Proinflammatory effect of telopeptides derived from collagen type II on articular cartilage of patients receiving total arthroplasty

Proinflammatory effect of telopeptides derived from collagen type II on articular cartilage of patients receiving total arthroplasty | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Proinflammatory effect of telopeptides derived from collagen type II on articular cartilage of patients receiving total arthroplasty Jiamin Mao, Quanming Wang, Yubo Lu, Bowen Chen, Ruiyang Xu, Lei Ding This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5086390/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective and design: To determine whether telopeptides of collagen type II could induce osteoarthritic cartilage damage via receptor for the native protein by using human articular cartilage. Material or subjects: Cartilage slices were harvested from patients receiving total arthroplasty. Treatment: Cartilage tissue cultures or primary chondrocyte cultures were treated with 30 µM N- or C-telopeptide (NT or CT) for 7 days or for 24 hrs. Methods: Loss of proteoglycan (PG) from cartilage were evaluated with DMMB assay. Conditioned media or cell lysates were measured for levels of MMPs-3&13 or integrin beta1 (ITGB1) with Western blotting or real-time PCR. Results: Both NT and CT could induce significant loss of PG from cartilage than controls (12.96 ± 5.38 µg PG/mg wet cartilage in CT group vs. 22.33 ± 7.75 µg PG/mg wet cartilage in scrambled CT group; P = 0.047). Up-regulation of MMPs-3 &13 was induced by either NT or CT at 24 hr (chondrocyte cultures) or Days 4 and 7 post-treatment (cartilage cultures). CT induced stronger expression of ITGB1 in chondrocytes than did NT. Conclusions: Telopeptides of collagen type II could damage human articular cartilage and up-regulate MMPs-3 and -13. The proinflammatory effect of CT might be mediated by ITGB1. Telopeptides Collagen Cartilage MMPs Chondrocytes Total arthroplasty Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Type II collagen restrictively exists in articular cartilage of the human body. It is a major extracellular matrix (ECM) component and accounts for 90-95% of all types of collagen in articular cartilage. Different from type I collagen that is formed by two alpha1 and one alpha2 peptide chains and is abundant in the body, such as bone and skin, type II collagen is consisted of three identical alpha1 peptide chains and is only found in cartilage inside weight-bearing joints, such as hips and knees [1]. The network weaved by type II collagen fibers is the structural basis of articular cartilage which can divert stress from subchondral bones inside a weight-bearing joint to function as a protective cushion. However, when aging or intraarticular fracture occurring, irreversibly degeneration of articular cartilage is induced and its protective function is compromised. Inside a weight-bearing joint with damaged cartilage, bone rubs against each other resulting in pain, stiffness, and even loss of joint motion. Those are characteristic manifestations of osteoarthritis (OA), the leading cause for disability in adults [2]. A crucial pathological change of osteoarthritic cartilage is ECM breakdown, such as fragmentation of type II collagen fibers, driven by matrix metalloproteinases (MMPs). Numerous studies have shown that fragments of type II collagen cleaved by MMPs, especially C-terminal telopeptide (CT) also denoted as CTX-II, were elevated in body fluids of OA animal models or patients diagnosed with OA. Matyas et al. reported that significantly increased levels of CT were observed in synovial fluids, serum and urine of canines at 12-week post-surgical transection of the anterior cruciate ligament [3]. Dam and colleagues discovered that urinary level of CT in patients with radiographic knee OA was 56% higher than that in control subjects. Furthermore, they found that baseline level of CT could be applied to prediction of longitudinal cartilage loss determined by MRI measurements over a 21-month follow-up [4]. Those fragments of type II collagen can not only act as biomarkers for OA progression but also exert biological effect on chondrocytes to promote cartilage degradation. In 2000, Jennings et al. firstly reported that those fragments could inhibit synthesis of collagen in bovine or human chondrocyte monolayer cultures, which interfered with the repairing of damaged cartilage. Moreover, they also discovered that those fragments at 1 mg/mL could induce significant tissue damage in human knee or ankle cartilage explant cultures. Coincidently, up-regulation of MMP-2 expression was observed in culture media of those explant cultures [5]. The MMP-2 up-regulation by fragments of type II collagen was further confirmed in bovine or human healthy articular cartilage explant or chondrocyte cultures. In addition, those authors reported that synthetic N-terminal telopeptide (NT) of collagen type II could induce up-regulation of MMP-3 and -13 at mRNA level up to 5- and 18-fold, respectively. By analysing culture media of human healthy ankle cartilage explant cultures with ELISA, they found that NT could induce significant release of MMP-3 from cartilage at time- and dose-dependent fashion [6]. This catabolic effect of NT could be mediated by annexin V which is a type of membrane receptor for collagen type II and also acts as a calcium channel in human articular chondrocytes [7]. The potential role of NT or CT from collagen type II in osteoarthritic cartilage damage was extensively studied by G. Homandberg’s laboratory which firstly reported that fragments degraded from fibronectin, another ECM protein, could aggravate cartilage breakdown via their pro-inflammatory effect on chondrocytes [8]. In bovine articular chondrocyte or cartilage explant cultures, they demonstrated that NT or CT could up-regulate expression of several cartilage-damaging metalloproteinases, including MMPs-1, 3, 13 and ADAMTS-5. This effect was comparable to that of fibronectin fragments (Fn-fs) but requiring much higher concentration. Also, those telopeptides could induce significant proteoglycan (PG) loss from cultured cartilage explants, indicating that they were proinflammatory agents as Fn-fs involved in OA pathogenesis. However, in terms of stimulating release of proinflammatory cytokines from chondrocytes, Fn-fs showed much stronger effect than NT or CT [9]. Although current literature has records of NT or CT cleaved from collagen type II on cartilage degrading bovine or human healthy cartilage, studies on how those telopeptides act on human osteoarthritic articular cartilage have never been reported. Hence, we hypothesized that NT or CT could act through receptors for collagen type II, integrins beta1 (ITGB1), to up-regulate cartilage damaging MMPs in human osteoarthritic chondrocytes and to promote inflammatory degeneration of the tissue harvested from total joint replacement surgery. Our aims were: 1) to examine whether NT or CT could induce expression of MMPs-1 and -13 in cartilage tissue cultures and chondrocyte monolayer cultures; 2) to determine whether NT or CT could deplete PG from cartilage causing tissue degradation; 3) to examine the effect of NT or CT on ITGB1 expression in chondrocyte monolayer cultures. Materials and Methods 1. Acquisition of human articular cartilage Full-thickness cartilage slices were harvested from either femoral head or tibial plateau of patients (N = 34, 26 women and 8 men, age ranging from 55 to 95 years) who were diagnosed with femoral neck fracture (N = 21), or late stage knee OA (N = 11), or femoral head necrosis (N = 2) and received total hip or knee replacement surgery at a local hospital with institutional review board approval (Reference number: LS2019001). Cartilage samples collected from 5 individual patients were used for tissue culture experiments and samples from 29 patients were used for establishment of primary chondrocyte cultures. Characteristics of those cartilage samples are summarized in Supplemental Table 1. 2. Preparation of telopeptides of type II collagen Peptides including telopeptides of type II collagen and corresponding control peptides were synthetized by GL Biochem (Shanghai, China) using sequences reported in previous studies [5, 7, 9]. The features of those peptides are summarized in Table 1. Immediately prior to being used in the experiments, lyophilized peptides were dissolved in sterile 1X PBS to make a 10 mg/mL stock solution. Based on the amino acid count of each peptide and the average molecular weight of amino acids (110 Da), a series of dilutions of stock solution were made to achieve 30 µM final concentration of each peptide in culture media. Equal volume of sterile 1X PBS was added into designated cultures as vehicle control. Table 1. Characteristics of synthesized peptides used in the study. Full Name Acronym Amino acid count Amino acid sequence Location on α1-chain of procollagen type II N-terminal telopeptide NT 31 QMAGGFDEKA GGA G LGVMQG PMGPMGPRGP P Residues 182 – 212 C-terminal telopeptide CT 24 IDMSAFAGLG PREKGPDPLQ YMRA Residues 1218–1241 Scrambled N-terminal telopeptide SN 31 GPGAGQPGKG RGPAPLQFGM AMMDMADPGE V N/A (control peptide of NT) Scrambled C-terminal telopeptide SC 24 MARFPAMLGP ARDPISYQKE GDGL N/A (control peptide of CT) Helical peptide HP 24 GPEGAQGPRG EPGTPGSPGP AGAS Residues 384 - 407 3. Establishment of cartilage tissue culture and collection of conditioned media and cartilage slices As illustrated in Figure 1, immediately after being shaved from osteochondral specimens derived from total hip or knee replacement surgery, full-thickness cartilage slices were aseptically weighed and evenly distributed into a 12-well culture plate at ~100 mg wet weight cartilage slices per well containing 1.0 mL serum free culture media (DMEM/F12/1% pen-strep). Firstly, cartilage slices were preequilibrated for two days and media were changed daily. Conditioned medium samples collected during preequilibration were denoted as Day -2 and -1. At Day 0, cartilage slices were either treated with 30 µM telopeptides or left untreated. Cartilage cultures treated with 1XPBS or 10 ng/mL rhIL-1b served as a negative or positive control, respectively. Media were replenished every other day and conditioned medium samples were collected at Days 2, 4, and 7. At Day 7, experiments were ended and cartilage slices were collected. Conditioned media and cartilage slices were analyzed for expression of MMPs-3, -13 and for PG depletion, respectively. 