Chloroquine Overcomes Chemotherapy Resistance and Suppresses Cancer Metastasis by Eradicating Dormant Cancer Cells

preprint OA: closed
Full text JSON View at publisher
Full text 147,287 characters · extracted from preprint-html · click to expand
Chloroquine Overcomes Chemotherapy Resistance and Suppresses Cancer Metastasis by Eradicating Dormant Cancer Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Chloroquine Overcomes Chemotherapy Resistance and Suppresses Cancer Metastasis by Eradicating Dormant Cancer Cells Irina Guzhova, Marina Mikeladze, Liubov Kuznetcova, Elena Komarova, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6237822/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Dec, 2025 Read the published version in Cell Death & Disease → Version 1 posted 9 You are reading this latest preprint version Abstract Tumor cell resistance to anticancer therapy and tumor relapse remain major challenges in cancer treatment. Chloroquine, an FDA-approved antimalarial drug currently undergoing clinical trials for various cancers, has emerged as a promising candidate for combination therapy with conventional anticancer agents. In this study, we demonstrate that in patients-derived osteosarcoma cells who had undergone multiple chemotherapy treatments, as well as in murine colorectal cancer cells, administration of standard chemotherapeutic agents induces autophagy, which likely serves as a cytoprotective mechanism promoting therapy resistance in at least of part of tumor population. Incorporating chloroquine into the treatment regimen effectively suppressed autophagy, significantly enhancing osteosarcoma cell death in both 2D and 3D models while simultaneously reducing cell proliferation and migration capacity. In an orthotopic in vivo model of colorectal cancer, the combination of chloroquine and oxaliplatin not only impaired tumor growth but also prevented metastatic dissemination and inhibited the formation of metastasis. Notably, comparative analyses of proliferating and dormant tumor cell populations revealed that chloroquine exerts preferential cytotoxicity toward dormant cancer cells. This suggests a dual therapeutic advantage, wherein cytostatic agents primarily eliminate proliferating cells, while chloroquine specifically eradicates dormant cancer cells, which are often implicated in tumor recurrence. Collectively, these findings highlight the potential of autophagy inhibition to enhance the chemotherapy efficacy and suggest chloroquine-based combination therapy as a promising strategy for suppressing tumor growth and metastasis, ultimately improving treatment outcomes in cancer patients. Biological sciences/Cell biology/Cell death Biological sciences/Cell biology/Autophagy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Osteosarcoma (OS) is a highly aggressive malignant tumor originating from bone tissue, characterized by limited treatment options and poor prognosis [ 1 ]. This neoplasm arises primarily from mesenchymal osteoblast precursor cells [ 2 ] and is predominantly localized in long tubular bones, with rare occurrences in the spine, pelvis, and sacral regions [ 3 ]. Colorectal cancer (CRC) ranks as the third most prevalent cancer globally, with an estimated 1.1 million new cases annually, and is the second leading cause of cancer-related mortality [ 4 ]. Although advancements in treatment have improved survival rates, metastatic colorectal cancer remains a lethal condition, with a 5-year survival rate of approximately 14% [ 5 ]. Metastasis occurs in 15–30% of patients, and 20–50% of those initially diagnosed with localized disease eventually develop metastatic spread. The liver is the most common site of metastasis, followed by the lungs, peritoneum, and distant lymph nodes [ 6 ]. Acquired drug resistance is a form of resistance that develops during the treatment of tumors that initially exhibit high sensitivity to therapeutic agents. This resistance arises due to the emergence of genetic mutations or the activation of adaptive cellular mechanisms [ 7 ]. Additionally, acquired resistance can lead to cross-resistance, where tumors become resistant to chemotherapeutic agents with distinct mechanisms of action, even to those not previously administered to the patient. Consequently, addressing drug resistance is critical for improving outcomes in cancer therapy [ 8 ]. Autophagy is a fundamental cellular process that facilitates the degradation and recycling of damaged organelles, protein aggregates, and other cytoplasmic components through the lysosomes. This process is essential for cellular homeostasis, adaptation to nutrient deprivation, immune regulation, and facilitation of apoptosis. Autophagy is classified into three major forms: macroautophagy, microautophagy, and chaperone-mediated autophagy [ 9 ]. Among which, macroautophagy is the most studied, whereby cellular components are sequestered within double-membraned autophagosomes, which subsequently fuse with lysosomes to form autophagolysosomes for degradation. This process is regulated by autophagy-related genes (ATGs) and plays a role in the turnover of organelles such as mitochondria, the endoplasmic reticulum, and ribosomes, as well as proteins, lipids, and RNA [ 10 ]. As tumors grow, their increasing metabolic demands often exceed the capacity of the local vasculature, leading to hypoxia and nutrient deprivation in poorly perfused tumor regions, known as necrotic foci. In response to these stress conditions, tumor cells undergo metabolic reprogramming, which frequently involves the activation of autophagy that enhances nutrient recycling and provides metabolic plasticity, enabling tumor cells to survive under stress [ 11 ]. The harsh conditions within the tumor microenvironment also facilitate the development of metastases [ 12 ]. The efficiency of colonization during the later stages of metastasis is influenced by the rate of micrometastasis formation, which depends on the ability of tumor cells to adapt to novel stromal interactions. Growing evidence highlights the critical role of autophagy in the metastatic cascade [ 13 ], as it supports the survival of dormant tumor cells [ 14 ], circulating tumor cells [ 15 ], and tumor stem cell (CSC) subpopulations, which are key mediators of invasion and treatment resistance [ 16 ]. Given the critical role of autophagy in tumor survival and metastasis, autophagy inhibition has emerged as a promising therapeutic strategy. Chloroquine (CQ) and its derivative hydroxychloroquine (HCQ) are well-established antimalarial agents belonging to the 4-aminoquinoline class. They are widely used for the prevention and treatment of malaria, extraintestinal amebiasis, and rheumatic diseases, as well as for managing inflammation [ 17 ]. More recently, CQ has gained attention as a potential anticancer agent, both as a monotherapy and in combination with other drugs due to its ability to inhibit autophagy and enhance tumor cell sensitivity to chemotherapy [ 18 , 19 ]. The primary aim of this study was to investigate the impact of chloroquine on the resistance of osteosarcoma and colorectal cancer cells to chemotherapy. Additionally, we sought to evaluate how chloroquine influences the metastatic potential of colorectal cancer. Materials and Methods Cell lines and culture conditions Osteosarcoma cell lines, OS921 and OS1056, were derived from patients undergoing chemotherapy at the N.N. Petrov National Medical Research Center of Oncology, Ministry of Health of the Russian Federation (St. Petersburg, Russia). These cell lines were established from lung metastases obtained during surgical procedures. The research protocol was approved by the local ethical committee, and all patients provided written informed consent prior to tissue collection. Tumor samples were preserved in compliance with the Helsinki Declaration and utilized in accordance with the Human Tissue Act of 2004. All patients had undergone multiple surgical interventions due to disease progression. OS921 cells were derived from conventional osteogenic sarcoma in a 13-year-old female patient who had received seven cycles of EURAMOS and two cycles of ICE chemotherapy prior to sample collection. The patient passed away two and a half months after sample collection. OS1056 cells were derived from chondroblastic osteosarcoma in a 39-year-old female patient who had undergone three lines of polychemotherapy (MAP, GemTax, and sorafenib/bevacizumab) before sample collection. The patient died nine months after sample collection. Osteosarcoma cells were isolated from tumor samples and cultured as previously described [ 20 ]. Cells were maintained for at least ten passages before experimentation. Human osteosarcoma HOS cell line and human lung carcinoma A549 and H1299 cell lines were obtained from the “Collection of Vertebrate Cell Cultures,” supported by a grant from the Ministry of Education and Science of the Russian Federation (Agreement No. 075-15-2021-683). Mouse colorectal carcinoma cells CT-26iRFP720luc (referred to as CT-26 luc) were transfected with the pHIV-iRFP720-E2A-Luc vector, as described previously [ 21 ]. All osteosarcoma cell lines were cultured at 37°C in a humidified atmosphere of 5% CO₂, using DMEM/F12 medium supplemented with 10% fetal bovine serum (Gibco, USA), 100 U/ml penicillin G, and 0.1 mg/ml streptomycin (Capricorn Scientific, Germany). CT-26 luc, A549, and H1299 cells were maintained under similar conditions in DMEM medium with identical supplements. Cell viability was assessed using trypan blue exclusion staining. Only cell populations with a viability of ≥ 95% were used for experiments. Cell counting was performed using a Luna II Cell Counter (Logos Biosystems, South Korea). Drug treatments For osteosarcoma cells, Etoposide (Okasa Pharma, India) was administered at 1, 2.5, and 5.8 µM for 24 hours. In combination treatment, cells were pretreated with 25 µM chloroquine (CQ; Sigma, USA) for 16 hours, followed by the addition of etoposide (1, 2.5, or 5.8 µM) for a subsequent 24-hour period. For CT-26 luc cells, they were pretreated with 0.8 µM chloroquine for 16 hours, followed by exposure to 10, 20, or 30 µM oxaliplatin (OxP; Okasa Pharma, India). Determination of cell viability and proliferation: Osteosarcoma cells sensitivity to etoposide was assessed using the MTT assay. HOS, OS921, and OS1056 cells were seeded in 96-well plates at a density of 20,000 cells/well. Cells were treated with 25 µM chloroquine (CQ) for 16 hours, followed by the addition of etoposide at the specified concentrations. After 24 hours of incubation, the medium was removed, and 100 µL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Paneco, Russia) solution (0.5 mg/mL) was added to each well. Plates were incubated for 3–4 hours, after which the MTT solution was removed, and the resulting formazan crystals were dissolved in dimethyl sulfoxide (DMSO; Biolot, Russia). Optical density was measured using a Varioskan LUX Multimode Microplate Reader (Thermo Scientific, USA). Data were presented as the percentage of viable cells relative to the control. Cell viability, proliferation, and migration were monitored using the xCELLigence system (ACEA Biosciences, San Diego, CA, USA), which provides non-invasive, real-time, label-free measurements based on electrical impedance. Increased impedance corresponds to greater cell adhesion and growth. CT-26 luc cells were seeded into E-plates, treated first with 0.8 µM CQ, and after 16 hours, 20 µM oxaliplatin (OxP) was added. The cell index was recorded continuously for 60 hours. HOS, OS921, and OS1056 cells were seeded into E-plates, treated with 25 µM CQ, followed by 1 µM etoposide, and their proliferation was monitored over 50–90 hours. The proliferative activity of dormant vs. growing A549 cells was compared by seeding cells into E-plate wells at 20,000 cells/well and incubating in medium containing 10%, 0.1%, or 0% FBS for 270 hours to assess dormancy and growth dynamics. Real-time polymerase chain reaction (RT-PCR) Real-time polymerase chain reaction (RT-PCR) RT-PCR was used to assess the expression of autophagy markers, epithelial-mesenchymal transition (EMT) markers, and stemness-related genes. Total RNA was isolated using TRIzol reagent (Thermo Fisher Scientific, USA). Reverse transcription was performed using the MMLV RT kit (Eurogen LLC, Russia) following the manufacturer’s protocol. RT-PCR reactions were conducted using a CFX96 Real-Time PCR system (BioRad, USA). DNA amplification was performed using the qPCRmix-HS SYBR kit (Eurogen LLC, Russia) according to the manufacturer’s instructions. Primers were purchased from Evrogen LLC (Moscow, Russia), and the sequences are listed in Table 1 . Table 1 Gene Forward Reverse ULK1 5`-ATGATTCTACCCACGGCAAG- 3` 5`-CTGGAAGATGGTGATGGGTT- 3` Atg7 5`-AAGCCATGATGTCGTCTTCCTAT-3` 5`-GCATTGATGACCAGCTTTCTCTT- 3` Snail1 5`-ATGAGGAATCTGGCTGCTGC-3` 5`-CAGGAGAAAATGCCTTTGGA- 3` TWIST 5`-TGCATGCATTCTCAAGAGGT-3` 5`-CTATGGTTTTGCAGGCCAGT- 3` Luciferase 5`-CTGGAAGATGGTGATGGGTT- 3` 5’-ACGAAGGTGTACATGCTTTGGA-3’ Aurka 5`-GCTGGAGAGCTTAAAATTGCAG-3` 5`-TTTTGTAGGTCTCTTGGTATGTG-3` CD44 5`-ACATCCTCACATCCAACACCTC-3` 5`-GCAGGTCTGTGACTGATGTACA-3` ADLH1 5`-AGGAGCCGAATCAGAAATGTCA-3` 5`-CAAATCGGTGAGTAGGACAGGT-3` Ki67 5`-TCCTAGGAAAACTCCAGTTGCC-3` 5`-AGACACTCTCTTTGAAGGCAGG-3` Actin 5`- TATGTTGCCCTAGACTTCGAGC − 3` 5`- CGATAGTGATGACCTGACCGTC − 3 Determination of apoptosis and cell cycle analysis Apoptosis in cancer cells and fibroblasts was analyzed using Annexin V/PI staining and flow cytometry. Following the indicated experimental procedures, conditioned media were collected, and cells were detached, pooled with the respective media, centrifuged, washed with cold PBS, and stained with Annexin V Alexa 647 (Thermo Fisher Scientific, USA) and propidium iodide (PI) according to the manufacturer's protocol. Flow cytometry was performed using a CytoFlex Flow Cytometer (Beckman Coulter, USA), and data were analyzed with CytExpert 2.0 software. For cell cycle analysis, 0.5–1 × 10 6 cells were harversted, resuspended in 0.5 mL PBS, fixed with cold 100% ethanol, and incubated on ice for 20 minutes. After centrifugation at 1,000 rpm for 5 minutes, the ethanol was removed, and the pellet was dried at room temperature. Cells were then stained with a PI-RNAase solution (50 µg/mL PI (Sigma-Aldrich, USA) and 100 µg/mL RNAse Type I-A (Biolot, Russia)) and incubated in the dark for 20 minutes. Approximately 50,000–100,000 cells were analyzed using the CytoFlex Flow Cytometer, and data were processed with CytExpert 2.0 software. Analysis of tumor cell motility The motility of osteosarcoma cells was evaluated using a wound healing assay. HOS, OS921, and OS1056 cells were seeded in 12-well plates at a density of 100,000 cells/mL. Upon reaching 80% confluence, a scratch was made using a culture scraper. Cells were pre-treated with 25 µM CQ for 16 hours, followed by the addition of 1, 2.5, or 5.8 µM etoposide for 24 hours. Wound healing was monitored for 48 hours using a JuLI Stage microscope, and images were analyzed with JuLIV 2.0 software. For CT-26luc cells, a migration assay was performed using a CIM plate. Cells were seeded in serum-free medium in the upper chamber, while the lower chamber contained medium with 10% FBS. Cells were treated with CQ and OxP at the indicated concentrations and monitored for 50 hours using the xCELLigence system (RTCA DP xCelligence, ACEA Biosciences, USA). Data were analyzed using RTCA Analysis Software (RTCA Software Pro, ACEA, San Diego, CA, USA). Colony formation assay HOS, OS921, and OS1056 cells were seeded in 6-well plates at 200,000 cells/well and treated with 25 µM CQ and etoposide at 1, 2.5, or 5.8 µM. After 24 hours, cells were washed and reseeded at 1,000 cells/well. Colonies were allowed to form for nine days, fixed with 10% formaldehyde, and stained with 0.01% crystal violet (Sigma-Aldrich, USA). Plates were scanned using a ChemiDoc system (Bio-Rad, USA), and colony numbers were quantified using ImageJ. Osteosarcoma spheroid model and ATP activity assay For the spheroid model, 50 µL of 1.5% agarose in DMEM/F12 medium was added to 96-well plates. HOS, OS921, and OS1056 cells were seeded at 30,000 cells/mL in 200 µL medium and incubated for 3–7 days. After spheroid formation, treatments were applied as described. Morphological changes were assessed after 96 hours using a Zeiss Axiovert 40CFL microscope and Zeiss AxioCam ERc 5s camera (Carl Zeiss MicroImaging GmbH, Germany). ATP activity was measured in 3D spheroid models using the EzCount ATP Cell Assay Kit (HiMedia, USA). After treatment, spheroids were