A first report of Pseudosuccinea columella (Say, 1817), an alien intermediate host for fascioliasis, in Malawi | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report A first report of Pseudosuccinea columella (Say, 1817), an alien intermediate host for fascioliasis, in Malawi S. Jones, A. Juhász, P. Makaula, L. J. Cunningham, J. Archer, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3872783/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Apr, 2024 Read the published version in Parasites & Vectors → Version 1 posted 9 You are reading this latest preprint version Abstract Starting in October 2021, quarterly malacological surveys have been undertaken in Malawi, sampling 12 specified freshwater habitats throughout a calendar year. Each survey monitors the presence of aquatic intermediate snail hosts of medical and veterinary importance; in March 2023, the alien lymnaeid species Pseudosuccinea columella was first encountered in Nsanje District. This species identity was later confirmed upon DNA analysis of mitochondrial ribosomal 16S sequences. In July 2023, P. columella was also noted at single sites within Mangochi and Chikwawa Districts, and again in Nsanje District, with an additional location observed. Of particular importance, our sampled location in Mangochi District was directly connected to Lake Malawi which expands the species list of invasive molluscs in this lake. Whilst P. columella is a well-known intermediate snail host for human and animal fascioliasis, screening collected snails for trematode cercariae, alongside molecular xenomonitoring, did not yield equivocal evidence of active fluke infection. However, the newly recognized presence of this alien intermediate snail host within Lake Malawi, and along the Shire River Valley, flags a new concern in altered local transmission potential for human and animal fascioliasis. Fasciola Lake Malawi lymnaeids molecular xenomonitoring Shire River Valley Figures Figure 1 Figure 2 Full Text Pseudosuccinea columella (Say, 1817), an invasive snail species originating from the Americas, has successfully colonised many freshwater habitats in Africa [1]. In southern Africa, its dispersion is recorded in Namibia, South Africa and Zimbabwe [2, 3, 4, 5]. As P. columella is an alien intermediate host of liver fluke, its distribution is of medical and veterinary interest. Our unexpected encounter with P. columella arose from broader malacological surveys for intermediate snail hosts of schistosomiasis, as part of the “ Hybridisation in UroGenital Schistosomiasis (HUGS)” project activities. Commencing in October 2021 then at quarterly intervals, HUGS has been inspecting 12 locations with standard freshwater snail collection protocols in Mangochi District (n=7), Chikwawa District (n=2) and Nsanje District (n=3), Fig. 1 . The chosen locations are exemplars of high-risk water contact sites for human and animal schistosomiasis, being each inspected by a team of three, collecting snails by hand or by metal scoop. Owing to its distinctive shell micro-sculpture (Brown, 1994), permitting quick in-field differentiation from Radix natalensis (Krauss, 1848), P. columella was first noticed during the March 2023 survey. Thereafter, a more purposeful search for living snails was made during July 2023 survey. In so doing, sufficient specimens (n=6) were obtained for an anatomical inspection, molecular snail taxonomy and molecular liver fluke xenomonitoring investigation, with additional specimens (n=29) checked for shedding liver fluke cercariae. Several specimens of R. natalensis were collected concurrently for later comparison. For anatomy, each snail was placed in water for 2 minutes at 80 o C. Soft tissues were then carefully removed from the shell with forceps. The empty shell was then viewed under a dissecting microscope and photographed, Fig. 2A/B & 2E/F , alongside more detailed inspection of the shell’s periostracum, Fig. 2C & 2G . To view the radula, head tissue was separated, incubated in lactic acid for three days, before mounting the radula onto a glass slide, with glass coverslip overlaid, then photographed under a light microscope (x1,000). Particular attention was given to morphology of the central and first lateral teeth, Fig. 2D & 2H . For molecular taxonomy, snail genomic DNA was extracted using cetyltrimethylammonium bromide (CTAB) method, as adapted from [6]. Prior to tissue lysis, Phocine Herpes Virus (PhHV) was added to snail tissues as an internal extraction and later PCR amplification control for molecular xenomonitoring. Extracted genomic DNA was quantified using a NanoDrop Spectrophotometer (ThermoFisher Scientific, UK) then normalised to 10 ng/uL using ddH 2 O. For molecular taxonomy, a partial region of the mitochondrial ribosomal 16S gene was targeted and PCR amplified using the universal primers 16brm: 5’-CCGGTCTGAACTCTGATCAT-3’ and 16arm: 5’-CGCCTGTTTATCAAAAACAT-3’ following [7]. After amplification, agarose gel (2%) electrophoresis with SYBR™ Safe DNA Gel Stain (Invitrogen, Carlsbad, CA, United States) ascertained amplicon purity before Sanger Sequencing with forward and reverse primers at Source BioScience (Source BioScience, Cambridge, United Kingdom). Identical 16S sequences were obtained, allowing creation of a single consensus sequence using Mega11 [8]. Species were confirmed using a BLAST search [9]. Newly obtained sequences were then deposited in GenBank (accession number OR801605). For molecular xenomonitoring of liver fluke infection, the assay of [10] was used implementing real-time PCR with TaqMan® probes. The following genus specific primers SSCPFaF: 