4. Establishment of primary chondrocyte culture and collection of conditioned media and cell lysates As illustrated in Figure 1, chondrocytes were isolated from cartilage slices digested sequentially with pronase E (Sigma-Aldrich Corp, MO, USA) and collagenase IA (Sigma-Aldrich Corp, MO, USA) as reported [10, 11]. Chondrocytes were plated in monolayer at a high density of 2.5 X 10 5 cells/cm 2 and cultured in DMEM/F12 supplemented with 10% FBS and 1% pen-strep for 4 – 5 days till reaching 90% or above confluence. At Day 5 or 6 post-seeding, cultures were switched to serum free media. After 24-hr of serum deprivation, cultures were treated with telopeptides, PBS, or rhIL-1b. After another 24-hr, conditioned media were collected for examination of MMP expression at protein level and cells were lysed for examination of expression of MMPs and ITGB1 at protein and mRNA level. 5. Determination of PG depletion from cartilage slices with DMMB assay Cartilage slices collected at Day 7 post-treatment were firstly digested with 0.5 mg/mL papain (Sigma-Aldrich Corp, MO, USA) digestion buffer at 65°C for 4 hrs. Sulfated glycosaminoglycan polysaccharide from shark fin cartilage (Sigma-Aldrich Corp, MO, USA) served as PG standard for the establishment of a standard curve. PG content in each cartilage digest sample or PG standards firstly reacted with DMMB reagent, resulting blue-colored product. The absorbance of each sample at 530 nm wavelength was measured with a BioTek microplate reader (Agilent Technologies, Inc., Santa Clara, CA, USA). PG content in each cartilage digest sample was calculated from absorbance and standard curve equation and normalized to the wet weight of cartilage slices. 6. Determination of expressions of MMPs and ITGB1 at protein levels with Western blotting To determine expression of MMPs, conditioned medium samples were firstly dialyzed with SnakeSkin™ dialysis tubing (MWCO = 10 kDa) (ThermoFisher Scientific, Waltham, MA, USA) against deionized water at 4°C for 48 hrs until phenol red color disappeared. Next, dialyzed conditioned medium samples were concentrated with a centrifugal vacuum concentrator (Labconco Corporation, Kansas City, MO, USA) until liquid portion in each sample was invisible to naked eye. Immediately prior to examination with Western blotting, each concentrated sample was reconstituted with 50 µL of deionized water. To determine ITGB1 expression, cultured chondrocytes were lysed with RIPA lysis and extraction buffer (ThermoFisher Scientific, Waltham, MA, USA) supplemented with 1:100 diluted protease inhibitor cocktail (ThermoFisher Scientific, Waltham, MA, USA) and then cell lysates were centrifugated at 8,000 rpm for 10 min at 4°C to obtain supernatants containing intracellular proteins. Protein concentration of each cell lysate sample was measured with a Pierce™ BCA Protein Assay kit (ThermoFisher Scientific, Waltham, MA, USA). Either reconstituted conditioned medium sample or cell lysate sample was prepared with 5X loading buffer, reduced with 0.5 M DTT, and boiled for 5 mins. Equal vol. of each medium sample or equal total proteins of cell lysate sample was loaded onto a 4% SDS-PAGE concentrating gel and proteins were separated in a 10% separating gel. After proteins were blotted onto a nitrocellulose membrane, 5% non-fat dry milk in 1X TBST was used to block the membrane. Proteins on the membrane were then probed with anti-MMP-1, or MMP-13, or ITGB1 antibody (Cell Signaling Technology™, Danvers, MA, USA) 1:1,000 dissolved in 5% BSA/TBST overnight at 4°C. After primary antibody incubation, the membrane was incubated in anti-rabbit IgG conjugated with HRP (Cell Signaling Technology™, Danvers, MA, USA) 1:3,000 diluted in 5% BSA/TBST for one hour at room temperature. To visualize proteins bands, SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific, Waltham, MA, USA) was applied to the membrane and chemiluminescence signals were captured with the ChemiDoc™ MP imaging system (BioRad, Hercules, CA, USA). Densitometric analysis of protein bands was performed with ImageJ. 7. Determination of expression of ITGB1 or MMPs at mRNA level with real-time PCR After 24-hr stimulation, chondrocytes were lysed with TRIzol™ Reagent (ThermoFisher Scientific, Waltham, MA, USA). Intracellular total RNAs were isolated with chloroform and purified with isopropanol and ethanol. Concentration and purity of each purified RNA sample were measured with a NanoDrop One/One C Microvolume UV-Vis spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). Up to 1,000 ng of total RNAs were reversely transcribed into cDNA with a PrimeScript™ RT Master Mix (Perfect Real Time) kit (Takara Bio Inc., Shiga, Japan). Expression levels of MMPs-1, -13, and ITGB1 were measured with a FastStart Essential DNA Green Master kit (Roche LifeScience, Basel, Switzerland) and nucleotide sequence encoding 18S rRNA was used as a reference gene. Ct values of target genes were read and recorded with LightCycler 480 Ⅱ (Roche LifeScience, Basel, Switzerland). All primers were synthesized by Exsyn-Biotechnology Co. Ltd. (Shanghai, China). The sequences of primers used for real time PCR experiments are listed in Table 2. The Ct values of MMPs-1, -13, and ITGB1 genes were compared to that of 18S rRNA, respectively. The relative mRNA expression level of each target gene was determined by 2 –∆∆Ct method. Table 2. Primer sequences for target genes. Genes Sequences of primers MMP-3 Forward AGGCTGTATGAAGGAGAGGCTGAT Reverse AGTGTTGGCTGAGTGAAAGAGAC MMP-13 Forward AGCATCTGGAGTAACCGTATTG Reverse CCCGCACTTCTGGAAGTATT ITGB1 Forward GGCAGTGCATGTGACTGTT Reverse CTGAACACATTCTTTATGCTC 18S rRNA Forward CGGCTACCACATCCAAGGAA Reverse GCTGGAATTACCGCGGCT 8. Statistical analyses The difference of PG content expressed as mean (µg/mg wet cartilage) ± standard deviation (S.D.) in each experimental group was compared to that in either PBS or control peptide treated group with unpaired t-test (t-Test: Two-Sample Assuming Equal Variances). The relative mRNA expression of MMPs or ITGB1 to 18S rRNA among experimental groups was calculated with 2 – ∆∆Ct method and the fold increase value was also compared by using unpaired t-test. The same test was employed to compare the difference of ITGB1 expression determined by gray values of protein bands among experimental groups. The difference between two compared groups is considered as statistically significant when P value is less than 0.05. Results 1. Telopeptides of type II collagen remarkably induced PG depletion from hip or knee cartilage, showing comparable catabolic effect as IL-1b and slightly stronger effect than helical peptide. After 7 days of continuous stimulation by 30 µM NT, there was only 13.49 ± 8.61 µg PG/mg wet cartilage remaining. This PG content was much lower than that in PBS (vehicle) treated (23.65 ± 13.97 µg PG/mg wet cartilage; P = 0.131) or SN (control peptide) treated tissue (19.00 ± 5.60 µg PG/mg wet cartilage; P = 0.162) (Figure 2A). Similarly, cartilage treated with 30 µM CT for 7 days only contained 12.96 ± 5.38 µg PG/mg wet cartilage which was significantly lower than PG content in cartilage treated either with vehicle (P = 0.101) or control peptide (SC) (22.33 ± 7.75 µg PG/mg wet cartilage; P = 0.047) (Figure 2B). Surprisingly, in terms of causing PG depletion from cartilage, telopeptides showed slightly stronger effect than did IL-1b. Cartilage treated by IL-1b for 7 days still contained 16.84 ± 7.01 µg PG/mg wet cartilage, a level slightly higher than that in tissue treated by either NT or CT. Peptide derived from the helical region of type II collagen (HP) also showed catabolic effect on cartilage. However, this effect was slightly weaker than either telopeptide based on PG content in cartilage treated by HP for 7 days (16.98 ± 6.61 µg PG/mg wet cartilage) (Figure 2C). 2. Strong expression of cartilage-damaging MMPs in femoral or tibial cartilage was induced by NT or CT at Day 4 post-treatment and the effect was still obvious at Day 7 post-treatment. One day prior to the beginning of the experiments, i.e. pre-equilibration Day -1, neither MMP-3 nor MMP-13 protein band was clearly detected in conditioned media collected from femoral head cartilage (male, 71 YO, diagnosed as femoral neck fracture) cultures in all experimental groups. However, at Day 4 post-treatment with NT or CT, strong MMP-3 or MMP-13 signal was observed in conditioned media. By contrast, neither of this signal was detectable in control groups. Although at Day 7 post-treatment MMP-3 or -13 signal was seemingly weaker in conditioned media of cultures treated with NT or CT than that at Day 4 post-treatment, the strength of either signal was still much stronger than that in the control groups (Figure 3A&B). Similar results were observed in cultures of cartilage from tibial plateau of a 77-years male patient diagnosed with late stage knee OA (Figure 3C&D). We also examined the effect of telopeptides on MMP up-regulation in femoral head cartilage of a 68 years female patient diagnosed with femoral head necrosis and found results described above were reproducible (Supplemental Figure 1A&B). In order to verify that those up-regulated MMPs in conditioned media was produced by chondrocytes in cultured cartilage slices, we deliberately killed all chondrocytes in some cartilage slices by repeating freeze-thawing cycle 3 times (freezing cartilage slices at -80°C for 3 min and then thawing them at 37°C for 5 min). At Day 4 post-treatment by telopeptides, MMP-3 signal was only detected in live cartilage slices treated with NT or CT while the signal was undetectable in freeze-thawed cartilage slices treated with NT or CT (Supplemental Figure 2). In chondrocyte monolayer cultures, we did not observe increased MMP mRNA expression at 24-hr post-treatment by NT or CT. However, in conditioned media collected at the same time point, we observed significant up-regulation of MMPs-3&13 in NT or CT treated samples (Supplemental Figure 3A-F). 