LINC00885 promotes the development of lung adenocarcinoma through AKT/MTOR/P70 signaling LINC00885 may regulate migration, proliferation, and invasion through the mTOR pathway in lung adenocarcinoma

LINC00885 promotes the development of lung adenocarcinoma through AKT/MTOR/P70 signaling LINC00885 may regulate migration, proliferation, and invasion through the mTOR pathway in lung adenocarcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LINC00885 promotes the development of lung adenocarcinoma through AKT/MTOR/P70 signaling LINC00885 may regulate migration, proliferation, and invasion through the mTOR pathway in lung adenocarcinoma Wang Wan, Dong Wu, Baizhen Dai, Kangxian Wang, Biao Deng, Mingjun Wang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4946723/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Previous studies have demonstrated a role for long non-coding RNAs in lung adenocarcinoma (LUAD). Here, we found high expression levels of LINC00885 in LUAD, especially in middle and advanced stage disease, by RNA-sequencing analysis. This suggests that LINC00885 may be a potential prognostic biomarker of LUAD. Our functional experiments showed that knocking down LINC00885 expression with small interfering RNAs inhibited the growth, migration, invasion, and autophagy of LUAD cells, blocked cell cycle progression, and promoted cell apoptosis. Additionally, LINC00885 knockdown reduced the protein expression levels of p21, MET, p-mTOR, and p-p70, suggesting that LINC00885 may regulate the growth and metastasis of LUAD through these signaling pathways. Additional experiments revealed that an mTOR activator rescued the inhibited cell growth, invasion, and migration following LINC00885 knockdown. Together, these findings demonstrate that LINC00885 may promote LUAD by regulating p21, MET, and mTOR/p70 signal transduction. This study suggests that LINC00885 may be a prognostic biomarker and therapeutic target in LUAD. lung adenocarcinoma LINCRNA P70 mTOR MET Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Non-small cell lung cancer (NSCLC) is a highly malignant cancer type with a high clinical incidence and mortality rates that are increasing annually worldwide [ 1 ] . Over the past several decades, significant improvements have been made in lung cancer treatment, including the development of targeted treatments. However, the emergence of resistant cancer cells during the course of molecular targeted therapy is a well-known limitation of these drugs [ 2 – 4 ] . It is therefore urgent to better understand the molecular mechanisms underlying lung cancer development and identify reliable biomarkers for its early detection, diagnosis, and treatment [ 5 ] . While long non-coding RNAs (lncRNAs) were initially considered “junk,” an increasing number of studies have demonstrated that lncRNAs play critical roles in development, differentiation, stress, and disease pathogenesis [ 6 ] . lncRNAs regulate gene expression and also regulate the expression levels of other lncRNAs [ 7 , 8 ] . Research has demonstrated that lncRNAs exhibit tissue- or cell-specific expression patterns and specific subcellular localization; lncRNAs contain locally highly conserved sequence elements and have special spatial secondary structures [ 9 ] . lncRNAs participate in multiple biological processes through various mechanisms, including through interactions with proteins, formation of endogenous small interfering RNAs (siRNAs) [ 10 ] , and the regulation of mRNA shearing, chromatin remodeling, histone remodeling, transcription, and other processes [ 11 , 12 ] . Considering the large number of lncRNAs in human cells, the role of these molecules in lung adenocarcinoma (LUAD) needs to be further investigated. High-throughput RNA sequencing (RNA-Seq) has emerged as a powerful method for transcriptomic analysis and is widely used for understanding gene functions and biological patterns, finding candidate drug targets, and identifying biomarkers for disease classification and diagnosis [ 13 ] , particularly novel lncRNAs [ 14 , 15 ] . In this study, by analyzing RNA-Seq and The Cancer Genome Atlas (TCGA) datasets, we identified a lncRNA called LINC00885 that is associated with LUAD. Studies have shown that LINC00885 exhibits a significant effect on breast and cervical cancer cells, and its high expression is associated with poor patient prognosis [ 16 – 18 ] . However, the effect of LINC00885 in lung cancer cells has not been studied. In the present study, we examined the roles of LINC00885 in LUAD. We found that knocking down LINC00885 levels decreased the expression of MET and p21. Moreover, silencing LINC00885 in cultured LUAD cells decreased cell proliferation, invasion, migration, and autophagy rates. Therefore, LINC00885 may be a potential therapeutic target for the treatment of LUAD. Materials and Methods Cell culture Human cell lines A549, PC9, H1299, H1975, and H1650 were obtained from the American Type Culture Collection (ATCC, https://www.atcc.org/ ). Cells were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Gaithersburg, MD, USA) and maintained in a 37°C incubator with a humidified atmosphere containing 5% CO 2 . siRNAs and cell transfection Cells were plated at specific densities and transfected with 10 nM siRNA oligonucleotides or non-targeting controls 24 to 48 h after plating. Transfection was performed with Lipofectamine® RNAiMax Reagent (Thermo Waltham, USA) in OptiMEM medium following the manufacturer’s instructions. Knockdown efficiency was determined by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) with the following primers: Si-LINC00885-1: sense CCUCCCAAUUAUCUCCUCUTT, antisense AGAGGAGAUAAUUGGGAGGTT; and si-LINC00885-2: CCGGCUGGUUCAAGAUCAATT, antisense UUGAUCUUGAACCAGCCGGTT. Cell proliferation and colony formation assays Cells were seeded in 96-well plates at 1000 cells per well and transfected with 10 nM siRNA or non-targeting (negative) control siRNA and LINC00885 overexpression or vector 12 to 24 h after seeding. At 72 to 96 h post-transfection, the proliferation rates were measured using cell proliferation reagent (WST-1, Beyotime, Shanghai, China) following the manufacturer’s instructions. The cell viability was calculated as a percentage of the viability of the negative control siRNA–transfected cells. For colony formation assays, cells transfected with LINC00885-targeting siRNAs or control siRNAs were seeded in a 6-well plate at a density of 250 cells/well. After 12 to 14 days of culture at 37°C, 0.1% crystal violet (Solarbio, Beijing, China) and 20% methanol were used as dye solution to fix and stain the colonies. The cells were imaged and counted. Western blot assay RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with protease inhibitors (Beyotime) was used to prepare whole cell lysates. Protein concentration was evaluated using a BCA Protein Assay Kit (Beyotime). Proteins were separated using SDS-PAGE and then transferred to polyvinylidene difluoride membranes. After blocking membranes with skim milk, the membranes were incubated with primary antibodies overnight at 4°C. The membranes were then incubated with secondary antibody for 1 h at 37°C. Protein signals were detected by P-ECL star ( EpiZyme , Shanghai, China). GAPDH was used as an endogenous control. RNA extraction and qRT-PCR Total RNA was extracted from cultured cells using Trizol reagent (Solarbio) following the manufacturer’s instructions. Reverse transcription to cDNA was performed using a reverse transcription kit (Takara, Tokyo, Japan). qRT-PCR reactions were run in an Applied Biosystems 7500 Real-Time PC System (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex Taq II (Takara, Dalian, China). GAPDH mRNA was used as an internal control, and data were analyzed using the 2 − ΔΔCt method. Each experiment was performed in triplicate. The PCR primer sequences are as follows: LINC00885F: CCAGCAGGGCCTAGTAACAC and LINC00885R: CCTTGCTCTTGGTGAGTGGT. Cell migration and invasion assays Quantitative analysis of the migration and invasion capabilities of LUAD cells was performed using the Transwell chamber system. A total of 60 µL of diluted extracellular matrix gel solution was added to the upper chambers (Costar Inc., USA) and the chambers were incubated for 4 h at 37°C. For the migration assay, ECM solution was not added in the upper chamber. Cells were seeded at a density of 1×10 5 cells in 100 µL RPMI-1640 medium with 1% FBS; the wells were then filled with 500 µL RPMI-1640 medium containing 20% FBS. The Transwell chambers were then incubated for 24 to 36 h at 37°C with 5% CO 2 to allow cell migration or invasion. When the incubation period ended, the remaining cells in the upper chamber were removed with a cotton swab. Cells that reached the bottom of the membrane were fixed with paraformaldehyde. The fixed cells were stained with crystal violet at room temperature for 30 min. The crystal violet bound to the cells was washed off with 200 µL of PBS. Cells were observed under a microscope at 4X and 10X and photographed. Flow cytometric analysis of apoptosis and cell cycle distribution For apoptosis analysis, cells were resuspended in moderate binding buffer containing Annexin V–fluorescein isothiocyanate (FITC) with propidium iodide (PI) (BD, NJ, USA). After incubation for 15 min, the cells were analyzed using a BD FACSAria3. For cell cycle analysis, cells were fixed at 4°C overnight in 75% ethanol and then stained with RNase A and PI for 30 min at 37°C (Keygen, Nanjing, China). Samples were analyzed by a flow cytometer (BD Biosciences, San Jose, CA, USA) in the Guangdong Medical University flow cytometry core. Animal models For the subcutaneous tumor model, the armpits of mice were subcutaneously injected with transfected A549 cells (5×10 6 cells/mice, n = 6/group for knockdown groups). In the experiment, mice were randomly assigned to two groups: control shRNA (sh-NC) and LINC00885 shRNA (sh-LINC00885). Tumor growth was observed and measured with a vernier caliper every week. T umor volume was calculated with the formula: V = (length×width 2 )/2. At 4 weeks after tumor formation, mice were euthanized and subcutaneous tumors.Four-week-old female nude mice (BALB/c) were purchased from the medical experimental Animal Center of Guangdong province (Guangdong, China). Statistical analysis Data were analyzed using GraphPad Prism 