transferred to luminescence plates, and firefly luciferase was added according to the manufacturer’s instructions. ATP levels were quantified by luminescence using a Varioskan LUX Multimode Microplate Reader. Western blotting Western blotting was used to evaluate autophagy markers in osteosarcoma and CT-26luc cells. HOS, OS921, and OS1056 cells were treated with 1, 2.5, or 5.8 µM etoposide, while CT-26luc cells were treated with oxaliplatin at 10, 20, or 30 µM for 24 hours. Protein lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM PMSF, 1% Triton X-100, 10% glycerol), centrifuged at 13,500 rpm, 4º C for 15 minutes, and protein concentrations were determined using the Bradford assay. Samples were then diluted in sample buffer, separated by SDS-PAGE, transferred onto nitrocellulose membranes, and probed with antibodies against Atg5, Beclin1, LC3A/B (Cell Signaling Technology, USA), SQSTM1/p62 (Abcam, UK), and α-tubulin (Thermo Fisher, USA). Secondary anti-rabbit antibodies conjugated with peroxidase (Abcam, UK) were used, and detection was performed using SuperSignal West Femto reagent on a ChemiDoc system (Bio-Rad, USA), and band intensities were analyzed using ImageJ. Animals All in vivo experimental protocols were approved by the Licensing Committee of the Institute of Cytology, Russian Academy of Sciences (Identification number: F18-00380). All procedures were conducted in compliance with relevant guidelines and regulations and are reported in accordance with the ARRIVE guidelines. Preparation of tumor cells for administration On the day of the procedure, CT-26luc cells in the logarithmic growth phase harvested, centrifuged at 1500 rpm for 5 minutes, and resuspended in serum-free DMEM. The cell count was determined, and the appropriate number of cells per mouse was prepared in 1 mL of medium. Five minutes prior to injection, cells were centrifuged again at 1,500 rpm for 5 minutes, and the pellet was resuspended in a 1:1 mixture of 50 µL serum-free DMEM and 50 µL Matrigel (Corning Incorporated, USA). Orthotopic tumor cell injection and treatment protocol Eighty female BALB/c mice were used for the experiments. Animals were anesthetized with a mixture of Zoletil-100 (tiletamine hydrochloride and zolazepam, Virbac, France) and Rometar (xylazine hydrochloride, Bioveta, Czech Republic) diluted in saline, administered intraperitoneally at 100 µL per mouse. After confirming the absence of a corneal reflex, abdominal area was shaved, disinfected, and a small incision was made to expose the cecum. Tumor cells (1 × 10⁶ per mouse) were injected into the submucosal layer of the cecum. Throughout the procedure, internal organs were periodically moistened with saline to prevent desiccation. After tumor cell injection, the abdominal wall was sutured, and diclofenac (Atoll, Russia) was administered for postoperative analgesia. Seven days post-inoculation, mice were randomly divided into four groups (n = 20 per group): Group 1 (Untreated): Received saline as a control, Group 2 (CQ): Treated with chloroquine (20 mg/kg) three times per week, Group 3 (OxP): Treated with oxaliplatin (50 mg/kg) once per week, and Group 4 (CQ + OxP): Received a combination of chloroquine and oxaliplatin at the same doses and schedules as in Groups 2 and 3. On day 30, 10 mice from each group underwent intravital bioluminescence imaging, after which they were euthanized and dissected to visually assess the presence of organ metastases. Then, the cecum, liver, lungs, and spleen were harvested for luciferase expression analysis using real-time PCR. The remaining 10 mice per group continued treatment for survival analysis. Intravital bioluminescence imaging Luciferin was dissolved in DPBS (Paneco, Russia) at 30 mg/mL. Mice were injected with 100 µL of luciferin and anesthetized using isoflurane (Aerrane). Luminescence was detected using an IVIS Spectrum In Vivo Imaging System (PerkinElmer, USA) in automatic signal accumulation mode. RNA isolation from organs and luciferase expression analysis Following euthanasia, the cecum, liver, lungs, and spleen were collected, rinsed in PBS, and cut into small fragments. Tissue homogenization was performed using ultrasound in ExtractRNA solution (Evrogen, Russia) at a ratio of 100 mg of tissue per 1 mL of reagent. Total RNA was then extracted according to the manufacturer's protocol. Luciferase expression was quantified using RT-PCR using a CFX96 Real-Time PCR System (Bio-Rad, USA) with primers listed in Table 1 . Statistical Analysis Data are presented as mean ± standard error of the mean (SEM). Statistical analyses were performed using GraphPad Prism 10.4.0. The Mann-Whitney U-test was used to compare groups, with statistical significance set at p < 0.05. Survival analysis was conducted using Kaplan-Meier curves. Results Anticancer drugs etoposide and oxaliplatin induce autophagy activation in osteosarcoma and colorectal cancer cells Previous studies have reported that cisplatin can induce autophagy in tumor cells, which may either promote cell death or contribute to drug resistance [ 22 ]. To explore this further, we selected osteosarcoma cells, which are commonly treated with etoposide, and murine colorectal cancer cells, for which platinum-based drugs are indicated [ 23 , 24 ]. In this study, we utilized the well-established HOS osteosarcoma cell line and two additional cell lines, OS921 and OS1056, derived from lung metastases of osteosarcoma patients who had undergone multiple chemotherapy regimens. The patient-derived cells exhibited morphology similar to HOS cells (Fig. 1 A) but demonstrated significantly higher resistance to etoposide compared to HOS cells (Fig. 1 B). To evaluate the impact of etoposide and oxaliplatin on autophagy activation, we performed RT-PCR to assess the expression of ULK1 and Atg7. Osteosarcoma cell lines HOS, OS921, and OS1056 were treated with etoposide at concentrations of 1, 2.5, and 5.8 µM, while CT-26 colorectal cancer cells were treated with oxaliplatin at concentrations of 10, 20, and 30 µM. In all cell lines, we observed a dose-dependent increase in the expression of both ULK1 and Atg7 (Fig. 1 C–F). Western blot analysis further confirmed autophagy activation, showing a dose-dependent increase in the levels of Atg5 and LC3-II, along with a decrease in p62 levels, a marker of autophagic flux (Fig. 1 G–J). In HOS cells, we also evaluated Beclin 1 expression, which increased more than 5.5-fold following treatment with 5.8 µM etoposide (Fig. 1 G, K). These findings, which focus on downstream markers of autophagy, strongly suggest that both etoposide and oxaliplatin stimulate autophagy activation in osteosarcoma and colorectal tumor cells. Chloroquine enhances the efficacy of etoposide in osteosarcoma and oxaliplatin in colorectal cancer Autophagy predominantly serves as a protective cellular mechanism in cancer cells, often contributing to malignant progression and chemotherapy resistance [ 25 ]. It is also associated with cellular processes such as dormancy and senescence [ 26 ]. To investigate whether autophagy modulation would overcome chemotherapy resistance in osteosarcoma, we selected chloroquine (CQ) as an autophagy inhibitor. CQ is FDA-approved for other diseases and has demonstrated efficacy in overcoming resistance in colorectal cancer cells [ 27 ]. To determine a safe concentration of CQ for normal cells, we conducted cytotoxicity assays using dermal fibroblasts (DF2). Both CQ alone and in combination with etoposide were tested, and we found that 25 µM CQ was non-toxic to normal cells, including when combined with etoposide at various concentrations (Fig. S1 ). However, surprisingly, initial experiments combining CQ and etoposide simultaneously on osteosarcoma cells demonstrated no significant difference in cell viability compared to etoposide treatment alone (Fig. S2). To optimize the treatment regimen, we pre-treated tumor cells with CQ for 16 hours and subsequently applied etoposide as previously described in [ 28 ]. Using the MTT assay, we observed a significant reduction in the viability of all three osteosarcoma cell lines following sequential treatment. This effect was particularly pronounced in patient-derived osteosarcoma cells resistant to etoposide. Specifically, in HOS cells treated with 5.8 µM etoposide alone, 37.0 ± 0.5% of cells survived, whereas pre-treatment with CQ reduced survival to 15.8 ± 1.8%. For OS921 cells, etoposide alone resulted in 56.3 ± 2.1% viability, while CQ pre-treatment reduced this to 21.6 ± 2.3%. Notably, OS1056 cells, which displayed high resistance to etoposide, exhibited 95.5 ± 0.7% survival with etoposide alone, but this dropped to 35.1 ± 0.3% with CQ pre-treatment (Fig. 2 A). Interestingly, the opposite effect was observed in dermal fibroblasts, where CQ pretreatment increased cell viability. At the highest etoposide concentration, 70 ± 1.5% of fibroblasts remained viable after etoposide alone, compared to 85.3 ± 3.1% with CQ pretreatment (Fig. 2 B). To further explore the mechanism of cell death, we performed Annexin V/PI staining followed by flow cytometry. Our results revealed that both etoposide alone and its combination with CQ induced cell death through apoptosis and necrosis, but CQ pre-treatment significantly favored and prompted apoptotic cell death in osteosarcoma cells (Fig. 2 C, D). We further validated these findings using xCELLigence technology, which allows real-time monitoring of cell viability. In all three osteosarcoma cell lines, CQ pretreatment led to nearly complete cell death, which occurred more rapidly and efficiently than with etoposide alone (Fig. 3 A). Similar results were observed in CT-26 colorectal cancer cells treated with a combination of 0.8 µM CQ and 20 µM OxP, where the cell index was more than twofold lower compared to oxaliplatin alone (Fig. 3 B). Next, we examined the effect of CQ and etoposide in a 3D spheroid model, which better mimics tumor behavior in vivo . Spheroids were treated with CQ, etoposide at 1, 2.5, or 5.8 µM, or their combination. The most pronounced effect was observed in HOS spheroids treated with 5.8 µM etoposide and CQ, where spheroids lost their defined contours and began disintegrating after 96 hours. More resistant OS921 and OS1056 spheroids exhibited complete degradation with a combination of CQ and only 1 µM etoposide (Fig. 3 C). To confirm these observations, we measured ATP levels using the EZcount™ ATP Cell Assay Kit. ATP, produced by metabolically active and viable spheroid cells, generates bioluminescence upon oxidation of D-luciferin by firefly luciferase. While CQ- and etoposide-treated HOS spheroids maintained some structural integrity, ATP activity was nearly undetectable. Similarly, ATP depletion confirmed near-total cell death in OS921 and OS1056 spheroids pre-treated with 25 µM CQ, further supporting the effectiveness of this combination therapy (Fig. 3 D). Our results demonstrate that chloroquine significantly enhances the cytotoxic effects of etoposide in osteosarcoma and oxaliplatin in colorectal cancer cells. Importantly, this combination therapy effectively overcomes chemotherapy resistance, particularly in patient-derived osteosarcoma cells, while protecting normal fibroblasts. These findings highlight the potential clinical relevance of chloroquine as an adjuvant to conventional chemotherapy CQ, introduced into the chemotherapy regimen, prevents the ability of osteosarcoma and mouse colorectal cancer cells to develop metastatic phenotype in vitro and in vivo . Both osteosarcoma and colorectal cancer are highly metastatic and prone to recurrence, posing significant therapeutic challenges [ 29 , 30 ]. To evaluate whether chloroquine (CQ) enhances the efficacy of chemotherapy in preventing metastasis, we assessed the impact of CQ on cell migration, epithelial-mesenchymal transition (EMT) markers, proliferative capacity from a dispersed population in vitro , as well as tumor growth and metastasis in vivo . While osteosarcoma cells are non-epithelial, CQ treatment significantly reduced the expression of Snail1 and TWIST in OS921, OS1056, and the control HOS cell line. Etoposide alone had no effect on these markers, but the combination of CQ and etoposide significantly downregulated their expression in osteosarcoma cells (Fig. 4 A). In the wound healing assay, etoposide monotherapy had no substantial impact on scratch closure, while preincubation with 25 µM CQ led to a modest, though significant, reduction in wound closure compared to untreated cells (Fig. 4 A,B). The migratory capacity of CT-26 cells was assessed using xCELLigence technology with CIM plates, which quantify cell migration through serum gradient-driven transwell migration. CQ-treated cells exhibited high migratory ability, similar to control cells, whereas etoposide monotherapy significantly reduced migration. The combination of CQ and etoposide further suppressed cell migration (Fig. 4 C). The colony formation assay, which assesses the ability of tumor cells to proliferate from a dispersed population, mimicking their potential to relapse, revealed that sparsely seeded cells retained their ability to form colonies under etoposide treatment. However, preincubation with 25 µM CQ followed by etoposide (1, 2.5, or 5.8 µM) completely abolished colony formation in all three osteosarcoma cell lines (Fig. 4 D, E). To evaluate the efficacy of CQ in sensitizing tumor cells to oxaliplatin therapy in vivo , we orthotopically injected 1×10 6 CT-26luc cells into the cecal mucosa of BALB/c mice. Mice were randomly divided into four groups (n = 20 per group): Untreated, CQ, OxP, and combination treatment (CQ + OxP). Treatment commenced on day 8 post-inoculation and continued until the experiment's conclusion. Ten mice per group were observed for survival analysis, while the remaining ten underwent bioluminescence imaging at day 30 for metastasis assessment in the lungs, liver and spleen. Bioluminescence imaging of CT-26luc tumors revealed that both CQ and oxaliplatin monotherapies slowed tumor growth. The ROI signal in the ‘CQ’ group was 1.8×10 10 ± 9.9×10 8 , compared to 1.7×10 9 ± 6.3×10 7 in the ‘Untreated’ group. The ‘OxP’ group exhibited a statistically significant tumor size reduction (ROI = 7.1×10 9 ± 2.3×10 7 , p < 0.005), while the ‘CQ + OxP’ combination produced the most substantial effect, reducing ROI to 2.4×10 8 ± 1.0×10 6 on day 30 (Fig. 5 A, B). Accordingly, tumor growth inhibition correlated with prolonged survival. The median survival time was 29 ± 1.2 days in the ‘Untreated’ group, 29.8 ± 1.2 days in the ‘CQ’ group, 33.7 ± 1.2 days in the ‘OxP’ group, and 39.7 ± 1.4 days in the ‘CQ + OxP’ group. By day 45, one mouse remained alive in both the ‘CQ’ and ‘OxP’ groups, while three mice survived in the ‘CQ + OxP’ group (Fig. 5 C). Furthermore, visual and molecular analyses were performed to assess metastasis. Visual examination of metastases revealed that animals in the ‘Untreated,’ ‘CQ,’ and ‘OxP’ groups developed metastases in the spleen and liver, while the combination group exhibited no detectable metastases in any organ (Fig. 5 D). To confirm these findings, we performed RT-PCR for luciferase expression in excised organs. Three mice from the ‘Untreated’ group and two from ‘CQ’ died before the experiment. Luciferase levels at the primary tumor site were 1.3 ± 0.1 in the ‘Untreated’ group, 1.1 ± 0.2 in the ‘CQ’ group, 0.8 ± 0.1 in the ‘OxP’ group, and 0.4 ± 0.1 in the ‘CQ + OxP’ group, with the latter demonstrating significant reduction compared to the untreated control (p = 0.0023). Notably, luciferase was undetectable in one mouse from the ‘CQ’ and ‘OxP’ groups and in five mice from the ‘CQ + OxP’ group, suggesting remarkable successful treatment by the combination therapy (Fig. 5 E). In the ‘Untreated’ group, all but one mouse developed lung metastases, three of which also exhibited both liver and spleen metastases. In the ‘CQ’ group, four mice developed lung metastases, one had liver metastases, and two had spleen metastases. Additionally, one mouse showed a high luciferase signal in the spleen, indicating metastatic presence. In total, five out of eight mice in this group developed metastases. In the ‘OxP’ group, only one mouse developed lung metastases. Another mouse developed metastases in both the liver and spleen, leading to a total of two out of 10 mice exhibiting metastatic spread. Remarkably, in the CQ + OxP combination group, no mice developed metastases in the lung, liver, or spleen (Fig. 5 E). Conventional cancer treatments, such as chemotherapy and radiotherapy, often fail to completely eradicate all