3. The effect of telopeptides on MMP up-regulation was still weaker than that of IL-1b. HP could also up-regulate MMP expression and this effect was comparable to telopeptides. We compared the effect of telopeptides on MMP up-regulation in cartilage cultures to that of IL-1b which is a well-studied pro-inflammation factor in OA pathogenesis. At Day 4 or 7 post-treatment, the strongest MMP-3 or -13 signal was detected in cartilage treated with 10 ng/mL rhIL-1b while MMP signals in NT or CT treated cartilage cultures were moderately weaker but with similar strength (Figure 4). Interestingly, we also observed that peptide derived from the helical region of type II collagen (HP) up-regulated expression of MMP-3 or -13 in cartilage cultures at Day 4 or 7 post-treatment. Seemingly, when compared to telopeptides, HP showed slightly stronger effect on up-regulating MMP-13 expression while slightly weaker effect on up-regulating MMP-3 expression (Figure 4). 4. Expression of type II collagen membrane receptor, ITGB1, in chondrocytes was moderately elevated by CT but not by NT stimulation. The effect of CT on up-regulation of ITGB1 was comparable to that of IL-1b. When examined at 24-hr post-treatment, the mRNA expression level of ITGB1 in chondrocytes treated with NT was similar to that in non-treated control cells or treated with vehicle reagent or scrambled control peptide (N = 5; Figure 5A). However, in CT-treated chondrocytes ITGB1 expression was elevated by 2.1-fold in average compared to that in non-treated controls (N = 3; P = 0.096; Figure 5B). This effect of CT was even slightly stronger than IL-1b which increased ITGB1 expression by 1.54-fold compared to non-treated controls (N = 2; Figure 5C). As a peptide derived from the helical region of collagen type II, HP exhibited little effect on ITGB1 expression at mRNA level, which was similar to NT (N = 3; Figure 5C). Nonetheless, either NT or CT could moderately increase ITGB1 protein expression at 24-hr post-treatment (Figure 5B). Discussion We are the first to report that telopeptides derived from collagen type II could cause significant PG loss from femoral or tibial cartilage of patients who received total joint replacement surgery. This telopeptide-induced cartilage damage was accompanied by up-regulated expression of MMPs-3&-13, two MMPs heavily involved in osteoarthritic cartilage degradation [ 12 , 13 ]. These results were consistent with what Guo and colleagues reported in a study that employed bovine articular cartilage harvested from metacarpophalangeal joints [ 9 ]. Furthermore, we also discovered that the telopeptide derived from the C-terminus of collagen type II could obviously up-regulate expression of ITGB1 which is a major membrane receptor for the native protein, implying that this receptor might mediate the action of C-telopeptide. In our human cartilage tissue cultures, we discovered that either telopeptide at 30 µM could induce remarkable PG depletion from the tissue after a 7-day continuous treatment. This dramatic effect of telopeptides was previously observed in bovine cartilage tissue cultures by Guo and colleagues. Their 6-day dose-response experiments indicated that NT or CT at 30 µM exhibited the strongest PG-depletion effect [ 9 ]. That was why we tested this dose in our human cartilage cultures. Although we only observed statistically significant PG loss in CT-treated cartilage, PG content in NT-treated cartilage was still 5–10 µg PG/mg wet cartilage lower than that in controls. The higher P values observed in NT group might be due to limited sample size and large standard deviation caused by individual difference. An earlier study conducted by Jennings et al. revealed that bovine collagen type II fragment mixture generated by bacterial collagenase could induce significant PG loss in human ankle or knee cartilage explant after 3-week culturing. The authors stated that their bovine collagen fragment mixture was enriched in N- or C-telopeptides and the MW was smaller than 10 kDa [ 5 ]. The effective dose of this fragment mixture was 1 mg/mL, equivalent to 200 µM if calculated with 5 kDa as average MW. However, this study did not use defined telopeptide of collagen type II as what we did in our study. We clearly showed that N-telopeptide corresponding to residues 182 to 212 or C-telopeptide corresponding to residues 1218 to 1241 of alpha1 chain of human collagen type II had cartilage-damaging bioactivity. Furthermore, we detected this catabolic activity of telopeptides on cartilage at one week of treatment, which was two weeks earlier than what they reported. Lastly, we examined the effect on cartilage of Asian patients diagnosed with femoral neck fracture, hip osteonecrosis or knee osteoarthritis which was not studied by them. They harvested macroscopically normal knee or ankle cartilage from three Caucasian corpses with a wider range of age (39–71 years). In order to explore the mechanism by which NT or CT induced cartilage damage, we examined the levels of two MMPs that can cause PG depletion and are heavily involved in OA pathogenesis, MMPs-3 and − 13 [ 13 , 14 ], in conditioned media harvested from cartilage explant cultures. Compared to medium samples collected at one day prior to telopeptide treatments that showed little MMP signal, samples at Day 4 or 7 post-treatment with either NT or CT showed not only detectable but also much stronger signals of MMPs-3 and − 13. The up-regulation of those two MMPs by telopeptides was also observed in the conditioned media of our human chondrocyte monolayer cultures at 24-hr post-treatment, a much earlier time point than that in cartilage cultures. This faster response of chondrocytes in monolayer cultures than in cartilage cultures might be due to lesser ECM surrounding the cell, which enabled faster penetration of telopeptides through ECM to reach to chondrocytes. Since those two MMPs have proved to be the driving force for cartilage PG depletion, this observation well explained why NT or CT induced significant loss of PG from cartilage ECM at Day 7 post-treatments observed in our study. In earlier studies, NT or CT induced up-regulation of MMPs in conditioned media was only observed in cartilage explant cultures established from bovine metacarpophalangeal joints or human healthy ankle joints. They did not examine this effect of those two telopeptides on OA-prone or OA cartilage derived from human hip or knee joints that was used in our study [ 6 , 9 ]. Moreover, Guo et al. reported that NT or CT at 30 µM could stimulate significant MMPs-3&13 release from bovine cartilage at 1-day post-treatment [ 9 ]. We discovered that the same dose of those two telopeptides could greatly up-regulate MMP expression in human chondrocytes at Day 4 post-treatment and this effect could still be detected at Day 7. Fichter and colleagues only reported the dose-dependent effect of NT on MMP-3 induction in human healthy ankle cartilage cultures. The highest dose they examined was around 300 µM. But this dose induced less MMP-3 release than did 30 µM, which implied that 30 µM might be the most effective dose in terms of inducing MMP-3 up-regulation in human chondrocytes [ 6 ]. Furthermore, we discovered that a peptide derived from the triple helical region of collagen type II (HP) could also induce up-regulation of MMPs-3&13 but with lesser effect when compared to telopeptides. This result may explain why HP induced lesser PG loss from cartilage explants than did NT or CT in our 7-day experiments. However, in terms of up-regulating those two MMPs, either telopeptides or HP still showed much weaker effect than did IL-1b. Up-regulated MMPs-3 and − 13 by IL-1b may cleave cartilage ECM collagen type II to generate bioactive telopeptides and HP which can induce more MMPs [ 7 , 15 ]. By contrast, neither of the telopeptides could induce IL-1b expression in bovine chondrocyte cultures [ 9 ]. Therefore, the accumulated action of IL-1b and collagen fragments was certainly stronger than that of any collagen fragment working alone. Next, we examined the effect of those collagen fragments on expression levels of major membrane receptors for collagen type II in order to test our hypothesis that the proinflammatory action of telopeptides or HP was mediated by receptors for their native protein. Integrins are membrane receptors for cartilage ECM proteins and each integrin is a heterodimer composed of an alpha and a beta subunit. Studies have shown that ITGB1 family are major membrane receptors for collagen type II in human articular cartilage and its expression level is elevated in osteoarthritic cartilage [ 16 , 17 ]. However, we only observed moderate elevation of ITGB1 protein expression in human articular chondrocytes after 24-hr treatment by CT. This observation implied that the catabolic action of CT might be mediated by ITGB1 while the action of NT or HP might be mediated by membrane receptors other than integrins. Our observation was consistent with what Lucic