6 and R software. Receiver operating characteristic (ROC) curve and the area under the curve (AUC) analysis were used to evaluate the tradeoff between sensitivity and specificity for the different possible cut-off points of a diagnostic test. Kaplan–Meier survival curves with log-rank test were used for survival analysis. The other datasets were evaluated by unpaired Student t-tests. A two-tailed P -value < 0.05 was considered statistically significant. Data availability All data generated or analyzed during this study are included in this published article. Results LINC00885 expression is upregulated in LUAD We analyzed 14 pairs of LUAD tissues and adjacent tissues with RNA-Seq and found that the expression level of LINC00885 in tumors was significantly higher than that in normal tissues (Fig. 1 A). ROC curve analysis was performed and the AUC values were higher than 0.73 (Fig. 1 B), indicating that LINC00885 may potentially be used as a novel diagnostic biomarker for LUAD. We also analyzed TCGA data and examined LINC00885 expression in different stages of LUAD; the results showed significantly higher expression of LINC00885 in stages III and IV (Fig. 1 C). We used R language for single gene analysis and found that LINC00885 expression levels were also significantly higher in TCGA dataset compared with normal tissue (Fig. 1 D). We used Biobank prediction and found that LINC00885 is mostly localized in the cytoplasm (Fig. 1 E). LINC00885 promotes the proliferation and colony formation of LUAD cells To examine the role of LINC00885 in LUAD cell growth and proliferation, we performed loss-of-function assays using siRNAs in A549, H1299, PC9, and H1650 cells. We confirmed that LINC00885 expression levels were significantly reduced 48 h post-transfection of si-LINC00885#1 or si-LINC00885#2 in the cell lines (Fig. 2 A). WST-1 assays showed that the two LINC00885-targeting siRNAs significantly reduced the proliferative capacity of A549, H1299, PC9, and H1650 cells compared with the si-NC (Fig. 2 B),while LINC00885 overexpression significantly promoted A549,PC9 cell growth compared with vector (Fig. 2 G). Knockdown of LINC00885 also significantly decreased the colony formation of LUAD cells (Fig. 2 C–F). Together, these results suggest that LINC00885 positively regulates the proliferation of LUAD cells. LINC00885 knockdown promotes apoptosis, autophagy, and cell cycle progression To examine the role of LINC00885 in apoptosis, we performed flow cytometry experiments. The results showed that cells transfected with LINC00885-targeting siRNA had higher rates of apoptosis compared with control cells (Fig. 3 A–F). Using western blot analysis, we found that expression of the apoptosis marker c-PARP was significantly increased 48 h post-siRNA transfection in A549 and PC9 cells with LINC00855 knockdown (Fig. 3 G). Together, this suggests that LINC00885 inhibits the apoptosis of LUAD cells. We next evaluated the involvement of LINC00885 in autophagy. We found that after knockdown of LINC00885, LC3B, a marker indicating level of autophagy, decreased significantly, while Beclin1 did not change, indicating that autophagy may be regulated by other ways (Fig. 3 H). Additionally, cell cycle analysis demonstrated that knockdown of LINC00885 caused cell cycle arrest at the G0/G1 phase in LUAD cells (Fig. 4 A–F). Together these data suggest that LINC00885 influences proliferation by regulating cell cycle progression. LINC00885 knockdown results in decreased p21 and MET protein expression in LUAD cells p21 protein is involved in cell cycle regulation and promotes carcinogenesis and tumor progression [ 19 – 21 ] ; it regulates cell proliferation in a variety of cell types [ 22 – 24 ] . Knockdown of LINC00885 resulted in reduced p21 protein expression levels in A549, PC9, and H1650 cells (Fig. 4 G). We found high expression levels of p21 were associated with a worse prognosis (lower overall survival) in NSCLC patients (Fig. 4 H). Western blot analysis showed that knockdown of LINC00885 decreased the levels of c-Met and p-MET (Fig. 4 I). Decreasing the expression of MET using siRNAs significantly reduced the proliferation of H1650 cells (Fig. 4 J). These findings suggest that LINC00885 regulates the proliferation of LUAD cells, possibly through regulating MET. LINC00885 regulates LUAD metastasis and cell proliferation through the Akt/mTOR/p70 pathway We next evaluated the role of LINC0085 on LUAD cell migration and invasion activities. Transwell assays showed that knocking down LINC00885 reduced the invasion and migration rates of A549 and PC9 cells (Fig. 5 A–D). LINC00885 knockdown significantly reduced the levels of p-Akt, p-mTOR and p-p70 in A549 and PC9 cells (Fig. 5 E). These results show that LINC00885 may regulate the migration, invasion, and proliferation of LUAD cells through the Akt/mTOR/p70 pathway. To evaluate the effect of LINC00885 on the Akt/mTOR/p70 signaling pathway in LUAD cells, A549 and PC9 cells were incubated with 5 µM MHY1485 for 48 h. MHY1485 is a cell permeable mTOR agonist that also inhibits autophagy [ 25 , 26 ] . The number of migrating cells was significantly higher in cells treated with both the LINC00885-targeting siRNA and MHY1485 compared with the cells treated with LINC00885-targeting siRNA alone (Fig. 6 A-D). Taken together,LINC00885 regulation of apoptosis ,autophagy,proliferation and metastasis may be through these separate signaling mechanisms(Fig. 6 E). LINC00885 promotes the proliferationof NSCLC cells in vivo To explore the effects of LINC00885 on the proliferation abilities of NSCLC cells in vivo, we constructed a subcutaneous nude mouse tumor model using A549 cells stably transfected with sh-LINC00885 and sh-NC. Sh-LINC00885 suppressed tumor growth in the subcutaneous tumor model compared with that in the sh-NC group and lower tumor volumes and weights were detected in the underexpression group(Fig. 7 A-D). Discussion Lung cancer has a complex etiology that has been attributed to factors such as tobacco use, sex, ethnicity, age, obesity, infections, and genetic contributions that work together to elicit the disease phenotype. The complicated nature of lung cancer may result from the molecular mechanisms underlying cancer progression, as well as the lack of early diagnostic biomarkers and therapeutic targets [ 27 ] . Numerous studies have shown that lncRNAs play crucial roles in cancer. LncRNAs regulate the proliferation, migration, invasion, apoptosis, and autophagy of cancer cells [ 7 , 28 ] . Mechanistically, this regulation occurs through lncRNA interactions with various cellular molecules and factors, including chromatin, proteins, mRNAs, and microRNAs [ 28 – 31 ] . Our results revealed the clinical significance of LINC00885 in LUAD and indicated that LINC00885 might be a candidate target for the diagnosis and treatment of LUAD. Previous reports have shown that LINC00885 plays a key role in cervical cancer. For example, LINC00885 upregulates MACC1 expression in cervical cancer cells by sponging miR-432-5p, thereby promoting cancer progression [ 18 ] , indicating that the LINC00885/miR-432-5p/MACC1 axis may serve a potential prognostic biomarker in cervical cancer. Overexpression of LINC00885 reversed the inhibitory effects of FOXP3 knockdown on the proliferation and invasion of cervical cancer cells [ 16 ] . LINC00885 also regulates mTOR, which is involved in cell metabolism, growth, proliferation, and survival [ 32 ] . mTOR enhances protein and lipid synthesis, while reducing autophagy [ 33 , 34 ] . P70S6K is one of the key components of mTOR signal transduction and regulates several proteins involved in protein translation. P70 promotes the initiation of translation and also the initiation of ribosomal RNA and affects protein expression levels. P70S6K is frequently activated in a wide range of cancer types and plays a crucial role in several processes considered hallmarks of cancer. Therefore, blocking P70S6K expression or activity may be a promising strategy for anticancer treatment [ 35 ] . Hepatocyte growth factor (HGF)/c-Met signaling plays an important role in promoting tumor angiogenesis, growth, and metastasis [ 36 – 38 ] . HGF binds to its receptor, c-Met, which activates several signaling pathways, including the mitogen activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK), PI3K/AKT, NF-κB, and STAT3/5 pathways [ 37 ] . Several articles have reported that MET is related to the proliferation, invasion, migration, apoptosis and other functions of tumor cells [ 39 – 41 ] . Our results suggest that LINC00885 may be involved in the progression of LUAD cells by controlling c-Met signaling. Further studies will be required to fully understand the biological mechanisms of LINC00885 in LUAD. PARP is a key modulator of apoptosis [ 42 ] .PARP inhibitors have been approved for the treatment of BRCA mutant ovarian cancer and breast cancer, and their mechanism is to play a role through the synthetic lethality of DNA repair gene mutations. [ 43 ] . Our data suggest that LINC00885 may inhibit apoptosis via PARP. The mechanism needs to be explored in more depth. Overall, our results show that LINC00885 plays a role in the cell proliferation, invasion, migration, apoptosis, and autophagy of LUAD cells. Future studies are required to further explore the mechanisms by which LINC00885 regulates cell. Declarations Funding This work was supported by the National Natural Science Foundation of China, No.81572786;Affiliated Hospital of Guangdong Medical University, No.LCYJ2018B001; Key Clinical Research Program of Affiliated Hospital of Guangdong Medical University, No.LCYJ2021A004. Author Contribution Conceptualization, W.S. and Z.L.; methodology, W.W., D.W., D.B., K.W.; formal analysis, B.D., M.W., and X.W. writing—original draft preparation, Q.M., and R.Z.; writing—review and editing, W.S. and W.W.; All authors have read and agreed to the published version of the manuscript. Acknowledgements We thank J. Iacona, Ph.D., from Liwen Bianji (Edanz) ( www.liwenbianji.cn ) for editing the English text of a draft of this manuscript. Institutional Review Board Statement : All experimental procedures involving animals were approved by Guangdong Medical University and used in compliance with a local ethics committee (Permit Number: AHGDMU-LAC-B-202207-0005). Data Availability Statement: All data generated or analyzed during this study are included in this published article. References Jin D, Guo J, Wu Y, Yang L, Wang X, Du J, et al. m(6)A demethylase ALKBH5 inhibits tumor growth and metastasis by reducing YTHDFs-mediated YAP expression and inhibiting miR-107/LATS2-mediated YAP activity in NSCLC. Mol Cancer. 