cancer cells, leading to the survival of residual populations and the enrichment of stem-like dormant cells. These cells exhibit enhanced resistance to therapy and increased autophagy activity, contributing to the formation of micrometastases and elevating the risk of cancer recurrence [ 31 ]. To investigate the mechanism by which CQ, in combination with OxP, dramatically suppresses metastasis, we established an in vitro dormancy model using serum depletion in cancer cells, and compared CQ’s effects on the viability of proliferating versus dormant cancer cells. When cells enter dormancy, they cease proliferation (Fig. 6 A) and arrest at the G0/G1 phase of the cell cycle (Fig. 6 B). Dormant cells exhibited reduced expression of proliferation markers (Aurka and Ki67) by day 5 of starvation. Meanwhile, dormant cells demonstrated increased expression of autophagy-related genes ULK1 and Atg7 in addition to displaying elevated levels of EMT markers ZEB1, TWIST, and Vimentin. Additionally, they acquired features of cancer stem cells, including elevated CD44 and ALDH1 expression (Fig. 6 C). Notably, dormant cells demonstrated resistance to antitumor drugs in both 2D (Fig. 6 D) and 3D lung cancer cell models (Fig. 6 E,F) Using Annexin V and propidium iodide (PI) staining followed by flow cytometry, we demonstrated that CQ preferentially induced cell death in the dormant population of lung cancer cells, primarily through necrosis, although apoptosis was also observed (Fig. 6 G–J). Following CQ treatment, 77.9% of proliferating A549 cells remained viable, whereas only 38.3% of dormant A549 cells survived (Fig. 6 G,H). Similarly, in H1299 cells, 82.9% of proliferating cells survived compared to just 34% of dormant cells (Fig. 6 I,J,). These findings suggest that in our in vivo experiments (Fig. 5 ), the combination of OxP and CQ targeted distinct tumor cell populations, whereby OxP primarily eliminated proliferating cancer cells, while CQ, primarily by suppressing autophagy, effectively eradicated resistant dormant cells that aroused as a result of chemotherapy. This dual mechanism likely contributes to the significant reduction in metastasis observed in the CQ + OxP treatment group. Discussion Resistance to anticancer drugs, tumor relapse, and metastasis remain major challenges in cancer therapy, with extensive research has been dedicated to address these challenges in cancer patients. Among the various strategies explored, combination therapies have emerged as a promising approach to circumvent resistance mechanisms by integrating conventional chemotherapies with immunotherapies, targeted therapies, and inhibitors of cellular proteostasis, beyond others. Our research group has focused on disrupting tumor cell resistance by targeting key components of the cellular proteostasis system. For instance, we previously demonstrated that the HSF1 inhibitor CL-43 substantially sensitized colorectal and lung carcinoma cells to chemotherapy [ 32 , 33 ]. Here, we explored autophagy inhibition as a potential strategy to counteract therapy resistance. While the role of autophagy in cancer is highly context-dependent and varies across tumor types, accumulating evidence underscores its critical involvement in cancer progression and therapy resistance [ 16 , 34 ]. Autophagy is induced in response to tumor-associated hypoxia and has been shown to mediate chemoresistance in colon cancer models [ 35 , 36 ]. Furthermore, several studies have reported a protective role of autophagy in osteosarcoma, glioblastoma, and acute myeloid leukemia, where its inhibition using CQ significantly reversed chemoresistance [ 37 – 38 ]. Recent findings, including our own, suggest that autophagy serves as a pro-survival compensatory mechanism following cellular proteostasis disruption, such as Hsp70 inhibition or proteasome blockade. However, this adaptive response can be effectively counteracted using autophagy inhibitors like CQ and SAR405 [ 39 – 44 ]. Thus, autophagy likely emerges as a universal hallmark of chemoresistance, enabling cancer cells to withstand therapy-induced stress. In our work, we examined not only established osteosarcoma cell lines but also patient-derived lung metastasis cells from individuals with osteosarcoma who had undergone multiple courses of therapy and experienced recurrent relapses. These patient-derived cells exhibited pronounced resistance to etoposide and showed enhanced autophagy activation in response to treatment. This observation led us to explore the therapeutic potential of autophagy inhibition by combining CQ with standard anticancer drugs. Our findings demonstrate that pre-treatment with CQ, administered 16 hours prior to etoposide, significantly impaired osteosarcoma cell resistance and sensitized them to chemotherapy. This was confirmed using multiple experimental approaches, including MTT assays, apoptosis quantification, xCELLigence real-time monitoring, and 3D spheroid models. CQ has been widely studied as a monotherapy and has been shown to induce cell death across various cancer types [ 27 , 45 – 47 ]. Preclinical studies have further demonstrated that CQ inhibits autophagy and reduces tumor growth in bladder cancer and pancreatic adenocarcinoma models [ 48 ]. Additionally, the combination of CQ with alkylating agents has been shown to suppress tumor growth in a mouse model of B-cell lymphoma [ 49 , 50 ]. Metastasis remains a key challenge in cancer therapy, often limiting curative treatment options [ 51 ]. In our study, the combination of CQ with anticancer drugs significantly downregulated EMT markers and reduced cell motility in both osteosarcoma and CT-26luc colorectal cancer cells. In colony formation assays, CQ-treated osteosarcoma cells lost their ability to resume tumor growth, highlighting its potential in preventing cancer cell repopulation and recurrence. Furthermore, half of the treated animals with osteosarcoma, the primary tumor failed to reach a sufficient size for analysis, underscoring the potent efficacy of this therapeutic approach. Although numerous preclinical studies have investigated CQ as an autophagy inhibitor in combination with chemotherapy, most in vivo experiments have relied on subcutaneous tumor models [ 46 , 52 , 53 ]. However, these models do not accurately recapitulate the tumor microenvironment and fail to mimic the metastatic process. In contrast, our study employed an orthotopic model in which CT-26luc cells were injected into the submucosa of the mouse cecum. This approach closely resembles the natural progression of colorectal cancer in patients and facilitates spontaneous metastasis to distant organs, such as the liver, lungs, and spleen. As a result, we observed metastases in the liver, lungs, and spleen in untreated animals and in those receiving monotherapy. Importantly, no detectable metastases were found in mice treated with the OxP + CQ combination, as confirmed by the absence of luciferase signals in metastatic organs. Our findings further indicate that CQ may substantially suppress metastasis by primarily targeting dormant cancer cells. In our in vitro dormancy model, CQ was significantly more cytotoxic to dormant cells than proliferative ones. This suggests that the combination of chemotherapy and CQ exerts a dual therapeutic effect: while conventional anticancer drugs eliminate actively proliferating tumor cells, CQ effectively eradicates dormant cells, which are otherwise resistant to standard therapies [ 16 , 54 ]. This therapeutic approach may provide a more comprehensive strategy for preventing both tumor regrowth and metastasis. Our study demonstrates that autophagy inhibition via CQ enhances the therapeutic efficacy of etoposide and oxaliplatin, leading to a significant reduction in cancer progression and metastasis compared to monotherapy. These findings, in conjunction with ongoing research efforts, support the potential of combining autophagy inhibitors with standard chemotherapy as a promising strategy for the treatment of osteosarcoma and colorectal cancer. Further investigations, particularly in clinical settings, are warranted to validate the translational relevance of this approach. Declarations Acknowledgement: Authors cordially thank Ms. Maria Istomina (Almazov National Medical Research Centre, St.Petersburg, Russia) for the help with animal experiments Conflict of Interests : Authors declare that they have no competing interests Ethics Approval All in vivo experimental protocols were approved by the licensing committee of the Institute of Cytology of the Russian Academy of Sciences (Identification number F18-00380). All methods were carried out in accordance with relevant guidelines and regulations and are reported in accordance with ARRIVE guidelines. The research protocol for receiving cells from patients was approved by the local ethical committee, and all patients provided written informed consent prior to tissue collection. Tumor samples were preserved in compliance with the Helsinki Declaration and utilized in accordance with the Human Tissue Act of 2004. References Lindsey BA, Markel JE Kleinerman ES. Osteosarcoma Overview. Rheumatol Ther; 4, 25–43 (2017) Otani S, Ohnuma M, Ito K & Matsushita Y. Cellular dynamics of distinct skeletal cells and the development of osteosarcoma. Front Endocrinol (Lausanne) 14, 1181204 (2023) Luetke A, Meyers PA, Lewis I & Juergens H. Osteosarcoma treatment - where do we stand? A state of the art review. Cancer Treat Rev 40, 523–532 (2014) Siegel RL, Wagle NS, Cercek A, Smith RA & Jemal A. Colorectal cancer statistics, 2023. CA Cancer J Clin 73, 233–254 (2023) Biller LH & Schrag D. Diagnosis and Treatment of Metastatic Colorectal Cancer: A Review. JAMA 325, 669–685 (2021) Cervantes A, Adam R, Roselló S, Arnold D, Normanno N, Taïeb J; ESMO Guidelines Committee. Metastatic colorectal cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Ann Oncol 34, 10–32 (2023) Holohan C, Van Schaeybroeck S, Longley DB & Johnston PG. Cancer drug resistance: an evolving paradigm. Nat Rev Cancer 13, 714–726 (2013) Longley DB & Johnston PG. Molecular mechanisms of drug resistance. J Pathol 205, 275–292 (2005) Galluzzi L, Bravo-San Pedro JM, Levine B, Green DR & Kroemer G. Pharmacological modulation of autophagy: therapeutic potential and persisting obstacles. Nat Rev Drug Discov 16, 487–511 (2017) Klionsky DJ, Petroni G, Amaravadi RK, Baehrecke EH, Ballabio A et al. Autophagy in major human diseases. EMBO J 40, e108863 (2021) Goldsmith J, Levine B & Debnath J. Autophagy and cancer metabolism. Methods Enzymol 542, 25–57 (2014) Elia I, Doglioni G & Fendt SM. Metabolic Hallmarks of Metastasis Formation. Trends Cell Biol 28, 673–684 (2018) doi: 10.1016/j.tcb.2018.04.002 . Mowers EE, Sharifi MN & Macleod KF. Autophagy in cancer metastasis. Oncogene 36, 1619–1630 (2017) Sosa MS, Bragado P & Aguirre-Ghiso JA. Mechanisms of disseminated cancer cell dormancy: an awakening field. Nat Rev Cancer 14, 611–622 (2014) Peng YF, Shi YH, Shen YH, Ding ZB, Ke AW, Zhou J, Qiu SJ & Fan J. Promoting colonization in metastatic HCC cells by modulation of autophagy. PLoS One 8, e74407 (2013) Alhasan B, Mikeladze M, Guzhova I & Margulis B. Autophagy, molecular chaperones, and unfolded protein response as promoters of tumor recurrence. Cancer Metastasis Rev 42, 217–254 (2023) Ben-Zvi I, Kivity S, Langevitz P & Shoenfeld Y. Hydroxychloroquine: from malaria to autoimmunity. Clin Rev Allergy Immunol 42, 145–153 (2012) Xu S, Zhong Y, Nie C, Pan Y, Adeli M & Haag R. Co-Delivery of Doxorubicin and Chloroquine by Polyglycerol Functionalized MoS2 Nanosheets for Efficient Multidrug-Resistant Cancer Therapy. Macromol Biosci 21, e2100233 (2021) Bano N, Ansari MI, Kainat KM, Singh VK & Sharma PK. Chloroquine synergizes doxorubicin efficacy in cervical cancer cells through flux impairment and down regulation of proteins involved in the fusion of autophagosomes to lysosomes. Biochem Biophys Res Commun 656:131–138, (2023) Danilova A, Misyurin V, Novik A, Girdyuk D, Avdonkina N, Nekhaeva T, et al. Cancer/testis antigens expression during cultivation of melanoma and soft tissue sarcoma cells. Clin Sarcoma Res 10, 3 (2020) Komarova EY, Suezov RV, Nikotina AD, Aksenov ND, Garaeva LA, Shtam TA, et al. Hsp70-containing extracellular vesicles are capable of activating of adaptive immunity in models of mouse melanoma and colon carcinoma. Sci Rep 11, 21314 (2021) Pervushin NV, Yapryntseva MA, Panteleev MA, Zhivotovsky B & Kopeina GS. Cisplatin Resistance and Metabolism: Simplification of Complexity. Cancers (Basel) 16, 3082 (2024) Perret A, Dômont J, Chamseddine AN, Dumont SN, Verret B, Briand S, et al. Efficacy and safety of oral metronomic etoposide in adult patients with metastatic osteosarcoma. Cancer Med 10, 230–236 (2021) Kuang Z, Wang J, Liu K, Wu J & Li J. Optimal duration of oxaliplatin-based adjuvant chemotherapy in patients with different risk factors for stage II-III colon cancer: a meta-analysis. Int J Surg 110, 3030–3038 (2024) Li D, Geng D & Wang M. Advances in natural products modulating autophagy influenced by cellular stress conditions and their anticancer roles in the treatment of ovarian cancer. FASEB J 38, e70075 (2024) Skrzeszewski M, Maciejewska M, Kobza D, Gawrylak A, Kieda C & Waś H. Risk factors of using late-autophagy inhibitors: Aspects to consider when combined with anticancer therapies. Biochem Pharmacol 225, 116277 (2024) Nikotina AD, Vladimirova SA, Kokoreva NE, Komarova EY, Aksenov ND, Efremov S, et al. Combined Cytotoxic Effect of Inhibitors of Proteostasis on Human Colon Cancer Cells. Pharmaceuticals (Basel) 15, 923 (2022) Liu Z, Wang H, Hu C, Wu C, Wang J, Hu F t al. Targeting autophagy enhances atezolizumab-induced mitochondria-related apoptosis in osteosarcoma. Cell Death Dis 12, 164 (2021) Barzegari A, Salemi F, Kamyab A, Aratikatla A, Nejati N, Valizade M, et al. The efficacy and applicability of chimeric antigen receptor (CAR) T cell-based regimens for primary bone tumors: A comprehensive review of current evidence. J Bone Oncol 48, 100635 (2024) Krzywoń L, Lazaris A, Petrillo SK, Zlotnik O, Gao ZH & Metrakos P. Histopathological Growth Patterns Determine the Outcomes of Colorectal Cancer Liver Metastasis Following Liver Resection. Cancers (Basel) 16, 3148 (2024) Kirkland JL. Tumor dormancy and disease recurrence. Cancer Metastasis Rev 42, 9–12 (2023) Nikotina AD, Koludarova L, Komarova EY, Mikhaylova ER, Aksenov ND, Suezov R, et al. Discovery and optimization of cardenolides inhibiting HSF1 activation in human colon HCT-116 cancer cells. Oncotarget 9, 27268–27279 (2018) Nikotina AD, Vladimirova SA, Kokoreva NE, Nevdakha VA, Lazarev VF, Kuznetcova LS, et al. Novel mechanism of drug resistance triggered by tumor-associated macrophages through Heat Shock Factor-1 activation. Cancer Immunol Immunother 73, 25 (2024) Debnath J, Gammoh N & Ryan KM. Autophagy and autophagy-related pathways in cancer. Nat Rev Mol Cell Biol 24, 560–575 (2023) Selvakumaran M, Amaravadi RK, Vasilevskaya IA & O'Dwyer PJ. Autophagy inhibition sensitizes colon cancer cells to antiangiogenic and cytotoxic therapy. Clin Cancer Res 19, 2995–3007 (2013) Zhu Y, Huang S, Chen S, Chen J, Wang Z, Wang Y & Zheng H. SOX2 promotes chemoresistance, cancer stem cells properties, and epithelial-mesenchymal transition by β-catenin and Beclin1/autophagy signaling in colorectal cancer. Cell Death Dis 12, 449 (2021) Niu J, Yan T, Guo W, Wang W, Ren T, Huang Y, et al. The COPS3-FOXO3 positive feedback loop regulates autophagy to promote cisplatin resistance in osteosarcoma. Autophagy 19, 1693–1710 (2023) Chen C, Zhang H, Yu Y, Huang Q, Wang W, Niu J, et al. Chloroquine suppresses proliferation and invasion and induces apoptosis of osteosarcoma cells associated with inhibition of phosphorylation of STAT3. Aging (Albany NY) 13, 17901–17913 (2021) Wang HL, Li JN, Kan WJ, Xu GY, Luo GH, Song N, et al.. Chloroquine enhances the efficacy of chemotherapy drugs against acute myeloid leukemia by inactivating the autophagy pathway. Acta Pharmacol Sin 44, 2296–2306 (2023) Yun EJ, Kim S, Hsieh JT & Baek ST. Wnt/β-catenin signaling pathway induces autophagy-mediated temozolomide-resistance in human glioblastoma. Cell Death Dis 11, 771 (2020) Alhasan B, Gladova YA, Sverchinsky DV, Aksenov ND, Margulis BA & Guzhova IV. Hsp70 Negatively Regulates Autophagy via Governing AMPK Activation, and Dual Hsp70-Autophagy Inhibition Induces Synergetic Cell Death in NSCLC Cells. Int J Mol Sci 25, 9090 (2024) Ferretti GDS, Quaas CE, Bertolini I, Zuccotti A, Saatci O, Kashatus JA, et al. HSP70-mediated mitochondrial dynamics and autophagy represent