5’-TTGGTACTCAGTTGTCAGTGTG-3’ and SSCPFaR: 5’-AGCATCAGACACATGACCAAG-3’, with species-specific TaqManÒ probes to detect Fasciola hepatica (Linnaeus, 1758) (ProFh: 5’-[6FAM]ACCAGGCACGTTCCGTCACTGTCACTTT[BHQ1]-3’) and Fasciola gigantica (Cobbold, 1856) (ProFg: 5’-[HEX]ACCAGGCACGTTCCGTTACTGTTACTTTGTC[BHQ1]-3’) were used. Real-time PCR reactions were performed using a MIC thermocycler (Bio Molecular Systems, Queensland, Australia) with positive control gDNA from adult worms of F. gigantica originating from Uganda. The BLAST search of the 402 bp consensus sequence matched with 100% similarity, P. columella isolate LS3 mitochondrion genome (assession number NC_042905.1) from North America. Twenty additional identical 16S matches were noted, inclusive of P. columella from Brazil [11] and South Africa [12] . While we did not observe any snails shedding fluke cercariae, we did note, from molecular xenomonitoring, very weak amplification DNA signatures, with cycle threshold (Ct) values of 35. We consider these to most likely arise from spurious amplification of other trematode larvae [13]. In Africa, human and animal fascioliasis is typically transmitted by freshwater snails of the genus Galba or Radix [14], giving rise to an often allopatric transmission of F. hepatica and F. gigantica respectively [15]. Given the ability of P. columella to transmit both species of liver fluke, this alien intermediate host snail potentially adds a new dimension to this snail-parasite relationship in Malawi, although we presently conclude that there was no evidence for active liver fluke infection within our sampled snails. To provide an insight into the ecology of P. columella , we review, in brief, the aquatic habitats where it was found. As shown in Fig. 1 , sampling site Mangochi 1 is predominantly a stream habitat, immediately marginal and directly connected to Lake Malawi itself. Since Lake Malawi is well-known internationally as a global hotspot of biological diversity, the addition of P. columella to its species list is non-trivial. Indeed, its presence likely adds to the expanding list of ecological change within the lake and is pertinent to other snail-borne disease locally [16, 17]. This stream’s natural water supply is augmented by a pisciculture facility some 2-3 km inland, at -14.32813 o , 35.128351 o . Here, water is directly taken from the lake, pumped underground, returning overground following this stream’s natural path. Before pisciculture, this stream was seasonal but is now a conducive habitat throughout the year and reasonable to speculate that the presence of P. columella here was fully or partially attributable to local development(s) in pisciculture along the Lake Malawi shoreline. Another contributing factor would be the introduction and subsequent dispersion of invasive aquatic plants such as water hyacinth ( Pontederia crassipes ), now common across all collecting sites, on which P. columella was often found. Following the Upper then Lower Shire River some 200 km southward, P. columella was found at Chikwawa 1, a natural and permanent oxbow lake of the Lower Shire River, Fig. 1 . Upon more extreme seasonal flooding, this oxbow is directly connected to the river, which recently occurred in March 2023 by cyclone Freddy. Moving a further 100 km southward, both Nsanje 4 and Nansje 5 are seasonal flooded areas for informal pisciculture and small holder rice farming. Each are temporarily connected to the Lower Shire Valley upon natural inundation(s) and by managed sluice gates, Fig. 1 . Water chemistry data was collected for each snail sampling site at each visit, this data included temperature (°C), pH, conductivity (µS) and total dissolved solids (TDS) (ppm). Average data for Mangochi 1 was temp: 27.8 °C; pH: 8.1; conductivity: 517.6 µS and TDS: 264.6 ppm. Data for Chikwawa 1 was temp: 32.7 °C; pH: 8.4; conductivity: 627.2 µS and TDS: 308.7 ppm. For Nsanje 4 water chemistry was temp: 32.5 °C; pH: 8.3; conductivity: 443 µS and TDS: 221.8 ppm. Finally, for Nsanje 5 the data was temp: 30.1 °C; pH: 8.0; conductivity: 436.3 µS and TDS: 202.7 ppm. Across all 12 sites surveyed across all time points the average water chemistry data was temp: 29.3 °C; pH: 8.2; conductivity: 487.9 µS and TDS: 244.9. Our report of P. columella considerably expands the known geographic range of this alien intermediate host snail species across southern Africa. We add to the malacological list of alien freshwater snails in Lake Malawi and Lower Shire River, contributing to a growing body of evidence for wider ecological change with new pressing need for further and more thorough surveillance of fascioliasis. Declarations Ethical Approval The “ Hybridisation in UroGenital Schistosomiasis (HUGS)” study as approved in the UK by the Research Ethics Committee of the Liverpool School of Tropical Medicine, study protocol (22-028), and in Malawi by the College of Medicine Research and Ethics Committee (COMREC), study protocol P.08/21/3381. Acknowledgments and Funding The Wellcome Trust directly funds the HUGS project with salary support for SJ, AJ, LJC, PM, SAK, GN, DRK, PC and DL, alongside financial backing for our malacological surveys. This assistance is in conjunction with the National Institute for Health Research (NIHR) (using the UK’s Official Development Assistance (ODA) Funding) and Wellcome Trust [220818/Z/20/Z] under the NIHR-Wellcome Partnership for Global Health Research. CN is supported by Wellcome [223660/Z/21/Z] under the NIHR-Wellcome Partnership for Global Health Research. We acknowledge collaborative support from Dr Chris Jones, LSTM and Dr Themba Mzilahowa, Malaria Alert Centre, as part of the NIHR Shire_vec project. The views expressed are those of the authors and not necessarily those of Wellcome, the NIHR or the Department of Health and Social Care. JA receives a MRC-DTP PhD Fellowship held at the LSTM. Availability of Data and Materials Not applicable Conflict of Interest Statement Authors report that there are no conflicts of interest. References Malatji MP, Mukaratirwa S. Molecular detection of natural infection of Lymnaea (Pseudosuccinea) columella (Gastropoda: Lymnaeidae) with Fasciola gigantica (Digenea: Fasciolidae) from two provinces of South Africa. Journal of Helminthology. 