2020;19(1):40. 10.1186/s12943-020-01161-1 . Epub 2020/02/29. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Cancer J Clin. 2018;68(6):394–424. 21492. PubMed PMID: 30207593. Siegel RL, Miller KD, Jemal A, Cancer statistics. 2020. CA: a cancer journal for clinicians. 2020;70(1):7–30. Epub 2020/01/09. doi: 10.3322/caac.21590. PubMed PMID: 31912902. Ettinger DS, Wood DE, Aggarwal C, Aisner DL, Akerley W, Bauman JR, et al. NCCN Guidelines Insights: Non-Small Cell Lung Cancer, Version 1.2020. J Natl Compr Cancer Network: JNCCN. 2019;17(12):1464–72. 10.6004/jnccn.2019.0059 . Epub 2019/12/06. Yang Z, Wu L, Wang A, Tang W, Zhao Y, Zhao H, et al. dbDEMC 2.0: updated database of differentially expressed miRNAs in human cancers. Nucleic Acids Res. 2017;45(D1). 10.1093/nar/gkw1079 . Epub 2016/12/03. D812-d8. Dangwal S, Schimmel K, Foinquinos A, Xiao K, Thum T. Noncoding RNAs in Heart Failure. Handbook of experimental pharmacology. 2017;243:423 – 45. Epub 2016/12/21. doi: 10.1007/164_2016_99. PubMed PMID: 27995387. Chen S, Liang H, Yang H, Zhou K, Xu L, Liu J et al. LincRNa-p21: function and mechanism in cancer. Medical oncology (Northwood, London, England). 2017;34(5):98. 10.1007/s12032-017-0959-5 . PubMed PMID: 28425074. Trovero MF, Rodríguez-Casuriaga R, Romeo C, Santiñaque FF, François M, Folle GA, et al. Revealing stage-specific expression patterns of long noncoding RNAs along mouse spermatogenesis. RNA Biol. 2020;17(3):350–65. PubMed PMID: 31869276; PubMed Central PMCID: PMCPMC6999611. Daneshvar K, Ardehali MB, Klein IA, Hsieh FK, Kratkiewicz AJ, Mahpour A, et al. lncRNA DIGIT and BRD3 protein form phase-separated condensates to regulate endoderm differentiation. Nat Cell Biol. 2020;22(10):1211–22. 10.1038/s41556-020-0572-2 . Epub 2020/09/09. Fatica A, Bozzoni I. Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet. 2014;15(1):7–21. 10.1038/nrg3606 . Epub 2013/12/04. Groff AF, Sanchez-Gomez DB, Soruco MML, Gerhardinger C, Barutcu AR, Li E, et al. In Vivo Characterization of Linc-p21 Reveals Functional cis-Regulatory DNA Elements. Cell Rep. 2016;16(8):2178–86. 10.1016/j.celrep.2016.07.050 . Epub 2016/08/16. Busch A, Eken SM, Maegdefessel L. Prospective and therapeutic screening value of non-coding RNA as biomarkers in cardiovascular disease. Annals translational Med. 2016;4(12):236. 10.21037/atm.2016.06.06 . Epub 2016/07/19. Lovén J, Orlando DA, Sigova AA, Lin CY, Rahl PB, Burge CB, et al. Revisiting global gene expression analysis. Cell. 2012;151(3):476–82. 10.1016/j.cell.2012.10.012 . Epub 2012/10/30. Iyer MK, Niknafs YS, Malik R, Singhal U, Sahu A, Hosono Y, et al. The landscape of long noncoding RNAs in the human transcriptome. Nat Genet. 2015;47(3):199–208. 10.1038/ng.3192 . Epub 2015/01/20. Balbin OA, Malik R, Dhanasekaran SM, Prensner JR, Cao X, Wu YM, et al. The landscape of antisense gene expression in human cancers. Genome Res. 2015;25(7):1068–79. 10.1101/gr.180596.114 . Epub 2015/06/13. Liu Y, Tu H, Zhang L, Xiong J, Li L. FOXP3induced LINC00885 promotes the proliferation and invasion of cervical cancer cells. Molecular medicine reports. 2021;23(6). Epub 2021/04/22. 10.3892/mmr.2021.12097 . PubMed PMID: 33880574; PubMed Central PMCID: PMCPMC8072316. MC A, P RCAGJL. T, H K, LINC00885 a Novel Oncogenic Long Non-Coding RNA Associated with Early Stage Breast Cancer Progression. 2020;21(19). 10.3390/ijms21197407 . PubMed PMID: 33049922. Chen H, Chi Y, Chen M, Zhao L. Long Intergenic Non-Coding RNA LINC00885 Promotes Tumorigenesis of Cervical Cancer by Upregulating MACC1 Expression Through Serving as a Competitive Endogenous RNA for microRNA-432-5p. Cancer Manage Res. 2021;13:1435–47. 10.2147/cmar.S291778 . Epub 2021/02/20. Su W, Feng S, Chen X, Yang X, Mao R, Guo C, et al. Silencing of Long Noncoding RNA MIR22HG Triggers Cell Survival/Death Signaling via Oncogenes YBX1, MET, and p21 in Lung Cancer. Cancer Res. 2018;78(12):3207–19. 10.1158/0008-5472.CAN-18-0222 . Epub 2018/04/20. Roninson IB. Oncogenic functions of tumour suppressor p21(Waf1/Cip1/Sdi1): association with cell senescence and tumour-promoting activities of stromal fibroblasts. Cancer Lett. 2002;179(1):1–14. 10.1016/s0304-3835(01)00847-3 . Epub 2002/03/07. Chang BD, Watanabe K, Broude EV, Fang J, Poole JC, Kalinichenko TV, et al. Effects of p21Waf1/Cip1/Sdi1 on cellular gene expression: implications for carcinogenesis, senescence, and age-related diseases. Proc Natl Acad Sci USA. 2000;97(8):4291–6. 10.1073/pnas.97.8.4291 . Epub 2000/04/13. Overton KW, Spencer SL, Noderer WL, Meyer T, Wang CL. Basal p21 controls population heterogeneity in cycling and quiescent cell cycle states. Proc Natl Acad Sci USA. 2014;111(41):E4386–93. 10.1073/pnas.1409797111 . PubMed PMID: 25267623; PubMed Central PMCID: PMCPMC4205626. Epub 2014/10/01. Suzuki D, Sahu R, Leu NA, Senoo M. The carboxy-terminus of p63 links cell cycle control and the proliferative potential of epidermal progenitor cells. Development. 2015;142(2):282–90. 10.1242/dev.118307 . Epub 2014/12/17. Cheng T, Rodrigues N, Shen H, Yang Y, Dombkowski D, Sykes M et al. Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science (New York, NY). 2000;287(5459):1804–8. Epub 2000/03/10. 10.1126/science.287.5459.1804 . PubMed PMID: 10710306. Choi YJ, Lee G, Yun SH, Lee W, Yu J, Kim SK, et al. The role of SHMT2 in modulating lipid metabolism in hepatocytes via glycine-mediated mTOR activation. Amino Acids. 2022;54(5):823–34. 10.1007/s00726-022-03141-9 . PubMed PMID: 35212811. Li F, Deng Y, Zhang S, Zhu B, Wang J, Wang J, et al. Human hepatocyte-enriched miRNA-192-3p promotes HBV replication through inhibiting Akt/mTOR signalling by targeting ZNF143 in hepatic cell lines. Emerg microbes infections. 2022;11(1):616–28. PubMed PMID: 35109781; PubMed Central PMCID: PMCPMC8865105. Yoon SO, Shin S, Karreth FA, Buel GR, Jedrychowski MP, Plas DR, et al. Focal Adhesion- and IGF1R-Dependent Survival and Migratory Pathways Mediate Tumor Resistance to mTORC1/2 Inhibition. Mol Cell. 2017;67(3):512–e274. 10.1016/j.molcel.2017.06.033 . PubMed PMID: 28757207. Schmitt AM, Chang HY. Long Noncoding RNAs in Cancer Pathways. Cancer cell. 2016;29(4):452 – 63. 10.1016/j.ccell.2016.03.010 . PubMed PMID: 27070700. Z PLJH. Y, S G, H Z, Q Z, ZNNT1 long noncoding RNA induces autophagy to inhibit tumorigenesis of uveal melanoma by regulating key autophagy gene expression. 2020;16(7):1186–99. 10.1080/15548627.2019.1659614 . PubMed PMID: 31462126. X Z LS, Autophagy XHBZ. MJJ. Long noncoding RNA CA7-4 promotes autophagy and apoptosis via sponging MIR877-3P and MIR5680 in high glucose-induced vascular endothelial cells. 2020;16(1):70–85. doi: 10.1080/15548627.2019.1598750. PubMed PMID: 30957640. H X JWSXJY. Y J, Y Z, The long noncoding RNA H19 promotes tamoxifen resistance in breast cancer via autophagy. 2019;12(1):81. 10.1186/s13045-019-0747-0 . PubMed PMID: 31340867. Showkat M, Beigh MA, Andrabi KI. mTOR Signaling in Protein Translation Regulation: Implications in Cancer Genesis and Therapeutic Interventions. Molecular biology international. 2014;2014:686984. Epub 2014/12/17. 10.1155/2014/686984 . PubMed PMID: 25505994; PubMed Central PMCID: PMCPMC4258317. Laplante M, Sabatini DM. mTOR signaling at a glance. J Cell Sci. 2009;122(Pt 20):3589–94. 10.1242/jcs.051011 . Epub 2009/10/09. Saxton RA, Sabatini DM. mTOR Signaling in Growth, Metabolism, and Disease. Cell. 2017;168(6):960–76. 10.1016/j.cell.2017.02.004 . Epub 2017/03/12. Ip CK, Wong AS. Exploiting p70 S6 kinase as a target for ovarian cancer. Expert Opin Ther Targets. 2012;16(6):619–30. 10.1517/14728222.2012.684680 . Epub 2012/05/09. You WK, McDonald DM. The hepatocyte growth factor/c-Met signaling pathway as a therapeutic target to inhibit angiogenesis. BMB Rep. 2008;41(12):833–9. 10.5483/bmbrep.2008.41.12.833 . Epub 2009/01/07. Zhang H, Feng Q, Chen WD, Wang YD. HGF/c-MET: A Promising Therapeutic Target in the Digestive System Cancers. Int J Mol Sci. 2018;19(11). 10.3390/ijms19113295 . PubMed PMID: 30360560; PubMed Central PMCID: PMCPMC6274736. Epub 2018/10/27. Matsumoto K, Umitsu M, De Silva DM, Roy A, Bottaro DP. Hepatocyte growth factor/MET in cancer progression and biomarker discovery. Cancer Sci. 2017;108(3):296–307. 10.1111/cas.13156 . Epub 2017/01/09. Cai H, Yu Y, Ni X, Li C, Hu Y, Wang J, et al. LncRNA LINC00998 inhibits the malignant glioma phenotype via the CBX3-mediated c-Met/Akt/mTOR axis. Cell Death Dis. 2020;11(12):1032. 10.1038/s41419-020-03247-6 . Epub 2020/12/04. Liu L, Li X, Shi Y, Chen H. The long noncoding RNA FTX promotes a malignant phenotype in bone marrow mesenchymal stem cells via the miR-186/c-Met axis. Biomed Pharmacother. 2020;131:110666. 10.1016/j.biopha.2020.110666 . Epub 2020/08/28. Guo Q, Li L, Bo Q, Chen L, Sun L, Shi H. Long noncoding RNA PITPNA-AS1 promotes cervical cancer progression through regulating the cell cycle and apoptosis by targeting the miR-876-5p/c-MET axis. Biomed Pharmacother. 2020;128:110072. 10.1016/j.biopha.2020.110072 . Epub 2020/05/28. Farmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature. 2005;434(7035):917–21. 10.1038/nature03445 . Epub 2005/04/15. Slade D. PARP and PARG inhibitors in cancer treatment. Genes Dev. 2020;34(5–6):360–94. Epub 2020/02/08. doi: 10.1101/gad.334516.119. PubMed PMID: 32029455; PubMed Central PMCID: PMCPMC7050487. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4946723","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":356093604,"identity":"ad8fb88d-8e05-41dc-94f3-f39640229769","order_by":0,"name":"Wang Wan","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wang","middleName":"","lastName":"Wan","suffix":""},{"id":356093606,"identity":"a67d674e-ab59-4cda-9ac8-2db35d1d5410","order_by":1,"name":"Dong Wu","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Wu","suffix":""},{"id":356093607,"identity":"18705adc-cba4-4c7a-a954-1dea156feea2","order_by":2,"name":"Baizhen Dai","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Baizhen","middleName":"","lastName":"Dai","suffix":""},{"id":356093608,"identity":"d768c7b6-5337-482a-92a2-c8967239619b","order_by":3,"name":"Kangxian Wang","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Kangxian","middleName":"","lastName":"Wang","suffix":""},{"id":356093613,"identity":"b0103f80-17ee-4410-ae6d-223344a010e9","order_by":4,"name":"Biao Deng","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Biao","middleName":"","lastName":"Deng","suffix":""},{"id":356093614,"identity":"366447f3-56db-4313-86d1-5deeabbe224c","order_by":5,"name":"Mingjun Wang","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Mingjun","middleName":"","lastName":"Wang","suffix":""},{"id":356093618,"identity":"27dedccb-5083-446c-84ef-2e2b7eadd692","order_by":6,"name":"Xuefeng Wang","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xuefeng","middleName":"","lastName":"Wang","suffix":""},{"id":356093622,"identity":"160e3fed-1d61-4c54-b0c2-e29895d6d4fb","order_by":7,"name":"Qiyang Mao","email":"","orcid":"","institution":"Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qiyang","middleName":"","lastName":"Mao","suffix":""},{"id":356093623,"identity":"fbdaee83-5942-4961-b4a4-fc198d0c9b96","order_by":8,"name":"Rongjing Zhang","email":"","orcid":"","institution":"Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Rongjing","middleName":"","lastName":"Zhang","suffix":""},{"id":356093625,"identity":"cd7733cb-d255-443e-958a-3c1a6fa8c03e","order_by":9,"name":"Wenmei Su","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYBADHjb29oOPwUxm5gbitPDxnEk2ZmAwAGphJE4Lg5xEgpk0WAsDAS3yM3IMHxfm2MiwMSSkVRdU/Inmbwdq+VGxDacWgxs5xsYzt6XxsDEcPHZ7xhmD3BmHGRsYe87cxq1FInebNO+2wzxsjA1pt3nbDHIbgFqYGdtwa5Gfkbv9N++2/zxszAxmxSAt8wlpYbiRu42Zd9sBHjY2BjNmkJYNhLQYnHn/GeiwZB42Hp5kaZ4zxrkbgVoO4vOLfHta4mfebXb28vOfH/zMUyGXO+/84YMPflTgcRhWcIBE9aNgFIyCUTAK0AAA6atSULxHUaEAAAAASUVORK5CYII=","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":true,"prefix":"","firstName":"Wenmei","middleName":"","lastName":"Su","suffix":""},{"id":356093627,"identity":"3b685a22-85d6-409f-9bdb-acc5abb4296f","order_by":10,"name":"Zhu Liang","email":"","orcid":"","institution":"Affiliated Hospital of Guangdong Medical University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhu","middleName":"","lastName":"Liang","suffix":""}],"badges":[],"createdAt":"2024-08-20 17:14:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4946723/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4946723/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65570081,"identity":"0d570c45-dbac-47bf-91c6-320545a4e2d5","added_by":"auto","created_at":"2024-09-30 06:21:46","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":265823,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Scatter plot showing LINC00885 expression levels in tumors and normal tissues as measured by RNA-Seq analysis. (B)\u003cem\u003e \u003c/em\u003eReceiver operating characteristiccurve analysis indicated an excellent area under the curve (0.73) for classifying the 14 lung adenocarcinomas (LUADs) from 14 normal lung tissues using LINC00885 expression. (C) LINC00885 expression in different stages of LUAD (The Cancer Genome Atlas (TCGA) dataset was analyzed by GEPIA). (D) Scatter plots of LINC00885 expression levels in LUAD and normal tissue samples in TCGA RNA-Seq datasets (LUAD vs. normal, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001). (E) Prediction location of LINC00885 in a constructed benchmark dataset (http://www.csbio.sjtu.edu.cn/bioinf/lncLocator/).\u003c/p\u003e","description":"","filename":"Figure1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4946723/v1/88da556e83d4a982ebe3fa71.jpg"},{"id":65570083,"identity":"83034552-7bef-40a2-9072-5481ce36b4ce","added_by":"auto","created_at":"2024-09-30 06:21:46","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":608723,"visible":true,"origin":"","legend":"\u003cp\u003e(A) LINC00885 siRNA knockdown efficiency in A549, PC9, H1299, and H1650 cells measured by qRT-PCR at 48 h post-transfection. GAPDH mRNA was used for data normalization. (B) Cell proliferation was decreased after LINC00885-targeting siRNA transfection in A549, PC9, H1299 and H1650 cells.***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 by t-tests. (C–F) Colony formation was increased after LINC00885 siRNA transfection in A549 (C, D) and PC9 (E, F) cell lines. The relative quantified values are shown in (D and F). ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 by t-tests. (G)In A549 and PC9 cells, cell proliferation increased after overexpression of LINC00885.***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05 by t-tests.\u003c/p\u003e","description":"","filename":"Figure2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4946723/v1/8eb2ff3f2b67601bb3e7c110.jpg"},{"id":65571059,"identity":"6d98121b-e814-44b2-881f-4ba4c06c98e6","added_by":"auto","created_at":"2024-09-30 06:37:46","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1113119,"visible":true,"origin":"","legend":"\u003cp\u003e(A–F) Apoptosis rates of H1650, A549, and PC9 cells transfected with LINC00885-targeting siRNA or negative control siRNA were examined by flow cytometry. After knockdown of LINC00885, the number of apoptotic cells increased significantly. **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 compared with negative control–transfected cells. (G) Protein expression levels of PARP in PC9 and A549 cells transfected with the indicated siRNAs were detected by western blot analysis. (H) Protein expression levels of Beclin1 and LC3B in PC9 and A549 cells transfected with the indicated siRNAs were detected by western blot analysis. GAPDH protein was used as an endogenous control for western blots.\u003c/p\u003e","description":"","filename":"Figure3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4946723/v1/f1b32ed9eb683f66f486465a.jpg"},{"id":65570082,"identity":"6c81966c-c313-497b-9d7e-d1569c890c2d","added_by":"auto","created_at":"2024-09-30 06:21:46","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":739779,"visible":true,"origin":"","legend":"\u003cp\u003e(A–F) Flow cytometric analysis showing that siRNA-mediated knockdown of LINC00885 arrested LUAD cells at the G0/G1 phase. ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 compared with negative control–transfected cells. (G) Knockdown of LINC00885 with siRNA in LUAD cells resulted in decreased p21 protein expression levels. (H) High expression levels of p21 were associated with a worse prognosis (lower overall survival) in NSCLC patients. (I) Knockdown of LINC00885 with siRNA in LUAD cells led to reduced levels of MET and p-MET. (J) Proliferation of H1650 cells significantly decreased following siRNA-mediated knockdown of MET expression. ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 compared with negative control–transfected cells.\u003c/p\u003e","description":"","filename":"Figure4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4946723/v1/40f8f29ef701a60153dba4f4.jpg"},{"id":65571829,"identity":"ddf33a6a-2016-4d9c-a1e9-2bbad61b09c0","added_by":"auto","created_at":"2024-09-30 06:45:46","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1513768,"visible":true,"origin":"","legend":"\u003cp\u003e(A–D) The invasion and migration rates of A549 and PC9 cells decreased following siRNA-mediated knockdown of LINC00885. (E) Western blot analysis of the protein expression levels of PI3K, AKT, p-AKT, MTOR, p-MTOR, P70, and p-P70 in A549 and PC9 cell lines transfected with the indicated siRNAs. GAPDH was used as an internal control for western blots.\u003c/p\u003e","description":"","filename":"Figure5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4946723/v1/542874f23e96cb256e308926.jpg"},{"id":65570087,"identity":"2bb00af1-4b1e-40f4-a47a-02433fd5dbce","added_by":"auto","created_at":"2024-09-30 06:21:46","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1185528,"visible":true,"origin":"","legend":"\u003cp\u003e(A-D) MHY1485 treatment partially rescued the reduction of invasion and migration in A549 and PC9 cells transfected with si-LINC00885. ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 compared with negative control–transfected cells.(B) Schematic illustration for the proposed mechanism for LINC00885 in regulating the proliferation, apoptosis, autophagy, invasion, and migration of LUAD cells through MET, PARP, LC3, and P70.\u003c/p\u003e","description":"","filename":"Figure6.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4946723/v1/5da24f4947fde280cac4874a.jpg"},{"id":65570810,"identity":"ed57bb8c-a36c-4b16-b76e-d8e558bc75fa","added_by":"auto","created_at":"2024-09-30 06:29:46","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":655173,"visible":true,"origin":"","legend":"\u003cp\u003e(A-B) The representative images of a subcutaneous tumor\u003c/p\u003e\n\u003cp\u003enude mouse model. Hypodermic injection of A549 cells stably transfected with lentivirus expressing the Linc00885 lower expression construct (sh-linc00885) or negative control (sh-NC) was performed in nude mice. (C) Tumor volume was measured every week. (D) Tumor weight of the two groups.\u003c/p\u003e","description":"","filename":"Figure7.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4946723/v1/ad007e20396ef91a449761f8.jpg"},{"id":70099187,"identity":"a2725721-66d3-4d73-a124-c5ef62bd6692","added_by":"auto","created_at":"2024-11-28 10:17:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6482042,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4946723/v1/3681e3f4-6ede-4416-bb06-508977f7ca50.