a novel vulnerability in pancreatic cancer. Cell Death Differ 31, 881–896 (2024) Salimi A, Schroeder KM, Schemionek-Reinders M, Vieri M, Maletzke S, Gezer D, et al. Targeting autophagy increases the efficacy of proteasome inhibitor treatment in multiple myeloma by induction of apoptosis and activation of JNK. BMC Cancer 22, 735 (2022) Zafeiropoulou K, Kalampounias G, Alexis S, Anastasopoulos D, Symeonidis A & Katsoris P. Autophagy and oxidative stress modulation mediate Bortezomib resistance in prostate cancer. PLoS One 19, e0289904 (2024) Anand K, Niravath P, Patel T, Ensor J, Rodriguez A, Boone T, et al. A Phase II Study of the Efficacy and Safety of Chloroquine in Combination With Taxanes in the Treatment of Patients With Advanced or Metastatic Anthracycline-refractory Breast Cancer. Clin Breast Cancer 21, 199–204 (2021) Sasaki K, Tsuno NH, Sunami E, Kawai K, Hongo K, Hiyoshi M, et al. Resistance of colon cancer to 5-fluorouracil may be overcome by combination with chloroquine, an in vivo study. Anticancer Drugs 23, 675 – 82 (2012) McCubrey JA, Abrams SL, Follo MY, Manzoli L, Ratti S, Martelli AM, et al. Effects of chloroquine and hydroxychloroquine on the sensitivity of pancreatic cancer cells to targeted therapies. Adv Biol Regul 87,100917 (2023) Lin YC, Lin JF, Wen SI, Yang SC, Tsai TF, Chen HE, et al. Chloroquine and hydroxychloroquine inhibit bladder cancer cell growth by targeting basal autophagy and enhancing apoptosis. Kaohsiung J Med Sci 33, 215–223 (2017) Amaravadi RK, Yu D, Lum JJ, Bui T, Christophorou MA, Evan GI, et al. Autophagy inhibition enhances therapy-induced apoptosis in a Myc-induced model of lymphoma. J Clin Invest 117, 326 – 36 (2007) Casagrande N, Borghese C, Avanzo M & Aldinucci D. In Doxorubicin-Adapted Hodgkin Lymphoma Cells, Acquiring Multidrug Resistance and Improved Immunosuppressive Abilities, Doxorubicin Activity Was Enhanced by Chloroquine and GW4869. Cells 12, 2732 (2023) Gerstberger S, Jiang Q & Ganesh K. Metastasis. Cell 186, 1564–1579 (2023) Kaneko M, Nozawa H, Hiyoshi M, Tada N, Murono K, Nirei T, et al. Temsirolimus and chloroquine cooperatively exhibit a potent antitumor effect against colorectal cancer cells. J Cancer Res Clin Oncol 140, 769 – 81 (2014) Selvakumaran M, Amaravadi RK, Vasilevskaya IA & O'Dwyer PJ. Autophagy inhibition sensitizes colon cancer cells to antiangiogenic and cytotoxic therapy. Clin Cancer Res 19, 2995–3007 (2013) Francescangeli F, De Angelis ML, Rossi R, Cuccu A, Giuliani A, De Maria R, et al. Dormancy, stemness, and therapy resistance: interconnected players in cancer evolution. Cancer Metastasis Rev 42, 197–215 (2023) Additional Declarations (Not answered) Supplementary Files SupplementarymaterialMikeladzeetal.pdf Supplementary Data Cite Share Download PDF Status: Published Journal Publication published 10 Dec, 2025 Read the published version in Cell Death & Disease → Version 1 posted Editorial decision: revise 15 Apr, 2025 Review # 2 received at journal 11 Apr, 2025 Review # 1 received at journal 09 Apr, 2025 Reviewer # 2 agreed at journal 02 Apr, 2025 Reviewer # 1 agreed at journal 02 Apr, 2025 Reviewers invited by journal 31 Mar, 2025 Submission checks completed at journal 17 Mar, 2025 First submitted to journal 16 Mar, 2025 Editor assigned by journal 16 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6237822","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":436366498,"identity":"a0cb7178-09b8-48ea-af17-4a2de173ae39","order_by":0,"name":"Irina Guzhova","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYBACNgbGBghLgvkAiJQhRQtbAojkIcE+CR4DEEVYC5/04bYHPxhqE+fP7vn86kaNBQ8D++GjG/A6jC+x3bCH4Xhi45yz26xzjgEdxpOWdgOvFh7GNqCyY4nNErnbjHPYgGwJHjOCWiT/ALW0SeQ8M875R6QWaR6GmsQeiRzmx7ltxGqRMThgPEMizYw5t0+Ch42QX+R72J9Jvqmok50/I/nx55xvdXL87IeP4dUCAQaHwTZKgEnCysGgDkQwfyBS9SgYBaNgFIwwAABlzz7pgzoi9QAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-8775-7713","institution":"Institute of Cytology of Russian Academy of Scences","correspondingAuthor":true,"prefix":"","firstName":"Irina","middleName":"","lastName":"Guzhova","suffix":""},{"id":436366499,"identity":"7feb3df9-47b8-4e44-862d-c34ce7775dc4","order_by":1,"name":"Marina Mikeladze","email":"","orcid":"","institution":"Institute of Cytology of Russian Academy of Scences","correspondingAuthor":false,"prefix":"","firstName":"Marina","middleName":"","lastName":"Mikeladze","suffix":""},{"id":436366500,"identity":"26584b77-ffa2-45aa-91c8-1ee0884290d8","order_by":2,"name":"Liubov Kuznetcova","email":"","orcid":"","institution":"Institute of Cytology of Russian Academy of Scences","correspondingAuthor":false,"prefix":"","firstName":"Liubov","middleName":"","lastName":"Kuznetcova","suffix":""},{"id":436366501,"identity":"1960935f-b96a-4ee8-ac91-6bc8bc85527e","order_by":3,"name":"Elena Komarova","email":"","orcid":"","institution":"Institute of Cytology of Russian Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Elena","middleName":"","lastName":"Komarova","suffix":""},{"id":436366502,"identity":"03c1e0c3-745f-43c8-9ffa-bf9c47b335d2","order_by":4,"name":"Margarita Galcheva","email":"","orcid":"","institution":"Institute of Cytology of Russian Academy of Scences","correspondingAuthor":false,"prefix":"","firstName":"Margarita","middleName":"","lastName":"Galcheva","suffix":""},{"id":436366503,"identity":"6b74918f-cf70-4cb2-a1ac-e9750e307beb","order_by":5,"name":"Vladimir Lazarev","email":"","orcid":"https://orcid.org/0000-0002-7117-6789","institution":"Institute of Cytology","correspondingAuthor":false,"prefix":"","firstName":"Vladimir","middleName":"","lastName":"Lazarev","suffix":""},{"id":436366504,"identity":"67efff76-d4de-4152-9e92-d58329d4dc47","order_by":6,"name":"Lev Khamaev","email":"","orcid":"","institution":"Institute of Cytology of Russian Academy of Scences","correspondingAuthor":false,"prefix":"","firstName":"Lev","middleName":"","lastName":"Khamaev","suffix":""},{"id":436366505,"identity":"33410f95-0552-4183-a9f8-3f62cd79681f","order_by":7,"name":"Anna Danilova","email":"","orcid":"https://orcid.org/0000-0003-4796-0386","institution":"N.N.Petrov Scientific Medical Research Center of Oncology","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Danilova","suffix":""},{"id":436366506,"identity":"b1d8b764-2305-4c83-9a66-e1c0d1125f3d","order_by":8,"name":"Boris Margulis","email":"","orcid":"https://orcid.org/0000-0002-2608-0147","institution":"Institute of Cytology of Russian Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Boris","middleName":"","lastName":"Margulis","suffix":""},{"id":436366507,"identity":"3d14b27a-8996-4bd6-bd61-7cadab5fddcf","order_by":9,"name":"Bashar Alhasan","email":"","orcid":"https://orcid.org/0000-0002-2239-2872","institution":"Institute of Cytology of Russian Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Bashar","middleName":"","lastName":"Alhasan","suffix":""}],"badges":[],"createdAt":"2025-03-16 13:25:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6237822/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6237822/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41419-025-08304-6","type":"published","date":"2025-12-10T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82071821,"identity":"452fd891-7f40-43be-8d55-899cb76f0ba8","added_by":"auto","created_at":"2025-05-06 13:22:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":522588,"visible":true,"origin":"","legend":"\u003cp\u003eAnticancer drugs activate autophagy in osteosarcoma and colorectal cancer cells\u003c/p\u003e\n\u003cp\u003e(А) Morphology of osteosarcoma cells: established HOS cells and patient-derived OS921 and OS1056 cells. Scale bars: 200 µm; (B) MTT assay results for HOS, OS921, and OS1056 cells treated with etoposide at indicated concentrations; (C-F) RT-PCR data showing the expression of autophagy-related genes ULK1 and Atg7 in (C) HOS, (D) OS921, (E) OS1056, and (F) CT-26 cells treated with etoposide or oxaliplatin at indicated concentrations; (G,K) Western blot analysis of autophagy markers in HOS cells treated with etoposide and (K) quantification of protein expression normalized to Tubulin; (H, L) Western blot results of OS921 cells and their respective quantification; (I,M) Western blot results of OS1056 cells and their respective quantification; (J,N) Western blot results of CT-26 cells and their respective quantification.\u003c/p\u003e","description":"","filename":"Figure1MikeadzeKuznetsova.png","url":"https://assets-eu.researchsquare.com/files/rs-6237822/v1/beab22281678cbc5699f756a.png"},{"id":82071822,"identity":"a5c8e354-d664-4bea-bdc2-f136df78a958","added_by":"auto","created_at":"2025-05-06 13:22:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":849830,"visible":true,"origin":"","legend":"\u003cp\u003eChloroquine enhances the cytotoxic effect of etoposide on osteosarcoma cells\u003c/p\u003e\n\u003cp\u003e(A) HOS, OS921, and OS1056 cells were pre-treated with 25 µM CQ for 16 hours, followed by etoposide treatment at 1, 2.5, and 5.8 µM. Cell viability was assessed 24 hours later using the MTT assay. (B) Dermal fibroblasts (DF2) underwent the same treatment as in (A) and were analyzed using the MTT assay (*p\u0026lt;.0.05, **p\u0026lt; 0.0001). (C) HOS, OS921, and OS1056 cells treated as in (A) were stained with Annexin V and PI, then analyzed via flow cytometry. Representative density plots are shown. (D) Quantification of viable, apoptotic, and necrotic cell populations from three independent experiments\u003c/p\u003e","description":"","filename":"Figure2MikeladzeKuznetsova.png","url":"https://assets-eu.researchsquare.com/files/rs-6237822/v1/e84c7b407eb4f4ad6bf058f3.png"},{"id":82071840,"identity":"65ec07d5-026a-466c-81a3-7619d99f6b58","added_by":"auto","created_at":"2025-05-06 13:22:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":937777,"visible":true,"origin":"","legend":"\u003cp\u003eChloroquine enhances the effect of etoposide and oxaliplatin in 2D and 3D tumor models.\u003c/p\u003e\n\u003cp\u003e(A) HOS, OS921, and OS1056 cells were pre-treated with 25 μM CQ for 16 hours, followed by 1 μM etoposide. Cell viability was monitored in real time using xCELLigence technology. (B) CT-26 cells were treated with 0.8 µM CQ, 20 µM OxP, or their combination and analyzed using xCELLigence technology. (C) Spheroids of HOS, OS921, and OS1056 cells were treated with 25 μM CQ, followed by 1, 2.5, or 5.8 μM etoposide after 16 hours. After 96 hours, spheroid morphology was assessed via microscopy. (D) ATP levels in the culture medium of spheroids treated with CQ and etoposide and their combinations.\u003c/p\u003e","description":"","filename":"Figure3MikeladzeKuznetsova.png","url":"https://assets-eu.researchsquare.com/files/rs-6237822/v1/9f5366765ab718ed377489c4.png"},{"id":82071823,"identity":"f0ef8fbe-81eb-4bce-b9fa-11beaf51ad36","added_by":"auto","created_at":"2025-05-06 13:22:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":616583,"visible":true,"origin":"","legend":"\u003cp\u003eCQ in combination with anticancer drugs reduces the migratory ability of osteosarcoma and colorectal cancer cells and inhibits osteosarcoma cell proliferation from a dispersed population.\u003c/p\u003e\n\u003cp\u003e(A) RT-PCR analysis of osteosarcoma cells treated with CQ, etoposide, or their combination for 24 hours. *p \u0026lt; 0.05; **p \u0026lt; 0.005. (B) Representative images from a wound healing assay in osteosarcoma cells treated as described above. Images were taken at the start of the experiment and after 96 hours. (C) Quantification of wound closure distances using JuLIV 2.0 software. **p \u0026lt; 0.0001. (D) Representative images of colony formation assays in osteosarcoma cells treated with CQ, etoposide at the indicated concentrations, or their combination. (E) Quantification of colony numbers using ImageJ software. **p \u0026lt; 0.0001. (F) Migration assay of CT-26luc colorectal cancer cells treated with CQ, OxP, or their combination, assessed using xCELLigence technology. (G) RT-PCR analysis of EMT markers Snail1 and TWIST in CT-26luc cells treated with CQ, OxP, or their combination. *p \u0026lt; 0.05; **p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure4MikeladzeKuznetsova.png","url":"https://assets-eu.researchsquare.com/files/rs-6237822/v1/314948da0827b21fe10078df.png"},{"id":82071824,"identity":"e9ab913d-da5b-487a-9122-050479c5298b","added_by":"auto","created_at":"2025-05-06 13:22:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1149929,"visible":true,"origin":"","legend":"\u003cp\u003eCombination of oxaliplatin and chloroquine suppresses colorectal cancer metastasis \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e(A) Bioluminescence imaging of mice bearing CT-26luc tumors in the colon, treated with CQ, OxP, or their combination. (B) Quantification of luminescence signals (ROI) from (A). *p \u0026lt; 0.05; **p \u0026lt; 0.01. (C) Kaplan–Meier survival curves for untreated, CQ, OxP, and CQ + OxP groups (n = 10 per group). (D) Visual assessment of primary tumors and metastases in organs, arrows indicate primary tumors and metastases. (E) RT-PCR quantification of luciferase expression in CT-26luc cells-injected colon tissue and metastatic organs, lungs, liver, and spleen. Each luminescence value corresponds to an individual mouse. Crosses indicate mice that died before the analysis.\u003c/p\u003e","description":"","filename":"Figure5MikeladzeKuznetsova.png","url":"https://assets-eu.researchsquare.com/files/rs-6237822/v1/034bab7fa1f04d72cd42e2fd.png"},{"id":82071825,"identity":"89bce387-8073-49c3-bf1d-a514adebc6f3","added_by":"auto","created_at":"2025-05-06 13:22:54","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":420112,"visible":true,"origin":"","legend":"\u003cp\u003eChloroquine exhibits greater toxicity toward dormant cancer cells than proliferating cells.\u003c/p\u003e\n\u003cp\u003e(A) Growth curves of proliferating (10% FBS) and dormant (0%, 0.1% FBS) A549 cells monitored using xCELLigence technology. Dormant cells exited dormancy and resumed proliferation upon reintroduction of 10% FBS. (B) Cell cycle dynamics in A549 and H1299 cells following transfer to 0.1% FBS medium, with the deepest cell cycle arrest observed on day 5, defining the dormant state. (C) Expression of proliferation (Aurka, Ki67), autophagy (ULK1, Atg7), EMT (Zeb1, TWIST, Vimentin), and stemness (CD44, ALDH1) markers in proliferating and dormant (day 5, 0.1% FBS) A549 cells, assessed by RT-PCR. (D) A549 cells were seeded in 96-well plates. After cell attachment, 10 µM etoposide was added, and cell viability was assessed via the MTT assay at 24, 48, and 72 hours. *p \u0026lt; 0.05; **p \u0026lt; 0.0001. (E) A549 spheroids were generated and subsequently cultured in either 10% FCS or 0.1% FCS. On the 5th day of starvation, spheroids were treated with 2.5 µM or 5.8 µM etoposide for 48 hours, after which representative images were captured. (F) ATP levels were measured to assess cell viability following etoposide treatment. **p \u0026lt; 0.0001. (G) Flow cytometry plots of A549 cells treated with CQ. (H) Quantification of viable, apoptotic, and necrotic A549 cells from three independent experiments. (I) Flow cytometry plots of H1299 cells treated with CQ. (J) Quantification of viable, apoptotic, and necrotic H1299 cells from two independent experiments.