and colleagues had reported in a study examining how those synthetic peptides derived from collagen type II interacted with chondrocytes. By applying those peptides to chondrocytes isolated from human talus cartilage, they discovered that annexin V, a calcium ion channel on chondrocyte membrane, were most likely the binding receptor for NT while ITGB1 family were receptors for CT or HP [ 7 ]. In our study, we examined the expression level of ITGB1 in chondrocytes treated with CT at 24 hr post-treatment which might not be ITGB1’s peak expression time point. This may explain why only moderate elevation of ITGB1 expression was observed in our study. In future studies, samples collected at earlier time points, such as 4-hr, 8-hr, 12-hr post-treatment, will be examined for ITGB1 expression at both mRNA and protein level. In summary, we established human articular cartilage explant cultures and primary human chondrocyte monolayer cultures to test our hypothesis that telopeptides derived from human collagen type II could induce osteoarthritic cartilage damage by depleting PG content from the tissue and up-regulating MMP expression. This catabolic action could be mediated by membrane receptors for the native protein of those telopeptides. Our data supported this hypothesis by revealing that remarkable PG loss was induced by NT or CT at 7-D post-treatment and significant up-regulation of MMPs-3&13 was induced at 4-D and 7-D post-treatment. At 24-hr post-treatment, ITGB1 expression was elevated by CT but not by NT, implying that the catabolic action of CT might be mediated by ITGB1. Future studies will determine whether annexin V mediates the catabolic action of NT. Here, we would like to clarify that the No. 195 amino acid in the sequence of NT used in this study was Gly (G) which should be Gln (Q) according to protein database (GenBank: KAI4065584.1 or UniProtKB/Swiss-Prot: P02458.3). We cited this amino acid sequence from a published paper authored by Guo et al [ 9 ]. This sequence was also used for synthesizing NT in a study conducted by Chowdhury et al. They observed similar catabolic effect of NT on porcine cartilage to what we observed in human cartilage [ 18 ]. This indicated that the Q to G substitution at No. 195 position of NT primary structure did not affect the secondary structure of this peptide. This may be explained by the non-polar nature shared by those two amino acids. The corrigendum regarding to this NT amino acid sequence error will be published in Inflammation Research journal in which the original paper containing this amino acid sequence error was published. Declarations Acknowledgements: We thank staff of Medical Research Facilities at Jiangnan University Wuxi College of Medicine for providing us technical assistances. Competing Interests: The authors have no relevant financial or non-financial interests to disclose. Funding: This work was supported by the Postgraduate Research & Practice Innovation Program of Jiangsu Province grant (KYCX22_2437) awarded to Jiamin Mao and by the Jiangsu Provincial Natural Science Foundation of China grant awarded to Lei Ding (BK20171143). Data Availability Statement: The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials. References Ouyang Z, Dong L, Yao F, Wang K, Chen Y, Li S, et al. Cartilage-Related Collagens in Osteoarthritis and Rheumatoid Arthritis: From Pathogenesis to Therapeutics. Int J Mol Sci 2023; 24. Vina ER, Kwoh CK. Epidemiology of osteoarthritis: literature update. Curr Opin Rheumatol 2018; 30:160-167. Matyas JR, Atley L, Ionescu M, Eyre DR, Poole AR. Analysis of cartilage biomarkers in the early phases of canine experimental osteoarthritis. Arthritis Rheum 2004; 50:543-52. Dam EB, Byrjalsen I, Karsdal MA, Qvist P, Christiansen C. Increased urinary excretion of C-telopeptides of type II collagen (CTX-II) predicts cartilage loss over 21 months by MRI. Osteoarthritis Cartilage 2009; 17:384-9. Jennings L, Wu L, King KB, Hammerle H, Cs-Szabo G, Mollenhauer J. The effects of collagen fragments on the extracellular matrix metabolism of bovine and human chondrocytes. Connect Tissue Res 2001; 42:71-86. Fichter M, Korner U, Schomburg J, Jennings L, Cole AA, Mollenhauer J. Collagen degradation products modulate matrix metalloproteinase expression in cultured articular chondrocytes. J Orthop Res 2006; 24:63-70. Lucic D, Mollenhauer J, Kilpatrick KE, Cole AA. N-telopeptide of type II collagen interacts with annexin V on human chondrocytes. Connect Tissue Res 2003; 44:225-39. Gene AH, Lei D, Danping G. Extracellular Matrix Fragments as Regulators of Cartilage Metabolism in Health and Disease. Current Rheumatology Reviews 2007; 3:183-196. Guo D, Ding L, Homandberg GA. Telopeptides of type II collagen upregulate proteinases and damage cartilage but are less effective than highly active fibronectin fragments. Inflamm Res 2009; 58:161-9. Xiong L, Cui M, Zhou Z, Wu M, Wang Q, Song H, et al. Primary culture of chondrocytes after collagenase IA or II treatment of articular cartilage from elderly patients undergoing arthroplasty. Asian Biomedicine 2021; 15:91-99. Mao J, Huang L, Ding Y, Ma X, Wang Q, Ding L. Insufficiency of collagenases in establishment of primary chondrocyte culture from cartilage of elderly patients receiving total joint replacement. Cell Tissue Bank 2023; 24:759-768. Burrage PS, Mix KS, Brinckerhoff CE. Matrix metalloproteinases: role in arthritis. Front Biosci 2006; 11:529-43. Hu Q, Ecker M. Overview of MMP-13 as a Promising Target for the Treatment of Osteoarthritis. Int J Mol Sci 2021; 22. Plsikova Matejova J, Spakova T, Harvanova D, Lacko M, Filip V, Sepitka R, et al. A Preliminary Study of Combined Detection of COMP, TIMP-1, and MMP-3 in Synovial Fluid: Potential Indicators of Osteoarthritis Progression. Cartilage 2021; 13:1421S-1430S. Yasuda T, Tchetina E, Ohsawa K, Roughley PJ, Wu W, Mousa A, et al. Peptides of type II collagen can induce the cleavage of type II collagen and aggrecan in articular cartilage. Matrix Biol 2006; 25:419-29. Loeser RF. Chondrocyte integrin expression and function. Biorheology 2000; 37:109-16. Loeser RF, Carlson CS, McGee MP. Expression of beta 1 integrins by cultured articular chondrocytes and in osteoarthritic cartilage. Exp Cell Res 1995; 217:248-57. Chowdhury TT, Schulz RM, Rai SS, Thuemmler CB, Wuestneck N, Bader A, et al. Biomechanical modulation of collagen fragment-induced anabolic and catabolic activities in chondrocyte/agarose constructs. Arthritis Res Ther 2010; 12:R82. Additional Declarations No competing interests reported. Supplementary Files SupplementoryInformation.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5086390","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":359870978,"identity":"c606127f-c82e-417f-b2ec-b20837ef4a07","order_by":0,"name":"Jiamin Mao","email":"","orcid":"","institution":"Jiangnan University Wuxi College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jiamin","middleName":"","lastName":"Mao","suffix":""},{"id":359870979,"identity":"63c24e58-3024-409d-99b6-106813c2b21a","order_by":1,"name":"Quanming Wang","email":"","orcid":"","institution":"Jiangnan University Affiliated Hospital","correspondingAuthor":false,"prefix":"","firstName":"Quanming","middleName":"","lastName":"Wang","suffix":""},{"id":359870980,"identity":"725cb298-e809-434a-899c-f4710551fa04","order_by":2,"name":"Yubo Lu","email":"","orcid":"","institution":"Jiangnan University Wuxi College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yubo","middleName":"","lastName":"Lu","suffix":""},{"id":359870981,"identity":"7d27147b-9b3b-4aac-b13a-dd8bbd5617aa","order_by":3,"name":"Bowen Chen","email":"","orcid":"","institution":"Jiangnan University Wuxi College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Bowen","middleName":"","lastName":"Chen","suffix":""},{"id":359870982,"identity":"2bc700b8-d46d-425d-96d2-2d2f0897f674","order_by":4,"name":"Ruiyang Xu","email":"","orcid":"","institution":"Jiangnan University Wuxi College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ruiyang","middleName":"","lastName":"Xu","suffix":""},{"id":359870983,"identity":"20e36b7b-c032-4c10-95ee-cd540c714142","order_by":5,"name":"Lei Ding","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYBACe2Yg8YBBQo6xGSFogFeLIUhlAoOEMfFaDA6AtTAkNiAL4tdynPfwi4QKi/TmduZnD7/usMtjYG/eJsFQcwe3lsN8aRYJZyRyG5vZzI1lzyQXM/AcK5NgOPYMjxYeM4PENpAWBjNpyTbmxAaJHDMJxobDBLT8k0hnbGb/BtRSn9gg/4agFuMHQJMTGJt5zCQ/th0GsnnwazEEqmRIOCZh2NjMUybN2HY8sY0nrdgi4RhuLfb8Z4w/fKipkzfsP75N8mdbdWI/++GNNz7U4NYCBGwSYOsaGBiYeUBcEC8Bnwagwg8gUh6IGX/gVzkKRsEoGAUjFAAA0glRADVQ2lsAAAAASUVORK5CYII=","orcid":"","institution":"Jiangnan University Wuxi College of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Lei","middleName":"","lastName":"Ding","suffix":""}],"badges":[],"createdAt":"2024-09-14 01:37:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5086390/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5086390/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65781071,"identity":"1b585595-1275-4410-b885-57e06595552e","added_by":"auto","created_at":"2024-10-02 15:09:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":57194,"visible":true,"origin":"","legend":"\u003cp\u003eScheme of experimental design. Human articular cartilage tissue or primary human articular chondrocyte cultures were employed to determine whether telopeptides of Col-2 could cause cartilage damage through up-regulating MMP up-regulation and inducing PG depletion. In addition, the effect of those telopeptides on expression of membrane receptor ITGB1 was examined.