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"LINC00885 promotes the development of lung adenocarcinoma through AKT/MTOR/P70 signaling LINC00885 may regulate migration, proliferation, and invasion through the mTOR pathway in lung adenocarcinoma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNon-small cell lung cancer (NSCLC) is a highly malignant cancer type with a high clinical incidence and mortality rates that are increasing annually worldwide\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Over the past several decades, significant improvements have been made in lung cancer treatment, including the development of targeted treatments. However, the emergence of resistant cancer cells during the course of molecular targeted therapy is a well-known limitation of these drugs\u003csup\u003e[\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. It is therefore urgent to better understand the molecular mechanisms underlying lung cancer development and identify reliable biomarkers for its early detection, diagnosis, and treatment\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eWhile long non-coding RNAs (lncRNAs) were initially considered \u0026ldquo;junk,\u0026rdquo; an increasing number of studies have demonstrated that lncRNAs play critical roles in development, differentiation, stress, and disease pathogenesis\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. lncRNAs regulate gene expression and also regulate the expression levels of other lncRNAs\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Research has demonstrated that lncRNAs exhibit tissue- or cell-specific expression patterns and specific subcellular localization; lncRNAs contain locally highly conserved sequence elements and have special spatial secondary structures\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. lncRNAs participate in multiple biological processes through various mechanisms, including through interactions with proteins, formation of endogenous small interfering RNAs (siRNAs)\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, and the regulation of mRNA shearing, chromatin remodeling, histone remodeling, transcription, and other processes\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Considering the large number of lncRNAs in human cells, the role of these molecules in lung adenocarcinoma (LUAD) needs to be further investigated.\u003c/p\u003e \u003cp\u003eHigh-throughput RNA sequencing (RNA-Seq) has emerged as a powerful method for transcriptomic analysis and is widely used for understanding gene functions and biological patterns, finding candidate drug targets, and identifying biomarkers for disease classification and diagnosis\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e, particularly novel lncRNAs\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. In this study, by analyzing RNA-Seq and The Cancer Genome Atlas (TCGA) datasets, we identified a lncRNA called LINC00885 that is associated with LUAD. Studies have shown that LINC00885 exhibits a significant effect on breast and cervical cancer cells, and its high expression is associated with poor patient prognosis\u003csup\u003e[\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. However, the effect of LINC00885 in lung cancer cells has not been studied.\u003c/p\u003e \u003cp\u003eIn the present study, we examined the roles of LINC00885 in LUAD. We found that knocking down LINC00885 levels decreased the expression of MET and p21. Moreover, silencing LINC00885 in cultured LUAD cells decreased cell proliferation, invasion, migration, and autophagy rates. Therefore, LINC00885 may be a potential therapeutic target for the treatment of LUAD.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eCell culture\u003c/p\u003e \u003cp\u003eHuman cell lines A549, PC9, H1299, H1975, and H1650 were obtained from the American Type Culture Collection (ATCC, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.atcc.org/\u003c/span\u003e\u003cspan address=\"https://www.atcc.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Cells were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Gaithersburg, MD, USA) and maintained in a 37\u0026deg;C incubator with a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003esiRNAs and cell transfection\u003c/p\u003e \u003cp\u003eCells were plated at specific densities and transfected with 10 nM siRNA oligonucleotides or non-targeting controls 24 to 48 h after plating. Transfection was performed with Lipofectamine\u0026reg; RNAiMax Reagent (Thermo Waltham, USA) in OptiMEM medium following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003eKnockdown efficiency was determined by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) with the following primers: Si-LINC00885-1: sense CCUCCCAAUUAUCUCCUCUTT, antisense AGAGGAGAUAAUUGGGAGGTT; and si-LINC00885-2: CCGGCUGGUUCAAGAUCAATT, antisense UUGAUCUUGAACCAGCCGGTT.\u003c/p\u003e \u003cp\u003eCell proliferation and colony formation assays\u003c/p\u003e \u003cp\u003eCells were seeded in 96-well plates at 1000 cells per well and transfected with 10 nM siRNA or non-targeting (negative) control siRNA and LINC00885 overexpression or vector 12 to 24 h after seeding. At 72 to 96 h post-transfection, the proliferation rates were measured using cell proliferation reagent (WST-1, Beyotime, Shanghai, China) following the manufacturer\u0026rsquo;s instructions. The cell viability was calculated as a percentage of the viability of the negative control siRNA\u0026ndash;transfected cells.\u003c/p\u003e \u003cp\u003eFor colony formation assays, cells transfected with LINC00885-targeting siRNAs or control siRNAs were seeded in a 6-well plate at a density of 250 cells/well. After 12 to 14 days of culture at 37\u0026deg;C, 0.1% crystal violet (Solarbio, Beijing, China) and 20% methanol were used as dye solution to fix and stain the colonies. The cells were imaged and counted.\u003c/p\u003e \u003cp\u003eWestern blot assay\u003c/p\u003e \u003cp\u003eRIPA lysis buffer (Beyotime, Shanghai, China) supplemented with protease inhibitors (Beyotime) was used to prepare whole cell lysates. Protein concentration was evaluated using a BCA Protein Assay Kit (Beyotime). Proteins were separated using SDS-PAGE and then transferred to polyvinylidene difluoride membranes. After blocking membranes with skim milk, the membranes were incubated with primary antibodies overnight at 4\u0026deg;C. The membranes were then incubated with secondary antibody for 1 h at 37\u0026deg;C. Protein signals were detected by P-ECL star (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eEpiZyme\u003c/span\u003e, Shanghai, China). GAPDH was used as an endogenous control.\u003c/p\u003e \u003cp\u003eRNA extraction and qRT-PCR\u003c/p\u003e \u003cp\u003eTotal RNA was extracted from cultured cells using Trizol reagent (Solarbio) following the manufacturer\u0026rsquo;s instructions. Reverse transcription to cDNA was performed using a reverse transcription kit (Takara, Tokyo, Japan). qRT-PCR reactions were run in an Applied Biosystems 7500 Real-Time PC System (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex Taq II (Takara, Dalian, China). GAPDH mRNA was used as an internal control, and data were analyzed using the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt method. Each experiment was performed in triplicate. The PCR primer sequences are as follows: LINC00885F: CCAGCAGGGCCTAGTAACAC and LINC00885R: CCTTGCTCTTGGTGAGTGGT.\u003c/p\u003e \u003cp\u003eCell migration and invasion assays\u003c/p\u003e \u003cp\u003eQuantitative analysis of the migration and invasion capabilities of LUAD cells was performed using the Transwell chamber system. A total of 60 \u0026micro;L of diluted extracellular matrix gel solution was added to the upper chambers (Costar Inc., USA) and the chambers were incubated for 4 h at 37\u0026deg;C. For the migration assay, ECM solution was not added in the upper chamber. Cells were seeded at a density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells in 100 \u0026micro;L RPMI-1640 medium with 1% FBS; the wells were then filled with 500 \u0026micro;L RPMI-1640 medium containing 20% FBS. The Transwell chambers were then incubated for 24 to 36 h at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e to allow cell migration or invasion. When the incubation period ended, the remaining cells in the upper chamber were removed with a cotton swab. Cells that reached the bottom of the membrane were fixed with paraformaldehyde. The fixed cells were stained with crystal violet at room temperature for 30 min. The crystal violet bound to the cells was washed off with 200 \u0026micro;L of PBS. Cells were observed under a microscope at 4X and 10X and photographed.\u003c/p\u003e \u003cp\u003eFlow cytometric analysis of apoptosis and cell cycle distribution\u003c/p\u003e \u003cp\u003eFor apoptosis analysis, cells were resuspended in moderate binding buffer containing Annexin V\u0026ndash;fluorescein isothiocyanate (FITC) with propidium iodide (PI) (BD, NJ, USA). After incubation for 15 min, the cells were analyzed using a BD FACSAria3.\u003c/p\u003e \u003cp\u003eFor cell cycle analysis, cells were fixed at 4\u0026deg;C overnight in 75% ethanol and then stained with RNase A and PI for 30 min at 37\u0026deg;C (Keygen, Nanjing, China). Samples were analyzed by a flow cytometer (BD Biosciences, San Jose, CA, USA) in the Guangdong Medical University flow cytometry core.\u003c/p\u003e \u003cp\u003eAnimal models\u003c/p\u003e \u003cp\u003eFor the subcutaneous tumor model, the armpits of mice were subcutaneously injected with transfected A549 cells (5\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/mice, n\u0026thinsp;=\u0026thinsp;6/group for knockdown groups). In the experiment, mice were randomly assigned to two groups: control shRNA (sh-NC) and LINC00885 shRNA (sh-LINC00885). Tumor growth was observed and measured with a vernier caliper every week. T umor volume was calculated with the formula: V = (length\u0026times;width\u003csup\u003e2\u003c/sup\u003e)/2. At 4 weeks after tumor formation, mice were euthanized and subcutaneous tumors.Four-week-old female nude mice (BALB/c) were purchased from the medical experimental Animal Center of Guangdong province (Guangdong, China).