2020;94; doi: 10.1017/S0022149X19000129. Malatji MP, Pfukenyi DM, Mukaratirwa S. Fasciola species and their vertebrate and snail intermediate hosts in East and Southern Africa: a review. Journal of Helminthology. 2019;94; doi: 10.1017/S0022149X19000531. Malatji MP, Lamb J, Mukaratirwa S. Molecular characterization of liver fluke intermediate host lymnaeids (Gastropoda: Pulmonata) snails from selected regions of Okavango Delta of Botswana, KwaZulu-Natal and Mpumalanga provinces of South Africa. Veterinary Parasitology: Regional Studies and Reports. 2019;17; doi: 10.1016/j.vprsr.2019.100318. Nyagura I, Malatji MP, Mukaratirwa S. Occurrence of Fasciola (Digenea: Fasciolidae) Species in Livestock, Wildlife and Humans, and the Geographical Distribution of Their Intermediate Hosts in South Africa—A Scoping Review. Frontiers in Veterinary Science. 2022;9; doi: 10.3389/fvets.2022.935428. Schols R, Carolus H, Hammoud C, Muzarabani KC, Barson M, Huyse T. Invasive snails, parasite spillback, and potential parasite spillover drive parasitic diseases of Hippopotamus amphibius in artificial lakes of Zimbabwe. BMC Biology. 2021;19 160; doi: 10.1186/s12915-021-01093-2. Abbasi I, King CH, Sturrock RF, Kariuki C, Muchiri E, Hamburger J. Differentiation of Schistosoma haematobium from Related Schistosomes by PCR Amplifying an Inter-Repeat Sequence. American Journal of Tropical Medicine and Hygiene 2007;76 5:950-5. Remigio E. Molecular phylogenetic relationships in the aquatic snail genus Lymnaea , the intermediate host of the causative agent of fascioliasis: insights from broader taxon sampling. Parasitology Research. 2002;88 7:687-96; doi: 10.1007/s00436-002-0658-8. Tamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology & Evolution. 2021;38 6; doi: 10.1093/molbev/msab120. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology. 1990;215 3:403-10; doi: 10.1016/S0022-2836(05)80360-2. Alasaad S, Soriguer RC, Abu-Madi M, El Behairy A, Jowers MJ, Baños PD, et al. A TaqMan real-time PCR-based assay for the identification of Fasciola spp. Vet Parasitol. 2011;179 1-3:266-71; doi: 10.1016/j.vetpar.2011.01.059. Medeiros C, Silva Scholte LL, Marques Cardoso PC, Pointier J-P, Rumi A, Rocha Oliveira IH, et al. An Integrative Approach for the Identification of Native and Exotic Lymnaeids from Brazil. Malacologia. 2022;65 1-2:25-42, 18. doi: 10.4002/040.065.0102. Mahulu A, Clewing C, Stelbrink B, Chibwana FD, Tumwebaze I, Russell Stothard J, et al. Cryptic intermediate snail host of the liver fluke Fasciola hepatica in Africa. Parasites & Vectors. 2019;12 1:573; doi: 10.1186/s13071-019-3825-9. Kane RA, Stothard JR, Rollinson D, Leclipteux T, Evraerts J, Standley CJ, et al. Detection and quantification of schistosome DNA in freshwater snails using either fluorescent probes in real-time PCR or oligochromatographic dipstick assays targeting the ribosomal intergenic spacer. Acta Tropica. 2013;128 2:241-9; doi: 10.1016/j.actatropica.2011.10.019. Ngcamphalala PI, Malatji MP, Mukaratirwa S. Geography and ecology of invasive Pseudosuccinea columella (Gastropoda: Lymnaeidae) and implications in the transmission of Fasciola species (Digenea: Fasciolidae) - a review. J Helminthol. 2022;96:e1; doi: 10.1017/s0022149x21000717. Howell A, Mugisha L, Davies J, LaCourse EJ, Claridge J, Williams DJL, et al. Bovine fasciolosis at increasing altitudes: Parasitological and malacological sampling on the slopes of Mount Elgon, Uganda. Parasites & Vectors. 2012;5 196; doi: 10.1186/1756-3305-5-196. Madsen H, Stauffer JR. Schistosomiasis Control Under Changing Ecological Settings in Lake Malawi. EcoHealth. 2022;19 3:320-3; doi: 10.1007/s10393-022-01606-7. Alharbi MH, Condemine C, Hesketh J, Kayuni SA, Arme TM, Archer J, et al. Biomphalaria pfeifferi (Gastropoda: Planorbidae) in Lake Malawi and Upper Shire River, Mangochi District, Malawi: Distribution, Genetic Diversity and Pre-Patent Schistosome Infections. Tropical Medicine and Infectious Disease. 2023;8 2:126. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 11 Apr, 2024 Read the published version in Parasites & Vectors → Version 1 posted Editorial decision: Revision requested 16 Feb, 2024 Reviews received at journal 15 Feb, 2024 Reviews received at journal 05 Feb, 2024 Reviewers agreed at journal 24 Jan, 2024 Reviewers agreed at journal 23 Jan, 2024 Reviewers invited by journal 22 Jan, 2024 Editor assigned by journal 19 Jan, 2024 Submission checks completed at journal 19 Jan, 2024 First submitted to journal 17 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3872783","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":268053773,"identity":"1c222600-3b91-43e5-9947-bcfff0b64906","order_by":0,"name":"S. Jones","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIie2RsQrCMBRFXynoEugaEc0vVLo4iN9iEJx018lAoY6dBcFfqEvmhoCLcS/ooAhOChU/QNO6uBg6OuQMLwRyePcSAIvlX8HFqIesOJxyQlpFQYIVDysqH49WVMhiN4Du9Ngmy3P4fIx7LVaXJxep34qvJglgdQ38A42w4KOAoZHvosyggFYakaRJk0YguNTxxuCi3BAsvpfKfL0UYS74izLvZlYg+2wZQOYwHSylDBdbTMGye5JiJTuJ0l32fBhE+OqLlaE+iSebC55KQhZS5jPeb8Xe8Hy6bQ3BNBJ/32pQ4SMdU1eLxWKxwBt2bluZMeQN3wAAAABJRU5ErkJggg==","orcid":"","institution":"Liverpool