\u003c/p\u003e","description":"","filename":"Figure6MikeladzeKuznetsova.png","url":"https://assets-eu.researchsquare.com/files/rs-6237822/v1/bfec99e15b921335ccc151fc.png"},{"id":101032196,"identity":"ae80062e-86d4-42df-ad02-f425dc0a4dcf","added_by":"auto","created_at":"2026-01-24 08:07:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5265627,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6237822/v1/8bb832f5-1462-40ee-ab6c-37082e2c2e22.pdf"},{"id":82073564,"identity":"994b670a-3a30-427e-a6a8-deb6f775bf49","added_by":"auto","created_at":"2025-05-06 13:30:54","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2281409,"visible":true,"origin":"","legend":"Supplementary Data","description":"","filename":"SupplementarymaterialMikeladzeetal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6237822/v1/852b600dc82a10485928194f.pdf"}],"financialInterests":"(Not answered)","formattedTitle":"Chloroquine Overcomes Chemotherapy Resistance and Suppresses Cancer Metastasis by Eradicating Dormant Cancer Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOsteosarcoma (OS) is a highly aggressive malignant tumor originating from bone tissue, characterized by limited treatment options and poor prognosis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This neoplasm arises primarily from mesenchymal osteoblast precursor cells [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] and is predominantly localized in long tubular bones, with rare occurrences in the spine, pelvis, and sacral regions [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eColorectal cancer (CRC) ranks as the third most prevalent cancer globally, with an estimated 1.1\u0026nbsp;million new cases annually, and is the second leading cause of cancer-related mortality [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Although advancements in treatment have improved survival rates, metastatic colorectal cancer remains a lethal condition, with a 5-year survival rate of approximately 14% [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Metastasis occurs in 15\u0026ndash;30% of patients, and 20\u0026ndash;50% of those initially diagnosed with localized disease eventually develop metastatic spread. The liver is the most common site of metastasis, followed by the lungs, peritoneum, and distant lymph nodes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAcquired drug resistance is a form of resistance that develops during the treatment of tumors that initially exhibit high sensitivity to therapeutic agents. This resistance arises due to the emergence of genetic mutations or the activation of adaptive cellular mechanisms [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Additionally, acquired resistance can lead to cross-resistance, where tumors become resistant to chemotherapeutic agents with distinct mechanisms of action, even to those not previously administered to the patient. Consequently, addressing drug resistance is critical for improving outcomes in cancer therapy [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAutophagy is a fundamental cellular process that facilitates the degradation and recycling of damaged organelles, protein aggregates, and other cytoplasmic components through the lysosomes. This process is essential for cellular homeostasis, adaptation to nutrient deprivation, immune regulation, and facilitation of apoptosis. Autophagy is classified into three major forms: macroautophagy, microautophagy, and chaperone-mediated autophagy [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Among which, macroautophagy is the most studied, whereby cellular components are sequestered within double-membraned autophagosomes, which subsequently fuse with lysosomes to form autophagolysosomes for degradation. This process is regulated by autophagy-related genes (ATGs) and plays a role in the turnover of organelles such as mitochondria, the endoplasmic reticulum, and ribosomes, as well as proteins, lipids, and RNA [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAs tumors grow, their increasing metabolic demands often exceed the capacity of the local vasculature, leading to hypoxia and nutrient deprivation in poorly perfused tumor regions, known as necrotic foci. In response to these stress conditions, tumor cells undergo metabolic reprogramming, which frequently involves the activation of autophagy that enhances nutrient recycling and provides metabolic plasticity, enabling tumor cells to survive under stress [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The harsh conditions within the tumor microenvironment also facilitate the development of metastases [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The efficiency of colonization during the later stages of metastasis is influenced by the rate of micrometastasis formation, which depends on the ability of tumor cells to adapt to novel stromal interactions. Growing evidence highlights the critical role of autophagy in the metastatic cascade [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], as it supports the survival of dormant tumor cells [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], circulating tumor cells [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and tumor stem cell (CSC) subpopulations, which are key mediators of invasion and treatment resistance [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGiven the critical role of autophagy in tumor survival and metastasis, autophagy inhibition has emerged as a promising therapeutic strategy. Chloroquine (CQ) and its derivative hydroxychloroquine (HCQ) are well-established antimalarial agents belonging to the 4-aminoquinoline class. They are widely used for the prevention and treatment of malaria, extraintestinal amebiasis, and rheumatic diseases, as well as for managing inflammation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. More recently, CQ has gained attention as a potential anticancer agent, both as a monotherapy and in combination with other drugs due to its ability to inhibit autophagy and enhance tumor cell sensitivity to chemotherapy [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe primary aim of this study was to investigate the impact of chloroquine on the resistance of osteosarcoma and colorectal cancer cells to chemotherapy. Additionally, we sought to evaluate how chloroquine influences the metastatic potential of colorectal cancer.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and culture conditions\u003c/h2\u003e \u003cp\u003eOsteosarcoma cell lines, OS921 and OS1056, were derived from patients undergoing chemotherapy at the N.N. Petrov National Medical Research Center of Oncology, Ministry of Health of the Russian Federation (St. Petersburg, Russia). These cell lines were established from lung metastases obtained during surgical procedures. The research protocol was approved by the local ethical committee, and all patients provided written informed consent prior to tissue collection. Tumor samples were preserved in compliance with the Helsinki Declaration and utilized in accordance with the Human Tissue Act of 2004.\u003c/p\u003e \u003cp\u003eAll patients had undergone multiple surgical interventions due to disease progression. OS921 cells were derived from conventional osteogenic sarcoma in a 13-year-old female patient who had received seven cycles of EURAMOS and two cycles of ICE chemotherapy prior to sample collection. The patient passed away two and a half months after sample collection.\u003c/p\u003e \u003cp\u003eOS1056 cells were derived from chondroblastic osteosarcoma in a 39-year-old female patient who had undergone three lines of polychemotherapy (MAP, GemTax, and sorafenib/bevacizumab) before sample collection. The patient died nine months after sample collection.\u003c/p\u003e \u003cp\u003eOsteosarcoma cells were isolated from tumor samples and cultured as previously described [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Cells were maintained for at least ten passages before experimentation.\u003c/p\u003e \u003cp\u003eHuman osteosarcoma HOS cell line and human lung carcinoma A549 and H1299 cell lines were obtained from the \u0026ldquo;Collection of Vertebrate Cell Cultures,\u0026rdquo; supported by a grant from the Ministry of Education and Science of the Russian Federation (Agreement No. 075-15-2021-683).\u003c/p\u003e \u003cp\u003eMouse colorectal carcinoma cells CT-26iRFP720luc (referred to as CT-26 luc) were transfected with the pHIV-iRFP720-E2A-Luc vector, as described previously [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAll osteosarcoma cell lines were cultured at 37\u0026deg;C in a humidified atmosphere of 5% CO₂, using DMEM/F12 medium supplemented with 10% fetal bovine serum (Gibco, USA), 100 U/ml penicillin G, and 0.1 mg/ml streptomycin (Capricorn Scientific, Germany). CT-26 luc, A549, and H1299 cells were maintained under similar conditions in DMEM medium with identical supplements.\u003c/p\u003e \u003cp\u003eCell viability was assessed using trypan blue exclusion staining. Only cell populations with a viability of \u0026ge;\u0026thinsp;95% were used for experiments. Cell counting was performed using a Luna II Cell Counter (Logos Biosystems, South Korea).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDrug treatments\u003c/h3\u003e\n\u003cp\u003eFor osteosarcoma cells, Etoposide (Okasa Pharma, India) was administered at 1, 2.5, and 5.8 \u0026micro;M for 24 hours. In combination treatment, cells were pretreated with 25 \u0026micro;M chloroquine (CQ; Sigma, USA) for 16 hours, followed by the addition of etoposide (1, 2.5, or 5.8 \u0026micro;M) for a subsequent 24-hour period.\u003c/p\u003e \u003cp\u003eFor CT-26 luc cells, they were pretreated with 0.8 \u0026micro;M chloroquine for 16 hours, followed by exposure to 10, 20, or 30 \u0026micro;M oxaliplatin (OxP; Okasa Pharma, India).\u003c/p\u003e\n\u003ch3\u003eDetermination of cell viability and proliferation:\u003c/h3\u003e\n\u003cp\u003eOsteosarcoma cells sensitivity to etoposide was assessed using the MTT assay. HOS, OS921, and OS1056 cells were seeded in 96-well plates at a density of 20,000 cells/well. Cells were treated with 25 \u0026micro;M chloroquine (CQ) for 16 hours, followed by the addition of etoposide at the specified concentrations. After 24 hours of incubation, the medium was removed, and 100 \u0026micro;L of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Paneco, Russia) solution (0.5 mg/mL) was added to each well. Plates were incubated for 3\u0026ndash;4 hours, after which the MTT solution was removed, and the resulting formazan crystals were dissolved in dimethyl sulfoxide (DMSO; Biolot, Russia). Optical density was measured using a Varioskan LUX Multimode Microplate Reader (Thermo Scientific, USA). Data were presented as the percentage of viable cells relative to the control.\u003c/p\u003e \u003cp\u003eCell viability, proliferation, and migration were monitored using the xCELLigence system (ACEA Biosciences, San Diego, CA, USA), which provides non-invasive, real-time, label-free measurements based on electrical impedance. Increased impedance corresponds to greater cell adhesion and growth. CT-26 luc cells were seeded into E-plates, treated first with 0.8 \u0026micro;M CQ, and after 16 hours, 20 \u0026micro;M oxaliplatin (OxP) was added. The cell index was recorded continuously for 60 hours. HOS, OS921, and OS1056 cells were seeded into E-plates, treated with 25 \u0026micro;M CQ, followed by 1 \u0026micro;M etoposide, and their proliferation was monitored over 50\u0026ndash;90 hours. The proliferative activity of dormant vs. growing A549 cells was compared by seeding cells into E-plate wells at 20,000 cells/well and incubating in medium containing 10%, 0.1%, or 0% FBS for 270 hours to assess dormancy and growth dynamics.\u003c/p\u003e\n\u003ch3\u003eReal-time polymerase chain reaction (RT-PCR)\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eReal-time polymerase chain reaction (RT-PCR)\u003c/div\u003e \u003cp\u003eRT-PCR was used to assess the expression of autophagy markers, epithelial-mesenchymal transition (EMT) markers, and stemness-related genes.\u003c/p\u003e \u003cp\u003eTotal RNA was isolated using TRIzol reagent (Thermo Fisher Scientific, USA). Reverse transcription was performed using the MMLV RT kit (Eurogen LLC, Russia) following the manufacturer\u0026rsquo;s protocol. RT-PCR reactions were conducted using a CFX96 Real-Time PCR system (BioRad, USA). DNA amplification was performed using the qPCRmix-HS SYBR kit (Eurogen LLC, Russia) according to the manufacturer\u0026rsquo;s instructions. Primers were purchased from Evrogen LLC (Moscow, Russia), and the sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e\u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eULK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-ATGATTCTACCCACGGCAAG- 3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`-CTGGAAGATGGTGATGGGTT- 3`\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAtg7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-AAGCCATGATGTCGTCTTCCTAT-3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`-GCATTGATGACCAGCTTTCTCTT- 3`\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSnail1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-ATGAGGAATCTGGCTGCTGC-3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`-CAGGAGAAAATGCCTTTGGA- 3`\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTWIST\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-TGCATGCATTCTCAAGAGGT-3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`-CTATGGTTTTGCAGGCCAGT- 3`\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLuciferase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-CTGGAAGATGGTGATGGGTT- 3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo;-ACGAAGGTGTACATGCTTTGGA-3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAurka\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-GCTGGAGAGCTTAAAATTGCAG-3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`-TTTTGTAGGTCTCTTGGTATGTG-3`\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-ACATCCTCACATCCAACACCTC-3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`-GCAGGTCTGTGACTGATGTACA-3`\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADLH1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-AGGAGCCGAATCAGAAATGTCA-3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`-CAAATCGGTGAGTAGGACAGGT-3`\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKi67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`-TCCTAGGAAAACTCCAGTTGCC-3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`-AGACACTCTCTTTGAAGGCAGG-3`\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eActin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5`- TATGTTGCCCTAGACTTCGAGC \u0026minus;\u0026thinsp;3`\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5`- CGATAGTGATGACCTGACCGTC \u0026minus;\u0026thinsp;3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eDetermination of apoptosis and cell cycle analysis\u003c/h3\u003e\n\u003cp\u003eApoptosis in cancer cells and fibroblasts was analyzed using Annexin V/PI staining and flow cytometry. Following the indicated experimental procedures, conditioned media were collected, and cells were detached, pooled with the respective media, centrifuged, washed with cold PBS, and stained with Annexin V Alexa 647 (Thermo Fisher Scientific, USA) and propidium iodide (PI) according to the manufacturer's protocol. Flow cytometry was performed using a CytoFlex Flow Cytometer (Beckman Coulter, USA), and data were analyzed with CytExpert 2.0 software.\u003c/p\u003e \u003cp\u003eFor cell cycle analysis, 0.5\u0026ndash;1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells were harversted, resuspended in 0.5 mL PBS, fixed with cold 100% ethanol, and incubated on ice for 20 minutes. After centrifugation at 1,000 rpm for 5 minutes, the ethanol was removed, and the pellet was dried at room temperature. Cells were then stained with a PI-RNAase solution (50 \u0026micro;g/mL PI (Sigma-Aldrich, USA) and 100 \u0026micro;g/mL RNAse Type I-A (Biolot, Russia)) and incubated in the dark for 20 minutes. Approximately 50,000\u0026ndash;100,000 cells were analyzed using the CytoFlex Flow Cytometer, and data were processed with CytExpert 2.0 software.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of tumor cell motility\u003c/h2\u003e \u003cp\u003eThe motility of osteosarcoma cells was evaluated using a wound healing assay. HOS, OS921, and OS1056 cells were seeded in 12-well plates at a density of 100,000 cells/mL. Upon reaching 80% confluence, a scratch was made using a culture scraper. Cells were pre-treated with 25 \u0026micro;M CQ for 16 hours, followed by the addition of 1, 2.5, or 5.8 \u0026micro;M etoposide for 24 hours. Wound healing was monitored for 48 hours using a JuLI Stage microscope, and images were analyzed with JuLIV 2.0 software.\u003c/p\u003e \u003cp\u003eFor CT-26luc cells, a migration assay was performed using a CIM plate. Cells were seeded in serum-free medium in the upper chamber, while the lower chamber contained medium with 10% FBS. Cells were treated with CQ and OxP at the indicated concentrations and monitored for 50 hours using the xCELLigence system (RTCA DP xCelligence, ACEA Biosciences, USA). Data were analyzed using RTCA Analysis Software (RTCA Software Pro, ACEA, San Diego, CA, USA).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eColony formation assay\u003c/h3\u003e\n\u003cp\u003eHOS, OS921, and OS1056 cells were seeded in 6-well plates at 200,000 cells/well and treated with 25 \u0026micro;M CQ and etoposide at 1, 2.5, or 5.8 \u0026micro;M. After 24 hours, cells were washed and reseeded at 1,000 cells/well. Colonies were allowed to form for nine days, fixed with 10% formaldehyde, and stained with 0.01% crystal violet (Sigma-Aldrich, USA). Plates were scanned using a ChemiDoc system (Bio-Rad, USA), and colony numbers were quantified using ImageJ.