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData were analyzed using GraphPad Prism 6 and R software. Receiver operating characteristic (ROC) curve and the area under the curve (AUC) analysis were used to evaluate the tradeoff between sensitivity and specificity for the different possible cut-off points of a diagnostic test. Kaplan\u0026ndash;Meier survival curves with log-rank test were used for survival analysis. The other datasets were evaluated by unpaired Student t-tests. A two-tailed \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eLINC00885 expression is upregulated in LUAD\u003c/p\u003e \u003cp\u003eWe analyzed 14 pairs of LUAD tissues and adjacent tissues with RNA-Seq and found that the expression level of LINC00885 in tumors was significantly higher than that in normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). ROC curve analysis was performed and the AUC values were higher than 0.73 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), indicating that LINC00885 may potentially be used as a novel diagnostic biomarker for LUAD. We also analyzed TCGA data and examined LINC00885 expression in different stages of LUAD; the results showed significantly higher expression of LINC00885 in stages III and IV (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). We used R language for single gene analysis and found that LINC00885 expression levels were also significantly higher in TCGA dataset compared with normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). We used Biobank prediction and found that LINC00885 is mostly localized in the cytoplasm (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eLINC00885 promotes the proliferation and colony formation of LUAD cells\u003c/p\u003e \u003cp\u003eTo examine the role of LINC00885 in LUAD cell growth and proliferation, we performed loss-of-function assays using siRNAs in A549, H1299, PC9, and H1650 cells. We confirmed that LINC00885 expression levels were significantly reduced 48 h post-transfection of si-LINC00885#1 or si-LINC00885#2 in the cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). WST-1 assays showed that the two LINC00885-targeting siRNAs significantly reduced the proliferative capacity of A549, H1299, PC9, and H1650 cells compared with the si-NC (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB),while LINC00885 overexpression significantly promoted A549,PC9 cell growth compared with vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Knockdown of LINC00885 also significantly decreased the colony formation of LUAD cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u0026ndash;F). Together, these results suggest that LINC00885 positively regulates the proliferation of LUAD cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eLINC00885 knockdown promotes apoptosis, autophagy, and cell cycle progression\u003c/p\u003e \u003cp\u003eTo examine the role of LINC00885 in apoptosis, we performed flow cytometry experiments. The results showed that cells transfected with LINC00885-targeting siRNA had higher rates of apoptosis compared with control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u0026ndash;F). Using western blot analysis, we found that expression of the apoptosis marker c-PARP was significantly increased 48 h post-siRNA transfection in A549 and PC9 cells with LINC00855 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Together, this suggests that LINC00885 inhibits the apoptosis of LUAD cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next evaluated the involvement of LINC00885 in autophagy. We found that after knockdown of LINC00885, LC3B, a marker indicating level of autophagy, decreased significantly, while Beclin1 did not change, indicating that autophagy may be regulated by other ways (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eAdditionally, \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ecell cycle analysis\u003c/span\u003e demonstrated that knockdown of LINC00885 caused \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ecell cycle\u003c/span\u003e arrest at the G0/G1 phase in LUAD cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026ndash;F). Together these data suggest that LINC00885 influences proliferation by regulating cell cycle progression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eLINC00885 knockdown results in decreased p21 and MET protein expression in LUAD cells\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ep21\u003c/span\u003e protein is involved in cell cycle regulation and promotes carcinogenesis and tumor progression\u003csup\u003e[\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e; it regulates cell proliferation in a variety of cell types\u003csup\u003e[\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Knockdown of LINC00885 resulted in reduced p21 protein expression levels in A549, PC9, and H1650 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). We found high expression levels of p21 were associated with a worse prognosis (lower overall survival) in NSCLC patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eWestern blot analysis showed that knockdown of LINC00885 decreased the levels of c-Met and p-MET (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). Decreasing the expression of MET using siRNAs significantly reduced the proliferation of H1650 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). These findings suggest that LINC00885 regulates the proliferation of LUAD cells, possibly through regulating MET.\u003c/p\u003e \u003cp\u003eLINC00885 regulates LUAD metastasis and cell proliferation through the Akt/mTOR/p70 pathway\u003c/p\u003e \u003cp\u003eWe next evaluated the role of LINC0085 on LUAD cell migration and invasion activities. Transwell assays showed that knocking down LINC00885 reduced the invasion and migration rates of A549 and PC9 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u0026ndash;D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eLINC00885 knockdown significantly reduced the levels of p-Akt, p-mTOR and p-p70 in A549 and PC9 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). These results show that LINC00885 may regulate the migration, invasion, and proliferation of LUAD cells through the Akt/mTOR/p70 pathway.\u003c/p\u003e \u003cp\u003eTo evaluate the effect of LINC00885 on the Akt/mTOR/p70 signaling pathway in LUAD cells, A549 and PC9 cells were incubated with 5 \u0026micro;M MHY1485 for 48 h. MHY1485 is a cell permeable mTOR agonist that also inhibits autophagy\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. The number of migrating cells was significantly higher in cells treated with both the LINC00885-targeting siRNA and MHY1485 compared with the cells treated with LINC00885-targeting siRNA alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-D). Taken together,LINC00885 regulation of apoptosis ,autophagy,proliferation and metastasis may be through these separate signaling mechanisms(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eLINC00885 promotes the proliferationof NSCLC cells in vivo\u003c/p\u003e \u003cp\u003eTo explore the effects of LINC00885 on the proliferation abilities of NSCLC cells in vivo, we constructed a subcutaneous nude mouse tumor model using A549 cells stably transfected with sh-LINC00885 and sh-NC. Sh-LINC00885 suppressed tumor growth in the subcutaneous tumor model compared with that in the sh-NC group and lower tumor volumes and weights were detected in the underexpression group(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eLung cancer has a complex etiology that has been attributed to factors such as tobacco use, sex, ethnicity, age, obesity, infections, and genetic contributions that work together to elicit the disease phenotype. The complicated nature of lung cancer may result from the molecular mechanisms underlying cancer progression, as well as the lack of early diagnostic biomarkers and therapeutic targets\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Numerous studies have shown that lncRNAs play crucial roles in cancer. LncRNAs regulate the proliferation, migration, invasion, apoptosis, and autophagy of cancer cells\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Mechanistically, this regulation occurs through lncRNA interactions with various cellular molecules and factors, including chromatin, proteins, mRNAs, and microRNAs\u003csup\u003e[\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Our results revealed the clinical significance of LINC00885 in LUAD and indicated that LINC00885 might be a candidate target for the diagnosis and treatment of LUAD.\u003c/p\u003e \u003cp\u003ePrevious reports have shown that LINC00885 plays a key role in cervical cancer. For example, LINC00885 upregulates MACC1 expression in cervical cancer cells by sponging miR-432-5p, thereby promoting cancer progression\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e, indicating that the LINC00885/miR-432-5p/MACC1 axis may serve a potential prognostic biomarker in cervical cancer. Overexpression of LINC00885 reversed the inhibitory effects of FOXP3 knockdown on the proliferation and invasion of cervical cancer cells\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eLINC00885 also regulates mTOR, which is involved in cell metabolism, growth, proliferation, and survival\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. mTOR enhances protein and lipid synthesis, while reducing autophagy\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. P70S6K is one of the key components of mTOR signal transduction and regulates several proteins involved in protein translation. P70 promotes the initiation of translation and also the initiation of ribosomal RNA and affects protein expression levels. P70S6K is frequently activated in a wide range of cancer types and plays a crucial role in several processes considered hallmarks of cancer. Therefore, blocking P70S6K expression or activity may be a promising strategy for anticancer treatment\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eHepatocyte growth factor (HGF)/c-Met signaling plays an important role in promoting tumor angiogenesis, growth, and metastasis\u003csup\u003e[\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. HGF binds to its receptor, c-Met, which activates several signaling pathways, including the mitogen activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK), PI3K/AKT, NF-κB, and STAT3/5 pathways\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. Several articles have reported that MET is related to the proliferation, invasion, migration, apoptosis and other functions of tumor cells\u003csup\u003e[\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. Our results suggest that LINC00885 may be involved in the progression of LUAD cells by controlling c-Met signaling. Further studies will be required to fully understand the biological mechanisms of LINC00885 in LUAD.\u003c/p\u003e \u003cp\u003ePARP is a key modulator of apoptosis\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e.PARP inhibitors have been approved for the treatment of BRCA mutant ovarian cancer and breast cancer, and their mechanism is to play a role through the synthetic lethality of DNA repair gene mutations.\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e. Our data suggest that LINC00885 may inhibit apoptosis via PARP. The mechanism needs to be explored in more depth.