the target tissue.\u003c/p\u003e\u003cp\u003eOur novel compounds were also evaluated in two human adipose cell lines, a human liposarcoma-derived SW cell line and an adipocyte primary cell culture (APCC) from VAT explants. In SW872 cells, at a concentration of 500 nM, our novel compounds slightly inhibited (10–30%) 11β-HSD1 activity but were comparable to 500 nM carbenoxolone (CBX) to some extent. Compared with 1 µM CBX, 1 µM doses of our compounds inhibited 11β-HSD1 activity by nearly 50%. Preliminary assays of the IC50 for Compound \u003cem\u003eJ\u003c/em\u003e indicated an IC50 of 2.1 µM in APCCs, which is similar to that of other previous preclinical inhibitors under similar conditions (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Despite the promising results, a few limitations of the study must be considered. A discrepancy in IC₅₀ values was observed between the cell-free recombinant enzyme assays and cellular models. For example, the IC₅₀ for compound J increased from 11.8 nM in cell-free assays to 8.4 µM and 2.1 µM in SW872 cells and adipocyte primary cell cultures, respectively. This highlights that factors such as compound permeability, metabolism, and the overall cellular environment can significantly influence efficacy. Another limitation was the use of liver microsomes to assess 11β-HSD2 activity, as this enzyme is not naturally expressed in the liver.\u003c/p\u003e\u003cp\u003eIn conclusion, we designed, synthesized and performed a preclinical evaluation of a novel family of adamantyloxadiazole-derived compounds that have inhibitory effects on the human 11β-HSD1 enzyme. We highlight the success of Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e, which showed relevant biopharmaceutical performance, in both cell-free assays and cell assays, and support further \u003cem\u003ein vivo\u003c/em\u003e studies in animals to evaluate their toxic effects, safety profiles, pharmacokinetics, distributions and efficacy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment.\u003c/strong\u003e We appreciate the valuable help provided by the Corbio-Q team during this research, such as help with writing and proof reading.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICAL STATEMENT:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003eThis study did not involve human participants, animal subjects, or any personal data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eThis study does not contain any individual person's data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e: The authors have no relevant financial or non-financial interests to disclose. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This work was partially supported by grants from ANID-FONDECYT 1212006 and 11251675, ICM-ANID ICN2021_045, ANID-FONDEQUIP (EQM150023), SOCHED 2024-06, CETREN-UC and Thani Biotechnologies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e All authors contributed to the conception and design of the study. Material preparation and data collection were carried out by Gonzalo Recabarren, Benjamín Diethelm, Eduardo Riquelme, Mauricio A. García, and Fidel A. Allende. Data analysis was performed by Cristian A. Carvajal, Alejandra Tapia-Castillo, Pablo González, Andrea Vecchiola, Sandra Solari, René Baudrand, and Jorge A. Pérez. The first draft of the manuscript was written by Pablo González, Cristian A. Carvajal, and Alejandra Tapia-Castillo, and all authors provided comments on previous versions of the manuscript. All authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment.\u003c/strong\u003e We appreciate the valuable help provided by the Corbio-Q team during this research, such as help with writing and proof reading.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eData Availability Statement:\u0026nbsp;\u003c/strong\u003eThe datasets generated and/or analyzed during the current study are not publicly available due to commercial interests and the existence of an granted patent but are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKadmiel M, Cidlowski JA. Glucocorticoid receptor signaling in health and disease. \u003cem\u003eTrends Pharmacol Sci\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2013;34(9):518-530.