\u003c/p\u003e\n\u003ch3\u003eOsteosarcoma spheroid model and ATP activity assay\u003c/h3\u003e\n\u003cp\u003eFor the spheroid model, 50 \u0026micro;L of 1.5% agarose in DMEM/F12 medium was added to 96-well plates. HOS, OS921, and OS1056 cells were seeded at 30,000 cells/mL in 200 \u0026micro;L medium and incubated for 3\u0026ndash;7 days. After spheroid formation, treatments were applied as described. Morphological changes were assessed after 96 hours using a Zeiss Axiovert 40CFL microscope and Zeiss AxioCam ERc 5s camera (Carl Zeiss MicroImaging GmbH, Germany).\u003c/p\u003e \u003cp\u003eATP activity was measured in 3D spheroid models using the EzCount ATP Cell Assay Kit (HiMedia, USA). After treatment, spheroids were transferred to luminescence plates, and firefly luciferase was added according to the manufacturer\u0026rsquo;s instructions. ATP levels were quantified by luminescence using a Varioskan LUX Multimode Microplate Reader.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eWestern blotting was used to evaluate autophagy markers in osteosarcoma and CT-26luc cells. HOS, OS921, and OS1056 cells were treated with 1, 2.5, or 5.8 \u0026micro;M etoposide, while CT-26luc cells were treated with oxaliplatin at 10, 20, or 30 \u0026micro;M for 24 hours. Protein lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM PMSF, 1% Triton X-100, 10% glycerol), centrifuged at 13,500 rpm, 4\u0026ordm; C for 15 minutes, and protein concentrations were determined using the Bradford assay. Samples were then diluted in sample buffer, separated by SDS-PAGE, transferred onto nitrocellulose membranes, and probed with antibodies against Atg5, Beclin1, LC3A/B (Cell Signaling Technology, USA), SQSTM1/p62 (Abcam, UK), and α-tubulin (Thermo Fisher, USA). Secondary anti-rabbit antibodies conjugated with peroxidase (Abcam, UK) were used, and detection was performed using SuperSignal West Femto reagent on a ChemiDoc system (Bio-Rad, USA), and band intensities were analyzed using ImageJ.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eAll \u003cem\u003ein vivo\u003c/em\u003e experimental protocols were approved by the Licensing Committee of the Institute of Cytology, Russian Academy of Sciences (Identification number: F18-00380). All procedures were conducted in compliance with relevant guidelines and regulations and are reported in accordance with the ARRIVE guidelines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of tumor cells for administration\u003c/h2\u003e \u003cp\u003eOn the day of the procedure, CT-26luc cells in the logarithmic growth phase harvested, centrifuged at 1500 rpm for 5 minutes, and resuspended in serum-free DMEM. The cell count was determined, and the appropriate number of cells per mouse was prepared in 1 mL of medium. Five minutes prior to injection, cells were centrifuged again at 1,500 rpm for 5 minutes, and the pellet was resuspended in a 1:1 mixture of 50 \u0026micro;L serum-free DMEM and 50 \u0026micro;L Matrigel (Corning Incorporated, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eOrthotopic tumor cell injection and treatment protocol\u003c/h2\u003e \u003cp\u003eEighty female BALB/c mice were used for the experiments. Animals were anesthetized with a mixture of Zoletil-100 (tiletamine hydrochloride and zolazepam, Virbac, France) and Rometar (xylazine hydrochloride, Bioveta, Czech Republic) diluted in saline, administered intraperitoneally at 100 \u0026micro;L per mouse. After confirming the absence of a corneal reflex, abdominal area was shaved, disinfected, and a small incision was made to expose the cecum. Tumor cells (1 \u0026times; 10⁶ per mouse) were injected into the submucosal layer of the cecum. Throughout the procedure, internal organs were periodically moistened with saline to prevent desiccation. After tumor cell injection, the abdominal wall was sutured, and diclofenac (Atoll, Russia) was administered for postoperative analgesia.\u003c/p\u003e \u003cp\u003eSeven days post-inoculation, mice were randomly divided into four groups (n\u0026thinsp;=\u0026thinsp;20 per group): Group 1 (Untreated): Received saline as a control, Group 2 (CQ): Treated with chloroquine (20 mg/kg) three times per week, Group 3 (OxP): Treated with oxaliplatin (50 mg/kg) once per week, and Group 4 (CQ\u0026thinsp;+\u0026thinsp;OxP): Received a combination of chloroquine and oxaliplatin at the same doses and schedules as in Groups 2 and 3.\u003c/p\u003e \u003cp\u003eOn day 30, 10 mice from each group underwent intravital bioluminescence imaging, after which they were euthanized and dissected to visually assess the presence of organ metastases. Then, the cecum, liver, lungs, and spleen were harvested for luciferase expression analysis using real-time PCR. The remaining 10 mice per group continued treatment for survival analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eIntravital bioluminescence imaging\u003c/h2\u003e \u003cp\u003eLuciferin was dissolved in DPBS (Paneco, Russia) at 30 mg/mL. Mice were injected with 100 \u0026micro;L of luciferin and anesthetized using isoflurane (Aerrane). Luminescence was detected using an IVIS Spectrum In Vivo Imaging System (PerkinElmer, USA) in automatic signal accumulation mode.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation from organs and luciferase expression analysis\u003c/h2\u003e \u003cp\u003eFollowing euthanasia, the cecum, liver, lungs, and spleen were collected, rinsed in PBS, and cut into small fragments. Tissue homogenization was performed using ultrasound in ExtractRNA solution (Evrogen, Russia) at a ratio of 100 mg of tissue per 1 mL of reagent. Total RNA was then extracted according to the manufacturer's protocol. Luciferase expression was quantified using RT-PCR using a CFX96 Real-Time PCR System (Bio-Rad, USA) with primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Statistical analyses were performed using GraphPad Prism 10.4.0. The Mann-Whitney U-test was used to compare groups, with statistical significance set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Survival analysis was conducted using Kaplan-Meier curves.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eAnticancer drugs etoposide and oxaliplatin induce autophagy activation in osteosarcoma and colorectal cancer cells\u003c/h2\u003e \u003cp\u003ePrevious studies have reported that cisplatin can induce autophagy in tumor cells, which may either promote cell death or contribute to drug resistance [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. To explore this further, we selected osteosarcoma cells, which are commonly treated with etoposide, and murine colorectal cancer cells, for which platinum-based drugs are indicated [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we utilized the well-established HOS osteosarcoma cell line and two additional cell lines, OS921 and OS1056, derived from lung metastases of osteosarcoma patients who had undergone multiple chemotherapy regimens. The patient-derived cells exhibited morphology similar to HOS cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) but demonstrated significantly higher resistance to etoposide compared to HOS cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the impact of etoposide and oxaliplatin on autophagy activation, we performed RT-PCR to assess the expression of ULK1 and Atg7. Osteosarcoma cell lines HOS, OS921, and OS1056 were treated with etoposide at concentrations of 1, 2.5, and 5.8 \u0026micro;M, while CT-26 colorectal cancer cells were treated with oxaliplatin at concentrations of 10, 20, and 30 \u0026micro;M. In all cell lines, we observed a dose-dependent increase in the expression of both ULK1 and Atg7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u0026ndash;F). Western blot analysis further confirmed autophagy activation, showing a dose-dependent increase in the levels of Atg5 and LC3-II, along with a decrease in p62 levels, a marker of autophagic flux (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG\u0026ndash;J). In HOS cells, we also evaluated Beclin 1 expression, which increased more than 5.5-fold following treatment with 5.8 \u0026micro;M etoposide (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG, K). These findings, which focus on downstream markers of autophagy, strongly suggest that both etoposide and oxaliplatin stimulate autophagy activation in osteosarcoma and colorectal tumor cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eChloroquine enhances the efficacy of etoposide in osteosarcoma and oxaliplatin in colorectal cancer\u003c/h2\u003e \u003cp\u003eAutophagy predominantly serves as a protective cellular mechanism in cancer cells, often contributing to malignant progression and chemotherapy resistance [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. It is also associated with cellular processes such as dormancy and senescence [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. To investigate whether autophagy modulation would overcome chemotherapy resistance in osteosarcoma, we selected chloroquine (CQ) as an autophagy inhibitor. CQ is FDA-approved for other diseases and has demonstrated efficacy in overcoming resistance in colorectal cancer cells [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo determine a safe concentration of CQ for normal cells, we conducted cytotoxicity assays using dermal fibroblasts (DF2). Both CQ alone and in combination with etoposide were tested, and we found that 25 \u0026micro;M CQ was non-toxic to normal cells, including when combined with etoposide at various concentrations (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). However, surprisingly, initial experiments combining CQ and etoposide simultaneously on osteosarcoma cells demonstrated no significant difference in cell viability compared to etoposide treatment alone (Fig. S2).\u003c/p\u003e \u003cp\u003eTo optimize the treatment regimen, we pre-treated tumor cells with CQ for 16 hours and subsequently applied etoposide as previously described in [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Using the MTT assay, we observed a significant reduction in the viability of all three osteosarcoma cell lines following sequential treatment. This effect was particularly pronounced in patient-derived osteosarcoma cells resistant to etoposide. Specifically, in HOS cells treated with 5.8 \u0026micro;M etoposide alone, 37.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5% of cells survived, whereas pre-treatment with CQ reduced survival to 15.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8%. For OS921 cells, etoposide alone resulted in 56.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1% viability, while CQ pre-treatment reduced this to 21.6\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3%. Notably, OS1056 cells, which displayed high resistance to etoposide, exhibited 95.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7% survival with etoposide alone, but this dropped to 35.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3% with CQ pre-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eInterestingly, the opposite effect was observed in dermal fibroblasts, where CQ pretreatment increased cell viability. At the highest etoposide concentration, 70\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5% of fibroblasts remained viable after etoposide alone, compared to 85.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.1% with CQ pretreatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eTo further explore the mechanism of cell death, we performed Annexin V/PI staining followed by flow cytometry. Our results revealed that both etoposide alone and its combination with CQ induced cell death through apoptosis and necrosis, but CQ pre-treatment significantly favored and prompted apoptotic cell death in osteosarcoma cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, D).\u003c/p\u003e \u003cp\u003eWe further validated these findings using xCELLigence technology, which allows real-time monitoring of cell viability. In all three osteosarcoma cell lines, CQ pretreatment led to nearly complete cell death, which occurred more rapidly and efficiently than with etoposide alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Similar results were observed in CT-26 colorectal cancer cells treated with a combination of 0.8 \u0026micro;M CQ and 20 \u0026micro;M OxP, where the cell index was more than twofold lower compared to oxaliplatin alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we examined the effect of CQ and etoposide in a 3D spheroid model, which better mimics tumor behavior \u003cem\u003ein vivo\u003c/em\u003e. Spheroids were treated with CQ, etoposide at 1, 2.5, or 5.8 \u0026micro;M, or their combination. The most pronounced effect was observed in HOS spheroids treated with 5.8 \u0026micro;M etoposide and CQ, where spheroids lost their defined contours and began disintegrating after 96 hours. More resistant OS921 and OS1056 spheroids exhibited complete degradation with a combination of CQ and only 1 \u0026micro;M etoposide (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eTo confirm these observations, we measured ATP levels using the EZcount\u0026trade; ATP Cell Assay Kit. ATP, produced by metabolically active and viable spheroid cells, generates bioluminescence upon oxidation of D-luciferin by firefly luciferase. While CQ- and etoposide-treated HOS spheroids maintained some structural integrity, ATP activity was nearly undetectable. Similarly, ATP depletion confirmed near-total cell death in OS921 and OS1056 spheroids pre-treated with 25 \u0026micro;M CQ, further supporting the effectiveness of this combination therapy (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eOur results demonstrate that chloroquine significantly enhances the cytotoxic effects of etoposide in osteosarcoma and oxaliplatin in colorectal cancer cells. Importantly, this combination therapy effectively overcomes chemotherapy resistance, particularly in patient-derived osteosarcoma cells, while protecting normal fibroblasts. These findings highlight the potential clinical relevance of chloroquine as an adjuvant to conventional chemotherapy\u003c/p\u003e \u003cp\u003e \u003cb\u003eCQ, introduced into the chemotherapy regimen, prevents the ability of osteosarcoma and mouse colorectal cancer cells to develop metastatic phenotype\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eBoth osteosarcoma and colorectal cancer are highly metastatic and prone to recurrence, posing significant therapeutic challenges [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. To evaluate whether chloroquine (CQ) enhances the efficacy of chemotherapy in preventing metastasis, we assessed the impact of CQ on cell migration, epithelial-mesenchymal transition (EMT) markers, proliferative capacity from a dispersed population \u003cem\u003ein vitro\u003c/em\u003e, as well as tumor growth and metastasis \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eWhile osteosarcoma cells are non-epithelial, CQ treatment significantly reduced the expression of Snail1 and TWIST in OS921, OS1056, and the control HOS cell line. Etoposide alone had no effect on these markers, but the combination of CQ and etoposide significantly downregulated their expression in osteosarcoma cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In the wound healing assay, etoposide monotherapy had no substantial impact on scratch closure, while preincubation with 25 \u0026micro;M CQ led to a modest, though significant, reduction in wound closure compared to untreated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA,B). The migratory capacity of CT-26 cells was assessed using xCELLigence technology with CIM plates, which quantify cell migration through serum gradient-driven transwell migration. CQ-treated cells exhibited high migratory ability, similar to control cells, whereas etoposide monotherapy significantly reduced migration. The combination of CQ and etoposide further suppressed cell migration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). The colony formation assay, which assesses the ability of tumor cells to proliferate from a dispersed population, mimicking their potential to relapse, revealed that sparsely seeded cells retained their ability to form colonies under etoposide treatment. However, preincubation with 25 \u0026micro;M CQ followed by etoposide (1, 2.5, or 5.8 \u0026micro;M) completely abolished colony formation in all three osteosarcoma cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the efficacy of CQ in sensitizing tumor cells to oxaliplatin therapy \u003cem\u003ein vivo\u003c/em\u003e, we orthotopically injected 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e CT-26luc cells into the cecal mucosa of BALB/c mice. Mice were randomly divided into four groups (n\u0026thinsp;=\u0026thinsp;20 per group): Untreated, CQ, OxP, and combination treatment (CQ\u0026thinsp;+\u0026thinsp;OxP). Treatment commenced on day 8 post-inoculation and continued until the experiment's conclusion. Ten mice per group were observed for survival analysis, while the remaining ten underwent bioluminescence imaging at day 30 for metastasis assessment in the lungs, liver and spleen.