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5086390/v1/a9dc298c7f95969ffa3641e3.png"},{"id":65781066,"identity":"fc3446c6-cb5b-47c3-be9f-33cd2bab962b","added_by":"auto","created_at":"2024-10-02 15:09:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":67208,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of PG content between telopeptide-treated and control cartilage slices at Day 7 post-treatment. A) PG content in NT-treated or control cartilage slices (N = 4). B) PG content in CT-treated or control cartilage slices (N = 4). C) PG content in NT or CT-treated cartilage slices was compared to that in HP- (N = 4) or IL-1b-treated tissue (N = 3). Error bar represents standard deviation.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5086390/v1/8fb7133dcab6466924c90fd6.png"},{"id":65781070,"identity":"e8ed8442-af6a-4476-85bc-7225a13dfecf","added_by":"auto","created_at":"2024-10-02 15:09:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":911089,"visible":true,"origin":"","legend":"\u003cp\u003eTime-dependent MMP up-regulation by telopeptides in cartilage cultures. Protein expression of MMP-3\u0026amp;-13 in conditioned media was examined at Days -1, 4, and 7. A) Expression of MMPs in NT-treated or control cultures of femoral head cartilage collected from a 71-years male patient diagnosed with femoral neck fracture. B) Expression of MMPs in CT-treated or control cultures of femoral head cartilage collected from a 71-years male patient diagnosed with femoral neck fracture. C) Expression of MMPs in NT-treated or control cultures of tibial plateau cartilage collected from a 77-years male patient diagnosed with late stage OA. D) Expression of MMPs in CT-treated or control cultures of tibial plateau cartilage collected from a 77-years male patient diagnosed with late stage OA.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5086390/v1/a6d29bc61175ab2a2687ae05.png"},{"id":65781068,"identity":"f507ec6a-b73c-44e1-bc42-8658729150c4","added_by":"auto","created_at":"2024-10-02 15:09:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":349885,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of MMP expression between telopeptides and IL-1b or HP at Day 4 or 7 post-treatment. Cartilage slices harvested from femoral head of a 71 years male patient diagnosed with femoral neck fracture were continuously treated with telopeptides or IL-1b or HP for 7 days. Conditioned media collected at Day 4 or 7 were examined for expression of MMP-3 and -13 with Western blotting.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5086390/v1/8c14b71427a71835b246a3fe.png"},{"id":65781751,"identity":"dfe30d73-9725-4c13-a37a-885145904415","added_by":"auto","created_at":"2024-10-02 15:17:13","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":231276,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of ITGB1 expression in chondrocytes at 24-hr post-treatment. Total intracellular RNAs or proteins were extracted from cultured chondrocytes either non-treated (NC) or treated with vehicle reagent (PBS) or with telopeptides (NT or CT) or with scrambled telopeptides (SN or SC) or with helical peptide (HP) or with rhIL-1b. After cDNA conversion, real-time PCR or Western blotting was performed to determine expression level of ITGB1 in each treatment group. ITGB1 mRNA expression level relative to 18S rRNA in NT (N = 5) or CT (N = 3) group was calculated and plotted (A\u0026amp;B). Expression level of ITGB1 mRNA in NT or CT treatment group was also compared to that in HP or rhIL-1b treated group (N = 3 for HP; N = 2 for IL-1b) (C). Representative blots showing protein expression levels of ITGB1 in NT or CT group and plots showing comparison results of band intensity in each treatment group (N = 3) (D). Error bars indicate standard deviation.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5086390/v1/ba817bb937a66623e96cf57a.png"},{"id":65782992,"identity":"a6183b51-5321-404d-b58b-0a24415c98b8","added_by":"auto","created_at":"2024-10-02 15:25:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2122739,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5086390/v1/b9e6adaf-e4be-418f-b80a-7c3c64de7aa5.pdf"},{"id":65781067,"identity":"b2abeb0d-e1ad-4a5b-9334-106281ae07b8","added_by":"auto","created_at":"2024-10-02 15:09:13","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":13647930,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementoryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-5086390/v1/1d51a47d987e36fd63d4f953.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Proinflammatory effect of telopeptides derived from collagen type II on articular cartilage of patients receiving total arthroplasty","fulltext":[{"header":"Introduction","content":"\u003cp\u003eType II collagen restrictively exists in articular cartilage of the human body. It is a major extracellular matrix (ECM) component and accounts for 90-95% of all types of collagen in articular cartilage. Different from type I collagen that is formed by two alpha1 and one alpha2 peptide chains and is abundant in the body, such as bone and skin, type II collagen is consisted of three identical alpha1 peptide chains and is only found in cartilage inside weight-bearing joints, such as hips and knees [1]. The network weaved by type II collagen fibers is the structural basis of articular cartilage which can divert stress from subchondral bones inside a weight-bearing joint to function as a protective cushion. \u003c/p\u003e\n\u003cp\u003eHowever, when aging or intraarticular fracture occurring, irreversibly degeneration of articular cartilage is induced and its protective function is compromised. Inside a weight-bearing joint with damaged cartilage, bone rubs against each other resulting in pain, stiffness, and even loss of joint motion. Those are characteristic manifestations of osteoarthritis (OA), the leading cause for disability in adults [2]. A crucial pathological change of osteoarthritic cartilage is ECM breakdown, such as fragmentation of type II collagen fibers, driven by matrix metalloproteinases (MMPs).\u003c/p\u003e\n\u003cp\u003eNumerous studies have shown that fragments of type II collagen cleaved by MMPs, especially C-terminal telopeptide (CT) also denoted as CTX-II, were elevated in body fluids of OA animal models or patients diagnosed with OA. Matyas et al. reported that significantly increased levels of CT were observed in synovial fluids, serum and urine of canines at 12-week post-surgical transection of the anterior cruciate ligament [3]. Dam and colleagues discovered that urinary level of CT in patients with radiographic knee OA was 56% higher than that in control subjects. Furthermore, they found that baseline level of CT could be applied to prediction of longitudinal cartilage loss determined by MRI measurements over a 21-month follow-up [4]. \u003c/p\u003e\n\u003cp\u003eThose fragments of type II collagen can not only act as biomarkers for OA progression but also exert biological effect on chondrocytes to promote cartilage degradation. In 2000, Jennings et al. firstly reported that those fragments could inhibit synthesis of collagen in bovine or human chondrocyte monolayer cultures, which interfered with the repairing of damaged cartilage. Moreover, they also discovered that those fragments at 1 mg/mL could induce significant tissue damage in human knee or ankle cartilage explant cultures. Coincidently, up-regulation of MMP-2 expression was observed in culture media of those explant cultures [5]. \u003c/p\u003e\n\u003cp\u003eThe MMP-2 up-regulation by fragments of type II collagen was further confirmed in bovine or human healthy articular cartilage explant or chondrocyte cultures. In addition, those authors reported that synthetic N-terminal telopeptide (NT) of collagen type II could induce up-regulation of MMP-3 and -13 at mRNA level up to 5- and 18-fold, respectively. By analysing culture media of human healthy ankle cartilage explant cultures with ELISA, they found that NT could induce significant release of MMP-3 from cartilage at time- and dose-dependent fashion [6]. This catabolic effect of NT could be mediated by annexin V which is a type of membrane receptor for collagen type II and also acts as a calcium channel in human articular chondrocytes [7]. \u003c/p\u003e\n\u003cp\u003eThe potential role of NT or CT from collagen type II in osteoarthritic cartilage damage was extensively studied by G. Homandberg’s laboratory which firstly reported that fragments degraded from fibronectin, another ECM protein, could aggravate cartilage breakdown via their pro-inflammatory effect on chondrocytes [8]. In bovine articular chondrocyte or cartilage explant cultures, they demonstrated that NT or CT could up-regulate expression of several cartilage-damaging metalloproteinases, including MMPs-1, 3, 13 and ADAMTS-5. This effect was comparable to that of fibronectin fragments (Fn-fs) but requiring much higher concentration. Also, those telopeptides could induce significant proteoglycan (PG) loss from cultured cartilage explants, indicating that they were proinflammatory agents as Fn-fs involved in OA pathogenesis. However, in terms of stimulating release of proinflammatory cytokines from chondrocytes, Fn-fs showed much stronger effect than NT or CT [9].