\u003c/li\u003e\n\u003cli\u003eYuan X, Li H, Bai H, Su Z, Xiang Q, Wang C, Zhao B, Zhang Y, Zhang Q, Chu Y, Huang Y. Synthesis of novel curcumin analogues for inhibition of 11beta-hydroxysteroid dehydrogenase type 1 with anti-diabetic properties. \u003cem\u003eEur J Med Chem\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2014;77:223-230.\u003c/li\u003e\n\u003cli\u003eGathercole LL, Lavery GG, Morgan SA, Cooper MS, Sinclair AJ, Tomlinson JW, Stewart PM. 11beta-Hydroxysteroid dehydrogenase 1: translational and therapeutic aspects. \u003cem\u003eEndocrine reviews\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2013;34(4):525-555.\u003c/li\u003e\n\u003cli\u003eTomlinson JW, Walker EA, Bujalska IJ, Draper N, Lavery GG, Cooper MS, Hewison M, Stewart PM. 11beta-hydroxysteroid dehydrogenase type 1: a tissue-specific regulator of glucocorticoid response. \u003cem\u003eEndocrine reviews\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2004;25(5):831-866.\u003c/li\u003e\n\u003cli\u003eWalker BR. Cortisol--cause and cure for metabolic syndrome? \u003cem\u003eDiabet Med\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2006;23(12):1281-1288.\u003c/li\u003e\n\u003cli\u003eTomlinson JW, Finney J, Gay C, Hughes BA, Hughes SV, Stewart PM. Impaired glucose tolerance and insulin resistance are associated with increased adipose 11beta-hydroxysteroid dehydrogenase type 1 expression and elevated hepatic 5alpha-reductase activity. \u003cem\u003eDiabetes\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2008;57(10):2652-2660.\u003c/li\u003e\n\u003cli\u003eMasuzaki H, Yamamoto H, Kenyon CJ, Elmquist JK, Morton NM, Paterson JM, Shinyama H, Sharp MG, Fleming S, Mullins JJ, Seckl JR, Flier JS. Transgenic amplification of glucocorticoid action in adipose tissue causes high blood pressure in mice. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2003;112(1):83-90.\u003c/li\u003e\n\u003cli\u003eLivingstone DE, Jones GC, Smith K, Jamieson PM, Andrew R, Kenyon CJ, Walker BR. Understanding the role of glucocorticoids in obesity: tissue-specific alterations of corticosterone metabolism in obese Zucker rats. \u003cem\u003eEndocrinology\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2000;141(2):560-563.\u003c/li\u003e\n\u003cli\u003eMorton NM, Paterson JM, Masuzaki H, Holmes MC, Staels B, Fievet C, Walker BR, Flier JS, Mullins JJ, Seckl JR. Novel adipose tissue-mediated resistance to diet-induced visceral obesity in 11 beta-hydroxysteroid dehydrogenase type 1-deficient mice. \u003cem\u003eDiabetes\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2004;53(4):931-938.\u003c/li\u003e\n\u003cli\u003eLagos CF, Vecchiola A, Allende F, Fuentes CA, Tichauer JE, Valdivia C, Solari S, Campino C, Tapia-Castillo A, Baudrand R, Villarroel P, Cifuentes M, Owen GI, Carvajal CA, Fardella CE. Identification of novel 11\u0026beta;-HSD1 inhibitors by combined ligand- and structure-based virtual screening. \u003cem\u003eMolecular and Cellular Endocrinology\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2014;384(1):71-82.\u003c/li\u003e\n\u003cli\u003eWake DJ, Walker BR. 11 beta-hydroxysteroid dehydrogenase type 1 in obesity and the metabolic syndrome. \u003cem\u003eMol Cell Endocrinol\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2004;215(1-2):45-54.\u003c/li\u003e\n\u003cli\u003eMorgan SA, Sherlock M, Gathercole LL, Lavery GG, Lenaghan C, Bujalska IJ, Laber D, Yu A, Convey G, Mayers R, Hegyi K, Sethi JK, Stewart PM, Smith DM, Tomlinson JW. 11beta-hydroxysteroid dehydrogenase type 1 regulates glucocorticoid-induced insulin resistance in skeletal muscle. \u003cem\u003eDiabetes\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2009;58(11):2506-2515.\u003c/li\u003e\n\u003cli\u003eDiethelm B, Lagos CF, Recabarren-Gajardo G. 1-Adamantylamidoxime. \u003cem\u003eMolbank\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2018;2018(2):M992.\u003c/li\u003e\n\u003cli\u003eFarman N, Bocchi B. Mineralocorticoid selectivity: molecular and cellular aspects. \u003cem\u003eKidney Int\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2000;57(4):1364-1369.\u003c/li\u003e\n\u003cli\u003eCarswell KA, Lee MJ, Fried SK. Culture of isolated human adipocytes and isolated adipose tissue. \u003cem\u003eMethods in molecular biology\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2012;806:203-214.