School of Tropical Medicine","correspondingAuthor":true,"prefix":"","firstName":"S.","middleName":"","lastName":"Jones","suffix":""},{"id":268053774,"identity":"b04b5901-7fc9-4fa3-ad63-361e1c8eca52","order_by":1,"name":"A. Juhász","email":"","orcid":"","institution":"Liverpool School of Tropical Medicine","correspondingAuthor":false,"prefix":"","firstName":"A.","middleName":"","lastName":"Juhász","suffix":""},{"id":268053775,"identity":"ed550ca1-d45c-4554-a94b-8f84212a1db3","order_by":2,"name":"P. Makaula","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"P.","middleName":"","lastName":"Makaula","suffix":""},{"id":268053776,"identity":"c4c29330-3fce-4653-8f74-d85e3375a8d8","order_by":3,"name":"L. J. Cunningham","email":"","orcid":"","institution":"Liverpool School of Tropical Medicine","correspondingAuthor":false,"prefix":"","firstName":"L.","middleName":"J.","lastName":"Cunningham","suffix":""},{"id":268053777,"identity":"85c5438a-0c7c-47d7-b11f-50a16c331b17","order_by":4,"name":"J. Archer","email":"","orcid":"","institution":"Liverpool School of Tropical Medicine","correspondingAuthor":false,"prefix":"","firstName":"J.","middleName":"","lastName":"Archer","suffix":""},{"id":268053778,"identity":"7cc33702-b28a-41bd-91f1-0bda75ccf0f0","order_by":5,"name":"C. Nkolokosa","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"C.","middleName":"","lastName":"Nkolokosa","suffix":""},{"id":268053779,"identity":"523440a5-b7c6-4861-9970-637e80be4a04","order_by":6,"name":"G. Namacha","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"G.","middleName":"","lastName":"Namacha","suffix":""},{"id":268053780,"identity":"bb02dd01-1911-45bf-92e1-67943110e6e5","order_by":7,"name":"E. Kambewa","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"E.","middleName":"","lastName":"Kambewa","suffix":""},{"id":268053781,"identity":"183110ed-3c6a-42b3-ab19-3e8b5a2efaec","order_by":8,"name":"D. Lally","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"D.","middleName":"","lastName":"Lally","suffix":""},{"id":268053782,"identity":"4416b657-4ca9-4a87-835a-2ee8d902e5ef","order_by":9,"name":"D. R. Kapira","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"D.","middleName":"R.","lastName":"Kapira","suffix":""},{"id":268053783,"identity":"6ffba551-48a8-461c-afee-6423d8e17069","order_by":10,"name":"P. Chammudzi","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"P.","middleName":"","lastName":"Chammudzi","suffix":""},{"id":268053784,"identity":"9d0cc32e-8b50-4827-b3a2-1c3fc320e92e","order_by":11,"name":"S. A. Kayuni","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"S.","middleName":"A.","lastName":"Kayuni","suffix":""},{"id":268053785,"identity":"1899e257-1ea9-48cb-b140-8835a451e615","order_by":12,"name":"J. Musaya","email":"","orcid":"","institution":"Malawi-Liverpool-Wellcome (MLW) Clinical Research Programme","correspondingAuthor":false,"prefix":"","firstName":"J.","middleName":"","lastName":"Musaya","suffix":""},{"id":268053786,"identity":"ceafc720-5284-41ea-a0de-d881d517d31d","order_by":13,"name":"J. Russell Stothard","email":"","orcid":"","institution":"Liverpool School of Tropical Medicine","correspondingAuthor":false,"prefix":"","firstName":"J.","middleName":"Russell","lastName":"Stothard","suffix":""}],"badges":[],"createdAt":"2024-01-17 11:44:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3872783/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3872783/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13071-024-06241-5","type":"published","date":"2024-04-11T15:02:14+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":49987272,"identity":"1e3392bb-cb97-4963-88a8-b75dd2468e05","added_by":"auto","created_at":"2024-01-22 17:32:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1396700,"visible":true,"origin":"","legend":"\u003cp\u003eSketch maps of the distribution of \u003cem\u003eP. columella \u003c/em\u003ein Mangochi (A), Chikwawa (B) and Nsanje (C) Districts, southern Malawi. Red circles indicate HUGS survey sites where \u003cem\u003eP. columella\u003c/em\u003e was found whereas grey circles are surveyed sites where this snail was not found. The locations are: Mangochi 1 (-14.31373\u003csup\u003eo\u003c/sup\u003e, 35.14174\u003csup\u003eo\u003c/sup\u003e); Chikwawa 1 (-16.03759\u003csup\u003eo\u003c/sup\u003e, 34.84091\u003csup\u003eo\u003c/sup\u003e); Nsanje 4 (-16.88780\u003csup\u003e o\u003c/sup\u003e, 35.27475\u003csup\u003e o\u003c/sup\u003e) \u0026amp; Nsanje 5 (-16.92985\u003csup\u003eo\u003c/sup\u003e, 35.26552\u003csup\u003eo\u003c/sup\u003e) with corresponding location photograph. Note that the panorama image of Mangochi 1 clearly shows the stream, flowing left to right, directly connected to Lake Malawi.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3872783/v1/315cc725952b1c949540fc37.png"},{"id":49987271,"identity":"53911e1b-af43-41a4-b1da-9720108adfee","added_by":"auto","created_at":"2024-01-22 17:32:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":453412,"visible":true,"origin":"","legend":"\u003cp\u003eConchological and anatomical comparison of \u003cem\u003ePseudosuccinia columella\u003c/em\u003e (top row) compared with \u003cem\u003eRadix natalensis\u003c/em\u003e(bottom row); \u003cem\u003eP. columella\u003c/em\u003e conchology (2A \u0026amp; 2B), shell microsculpture of the black square hatched area (2C) and radular teeth (2D) and \u003cem\u003eR. natalensis\u003c/em\u003e conchology (2E \u0026amp; 2F), shell microsculpture of the black square hatched area (2G) and radular teeth (2H). Although there is minor variation in the shape of the inner cusp of the first lateral teeth, the discriminatory feature is the periostracum’s spiral ridges.