\u003c/p\u003e \u003cp\u003eOverall, our results show that LINC00885 plays a role in the cell proliferation, invasion, migration, apoptosis, and autophagy of LUAD cells. Future studies are required to further explore the mechanisms by which LINC00885 regulates cell.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the National Natural Science Foundation of China, No.81572786;Affiliated Hospital of Guangdong Medical University, No.LCYJ2018B001; Key Clinical Research Program of Affiliated Hospital of Guangdong Medical University, No.LCYJ2021A004.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization, W.S. and Z.L.; methodology, W.W., D.W., D.B., K.W.; formal analysis, B.D., M.W., and X.W. writing\u0026mdash;original draft preparation, Q.M., and R.Z.; writing\u0026mdash;review and editing, W.S. and W.W.; All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe thank J. Iacona, Ph.D., from Liwen Bianji (Edanz) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.liwenbianji.cn\u003c/span\u003e\u003cspan address=\"http://www.liwenbianji.cn\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for editing the English text of a draft of this manuscript.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eInstitutional Review Board Statement\u003c/strong\u003e: All experimental procedures involving animals were approved by Guangdong Medical University and used in compliance with a local ethics committee (Permit Number: AHGDMU-LAC-B-202207-0005).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u003c/strong\u003e All data generated or analyzed during this study are included in this published article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eJin D, Guo J, Wu Y, Yang L, Wang X, Du J, et al. m(6)A demethylase ALKBH5 inhibits tumor growth and metastasis by reducing YTHDFs-mediated YAP expression and inhibiting miR-107/LATS2-mediated YAP activity in NSCLC. Mol Cancer. 2020;19(1):40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12943-020-01161-1\u003c/span\u003e\u003cspan address=\"10.1186/s12943-020-01161-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020/02/29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Cancer J Clin. 2018;68(6):394\u0026ndash;424. 21492. PubMed PMID: 30207593.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiegel RL, Miller KD, Jemal A, Cancer statistics. 2020. CA: a cancer journal for clinicians. 2020;70(1):7\u0026ndash;30. Epub 2020/01/09. doi: 10.3322/caac.21590. PubMed PMID: 31912902.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEttinger DS, Wood DE, Aggarwal C, Aisner DL, Akerley W, Bauman JR, et al. NCCN Guidelines Insights: Non-Small Cell Lung Cancer, Version 1.2020. J Natl Compr Cancer Network: JNCCN. 2019;17(12):1464\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.6004/jnccn.2019.0059\u003c/span\u003e\u003cspan address=\"10.6004/jnccn.2019.0059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2019/12/06.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Z, Wu L, Wang A, Tang W, Zhao Y, Zhao H, et al. dbDEMC 2.0: updated database of differentially expressed miRNAs in human cancers. Nucleic Acids Res. 2017;45(D1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkw1079\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkw1079\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2016/12/03. D812-d8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDangwal S, Schimmel K, Foinquinos A, Xiao K, Thum T. Noncoding RNAs in Heart Failure. Handbook of experimental pharmacology. 2017;243:423\u0026thinsp;\u0026ndash;\u0026thinsp;45. Epub 2016/12/21. doi: 10.1007/164_2016_99. PubMed PMID: 27995387.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Liang H, Yang H, Zhou K, Xu L, Liu J et al. LincRNa-p21: function and mechanism in cancer. Medical oncology (Northwood, London, England). 2017;34(5):98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12032-017-0959-5\u003c/span\u003e\u003cspan address=\"10.1007/s12032-017-0959-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 28425074.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrovero MF, Rodr\u0026iacute;guez-Casuriaga R, Romeo C, Santi\u0026ntilde;aque FF, Fran\u0026ccedil;ois M, Folle GA, et al. Revealing stage-specific expression patterns of long noncoding RNAs along mouse spermatogenesis. RNA Biol. 2020;17(3):350\u0026ndash;65. PubMed PMID: 31869276; PubMed Central PMCID: PMCPMC6999611.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaneshvar K, Ardehali MB, Klein IA, Hsieh FK, Kratkiewicz AJ, Mahpour A, et al. lncRNA DIGIT and BRD3 protein form phase-separated condensates to regulate endoderm differentiation. Nat Cell Biol. 2020;22(10):1211\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41556-020-0572-2\u003c/span\u003e\u003cspan address=\"10.1038/s41556-020-0572-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020/09/09.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFatica A, Bozzoni I. Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet. 2014;15(1):7\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrg3606\u003c/span\u003e\u003cspan address=\"10.1038/nrg3606\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2013/12/04.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGroff AF, Sanchez-Gomez DB, Soruco MML, Gerhardinger C, Barutcu AR, Li E, et al. In Vivo Characterization of Linc-p21 Reveals Functional cis-Regulatory DNA Elements. Cell Rep. 2016;16(8):2178\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2016.07.050\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2016.07.050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2016/08/16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBusch A, Eken SM, Maegdefessel L. Prospective and therapeutic screening value of non-coding RNA as biomarkers in cardiovascular disease. Annals translational Med. 2016;4(12):236. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.21037/atm.2016.06.06\u003c/span\u003e\u003cspan address=\"10.21037/atm.2016.06.06\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2016/07/19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLov\u0026eacute;n J, Orlando DA, Sigova AA, Lin CY, Rahl PB, Burge CB, et al. Revisiting global gene expression analysis. Cell. 2012;151(3):476\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2012.10.012\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2012.10.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2012/10/30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIyer MK, Niknafs YS, Malik R, Singhal U, Sahu A, Hosono Y, et al. The landscape of long noncoding RNAs in the human transcriptome. Nat Genet. 2015;47(3):199\u0026ndash;208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ng.3192\u003c/span\u003e\u003cspan address=\"10.1038/ng.3192\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2015/01/20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalbin OA, Malik R, Dhanasekaran SM, Prensner JR, Cao X, Wu YM, et al. The landscape of antisense gene expression in human cancers. Genome Res. 2015;25(7):1068\u0026ndash;79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/gr.180596.114\u003c/span\u003e\u003cspan address=\"10.1101/gr.180596.114\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2015/06/13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Tu H, Zhang L, Xiong J, Li L. FOXP3induced LINC00885 promotes the proliferation and invasion of cervical cancer cells. Molecular medicine reports. 2021;23(6). Epub 2021/04/22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/mmr.2021.12097\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2021.12097\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 33880574; PubMed Central PMCID: PMCPMC8072316.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMC A, P RCAGJL. T, H K, LINC00885 a Novel Oncogenic Long Non-Coding RNA Associated with Early Stage Breast Cancer Progression. 2020;21(19). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21197407\u003c/span\u003e\u003cspan address=\"10.3390/ijms21197407\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 33049922.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen H, Chi Y, Chen M, Zhao L. Long Intergenic Non-Coding RNA LINC00885 Promotes Tumorigenesis of Cervical Cancer by Upregulating MACC1 Expression Through Serving as a Competitive Endogenous RNA for microRNA-432-5p. Cancer Manage Res. 2021;13:1435\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/cmar.S291778\u003c/span\u003e\u003cspan address=\"10.2147/cmar.S291778\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2021/02/20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu W, Feng S, Chen X, Yang X, Mao R, Guo C, et al. Silencing of Long Noncoding RNA MIR22HG Triggers Cell Survival/Death Signaling via Oncogenes YBX1, MET, and p21 in Lung Cancer. Cancer Res. 2018;78(12):3207\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.CAN-18-0222\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-18-0222\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2018/04/20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoninson IB. Oncogenic functions of tumour suppressor p21(Waf1/Cip1/Sdi1): association with cell senescence and tumour-promoting activities of stromal fibroblasts. Cancer Lett. 2002;179(1):1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0304-3835(01)00847-3\u003c/span\u003e\u003cspan address=\"10.1016/s0304-3835(01)00847-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2002/03/07.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang BD, Watanabe K, Broude EV, Fang J, Poole JC, Kalinichenko TV, et al. Effects of p21Waf1/Cip1/Sdi1 on cellular gene expression: implications for carcinogenesis, senescence, and age-related diseases. Proc Natl Acad Sci USA. 2000;97(8):4291\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.97.8.4291\u003c/span\u003e\u003cspan address=\"10.1073/pnas.97.8.4291\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2000/04/13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOverton KW, Spencer SL, Noderer WL, Meyer T, Wang CL. Basal p21 controls population heterogeneity in cycling and quiescent cell cycle states. Proc Natl Acad Sci USA. 2014;111(41):E4386\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1409797111\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1409797111\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 25267623; PubMed Central PMCID: PMCPMC4205626. Epub 2014/10/01.