\u003c/li\u003e\n\u003cli\u003eGarcia MA, Contreras D, Gonzalez PM. Metformin Transport in Native MDCK-Wt and MDCK-II Monolayers Unveils Functional Inter-Strains Differences Influencing Drug Permeability. \u003cem\u003ePharm Res\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2020;37(7):121.\u003c/li\u003e\n\u003cli\u003eMeli R, Morris GM, Biggin PC. Scoring Functions for Protein-Ligand Binding Affinity Prediction using Structure-Based Deep Learning: A Review. \u003cem\u003eFront Bioinform\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2022;2.\u003c/li\u003e\n\u003cli\u003eChuanxin Z, Shengzheng W, Lei D, Duoli X, Jin L, Fuzeng R, Aiping L, Ge Z. Progress in 11beta-HSD1 inhibitors for the treatment of metabolic diseases: A comprehensive guide to their chemical structure diversity in drug development. \u003cem\u003eEur J Med Chem\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2020;191:112134.\u003c/li\u003e\n\u003cli\u003eScott JS, Bowker SS, Deschoolmeester J, Gerhardt S, Hargreaves D, Kilgour E, Lloyd A, Mayers RM, McCoull W, Newcombe NJ, Ogg D, Packer MJ, Rees A, Revill J, Schofield P, Selmi N, Swales JG, Whittamore PR. Discovery of a potent, selective, and orally bioavailable acidic 11beta-hydroxysteroid dehydrogenase type 1 (11beta-HSD1) inhibitor: discovery of 2-[(3S)-1-[5-(cyclohexylcarbamoyl)-6-propylsulfanylpyridin-2-yl]-3-piperidyl]acetic acid (AZD4017). \u003cem\u003eJ Med Chem\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2012;55(12):5951-5964.\u003c/li\u003e\n\u003cli\u003eSilvestre CACMS. Inhibitors of 11\u0026beta;-Hydroxysteroid Dehydrogenase Type 1 as Potential Drugs for Type 2 Diabetes Mellitus\u0026mdash;A Systematic Review of Clinical and In Vivo Preclinical Studies. \u003cem\u003eScientia Pharmaceutica\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2021;89(1).\u003c/li\u003e\n\u003cli\u003eScott JS, Bowker SS, deSchoolmeester J, Gerhardt S, Hargreaves D, Kilgour E, Lloyd A, Mayers RM, McCoull W, Newcombe NJ, Ogg D, Packer MJ, Rees A, Revill J, Schofield P, Selmi N, Swales JG, Whittamore PRO. Discovery of a Potent, Selective, and Orally Bioavailable Acidic 11\u0026beta;-Hydroxysteroid Dehydrogenase Type 1 (11\u0026beta;-HSD1) Inhibitor: Discovery of 2-[(3S)-1-[5-(Cyclohexylcarbamoyl)-6-propylsulfanylpyridin-2-yl]-3-piperidyl]acetic Acid (AZD4017). \u003cem\u003eJournal of Medicinal Chemistry\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2012;55(12):5951-5964.\u003c/li\u003e\n\u003cli\u003eByun SY, Shin YJ, Nam KY, Hong SP, Ahn SK. A novel highly potent and selective 11\u0026beta;-hydroxysteroid dehydrogenase type 1 inhibitor, UI-1499. \u003cem\u003eLife Sciences\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2015;120:1-7.\u003c/li\u003e\n\u003cli\u003eRyu JH, Lee JA, Kim S, Shin YA, Yang J, Han HY, Son HJ, Kim YH, Sa JH, Kim J-S, Lee J, Lee J, Park H-g. Discovery of 2-((R)-4-(2-Fluoro-4-(methylsulfonyl)phenyl)-2-methylpiperazin-1-yl)-N-((1R,2s,3S,5S,7S)-5-hydroxyadamantan-2-yl)pyrimidine-4-carboxamide (SKI2852): A Highly Potent, Selective, and Orally Bioavailable Inhibitor of 11\u0026beta;-Hydroxysteroid Dehydrogenase Type 1 (11\u0026beta;-HSD1). \u003cem\u003eJournal of Medicinal Chemistry\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2016;59(22):10176-10189.\u003c/li\u003e\n\u003cli\u003eLipinski CA. Drug-like properties and the causes of poor solubility and poor permeability. \u003cem\u003eJ Pharmacol Toxicol Methods\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2000;44(1):235-249.\u003c/li\u003e\n\u003cli\u003eDrozdzik M, Groer C, Penski J, Lapczuk J, Ostrowski M, Lai Y, Prasad B, Unadkat JD, Siegmund W, Oswald S. Protein abundance of clinically relevant multidrug transporters along the entire length of the human intestine. \u003cem\u003eMol Pharm\u003c/em\u003e.\u003cem\u003e \u003c/em\u003e2014;11(10):3547-3555.