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3872783/v1/88c3ce931b06e5c0123aabf4.png"},{"id":54712989,"identity":"a766443d-cac4-4a66-af9d-ab6a129a8c1a","added_by":"auto","created_at":"2024-04-15 15:14:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1889511,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3872783/v1/d50e5a98-1c14-448a-aa9f-60e9c11959b1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"A first report of Pseudosuccinea columella (Say, 1817), an alien intermediate host for fascioliasis, in Malawi","fulltext":[{"header":"Full Text","content":"\u003cp\u003e\u003cem\u003ePseudosuccinea columella\u003c/em\u003e (Say, 1817), an invasive snail species originating from the Americas, has successfully colonised many freshwater habitats in Africa\u0026nbsp;[1]. In southern Africa, its dispersion is recorded in Namibia, South Africa and Zimbabwe\u0026nbsp;[2, 3, 4, 5]. As \u003cem\u003eP. columella\u0026nbsp;\u003c/em\u003eis an alien intermediate host of liver fluke, its distribution is of medical and veterinary interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026lt;\u003cem\u003eplease insert \u003cstrong\u003eFig. 1\u003c/strong\u003e near here\u003c/em\u003e\u0026gt;\u003c/p\u003e\n\u003cp\u003eOur unexpected encounter with \u003cem\u003eP. columella\u003c/em\u003e arose from broader malacological surveys for intermediate snail hosts of schistosomiasis, as part of the \u0026ldquo;\u003cem\u003eHybridisation in UroGenital Schistosomiasis\u0026nbsp;\u003c/em\u003e(HUGS)\u0026rdquo; project activities. Commencing in October 2021 then at quarterly intervals, HUGS has been inspecting 12 locations with standard freshwater snail collection protocols in Mangochi District (n=7), Chikwawa District (n=2) and Nsanje District (n=3), \u003cstrong\u003eFig. 1\u003c/strong\u003e. The chosen locations are exemplars of high-risk water contact sites for human and animal schistosomiasis, being each inspected by a team of three, collecting snails by hand or by metal scoop.\u003c/p\u003e\n\u003cp\u003eOwing to its distinctive shell micro-sculpture (Brown, 1994), permitting quick in-field differentiation from \u003cem\u003eRadix natalensis\u003c/em\u003e (Krauss, 1848), \u003cem\u003eP. columella\u003c/em\u003e was first noticed during the March 2023 survey. Thereafter, a more purposeful search for living snails was made during July 2023 survey. In so doing, sufficient specimens (n=6) were obtained for an anatomical inspection, molecular snail taxonomy and molecular liver fluke xenomonitoring investigation, with additional specimens (n=29) checked for shedding liver fluke cercariae. Several specimens of \u003cem\u003eR. natalensis\u003c/em\u003e were collected concurrently for later comparison.\u003c/p\u003e\n\u003cp\u003e\u0026lt;\u003cem\u003eplease insert \u003cstrong\u003eFig. 2\u003c/strong\u003e near here\u003c/em\u003e\u0026gt;\u003c/p\u003e\n\u003cp\u003eFor anatomy, each snail was placed in water for 2 minutes at 80 \u003csup\u003eo\u003c/sup\u003eC. Soft tissues were then carefully removed from the shell with forceps. The empty shell was then viewed under a dissecting microscope and photographed, \u003cstrong\u003eFig. 2A/B \u0026amp; 2E/F\u003c/strong\u003e, alongside more detailed inspection of the shell\u0026rsquo;s periostracum, \u003cstrong\u003eFig. 2C \u0026amp; 2G\u003c/strong\u003e. \u0026nbsp;To view the radula, head tissue was separated, incubated in lactic acid for three days, before mounting the radula onto a glass slide, with glass coverslip overlaid, then photographed under a light microscope (x1,000). Particular attention was given to morphology of the central and first lateral teeth, \u003cstrong\u003eFig. 2D \u0026amp; 2H\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor molecular taxonomy, snail genomic DNA was extracted using cetyltrimethylammonium bromide (CTAB) method, as adapted from\u0026nbsp;[6]. Prior to tissue lysis, Phocine Herpes Virus (PhHV) was added to snail tissues as an internal extraction and later PCR amplification control for molecular xenomonitoring. Extracted genomic DNA was quantified using a NanoDrop Spectrophotometer (ThermoFisher Scientific, UK) then normalised to 10 ng/uL using ddH\u003csub\u003e2\u003c/sub\u003eO. For molecular taxonomy, a partial region of the mitochondrial ribosomal 16S gene was targeted and PCR amplified using the universal primers 16brm: 5\u0026rsquo;-CCGGTCTGAACTCTGATCAT-3\u0026rsquo; and 16arm: 5\u0026rsquo;-CGCCTGTTTATCAAAAACAT-3\u0026rsquo; following\u0026nbsp;[7]. After amplification, agarose gel (2%) electrophoresis with SYBR\u0026trade; Safe DNA Gel Stain (Invitrogen, Carlsbad, CA, United States) ascertained amplicon purity before Sanger Sequencing with forward and reverse primers at Source BioScience (Source BioScience, Cambridge, United Kingdom). Identical 16S sequences were obtained, allowing creation of a single consensus sequence using Mega11\u0026nbsp;[8]. Species were confirmed using a\u0026nbsp;BLAST search\u0026nbsp;[9]. Newly obtained sequences were then deposited in GenBank (accession number OR801605).