\u003c/p\u003e\n\u003cp\u003eAlthough current literature has records of NT or CT cleaved from collagen type II on cartilage degrading bovine or human healthy cartilage, studies on how those telopeptides act on human osteoarthritic articular cartilage have never been reported. Hence, we hypothesized that NT or CT could act through receptors for collagen type II, integrins beta1 (ITGB1), to up-regulate cartilage damaging MMPs in human osteoarthritic chondrocytes and to promote inflammatory degeneration of the tissue harvested from total joint replacement surgery. Our aims were: 1) to examine whether NT or CT could induce expression of MMPs-1 and -13 in cartilage tissue cultures and chondrocyte monolayer cultures; 2) to determine whether NT or CT could deplete PG from cartilage causing tissue degradation; 3) to examine the effect of NT or CT on ITGB1 expression in chondrocyte monolayer cultures. \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cem\u003e1. Acquisition of human articular cartilage\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFull-thickness cartilage slices were harvested from either femoral head or tibial plateau of patients (N = 34, 26 women and 8 men, age ranging from 55 to 95 years) who were diagnosed with femoral neck fracture (N = 21), or late stage knee OA (N = 11), or femoral head necrosis (N = 2) and received total hip or knee replacement surgery at a local hospital with institutional review board approval (Reference number: LS2019001). Cartilage samples collected from 5 individual patients were used for tissue culture experiments and samples from 29 patients were used for establishment of primary chondrocyte cultures. Characteristics of those cartilage samples are summarized in Supplemental Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e2. Preparation of telopeptides of type II collagen\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePeptides including telopeptides of type II collagen and corresponding control peptides were synthetized by GL Biochem (Shanghai, China) using sequences reported in previous studies\u0026nbsp;[5, 7, 9]. The features of those peptides are summarized in Table 1. Immediately prior to being used in the experiments, lyophilized peptides were dissolved in sterile 1X PBS to make a 10 mg/mL stock solution. Based on the amino acid count of each peptide and the average molecular weight of amino acids (110 Da), a series of dilutions of stock solution were made to achieve 30 \u0026micro;M final concentration of each peptide in culture media. Equal volume of sterile 1X PBS was added into designated cultures as vehicle control. \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 1. Characteristics of synthesized peptides used in the study.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eFull Name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAcronym\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAmino acid count\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAmino acid sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eLocation on \u0026alpha;1-chain of procollagen type II\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN-terminal telopeptide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eQMAGGFDEKA GGA\u003cstrong\u003eG\u003c/strong\u003eLGVMQG PMGPMGPRGP P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eResidues 182 \u0026ndash; 212\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eC-terminal telopeptide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIDMSAFAGLG PREKGPDPLQ YMRA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eResidues 1218\u0026ndash;1241\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eScrambled N-terminal telopeptide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGPGAGQPGKG RGPAPLQFGM AMMDMADPGE V\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A (control peptide of NT)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eScrambled C-terminal telopeptide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMARFPAMLGP ARDPISYQKE GDGL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A (control peptide of CT)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHelical peptide\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGPEGAQGPRG EPGTPGSPGP AGAS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eResidues 384 - 407\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3. Establishment of cartilage tissue culture and collection of conditioned media and cartilage slices\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAs illustrated in Figure 1, immediately after being shaved from osteochondral specimens derived from total hip or knee replacement surgery, full-thickness cartilage slices were aseptically weighed and evenly distributed into a 12-well culture plate at ~100 mg wet weight cartilage slices per well containing 1.0 mL serum free culture media (DMEM/F12/1% pen-strep). Firstly, cartilage slices were preequilibrated for two days and media were changed daily. Conditioned medium samples collected during preequilibration were denoted as Day -2 and -1. At Day 0, cartilage slices were either treated with 30 \u0026micro;M telopeptides or left untreated. Cartilage cultures treated with 1XPBS or 10 ng/mL rhIL-1b served as a negative or positive control, respectively. Media were replenished every other day and conditioned medium samples were collected at Days 2, 4, and 7. At Day 7, experiments were ended and cartilage slices were collected. Conditioned media and cartilage slices were analyzed for expression of MMPs-3, -13 and for PG depletion, respectively. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4. Establishment of primary chondrocyte culture and collection of conditioned media and cell lysates\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAs illustrated in Figure 1, chondrocytes were isolated from cartilage slices digested sequentially with pronase E (Sigma-Aldrich Corp, MO, USA) and collagenase IA (Sigma-Aldrich Corp, MO, USA) as reported\u0026nbsp;[10, 11]. Chondrocytes were plated in monolayer at a high density of 2.5 X 10\u003csup\u003e5\u003c/sup\u003e cells/cm\u003csup\u003e2\u003c/sup\u003e and cultured in DMEM/F12 supplemented with 10% FBS and 1% pen-strep for 4 \u0026ndash; 5 days till reaching 90% or above confluence. At Day 5 or 6 post-seeding, cultures were switched to serum free media. After 24-hr of serum deprivation, cultures were treated with telopeptides, PBS, or rhIL-1b. After another 24-hr, conditioned media were collected for examination of MMP expression at protein level and cells were lysed for examination of expression of MMPs and ITGB1 at protein and mRNA level. \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e5. Determination of PG depletion from cartilage slices with DMMB assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Cartilage slices collected at Day 7 post-treatment were firstly digested with 0.5 mg/mL papain (Sigma-Aldrich Corp, MO, USA) digestion buffer at 65\u0026deg;C for 4 hrs. Sulfated glycosaminoglycan polysaccharide from shark fin cartilage (Sigma-Aldrich Corp, MO, USA) served as PG standard for the establishment of a standard curve. PG content in each cartilage digest sample or PG standards firstly reacted with DMMB reagent, resulting blue-colored product. The absorbance of each sample at 530 nm wavelength was measured with a BioTek microplate reader (Agilent Technologies, Inc., Santa Clara, CA, USA). PG content in each cartilage digest sample was calculated from absorbance and standard curve equation and normalized to the wet weight of cartilage slices.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e6. Determination of expressions of MMPs and ITGB1 at protein levels with Western blotting\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo determine expression of MMPs, conditioned medium samples were firstly dialyzed with SnakeSkin\u0026trade; dialysis tubing (MWCO = 10 kDa) (ThermoFisher Scientific, Waltham, MA, USA) against deionized water at 4\u0026deg;C for 48 hrs until phenol red color disappeared. Next, dialyzed conditioned medium samples were concentrated with a centrifugal vacuum concentrator (Labconco Corporation, Kansas City, MO, USA) until liquid portion in each sample was invisible to naked eye. Immediately prior to examination with Western blotting, each concentrated sample was reconstituted with 50 \u0026micro;L of deionized water.\u003c/p\u003e\n\u003cp\u003eTo determine ITGB1 expression, cultured chondrocytes were lysed with RIPA lysis and extraction buffer (ThermoFisher Scientific, Waltham, MA, USA) supplemented with 1:100 diluted protease inhibitor cocktail (ThermoFisher Scientific, Waltham, MA, USA) and then cell lysates were centrifugated at 8,000 rpm for 10 min at 4\u0026deg;C to obtain supernatants containing intracellular proteins. Protein concentration of each cell lysate sample was measured with a Pierce\u0026trade; BCA Protein Assay kit (ThermoFisher Scientific, Waltham, MA, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEither reconstituted conditioned medium sample or cell lysate sample was prepared with 5X loading buffer, reduced with 0.5 M DTT, and boiled for 5 mins. Equal vol. of each medium sample or equal total proteins of cell lysate sample was loaded onto a 4% SDS-PAGE concentrating gel and proteins were separated in a 10% separating gel. After proteins were blotted onto a nitrocellulose membrane, 5% non-fat dry milk in 1X TBST was used to block the membrane. Proteins on the membrane were then probed with anti-MMP-1, or MMP-13, or ITGB1 antibody (Cell Signaling Technology\u0026trade;, Danvers, MA, USA) 1:1,000 dissolved in 5% BSA/TBST overnight at 4\u0026deg;C. After primary antibody incubation, the membrane was incubated in anti-rabbit IgG conjugated with HRP (Cell Signaling Technology\u0026trade;, Danvers, MA, USA) 1:3,000 diluted in 5% BSA/TBST for one hour at room temperature.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo visualize proteins bands, SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific, Waltham, MA, USA) was applied to the membrane and chemiluminescence signals were captured with the ChemiDoc\u0026trade; MP imaging system (BioRad, Hercules, CA, USA). Densitometric analysis of protein bands was performed with ImageJ. \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e7.