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki D, Sahu R, Leu NA, Senoo M. The carboxy-terminus of p63 links cell cycle control and the proliferative potential of epidermal progenitor cells. Development. 2015;142(2):282\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/dev.118307\u003c/span\u003e\u003cspan address=\"10.1242/dev.118307\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2014/12/17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng T, Rodrigues N, Shen H, Yang Y, Dombkowski D, Sykes M et al. Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science (New York, NY). 2000;287(5459):1804\u0026ndash;8. Epub 2000/03/10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.287.5459.1804\u003c/span\u003e\u003cspan address=\"10.1126/science.287.5459.1804\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 10710306.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi YJ, Lee G, Yun SH, Lee W, Yu J, Kim SK, et al. The role of SHMT2 in modulating lipid metabolism in hepatocytes via glycine-mediated mTOR activation. Amino Acids. 2022;54(5):823\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00726-022-03141-9\u003c/span\u003e\u003cspan address=\"10.1007/s00726-022-03141-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 35212811.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi F, Deng Y, Zhang S, Zhu B, Wang J, Wang J, et al. Human hepatocyte-enriched miRNA-192-3p promotes HBV replication through inhibiting Akt/mTOR signalling by targeting ZNF143 in hepatic cell lines. Emerg microbes infections. 2022;11(1):616\u0026ndash;28. PubMed PMID: 35109781; PubMed Central PMCID: PMCPMC8865105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoon SO, Shin S, Karreth FA, Buel GR, Jedrychowski MP, Plas DR, et al. Focal Adhesion- and IGF1R-Dependent Survival and Migratory Pathways Mediate Tumor Resistance to mTORC1/2 Inhibition. Mol Cell. 2017;67(3):512\u0026ndash;e274. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molcel.2017.06.033\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2017.06.033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 28757207.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmitt AM, Chang HY. Long Noncoding RNAs in Cancer Pathways. Cancer cell. 2016;29(4):452\u0026thinsp;\u0026ndash;\u0026thinsp;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ccell.2016.03.010\u003c/span\u003e\u003cspan address=\"10.1016/j.ccell.2016.03.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 27070700.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZ PLJH. Y, S G, H Z, Q Z, ZNNT1 long noncoding RNA induces autophagy to inhibit tumorigenesis of uveal melanoma by regulating key autophagy gene expression. 2020;16(7):1186\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2019.1659614\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2019.1659614\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 31462126.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eX Z LS, Autophagy XHBZ. MJJ. Long noncoding RNA CA7-4 promotes autophagy and apoptosis via sponging MIR877-3P and MIR5680 in high glucose-induced vascular endothelial cells. 2020;16(1):70\u0026ndash;85. doi: 10.1080/15548627.2019.1598750. PubMed PMID: 30957640.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH X JWSXJY. Y J, Y Z, The long noncoding RNA H19 promotes tamoxifen resistance in breast cancer via autophagy. 2019;12(1):81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13045-019-0747-0\u003c/span\u003e\u003cspan address=\"10.1186/s13045-019-0747-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 31340867.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShowkat M, Beigh MA, Andrabi KI. mTOR Signaling in Protein Translation Regulation: Implications in Cancer Genesis and Therapeutic Interventions. Molecular biology international. 2014;2014:686984. Epub 2014/12/17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2014/686984\u003c/span\u003e\u003cspan address=\"10.1155/2014/686984\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 25505994; PubMed Central PMCID: PMCPMC4258317.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaplante M, Sabatini DM. mTOR signaling at a glance. J Cell Sci. 2009;122(Pt 20):3589\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/jcs.051011\u003c/span\u003e\u003cspan address=\"10.1242/jcs.051011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2009/10/09.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaxton RA, Sabatini DM. mTOR Signaling in Growth, Metabolism, and Disease. Cell. 2017;168(6):960\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2017.02.004\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2017.02.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2017/03/12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIp CK, Wong AS. Exploiting p70 S6 kinase as a target for ovarian cancer. Expert Opin Ther Targets. 2012;16(6):619\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1517/14728222.2012.684680\u003c/span\u003e\u003cspan address=\"10.1517/14728222.2012.684680\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2012/05/09.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYou WK, McDonald DM. The hepatocyte growth factor/c-Met signaling pathway as a therapeutic target to inhibit angiogenesis. BMB Rep. 2008;41(12):833\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5483/bmbrep.2008.41.12.833\u003c/span\u003e\u003cspan address=\"10.5483/bmbrep.2008.41.12.833\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2009/01/07.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Feng Q, Chen WD, Wang YD. HGF/c-MET: A Promising Therapeutic Target in the Digestive System Cancers. Int J Mol Sci. 2018;19(11). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms19113295\u003c/span\u003e\u003cspan address=\"10.3390/ijms19113295\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 30360560; PubMed Central PMCID: PMCPMC6274736. Epub 2018/10/27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsumoto K, Umitsu M, De Silva DM, Roy A, Bottaro DP. Hepatocyte growth factor/MET in cancer progression and biomarker discovery. Cancer Sci. 2017;108(3):296\u0026ndash;307. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cas.13156\u003c/span\u003e\u003cspan address=\"10.1111/cas.13156\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2017/01/09.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai H, Yu Y, Ni X, Li C, Hu Y, Wang J, et al. LncRNA LINC00998 inhibits the malignant glioma phenotype via the CBX3-mediated c-Met/Akt/mTOR axis. Cell Death Dis. 2020;11(12):1032. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-020-03247-6\u003c/span\u003e\u003cspan address=\"10.1038/s41419-020-03247-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020/12/04.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Li X, Shi Y, Chen H. The long noncoding RNA FTX promotes a malignant phenotype in bone marrow mesenchymal stem cells via the miR-186/c-Met axis. Biomed Pharmacother. 2020;131:110666. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2020.110666\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2020.110666\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020/08/28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Q, Li L, Bo Q, Chen L, Sun L, Shi H. Long noncoding RNA PITPNA-AS1 promotes cervical cancer progression through regulating the cell cycle and apoptosis by targeting the miR-876-5p/c-MET axis. Biomed Pharmacother. 2020;128:110072. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2020.110072\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2020.110072\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020/05/28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature. 2005;434(7035):917\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature03445\u003c/span\u003e\u003cspan address=\"10.1038/nature03445\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2005/04/15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSlade D. PARP and PARG inhibitors in cancer treatment. Genes Dev. 2020;34(5\u0026ndash;6):360\u0026ndash;94. Epub 2020/02/08. doi: 10.1101/gad.334516.119. PubMed PMID: 32029455; PubMed Central PMCID: PMCPMC7050487.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"lung adenocarcinoma, LINCRNA, P70, mTOR, MET","lastPublishedDoi":"10.21203/rs.3.rs-4946723/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4946723/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePrevious studies have demonstrated a role for long non-coding RNAs in lung adenocarcinoma (LUAD). Here, we found high expression levels of LINC00885 in LUAD, especially in middle and advanced stage disease, by RNA-sequencing analysis. This suggests that LINC00885 may be a potential prognostic biomarker of LUAD. Our functional experiments showed that knocking down LINC00885 expression with small interfering RNAs inhibited the growth, migration, invasion, and autophagy of LUAD cells, blocked cell cycle progression, and promoted cell apoptosis. Additionally, LINC00885 knockdown reduced the protein expression levels of p21, MET, p-mTOR, and p-p70, suggesting that LINC00885 may regulate the growth and metastasis of LUAD through these signaling pathways. Additional experiments revealed that an mTOR activator rescued the inhibited cell growth, invasion, and migration following LINC00885 knockdown. Together, these findings demonstrate that LINC00885 may promote LUAD by regulating p21, MET, and mTOR/p70 signal transduction. This study suggests that LINC00885 may be a prognostic biomarker and therapeutic target in LUAD.\u003c/p\u003e","manuscriptTitle":"LINC00885 promotes the development of lung adenocarcinoma through AKT/MTOR/P70 signaling LINC00885 may regulate migration, proliferation, and invasion through the mTOR pathway in lung adenocarcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-30 06:21:41","doi":"10.21203/rs.3.rs-4946723/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"81aca280-3264-43c8-9da1-15d2d4962b94","owner":[],"postedDate":"September 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-28T10:08:50+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-30 06:21:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4946723","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4946723","identity":"rs-4946723","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}