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor molecular xenomonitoring of liver fluke infection, the assay of\u0026nbsp;[10]\u0026nbsp;was used implementing real-time PCR with TaqMan\u0026reg; probes. The following genus specific primers SSCPFaF: 5\u0026rsquo;-TTGGTACTCAGTTGTCAGTGTG-3\u0026rsquo; and SSCPFaR: 5\u0026rsquo;-AGCATCAGACACATGACCAAG-3\u0026rsquo;, with species-specific TaqMan\u0026Ograve;\u0026nbsp;probes to detect \u003cem\u003eFasciola hepatica\u0026nbsp;\u003c/em\u003e(Linnaeus, 1758)\u003cem\u003e\u0026nbsp;\u003c/em\u003e(ProFh: 5\u0026rsquo;-[6FAM]ACCAGGCACGTTCCGTCACTGTCACTTT[BHQ1]-3\u0026rsquo;) and \u003cem\u003eFasciola gigantica\u003c/em\u003e (Cobbold, 1856) (ProFg:\u003cem\u003e\u0026nbsp;\u003c/em\u003e5\u0026rsquo;-[HEX]ACCAGGCACGTTCCGTTACTGTTACTTTGTC[BHQ1]-3\u0026rsquo;) were used. Real-time PCR reactions were performed using a MIC thermocycler (Bio Molecular Systems, Queensland, Australia) with positive control gDNA from adult worms of \u003cem\u003eF. gigantica\u003c/em\u003e originating from Uganda. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe BLAST search of the 402 bp consensus sequence matched with 100% similarity, \u003cem\u003eP. columella\u0026nbsp;\u003c/em\u003eisolate LS3 mitochondrion genome (assession number NC_042905.1) from North America. Twenty additional identical 16S matches were noted, inclusive of \u003cem\u003eP. columella\u003c/em\u003e from Brazil\u0026nbsp;[11]\u0026nbsp;and South Africa\u0026nbsp;[12]\u0026nbsp;. While we did not observe any snails shedding fluke cercariae, we did note, from molecular xenomonitoring, very weak amplification DNA signatures, with cycle threshold (Ct) values of 35. We consider these to most likely arise from spurious amplification of other trematode larvae\u0026nbsp;[13]. In Africa, human and animal fascioliasis is typically transmitted by freshwater snails of the genus \u003cem\u003eGalba\u003c/em\u003e or \u003cem\u003eRadix\u003c/em\u003e [14], giving rise to an often allopatric transmission of \u003cem\u003eF. hepatica\u003c/em\u003e and \u003cem\u003eF. gigantica\u003c/em\u003e respectively\u0026nbsp;[15]. Given the ability of \u003cem\u003eP. columella\u003c/em\u003e to transmit both species of liver fluke, this alien intermediate host snail potentially adds a new dimension to this snail-parasite relationship in Malawi, although we presently conclude that there was no evidence for active liver fluke infection within our sampled snails.\u003c/p\u003e\n\u003cp\u003eTo provide an insight into the ecology of \u003cem\u003eP. columella\u003c/em\u003e, we review, in brief, the aquatic habitats where it was found. As shown in \u003cstrong\u003eFig. 1\u003c/strong\u003e, sampling site\u0026nbsp;Mangochi 1 is predominantly a stream habitat, immediately marginal and directly connected to Lake Malawi itself. Since Lake Malawi is well-known internationally as a global hotspot of biological diversity, the addition of \u003cem\u003eP. columella\u003c/em\u003e to its species list is non-trivial. Indeed, its presence likely adds to the expanding list of ecological change within the lake and is pertinent to other snail-borne disease locally\u0026nbsp;[16, 17]. This stream\u0026rsquo;s natural water supply is augmented by a pisciculture facility some 2-3 km inland, at -14.32813\u003csup\u003eo\u003c/sup\u003e, 35.128351\u003csup\u003eo\u003c/sup\u003e. Here, water is directly taken from the lake, pumped underground, returning overground following this stream\u0026rsquo;s natural path. Before pisciculture, this stream was seasonal but is now a conducive habitat throughout the year and reasonable to speculate that the presence of \u003cem\u003eP. columella\u003c/em\u003e here was fully or partially attributable to local development(s) in pisciculture along the Lake Malawi shoreline. Another contributing factor would be the introduction and subsequent dispersion of invasive aquatic plants such as water hyacinth (\u003cem\u003ePontederia crassipes\u003c/em\u003e), now common across all collecting sites, on which \u003cem\u003eP. columella\u003c/em\u003e was often found.\u003c/p\u003e\n\u003cp\u003eFollowing the Upper then Lower Shire River some 200 km southward, \u003cem\u003eP. columella\u003c/em\u003e was found at Chikwawa 1, a natural and permanent oxbow lake of the Lower Shire River, \u003cstrong\u003eFig. 1\u003c/strong\u003e. Upon more extreme seasonal flooding, this oxbow is directly connected to the river, which recently occurred in March 2023 by cyclone Freddy. Moving a further 100 km southward, both Nsanje 4 and Nansje 5 are seasonal flooded areas for informal pisciculture and small holder rice farming. Each are temporarily connected to the Lower Shire Valley upon natural inundation(s) and by managed sluice gates, \u003cstrong\u003eFig. 1\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWater chemistry data was collected for each snail sampling site at each visit, this data included temperature (\u0026deg;C), pH, conductivity (\u0026micro;S) and total dissolved solids (TDS) (ppm). Average data for Mangochi 1 was temp: 27.8 \u0026deg;C; pH: 8.1; conductivity: 517.6 \u0026micro;S and TDS: 264.6 ppm. Data for Chikwawa 1 was temp: 32.7 \u0026deg;C; pH: 8.4; conductivity: 627.2 \u0026micro;S and TDS: 308.7 ppm. For Nsanje 4 water chemistry was temp: 32.5 \u0026deg;C; pH: 8.3; conductivity: 443 \u0026micro;S and TDS: 221.8 ppm. Finally, for Nsanje 5 the data was temp: 30.1 \u0026deg;C; pH: 8.0; conductivity: 436.3 \u0026micro;S and TDS: 202.7 ppm. Across all 12 sites surveyed across all time points the average water chemistry data was temp: 29.3 \u0026deg;C; pH: 8.2; conductivity: 487.9 \u0026micro;S and TDS: 244.9.