\u003c/p\u003e \u003cp\u003eBioluminescence imaging of CT-26luc tumors revealed that both CQ and oxaliplatin monotherapies slowed tumor growth. The ROI signal in the \u0026lsquo;CQ\u0026rsquo; group was 1.8\u0026times;10\u003csup\u003e10\u003c/sup\u003e \u0026plusmn; 9.9\u0026times;10\u003csup\u003e8\u003c/sup\u003e, compared to 1.7\u0026times;10\u003csup\u003e9\u003c/sup\u003e \u0026plusmn; 6.3\u0026times;10\u003csup\u003e7\u003c/sup\u003e in the \u0026lsquo;Untreated\u0026rsquo; group. The \u0026lsquo;OxP\u0026rsquo; group exhibited a statistically significant tumor size reduction (ROI\u0026thinsp;=\u0026thinsp;7.1\u0026times;10\u003csup\u003e9\u003c/sup\u003e \u0026plusmn; 2.3\u0026times;10\u003csup\u003e7\u003c/sup\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.005), while the \u0026lsquo;CQ\u0026thinsp;+\u0026thinsp;OxP\u0026rsquo; combination produced the most substantial effect, reducing ROI to 2.4\u0026times;10\u003csup\u003e8\u003c/sup\u003e \u0026plusmn; 1.0\u0026times;10\u003csup\u003e6\u003c/sup\u003e on day 30 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAccordingly, tumor growth inhibition correlated with prolonged survival. The median survival time was 29\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2 days in the \u0026lsquo;Untreated\u0026rsquo; group, 29.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2 days in the \u0026lsquo;CQ\u0026rsquo; group, 33.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2 days in the \u0026lsquo;OxP\u0026rsquo; group, and 39.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4 days in the \u0026lsquo;CQ\u0026thinsp;+\u0026thinsp;OxP\u0026rsquo; group. By day 45, one mouse remained alive in both the \u0026lsquo;CQ\u0026rsquo; and \u0026lsquo;OxP\u0026rsquo; groups, while three mice survived in the \u0026lsquo;CQ\u0026thinsp;+\u0026thinsp;OxP\u0026rsquo; group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eFurthermore, visual and molecular analyses were performed to assess metastasis. Visual examination of metastases revealed that animals in the \u0026lsquo;Untreated,\u0026rsquo; \u0026lsquo;CQ,\u0026rsquo; and \u0026lsquo;OxP\u0026rsquo; groups developed metastases in the spleen and liver, while the combination group exhibited no detectable metastases in any organ (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). To confirm these findings, we performed RT-PCR for luciferase expression in excised organs. Three mice from the \u0026lsquo;Untreated\u0026rsquo; group and two from \u0026lsquo;CQ\u0026rsquo; died before the experiment. Luciferase levels at the primary tumor site were 1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 in the \u0026lsquo;Untreated\u0026rsquo; group, 1.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 in the \u0026lsquo;CQ\u0026rsquo; group, 0.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 in the \u0026lsquo;OxP\u0026rsquo; group, and 0.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 in the \u0026lsquo;CQ\u0026thinsp;+\u0026thinsp;OxP\u0026rsquo; group, with the latter demonstrating significant reduction compared to the untreated control (p\u0026thinsp;=\u0026thinsp;0.0023). Notably, luciferase was undetectable in one mouse from the \u0026lsquo;CQ\u0026rsquo; and \u0026lsquo;OxP\u0026rsquo; groups and in five mice from the \u0026lsquo;CQ\u0026thinsp;+\u0026thinsp;OxP\u0026rsquo; group, suggesting remarkable successful treatment by the combination therapy (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eIn the \u0026lsquo;Untreated\u0026rsquo; group, all but one mouse developed lung metastases, three of which also exhibited both liver and spleen metastases. In the \u0026lsquo;CQ\u0026rsquo; group, four mice developed lung metastases, one had liver metastases, and two had spleen metastases. Additionally, one mouse showed a high luciferase signal in the spleen, indicating metastatic presence. In total, five out of eight mice in this group developed metastases. In the \u0026lsquo;OxP\u0026rsquo; group, only one mouse developed lung metastases. Another mouse developed metastases in both the liver and spleen, leading to a total of two out of 10 mice exhibiting metastatic spread. Remarkably, in the CQ\u0026thinsp;+\u0026thinsp;OxP combination group, no mice developed metastases in the lung, liver, or spleen (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eConventional cancer treatments, such as chemotherapy and radiotherapy, often fail to completely eradicate all cancer cells, leading to the survival of residual populations and the enrichment of stem-like dormant cells. These cells exhibit enhanced resistance to therapy and increased autophagy activity, contributing to the formation of micrometastases and elevating the risk of cancer recurrence [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. To investigate the mechanism by which CQ, in combination with OxP, dramatically suppresses metastasis, we established an \u003cem\u003ein vitro\u003c/em\u003e dormancy model using serum depletion in cancer cells, and compared CQ\u0026rsquo;s effects on the viability of proliferating versus dormant cancer cells.\u003c/p\u003e \u003cp\u003eWhen cells enter dormancy, they cease proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) and arrest at the G0/G1 phase of the cell cycle (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Dormant cells exhibited reduced expression of proliferation markers (Aurka and Ki67) by day 5 of starvation. Meanwhile, dormant cells demonstrated increased expression of autophagy-related genes ULK1 and Atg7 in addition to displaying elevated levels of EMT markers ZEB1, TWIST, and Vimentin. Additionally, they acquired features of cancer stem cells, including elevated CD44 and ALDH1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Notably, dormant cells demonstrated resistance to antitumor drugs in both 2D (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD) and 3D lung cancer cell models (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE,F)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUsing Annexin V and propidium iodide (PI) staining followed by flow cytometry, we demonstrated that CQ preferentially induced cell death in the dormant population of lung cancer cells, primarily through necrosis, although apoptosis was also observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG\u0026ndash;J). Following CQ treatment, 77.9% of proliferating A549 cells remained viable, whereas only 38.3% of dormant A549 cells survived (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG,H). Similarly, in H1299 cells, 82.9% of proliferating cells survived compared to just 34% of dormant cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI,J,).\u003c/p\u003e \u003cp\u003eThese findings suggest that in our \u003cem\u003ein vivo\u003c/em\u003e experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), the combination of OxP and CQ targeted distinct tumor cell populations, whereby OxP primarily eliminated proliferating cancer cells, while CQ, primarily by suppressing autophagy, effectively eradicated resistant dormant cells that aroused as a result of chemotherapy. This dual mechanism likely contributes to the significant reduction in metastasis observed in the CQ\u0026thinsp;+\u0026thinsp;OxP treatment group.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eResistance to anticancer drugs, tumor relapse, and metastasis remain major challenges in cancer therapy, with extensive research has been dedicated to address these challenges in cancer patients. Among the various strategies explored, combination therapies have emerged as a promising approach to circumvent resistance mechanisms by integrating conventional chemotherapies with immunotherapies, targeted therapies, and inhibitors of cellular proteostasis, beyond others. Our research group has focused on disrupting tumor cell resistance by targeting key components of the cellular proteostasis system. For instance, we previously demonstrated that the HSF1 inhibitor CL-43 substantially sensitized colorectal and lung carcinoma cells to chemotherapy [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Here, we explored autophagy inhibition as a potential strategy to counteract therapy resistance.\u003c/p\u003e \u003cp\u003eWhile the role of autophagy in cancer is highly context-dependent and varies across tumor types, accumulating evidence underscores its critical involvement in cancer progression and therapy resistance [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Autophagy is induced in response to tumor-associated hypoxia and has been shown to mediate chemoresistance in colon cancer models [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Furthermore, several studies have reported a protective role of autophagy in osteosarcoma, glioblastoma, and acute myeloid leukemia, where its inhibition using CQ significantly reversed chemoresistance [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Recent findings, including our own, suggest that autophagy serves as a pro-survival compensatory mechanism following cellular proteostasis disruption, such as Hsp70 inhibition or proteasome blockade. However, this adaptive response can be effectively counteracted using autophagy inhibitors like CQ and SAR405 [\u003cspan additionalcitationids=\"CR40 CR41 CR42 CR43\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Thus, autophagy likely emerges as a universal hallmark of chemoresistance, enabling cancer cells to withstand therapy-induced stress.\u003c/p\u003e \u003cp\u003eIn our work, we examined not only established osteosarcoma cell lines but also patient-derived lung metastasis cells from individuals with osteosarcoma who had undergone multiple courses of therapy and experienced recurrent relapses. These patient-derived cells exhibited pronounced resistance to etoposide and showed enhanced autophagy activation in response to treatment. This observation led us to explore the therapeutic potential of autophagy inhibition by combining CQ with standard anticancer drugs. Our findings demonstrate that pre-treatment with CQ, administered 16 hours prior to etoposide, significantly impaired osteosarcoma cell resistance and sensitized them to chemotherapy. This was confirmed using multiple experimental approaches, including MTT assays, apoptosis quantification, xCELLigence real-time monitoring, and 3D spheroid models.\u003c/p\u003e \u003cp\u003eCQ has been widely studied as a monotherapy and has been shown to induce cell death across various cancer types [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Preclinical studies have further demonstrated that CQ inhibits autophagy and reduces tumor growth in bladder cancer and pancreatic adenocarcinoma models [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Additionally, the combination of CQ with alkylating agents has been shown to suppress tumor growth in a mouse model of B-cell lymphoma [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMetastasis remains a key challenge in cancer therapy, often limiting curative treatment options [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. In our study, the combination of CQ with anticancer drugs significantly downregulated EMT markers and reduced cell motility in both osteosarcoma and CT-26luc colorectal cancer cells. In colony formation assays, CQ-treated osteosarcoma cells lost their ability to resume tumor growth, highlighting its potential in preventing cancer cell repopulation and recurrence. Furthermore, half of the treated animals with osteosarcoma, the primary tumor failed to reach a sufficient size for analysis, underscoring the potent efficacy of this therapeutic approach.\u003c/p\u003e \u003cp\u003eAlthough numerous preclinical studies have investigated CQ as an autophagy inhibitor in combination with chemotherapy, most in vivo experiments have relied on subcutaneous tumor models [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. However, these models do not accurately recapitulate the tumor microenvironment and fail to mimic the metastatic process. In contrast, our study employed an orthotopic model in which CT-26luc cells were injected into the submucosa of the mouse cecum. This approach closely resembles the natural progression of colorectal cancer in patients and facilitates spontaneous metastasis to distant organs, such as the liver, lungs, and spleen. As a result, we observed metastases in the liver, lungs, and spleen in untreated animals and in those receiving monotherapy. Importantly, no detectable metastases were found in mice treated with the OxP\u0026thinsp;+\u0026thinsp;CQ combination, as confirmed by the absence of luciferase signals in metastatic organs.\u003c/p\u003e \u003cp\u003eOur findings further indicate that CQ may substantially suppress metastasis by primarily targeting dormant cancer cells. In our \u003cem\u003ein vitro\u003c/em\u003e dormancy model, CQ was significantly more cytotoxic to dormant cells than proliferative ones. This suggests that the combination of chemotherapy and CQ exerts a dual therapeutic effect: while conventional anticancer drugs eliminate actively proliferating tumor cells, CQ effectively eradicates dormant cells, which are otherwise resistant to standard therapies [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. This therapeutic approach may provide a more comprehensive strategy for preventing both tumor regrowth and metastasis.\u003c/p\u003e \u003cp\u003eOur study demonstrates that autophagy inhibition via CQ enhances the therapeutic efficacy of etoposide and oxaliplatin, leading to a significant reduction in cancer progression and metastasis compared to monotherapy. These findings, in conjunction with ongoing research efforts, support the potential of combining autophagy inhibitors with standard chemotherapy as a promising strategy for the treatment of osteosarcoma and colorectal cancer. Further investigations, particularly in clinical settings, are warranted to validate the translational relevance of this approach.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAuthors cordially thank Ms. Maria Istomina (Almazov National Medical Research Centre, St.Petersburg, Russia) for the help with animal experiments\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interests\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAuthors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll \u003cem\u003ein vivo\u003c/em\u003e experimental protocols were approved by the licensing committee of the Institute of Cytology of the Russian Academy of Sciences (Identification number F18-00380). All methods were carried out in accordance with relevant guidelines and regulations and are reported in accordance with ARRIVE guidelines.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe research protocol for receiving cells from patients was approved by the local ethical committee, and all patients provided written informed consent prior to tissue collection. Tumor samples were preserved in compliance with the Helsinki Declaration and utilized in accordance with the Human Tissue Act of 2004.