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"11β-Hydroxysteroid dehydrogenase type 1, 11β-HSD1 inhibitor, metabolic syndrome, adamantyloxadiazole compounds","lastPublishedDoi":"10.21203/rs.3.rs-7933515/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7933515/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNontumoral cortisol dysregulation in obese individuals is associated with many facets of metabolic syndrome, including central adiposity, diabetes mellitus (T2DM), dyslipidemia, and hypertension. Glucocorticoid availability and function at the cell/tissue level are classically regulated by 11-beta hydroxysteroid dehydrogenase type (11β-HSD) enzymes. The 11β-HSD1 enzyme is expressed primarily in the liver and adipose tissue (AT) where cortisone in converted into its active form, cortisol. 11β-HSD1 expression in AT promotes adipocyte proliferation and hypertension, leading to the development of abdominal obesity and comorbidities. The 11β-HSD1 enzyme is a key therapeutic target for modulating obesity and associated metabolic disorders.\u003c/p\u003e\u003cp\u003eIn response to this need, our research aimed to design and characterize a family of nonsteroidal compounds displaying specific and selective inhibition of the 11β-HSD1 enzyme. For this purpose, we designed, synthetized, and characterized a family of adamantyloxadiazole compounds to selectively inhibit the human 11β-HSD1 enzyme that are henceforth designated sequentially from A to N (14 compounds). Our newly synthesized compounds were designed \u003cem\u003ein silico\u003c/em\u003e and synthesized via retrosynthesis. We tested the following properties of our novel compounds: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) their biopharmaceutical properties, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) their inhibitory potency (IC50) over 11β-HSD1 reductase activity in cell-free assays, and (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) their relative inhibitory potency and IC50 in human adipocytes.\u003c/p\u003e\u003cp\u003eBiopharmaceutical characterization of the compounds revealed high transcellular permeability and no interaction with P-glycoprotein, a known efflux pump that decreases oral systemic and central exposure, for Compounds \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e. \u003cem\u003eIn vitro\u003c/em\u003e studies of the inhibition of the 11β-HSD1 enzyme via cell-free and microsome-based assays indicated significant inhibitory potency, with optimal specificity and selectivity observed at the nanomolar level, highlighting both the IC50 values of Compound \u003cem\u003eJ\u003c/em\u003e (11,8 nM) and Compound \u003cem\u003eL\u003c/em\u003e (3,9 nM), which also preserve 11b-HSD oxidase activities (\u0026gt;\u0026thinsp;90%). In human adipocytes, 1 \u0026micro;M Compounds \u003cem\u003eE\u003c/em\u003e, \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e demonstrated a high potency of 11β-HSD1 inhibition, near 40\u0026ndash;60%, compared to 1 \u0026micro;M inhibitor carbenoxolone, which showed approximately a 90% inhibition.\u003c/p\u003e\u003cp\u003eThe preclinical evaluation of these adamantyloxadiazole derivatives revealed their potential as effective inhibitors of the 11β-HSD1 enzyme, with Compounds \u003cem\u003eE\u003c/em\u003e, \u003cem\u003eJ\u003c/em\u003e and \u003cem\u003eL\u003c/em\u003e showing particularly relevant performance \u003cem\u003ein vitro\u003c/em\u003e. These findings support the progression of \u003cem\u003ein vivo\u003c/em\u003e studies to further explore their therapeutic potential in treating obesity and associated metabolic disorders.\u003c/p\u003e","manuscriptTitle":"Novel nonsteroidal inhibitors of the human 11-beta hydroxysteroid dehydrogenase type 1 enzyme for the treatment of obesity and metabolic syndrome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-06 06:21:41","doi":"10.21203/rs.3.rs-7933515/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1eeb31f5-2297-4f29-862e-8012cfd28116","owner":[],"postedDate":"November 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":57215036,"name":"Biological sciences/Biochemistry"},{"id":57215037,"name":"Health sciences/Diseases"},{"id":57215038,"name":"Biological sciences/Drug discovery"}],"tags":[],"updatedAt":"2025-11-20T07:38:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-06 06:21:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7933515","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7933515","identity":"rs-7933515","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}