\u0026nbsp;\u003c/em\u003e\u003cem\u003eDetermination of expression of ITGB1 or MMPs at mRNA level with real-time PCR\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAfter 24-hr stimulation, chondrocytes were lysed with TRIzol\u0026trade; Reagent (ThermoFisher Scientific, Waltham, MA, USA). Intracellular total RNAs were isolated with chloroform and purified with isopropanol and ethanol. Concentration and purity of each purified RNA sample were measured with a NanoDrop One/One\u003csup\u003eC\u003c/sup\u003e Microvolume UV-Vis spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). Up to 1,000 ng of total RNAs were reversely transcribed into cDNA with a PrimeScript\u0026trade; RT Master Mix (Perfect Real Time) kit (Takara Bio Inc., Shiga, Japan). Expression levels of MMPs-1, -13, and ITGB1 were measured with a FastStart Essential DNA Green Master kit (Roche LifeScience, Basel, Switzerland) and nucleotide sequence encoding 18S rRNA was used as a reference gene.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCt values of target genes were read and recorded with LightCycler 480\u0026nbsp;Ⅱ\u0026nbsp;(Roche LifeScience, Basel, Switzerland). All primers were synthesized by Exsyn-Biotechnology Co. Ltd. (Shanghai, China). The sequences of primers used for real time PCR experiments are listed in Table 2. The Ct values of MMPs-1, -13, and ITGB1 genes were compared to that of 18S rRNA, respectively. The relative mRNA expression level of each target gene was determined by 2\u003csup\u003e\u0026ndash;∆∆Ct\u003c/sup\u003e method.\u003c/p\u003e\n\u003cp\u003eTable 2. Primer sequences for target genes. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"652\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.69325153374233%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Genes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"75.30674846625767%\" colspan=\"2\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Sequences of primers\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.65543644716692%\" rowspan=\"2\"\u003e\n \u003cp\u003eMMP-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.65543644716692%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.68912710566616%\" valign=\"top\"\u003e\n \u003cp\u003eAGGCTGTATGAAGGAGAGGCTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.72357723577236%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"67.27642276422765%\" valign=\"top\"\u003e\n \u003cp\u003eAGTGTTGGCTGAGTGAAAGAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.65543644716692%\" rowspan=\"2\"\u003e\n \u003cp\u003eMMP-13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.65543644716692%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.68912710566616%\" valign=\"top\"\u003e\n \u003cp\u003eAGCATCTGGAGTAACCGTATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.72357723577236%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"67.27642276422765%\" valign=\"top\"\u003e\n \u003cp\u003eCCCGCACTTCTGGAAGTATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.65543644716692%\" rowspan=\"2\"\u003e\n \u003cp\u003eITGB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.65543644716692%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.68912710566616%\" valign=\"top\"\u003e\n \u003cp\u003eGGCAGTGCATGTGACTGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.72357723577236%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"67.27642276422765%\" valign=\"top\"\u003e\n \u003cp\u003eCTGAACACATTCTTTATGCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"24.65543644716692%\" rowspan=\"2\"\u003e\n \u003cp\u003e18S rRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.65543644716692%\" valign=\"top\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.68912710566616%\" valign=\"top\"\u003e\n \u003cp\u003eCGGCTACCACATCCAAGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.72357723577236%\" valign=\"top\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"67.27642276422765%\" valign=\"top\"\u003e\n \u003cp\u003eGCTGGAATTACCGCGGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003e8. Statistical analyses\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe difference of PG content expressed as mean (\u0026micro;g/mg wet cartilage) \u0026plusmn; standard deviation (S.D.) in each experimental group was compared to that in either PBS or control peptide treated group with unpaired t-test (t-Test: Two-Sample Assuming Equal Variances). The relative mRNA expression of MMPs or ITGB1 to 18S rRNA among experimental groups was calculated with 2\u003csup\u003e\u0026ndash; ∆∆Ct\u003c/sup\u003e method and the fold increase value was also compared by using unpaired t-test. The same test was employed to compare the difference of ITGB1 expression determined by gray values of protein bands among experimental groups. The difference between two compared groups is considered as statistically significant when P value is less than 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cem\u003e1. Telopeptides of type II collagen remarkably induced PG depletion from hip or knee cartilage, showing comparable catabolic effect as IL-1b and slightly stronger effect than helical peptide. \u0026nbsp;\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAfter 7 days of continuous stimulation by 30 \u0026micro;M NT, there was only 13.49 \u0026plusmn; 8.61 \u0026micro;g PG/mg wet cartilage remaining. This PG content was much lower than that in PBS (vehicle) treated (23.65 \u0026plusmn; 13.97 \u0026micro;g PG/mg wet cartilage; P = 0.131) or SN (control peptide) treated tissue (19.00 \u0026plusmn; 5.60 \u0026micro;g PG/mg wet cartilage; P = 0.162) (Figure 2A). Similarly, cartilage treated with 30 \u0026micro;M CT for 7 days only contained 12.96 \u0026plusmn; 5.38 \u0026micro;g PG/mg wet cartilage which was significantly lower than PG content in cartilage treated either with vehicle (P = 0.101) or control peptide (SC) (22.33 \u0026plusmn; 7.75 \u0026micro;g PG/mg wet cartilage; P = 0.047) (Figure 2B).\u003c/p\u003e\n\u003cp\u003eSurprisingly, in terms of causing PG depletion from cartilage, telopeptides showed slightly stronger effect than did IL-1b. Cartilage treated by IL-1b for 7 days still contained 16.84 \u0026plusmn; 7.01 \u0026micro;g PG/mg wet cartilage, a level slightly higher than that in tissue treated by either NT or CT. Peptide derived from the helical region of type II collagen (HP) also showed catabolic effect on cartilage. However, this effect was slightly weaker than either telopeptide based on PG content in cartilage treated by HP for 7 days (16.98 \u0026plusmn; 6.61 \u0026micro;g PG/mg wet cartilage) (Figure 2C).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e2. Strong expression of cartilage-damaging MMPs in femoral or tibial cartilage was induced by NT or CT at Day 4 post-treatment and the effect was still obvious at Day 7 post-treatment.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eOne day prior to the beginning of the experiments, i.e. pre-equilibration Day -1, neither MMP-3 nor MMP-13 protein band was clearly detected in conditioned media collected from femoral head cartilage (male, 71 YO, diagnosed as femoral neck fracture) cultures in all experimental groups. However, at Day 4 post-treatment with NT or CT, strong MMP-3 or MMP-13 signal was observed in conditioned media. By contrast, neither of this signal was detectable in control groups. Although at Day 7 post-treatment MMP-3 or -13 signal was seemingly weaker in conditioned media of cultures treated with NT or CT than that at Day 4 post-treatment, the strength of either signal was still much stronger than that in the control groups (Figure 3A\u0026amp;B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSimilar results were observed in cultures of cartilage from tibial plateau of a 77-years male patient diagnosed with late stage knee OA (Figure 3C\u0026amp;D). We also examined the effect of telopeptides on MMP up-regulation in femoral head cartilage of a 68 years female patient diagnosed with femoral head necrosis and found results described above were reproducible (Supplemental Figure 1A\u0026amp;B). \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn order to verify that those up-regulated MMPs in conditioned media was produced by chondrocytes in cultured cartilage slices, we deliberately killed all chondrocytes in some cartilage slices by repeating freeze-thawing cycle 3 times (freezing cartilage slices at -80\u0026deg;C for 3 min and then thawing them at 37\u0026deg;C for 5 min). At Day 4 post-treatment by telopeptides, MMP-3 signal was only detected in live cartilage slices treated with NT or CT while the signal was undetectable in freeze-thawed cartilage slices treated with NT or CT (Supplemental Figure 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn chondrocyte monolayer cultures, we did not observe increased MMP mRNA expression at 24-hr post-treatment by NT or CT. However, in conditioned media collected at the same time point, we observed significant up-regulation of MMPs-3\u0026amp;13 in NT or CT treated samples (Supplemental Figure 3A-F). \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e3. The effect of telopeptides on MMP up-regulation was still weaker than that of IL-1b. HP could also up-regulate MMP expression and this effect was comparable to telopeptides.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWe compared the effect of telopeptides on MMP up-regulation in cartilage cultures to that of IL-1b which is a well-studied pro-inflammation factor in OA pathogenesis. At Day 4 or 7 post-treatment, the strongest MMP-3 or -13 signal was detected in cartilage treated with 10 ng/mL rhIL-1b while MMP signals in NT or CT treated cartilage cultures were moderately weaker but with similar strength (Figure 4).\u003c/p\u003e\n\u003cp\u003eInterestingly, we also observed that peptide derived from the helical region of type II collagen (HP) up-regulated expression of MMP-3 or -13 in cartilage cultures at Day 4 or 7 post-treatment. Seemingly, when compared to telopeptides, HP showed slightly stronger effect on up-regulating MMP-13 expression while slightly weaker effect on up-regulating MMP-3 expression (Figure 4). \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4. Expression of type II collagen membrane receptor, ITGB1, in chondrocytes was moderately elevated by CT but not by NT stimulation. The effect of CT on up-regulation of ITGB1 was comparable to that of IL-1b.