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLindsey BA, Markel JE Kleinerman ES. Osteosarcoma Overview. Rheumatol Ther; 4, 25\u0026ndash;43 (2017)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtani S, Ohnuma M, Ito K \u0026amp; Matsushita Y. Cellular dynamics of distinct skeletal cells and the development of osteosarcoma. Front Endocrinol (Lausanne) 14, 1181204 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuetke A, Meyers PA, Lewis I \u0026amp; Juergens H. Osteosarcoma treatment - where do we stand? A state of the art review. Cancer Treat Rev 40, 523\u0026ndash;532 (2014)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiegel RL, Wagle NS, Cercek A, Smith RA \u0026amp; Jemal A. Colorectal cancer statistics, 2023. CA Cancer J Clin 73, 233\u0026ndash;254 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiller LH \u0026amp; Schrag D. Diagnosis and Treatment of Metastatic Colorectal Cancer: A Review. JAMA 325, 669\u0026ndash;685 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCervantes A, Adam R, Rosell\u0026oacute; S, Arnold D, Normanno N, Ta\u0026iuml;eb J; ESMO Guidelines Committee. Metastatic colorectal cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Ann Oncol 34, 10\u0026ndash;32 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolohan C, Van Schaeybroeck S, Longley DB \u0026amp; Johnston PG. Cancer drug resistance: an evolving paradigm. Nat Rev Cancer 13, 714\u0026ndash;726 (2013)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLongley DB \u0026amp; Johnston PG. Molecular mechanisms of drug resistance. J Pathol 205, 275\u0026ndash;292 (2005)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalluzzi L, Bravo-San Pedro JM, Levine B, Green DR \u0026amp; Kroemer G. Pharmacological modulation of autophagy: therapeutic potential and persisting obstacles. Nat Rev Drug Discov 16, 487\u0026ndash;511 (2017)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlionsky DJ, Petroni G, Amaravadi RK, Baehrecke EH, Ballabio A et al. Autophagy in major human diseases. EMBO J 40, e108863 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoldsmith J, Levine B \u0026amp; Debnath J. Autophagy and cancer metabolism. Methods Enzymol 542, 25\u0026ndash;57 (2014)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElia I, Doglioni G \u0026amp; Fendt SM. Metabolic Hallmarks of Metastasis Formation. Trends Cell Biol 28, 673\u0026ndash;684 (2018) doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tcb.2018.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.tcb.2018.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMowers EE, Sharifi MN \u0026amp; Macleod KF. Autophagy in cancer metastasis. Oncogene 36, 1619\u0026ndash;1630 (2017)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSosa MS, Bragado P \u0026amp; Aguirre-Ghiso JA. Mechanisms of disseminated cancer cell dormancy: an awakening field. Nat Rev Cancer 14, 611\u0026ndash;622 (2014)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng YF, Shi YH, Shen YH, Ding ZB, Ke AW, Zhou J, Qiu SJ \u0026amp; Fan J. Promoting colonization in metastatic HCC cells by modulation of autophagy. PLoS One 8, e74407 (2013)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlhasan B, Mikeladze M, Guzhova I \u0026amp; Margulis B. Autophagy, molecular chaperones, and unfolded protein response as promoters of tumor recurrence. Cancer Metastasis Rev 42, 217\u0026ndash;254 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBen-Zvi I, Kivity S, Langevitz P \u0026amp; Shoenfeld Y. Hydroxychloroquine: from malaria to autoimmunity. Clin Rev Allergy Immunol 42, 145\u0026ndash;153 (2012)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu S, Zhong Y, Nie C, Pan Y, Adeli M \u0026amp; Haag R. Co-Delivery of Doxorubicin and Chloroquine by Polyglycerol Functionalized MoS2 Nanosheets for Efficient Multidrug-Resistant Cancer Therapy. Macromol Biosci 21, e2100233 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBano N, Ansari MI, Kainat KM, Singh VK \u0026amp; Sharma PK. Chloroquine synergizes doxorubicin efficacy in cervical cancer cells through flux impairment and down regulation of proteins involved in the fusion of autophagosomes to lysosomes. Biochem Biophys Res Commun 656:131\u0026ndash;138, (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanilova A, Misyurin V, Novik A, Girdyuk D, Avdonkina N, Nekhaeva T, et al. Cancer/testis antigens expression during cultivation of melanoma and soft tissue sarcoma cells. Clin Sarcoma Res 10, 3 (2020)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomarova EY, Suezov RV, Nikotina AD, Aksenov ND, Garaeva LA, Shtam TA, et al. Hsp70-containing extracellular vesicles are capable of activating of adaptive immunity in models of mouse melanoma and colon carcinoma. Sci Rep 11, 21314 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePervushin NV, Yapryntseva MA, Panteleev MA, Zhivotovsky B \u0026amp; Kopeina GS. Cisplatin Resistance and Metabolism: Simplification of Complexity. Cancers (Basel) 16, 3082 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerret A, D\u0026ocirc;mont J, Chamseddine AN, Dumont SN, Verret B, Briand S, et al. Efficacy and safety of oral metronomic etoposide in adult patients with metastatic osteosarcoma. Cancer Med 10, 230\u0026ndash;236 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuang Z, Wang J, Liu K, Wu J \u0026amp; Li J. Optimal duration of oxaliplatin-based adjuvant chemotherapy in patients with different risk factors for stage II-III colon cancer: a meta-analysis. Int J Surg 110, 3030\u0026ndash;3038 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi D, Geng D \u0026amp; Wang M. Advances in natural products modulating autophagy influenced by cellular stress conditions and their anticancer roles in the treatment of ovarian cancer. FASEB J 38, e70075 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkrzeszewski M, Maciejewska M, Kobza D, Gawrylak A, Kieda C \u0026amp; Waś H. Risk factors of using late-autophagy inhibitors: Aspects to consider when combined with anticancer therapies. Biochem Pharmacol 225, 116277 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikotina AD, Vladimirova SA, Kokoreva NE, Komarova EY, Aksenov ND, Efremov S, et al. Combined Cytotoxic Effect of Inhibitors of Proteostasis on Human Colon Cancer Cells. Pharmaceuticals (Basel) 15, 923 (2022)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z, Wang H, Hu C, Wu C, Wang J, Hu F t al. Targeting autophagy enhances atezolizumab-induced mitochondria-related apoptosis in osteosarcoma. Cell Death Dis 12, 164 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarzegari A, Salemi F, Kamyab A, Aratikatla A, Nejati N, Valizade M, et al. The efficacy and applicability of chimeric antigen receptor (CAR) T cell-based regimens for primary bone tumors: A comprehensive review of current evidence. J Bone Oncol 48, 100635 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrzywoń L, Lazaris A, Petrillo SK, Zlotnik O, Gao ZH \u0026amp; Metrakos P. Histopathological Growth Patterns Determine the Outcomes of Colorectal Cancer Liver Metastasis Following Liver Resection. Cancers (Basel) 16, 3148 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKirkland JL. Tumor dormancy and disease recurrence. Cancer Metastasis Rev 42, 9\u0026ndash;12 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikotina AD, Koludarova L, Komarova EY, Mikhaylova ER, Aksenov ND, Suezov R, et al. Discovery and optimization of cardenolides inhibiting HSF1 activation in human colon HCT-116 cancer cells. Oncotarget 9, 27268\u0026ndash;27279 (2018)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikotina AD, Vladimirova SA, Kokoreva NE, Nevdakha VA, Lazarev VF, Kuznetcova LS, et al. Novel mechanism of drug resistance triggered by tumor-associated macrophages through Heat Shock Factor-1 activation. Cancer Immunol Immunother 73, 25 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDebnath J, Gammoh N \u0026amp; Ryan KM. Autophagy and autophagy-related pathways in cancer. Nat Rev Mol Cell Biol 24, 560\u0026ndash;575 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvakumaran M, Amaravadi RK, Vasilevskaya IA \u0026amp; O'Dwyer PJ. Autophagy inhibition sensitizes colon cancer cells to antiangiogenic and cytotoxic therapy. Clin Cancer Res 19, 2995\u0026ndash;3007 (2013)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Y, Huang S, Chen S, Chen J, Wang Z, Wang Y \u0026amp; Zheng H. SOX2 promotes chemoresistance, cancer stem cells properties, and epithelial-mesenchymal transition by β-catenin and Beclin1/autophagy signaling in colorectal cancer. Cell Death Dis 12, 449 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiu J, Yan T, Guo W, Wang W, Ren T, Huang Y, et al. The COPS3-FOXO3 positive feedback loop regulates autophagy to promote cisplatin resistance in osteosarcoma. Autophagy 19, 1693\u0026ndash;1710 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen C, Zhang H, Yu Y, Huang Q, Wang W, Niu J, et al. Chloroquine suppresses proliferation and invasion and induces apoptosis of osteosarcoma cells associated with inhibition of phosphorylation of STAT3. Aging (Albany NY) 13, 17901\u0026ndash;17913 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang HL, Li JN, Kan WJ, Xu GY, Luo GH, Song N, et al.. Chloroquine enhances the efficacy of chemotherapy drugs against acute myeloid leukemia by inactivating the autophagy pathway. Acta Pharmacol Sin 44, 2296\u0026ndash;2306 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYun EJ, Kim S, Hsieh JT \u0026amp; Baek ST. Wnt/β-catenin signaling pathway induces autophagy-mediated temozolomide-resistance in human glioblastoma. Cell Death Dis 11, 771 (2020)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlhasan B, Gladova YA, Sverchinsky DV, Aksenov ND, Margulis BA \u0026amp; Guzhova IV. Hsp70 Negatively Regulates Autophagy via Governing AMPK Activation, and Dual Hsp70-Autophagy Inhibition Induces Synergetic Cell Death in NSCLC Cells. Int J Mol Sci 25, 9090 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerretti GDS, Quaas CE, Bertolini I, Zuccotti A, Saatci O, Kashatus JA, et al. HSP70-mediated mitochondrial dynamics and autophagy represent a novel vulnerability in pancreatic cancer. Cell Death Differ 31, 881\u0026ndash;896 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalimi A, Schroeder KM, Schemionek-Reinders M, Vieri M, Maletzke S, Gezer D, et al. Targeting autophagy increases the efficacy of proteasome inhibitor treatment in multiple myeloma by induction of apoptosis and activation of JNK. BMC Cancer 22, 735 (2022)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZafeiropoulou K, Kalampounias G, Alexis S, Anastasopoulos D, Symeonidis A \u0026amp; Katsoris P. Autophagy and oxidative stress modulation mediate Bortezomib resistance in prostate cancer. PLoS One 19, e0289904 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnand K, Niravath P, Patel T, Ensor J, Rodriguez A, Boone T, et al. A Phase II Study of the Efficacy and Safety of Chloroquine in Combination With Taxanes in the Treatment of Patients With Advanced or Metastatic Anthracycline-refractory Breast Cancer. Clin Breast Cancer 21, 199\u0026ndash;204 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSasaki K, Tsuno NH, Sunami E, Kawai K, Hongo K, Hiyoshi M, et al. Resistance of colon cancer to 5-fluorouracil may be overcome by combination with chloroquine, an in vivo study. \u003cem\u003eAnticancer Drugs\u003c/em\u003e 23, 675\u0026thinsp;\u0026ndash;\u0026thinsp;82 (2012)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCubrey JA, Abrams SL, Follo MY, Manzoli L, Ratti S, Martelli AM, et al. Effects of chloroquine and hydroxychloroquine on the sensitivity of pancreatic cancer cells to targeted therapies. Adv Biol Regul 87,100917 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin YC, Lin JF, Wen SI, Yang SC, Tsai TF, Chen HE, et al. Chloroquine and hydroxychloroquine inhibit bladder cancer cell growth by targeting basal autophagy and enhancing apoptosis. Kaohsiung J Med Sci 33, 215\u0026ndash;223 (2017)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmaravadi RK, Yu D, Lum JJ, Bui T, Christophorou MA, Evan GI, et al. Autophagy inhibition enhances therapy-induced apoptosis in a Myc-induced model of lymphoma. \u003cem\u003eJ Clin Invest\u003c/em\u003e 117, 326\u0026thinsp;\u0026ndash;\u0026thinsp;36 (2007)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasagrande N, Borghese C, Avanzo M \u0026amp; Aldinucci D. In Doxorubicin-Adapted Hodgkin Lymphoma Cells, Acquiring Multidrug Resistance and Improved Immunosuppressive Abilities, Doxorubicin Activity Was Enhanced by Chloroquine and GW4869. \u003cem\u003eCells\u003c/em\u003e 12, 2732 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGerstberger S, Jiang Q \u0026amp; Ganesh K. Metastasis. Cell 186, 1564\u0026ndash;1579 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaneko M, Nozawa H, Hiyoshi M, Tada N, Murono K, Nirei T, et al. Temsirolimus and chloroquine cooperatively exhibit a potent antitumor effect against colorectal cancer cells. \u003cem\u003eJ Cancer Res Clin Oncol\u003c/em\u003e 140, 769\u0026thinsp;\u0026ndash;\u0026thinsp;81 (2014)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvakumaran M, Amaravadi RK, Vasilevskaya IA \u0026amp; O'Dwyer PJ. Autophagy inhibition sensitizes colon cancer cells to antiangiogenic and cytotoxic therapy. Clin Cancer Res 19, 2995\u0026ndash;3007 (2013)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrancescangeli F, De Angelis ML, Rossi R, Cuccu A, Giuliani A, De Maria R, et al. Dormancy, stemness, and therapy resistance: interconnected players in cancer evolution. Cancer Metastasis Rev 42, 197\u0026ndash;215 (2023)\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6237822/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6237822/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTumor cell resistance to anticancer therapy and tumor relapse remain major challenges in cancer treatment. Chloroquine, an FDA-approved antimalarial drug currently undergoing clinical trials for various cancers, has emerged as a promising candidate for combination therapy with conventional anticancer agents. In this study, we demonstrate that in patients-derived osteosarcoma cells who had undergone multiple chemotherapy treatments, as well as in murine colorectal cancer cells, administration of standard chemotherapeutic agents induces autophagy, which likely serves as a cytoprotective mechanism promoting therapy resistance in at least of part of tumor population. Incorporating chloroquine into the treatment regimen effectively suppressed autophagy, significantly enhancing osteosarcoma cell death in both 2D and 3D models while simultaneously reducing cell proliferation and migration capacity. In an orthotopic \u003cem\u003ein vivo\u003c/em\u003e model of colorectal cancer, the combination of chloroquine and oxaliplatin not only impaired tumor growth but also prevented metastatic dissemination and inhibited the formation of metastasis. Notably, comparative analyses of proliferating and dormant tumor cell populations revealed that chloroquine exerts preferential cytotoxicity toward dormant cancer cells. This suggests a dual therapeutic advantage, wherein cytostatic agents primarily eliminate proliferating cells, while chloroquine specifically eradicates dormant cancer cells, which are often implicated in tumor recurrence. Collectively, these findings highlight the potential of autophagy inhibition to enhance the chemotherapy efficacy and suggest chloroquine-based combination therapy as a promising strategy for suppressing tumor growth and metastasis, ultimately improving treatment outcomes in cancer patients.\u003c/p\u003e","manuscriptTitle":"Chloroquine Overcomes Chemotherapy Resistance and Suppresses Cancer Metastasis by Eradicating Dormant Cancer Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-06 13:22:49","doi":"10.21203/rs.3.rs-6237822/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-04-15T16:07:38+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-04-11T16:42:07+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-04-09T13:43:15+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-04-02T12:53:36+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-04-02T07:27:43+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-03-31T13:30:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-17T11:57:34+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2025-03-16T13:22:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-03-16T13:22:59+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"02ab9c64-f8d5-4555-9d62-5b737a2843d5","owner":[],"postedDate":"May 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46461140,"name":"Biological sciences/Cell biology/Cell death"},{"id":46461141,"name":"Biological sciences/Cell biology/Autophagy"}],"tags":[],"updatedAt":"2026-01-24T08:07:47+00:00","versionOfRecord":{"articleIdentity":"rs-6237822","link":"https://doi.org/10.1038/s41419-025-08304-6","journal":{"identity":"cell-death-and-disease","isVorOnly":false,"title":"Cell Death \u0026 Disease"},"publishedOn":"2025-12-10 05:00:00","publishedOnDateReadable":"December 10th, 2025"},"versionCreatedAt":"2025-05-06 13:22:49","video":"","vorDoi":"10.1038/s41419-025-08304-6","vorDoiUrl":"https://doi.org/10.1038/s41419-025-08304-6","workflowStages":[]},"version":"v1","identity":"rs-6237822","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6237822","identity":"rs-6237822","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00