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOur report of \u003cem\u003eP. columella\u003c/em\u003e considerably expands the known geographic range of this alien intermediate host snail species across southern Africa. We add to the malacological list of alien freshwater snails in Lake Malawi and Lower Shire River, contributing to a growing body of evidence for wider ecological change with new pressing need for further and more thorough surveillance of fascioliasis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u0026ldquo;\u003cem\u003eHybridisation in UroGenital Schistosomiasis\u003c/em\u003e (HUGS)\u0026rdquo; study as approved in the UK by the Research Ethics Committee of the Liverpool School of Tropical Medicine, study protocol (22-028), and in Malawi by the College of Medicine Research and Ethics Committee (COMREC), study protocol P.08/21/3381.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments and Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Wellcome Trust directly funds the HUGS project with salary support for SJ, AJ, LJC, PM, SAK, GN, DRK, PC and DL, alongside financial backing for our malacological surveys. This assistance is in conjunction with the National Institute for Health Research (NIHR) (using the UK\u0026rsquo;s Official Development Assistance (ODA) Funding) and Wellcome Trust [220818/Z/20/Z] under the NIHR-Wellcome Partnership for Global Health Research. CN is supported by Wellcome [223660/Z/21/Z] under the NIHR-Wellcome Partnership for Global Health Research. We acknowledge collaborative support from Dr Chris Jones, LSTM and Dr Themba Mzilahowa, Malaria Alert Centre, as part of the NIHR Shire_vec project. The views expressed are those of the authors and not necessarily those of Wellcome, the NIHR or the Department of Health and Social Care. JA receives a MRC-DTP PhD Fellowship held at the LSTM.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors report that there are no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eMalatji MP, Mukaratirwa S. Molecular detection of natural infection of \u003cem\u003eLymnaea (Pseudosuccinea) columella\u003c/em\u003e (Gastropoda: Lymnaeidae) with \u003cem\u003eFasciola gigantica\u003c/em\u003e (Digenea: Fasciolidae) from two provinces of South Africa. Journal of Helminthology.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2020;94; doi: 10.1017/S0022149X19000129.\u003c/li\u003e\n \u003cli\u003eMalatji MP, Pfukenyi DM, Mukaratirwa S. \u003cem\u003eFasciola\u003c/em\u003e species and their vertebrate and snail intermediate hosts in East and Southern Africa: a review. Journal of Helminthology.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2019;94; doi: 10.1017/S0022149X19000531.\u003c/li\u003e\n \u003cli\u003eMalatji MP, Lamb J, Mukaratirwa S. Molecular characterization of liver fluke intermediate host lymnaeids (Gastropoda: Pulmonata) snails from selected regions of Okavango Delta of Botswana, KwaZulu-Natal and Mpumalanga provinces of South Africa. Veterinary Parasitology: Regional Studies and Reports.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2019;17; doi: 10.1016/j.vprsr.2019.100318.\u003c/li\u003e\n \u003cli\u003eNyagura I, Malatji MP, Mukaratirwa S. Occurrence of \u003cem\u003eFasciola\u003c/em\u003e (Digenea: Fasciolidae) Species in Livestock, Wildlife and Humans, and the Geographical Distribution of Their Intermediate Hosts in South Africa\u0026mdash;A Scoping Review. Frontiers in Veterinary Science.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2022;9; doi: 10.3389/fvets.2022.935428.\u003c/li\u003e\n \u003cli\u003eSchols R, Carolus H, Hammoud C, Muzarabani KC, Barson M, Huyse T. Invasive snails, parasite spillback, and potential parasite spillover drive parasitic diseases of \u003cem\u003eHippopotamus amphibius\u003c/em\u003e in artificial lakes of Zimbabwe. BMC Biology.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2021;19 160; doi: 10.1186/s12915-021-01093-2.\u003c/li\u003e\n \u003cli\u003eAbbasi I, King CH, Sturrock RF, Kariuki C, Muchiri E, Hamburger J. Differentiation of \u003cem\u003eSchistosoma haematobium\u003c/em\u003e from Related Schistosomes by PCR Amplifying an Inter-Repeat Sequence. American Journal of Tropical Medicine and Hygiene 2007;76 5:950-5.\u003c/li\u003e\n \u003cli\u003eRemigio E. Molecular phylogenetic relationships in the aquatic snail genus \u003cem\u003eLymnaea\u003c/em\u003e, the intermediate host of the causative agent of fascioliasis: insights from broader taxon sampling. Parasitology Research.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2002;88 7:687-96; doi: 10.1007/s00436-002-0658-8.\u003c/li\u003e\n \u003cli\u003eTamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology \u0026amp; Evolution.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2021;38 6; doi: 10.1093/molbev/msab120.\u003c/li\u003e\n \u003cli\u003eAltschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology.\u003cem\u003e\u0026nbsp;\u003c/em\u003e1990;215 3:403-10; doi: 10.1016/S0022-2836(05)80360-2.\u003c/li\u003e\n \u003cli\u003eAlasaad S, Soriguer RC, Abu-Madi M, El Behairy A, Jowers MJ, Ba\u0026ntilde;os PD, \u003cem\u003eet al.\u003c/em\u003e A TaqMan real-time PCR-based assay for the identification of \u003cem\u003eFasciola spp.\u003c/em\u003e Vet Parasitol.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2011;179 1-3:266-71; doi: 10.1016/j.vetpar.2011.01.059.\u003c/li\u003e\n \u003cli\u003eMedeiros C, Silva Scholte LL, Marques Cardoso PC, Pointier J-P, Rumi A, Rocha Oliveira IH, \u003cem\u003eet al.\u003c/em\u003e An Integrative Approach for the Identification of Native and Exotic Lymnaeids from Brazil. Malacologia.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2022;65 1-2:25-42, 18. doi: 10.4002/040.065.0102.\u003c/li\u003e\n \u003cli\u003eMahulu A, Clewing C, Stelbrink B, Chibwana FD, Tumwebaze I, Russell Stothard J, \u003cem\u003eet al.\u003c/em\u003e Cryptic intermediate snail host of the liver fluke \u003cem\u003eFasciola hepatica\u003c/em\u003e in Africa. Parasites \u0026amp; Vectors.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2019;12 1:573; doi: 10.1186/s13071-019-3825-9.\u003c/li\u003e\n \u003cli\u003eKane RA, Stothard JR, Rollinson D, Leclipteux T, Evraerts J, Standley CJ, \u003cem\u003eet al.\u003c/em\u003e Detection and quantification of schistosome DNA in freshwater snails using either fluorescent probes in real-time PCR or oligochromatographic dipstick assays targeting the ribosomal intergenic spacer. Acta Tropica.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2013;128 2:241-9; doi: 10.1016/j.actatropica.2011.10.019.\u003c/li\u003e\n \u003cli\u003eNgcamphalala PI, Malatji MP, Mukaratirwa S. Geography and ecology of invasive Pseudosuccinea columella (Gastropoda: Lymnaeidae) and implications in the transmission of \u003cem\u003eFasciola\u003c/em\u003e species (Digenea: Fasciolidae) - a review. J Helminthol.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2022;96:e1; doi: 10.1017/s0022149x21000717.\u003c/li\u003e\n \u003cli\u003eHowell A, Mugisha L, Davies J, LaCourse EJ, Claridge J, Williams DJL, \u003cem\u003eet al.\u003c/em\u003e Bovine fasciolosis at increasing altitudes: Parasitological and malacological sampling on the slopes of Mount Elgon, Uganda. Parasites \u0026amp; Vectors.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2012;5 196; doi: 10.1186/1756-3305-5-196.\u003c/li\u003e\n \u003cli\u003eMadsen H, Stauffer JR. Schistosomiasis Control Under Changing Ecological Settings in Lake Malawi. EcoHealth.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2022;19 3:320-3; doi: 10.1007/s10393-022-01606-7.\u003c/li\u003e\n \u003cli\u003eAlharbi MH, Condemine C, Hesketh J, Kayuni SA, Arme TM, Archer J,\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e\u003cem\u003eBiomphalaria pfeifferi\u003c/em\u003e (Gastropoda: Planorbidae) in Lake Malawi and Upper Shire River, Mangochi District, Malawi: Distribution, Genetic Diversity and Pre-Patent Schistosome Infections. Tropical Medicine and Infectious Disease.\u003cem\u003e\u0026nbsp;\u003c/em\u003e2023;8 2:126.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Fasciola, Lake Malawi, lymnaeids, molecular xenomonitoring, Shire River Valley","lastPublishedDoi":"10.21203/rs.3.rs-3872783/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3872783/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eStarting in October 2021, quarterly malacological surveys have been undertaken in Malawi, sampling 12 specified freshwater habitats throughout a calendar year. Each survey monitors the presence of aquatic intermediate snail hosts of medical and veterinary importance; in March 2023, the alien lymnaeid species \u003cem\u003ePseudosuccinea columella\u003c/em\u003e was first encountered in Nsanje District. This species identity was later confirmed upon DNA analysis of mitochondrial ribosomal 16S sequences. In July 2023, \u003cem\u003eP. columella\u003c/em\u003e was also noted at single sites within Mangochi and Chikwawa Districts, and again in Nsanje District, with an additional location observed. Of particular importance, our sampled location in Mangochi District was directly connected to Lake Malawi which expands the species list of invasive molluscs in this lake. Whilst \u003cem\u003eP. columella\u003c/em\u003e is a well-known intermediate snail host for human and animal fascioliasis, screening collected snails for trematode cercariae, alongside molecular xenomonitoring, did not yield equivocal evidence of active fluke infection. However, the newly recognized presence of this alien intermediate snail host within Lake Malawi, and along the Shire River Valley, flags a new concern in altered local transmission potential for human and animal fascioliasis.\u003c/p\u003e","manuscriptTitle":"A first report of Pseudosuccinea columella (Say, 1817), an alien intermediate host for fascioliasis, in Malawi","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-22 17:32:51","doi":"10.21203/rs.3.rs-3872783/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-16T12:35:24+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-15T08:42:54+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-05T15:57:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"93f64ae4-18b2-4d86-ab37-d2cd52cc00e3","date":"2024-01-24T13:56:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"2477aa1e-859c-4103-b8b1-93658a62f3bb","date":"2024-01-23T11:27:49+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-22T12:05:23+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-19T13:10:35+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-19T12:55:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasites \u0026 Vectors","date":"2024-01-17T11:34:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5d13cecc-aac2-4b53-968c-424e9d6da80b","owner":[],"postedDate":"January 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-04-15T15:11:22+00:00","versionOfRecord":{"articleIdentity":"rs-3872783","link":"https://doi.org/10.1186/s13071-024-06241-5","journal":{"identity":"parasites-and-vectors","isVorOnly":false,"title":"Parasites \u0026 Vectors"},"publishedOn":"2024-04-11 15:02:14","publishedOnDateReadable":"April 11th, 2024"},"versionCreatedAt":"2024-01-22 17:32:51","video":"","vorDoi":"10.1186/s13071-024-06241-5","vorDoiUrl":"https://doi.org/10.1186/s13071-024-06241-5","workflowStages":[]},"version":"v1","identity":"rs-3872783","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3872783","identity":"rs-3872783","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.