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWhen examined at 24-hr post-treatment, the mRNA expression level of ITGB1 in chondrocytes treated with NT was similar to that in non-treated control cells or treated with vehicle reagent or scrambled control peptide (N = 5; Figure 5A). However, in CT-treated chondrocytes ITGB1 expression was elevated by 2.1-fold in average compared to that in non-treated controls (N = 3; P = 0.096; Figure 5B). This effect of CT was even slightly stronger than IL-1b which increased ITGB1 expression by 1.54-fold compared to non-treated controls (N = 2; Figure 5C). As a peptide derived from the helical region of collagen type II, HP exhibited little effect on ITGB1 expression at mRNA level, which was similar to NT (N = 3; Figure 5C). Nonetheless, either NT or CT could moderately increase ITGB1 protein expression at 24-hr post-treatment (Figure 5B). \u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe are the first to report that telopeptides derived from collagen type II could cause significant PG loss from femoral or tibial cartilage of patients who received total joint replacement surgery. This telopeptide-induced cartilage damage was accompanied by up-regulated expression of MMPs-3\u0026amp;-13, two MMPs heavily involved in osteoarthritic cartilage degradation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. These results were consistent with what Guo and colleagues reported in a study that employed bovine articular cartilage harvested from metacarpophalangeal joints [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Furthermore, we also discovered that the telopeptide derived from the C-terminus of collagen type II could obviously up-regulate expression of ITGB1 which is a major membrane receptor for the native protein, implying that this receptor might mediate the action of C-telopeptide.\u003c/p\u003e \u003cp\u003eIn our human cartilage tissue cultures, we discovered that either telopeptide at 30 \u0026micro;M could induce remarkable PG depletion from the tissue after a 7-day continuous treatment. This dramatic effect of telopeptides was previously observed in bovine cartilage tissue cultures by Guo and colleagues. Their 6-day dose-response experiments indicated that NT or CT at 30 \u0026micro;M exhibited the strongest PG-depletion effect [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. That was why we tested this dose in our human cartilage cultures. Although we only observed statistically significant PG loss in CT-treated cartilage, PG content in NT-treated cartilage was still 5\u0026ndash;10 \u0026micro;g PG/mg wet cartilage lower than that in controls. The higher P values observed in NT group might be due to limited sample size and large standard deviation caused by individual difference.\u003c/p\u003e \u003cp\u003eAn earlier study conducted by Jennings et al. revealed that bovine collagen type II fragment mixture generated by bacterial collagenase could induce significant PG loss in human ankle or knee cartilage explant after 3-week culturing. The authors stated that their bovine collagen fragment mixture was enriched in N- or C-telopeptides and the MW was smaller than 10 kDa [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The effective dose of this fragment mixture was 1 mg/mL, equivalent to 200 \u0026micro;M if calculated with 5 kDa as average MW. However, this study did not use defined telopeptide of collagen type II as what we did in our study. We clearly showed that N-telopeptide corresponding to residues 182 to 212 or C-telopeptide corresponding to residues 1218 to 1241 of alpha1 chain of human collagen type II had cartilage-damaging bioactivity. Furthermore, we detected this catabolic activity of telopeptides on cartilage at one week of treatment, which was two weeks earlier than what they reported. Lastly, we examined the effect on cartilage of Asian patients diagnosed with femoral neck fracture, hip osteonecrosis or knee osteoarthritis which was not studied by them. They harvested macroscopically normal knee or ankle cartilage from three Caucasian corpses with a wider range of age (39\u0026ndash;71 years).\u003c/p\u003e \u003cp\u003eIn order to explore the mechanism by which NT or CT induced cartilage damage, we examined the levels of two MMPs that can cause PG depletion and are heavily involved in OA pathogenesis, MMPs-3 and \u0026minus;\u0026thinsp;13 [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], in conditioned media harvested from cartilage explant cultures. Compared to medium samples collected at one day prior to telopeptide treatments that showed little MMP signal, samples at Day 4 or 7 post-treatment with either NT or CT showed not only detectable but also much stronger signals of MMPs-3 and \u0026minus;\u0026thinsp;13. The up-regulation of those two MMPs by telopeptides was also observed in the conditioned media of our human chondrocyte monolayer cultures at 24-hr post-treatment, a much earlier time point than that in cartilage cultures. This faster response of chondrocytes in monolayer cultures than in cartilage cultures might be due to lesser ECM surrounding the cell, which enabled faster penetration of telopeptides through ECM to reach to chondrocytes. Since those two MMPs have proved to be the driving force for cartilage PG depletion, this observation well explained why NT or CT induced significant loss of PG from cartilage ECM at Day 7 post-treatments observed in our study.\u003c/p\u003e \u003cp\u003eIn earlier studies, NT or CT induced up-regulation of MMPs in conditioned media was only observed in cartilage explant cultures established from bovine metacarpophalangeal joints or human healthy ankle joints. They did not examine this effect of those two telopeptides on OA-prone or OA cartilage derived from human hip or knee joints that was used in our study [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Moreover, Guo et al. reported that NT or CT at 30 \u0026micro;M could stimulate significant MMPs-3\u0026amp;13 release from bovine cartilage at 1-day post-treatment [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. We discovered that the same dose of those two telopeptides could greatly up-regulate MMP expression in human chondrocytes at Day 4 post-treatment and this effect could still be detected at Day 7. Fichter and colleagues only reported the dose-dependent effect of NT on MMP-3 induction in human healthy ankle cartilage cultures. The highest dose they examined was around 300 \u0026micro;M. But this dose induced less MMP-3 release than did 30 \u0026micro;M, which implied that 30 \u0026micro;M might be the most effective dose in terms of inducing MMP-3 up-regulation in human chondrocytes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFurthermore, we discovered that a peptide derived from the triple helical region of collagen type II (HP) could also induce up-regulation of MMPs-3\u0026amp;13 but with lesser effect when compared to telopeptides. This result may explain why HP induced lesser PG loss from cartilage explants than did NT or CT in our 7-day experiments. However, in terms of up-regulating those two MMPs, either telopeptides or HP still showed much weaker effect than did IL-1b. Up-regulated MMPs-3 and \u0026minus;\u0026thinsp;13 by IL-1b may cleave cartilage ECM collagen type II to generate bioactive telopeptides and HP which can induce more MMPs [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. By contrast, neither of the telopeptides could induce IL-1b expression in bovine chondrocyte cultures [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Therefore, the accumulated action of IL-1b and collagen fragments was certainly stronger than that of any collagen fragment working alone.\u003c/p\u003e \u003cp\u003eNext, we examined the effect of those collagen fragments on expression levels of major membrane receptors for collagen type II in order to test our hypothesis that the proinflammatory action of telopeptides or HP was mediated by receptors for their native protein. Integrins are membrane receptors for cartilage ECM proteins and each integrin is a heterodimer composed of an alpha and a beta subunit. Studies have shown that ITGB1 family are major membrane receptors for collagen type II in human articular cartilage and its expression level is elevated in osteoarthritic cartilage [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, we only observed moderate elevation of ITGB1 protein expression in human articular chondrocytes after 24-hr treatment by CT. This observation implied that the catabolic action of CT might be mediated by ITGB1 while the action of NT or HP might be mediated by membrane receptors other than integrins.\u003c/p\u003e \u003cp\u003eOur observation was consistent with what Lucic and colleagues had reported in a study examining how those synthetic peptides derived from collagen type II interacted with chondrocytes. By applying those peptides to chondrocytes isolated from human talus cartilage, they discovered that annexin V, a calcium ion channel on chondrocyte membrane, were most likely the binding receptor for NT while ITGB1 family were receptors for CT or HP [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In our study, we examined the expression level of ITGB1 in chondrocytes treated with CT at 24 hr post-treatment which might not be ITGB1\u0026rsquo;s peak expression time point. This may explain why only moderate elevation of ITGB1 expression was observed in our study. In future studies, samples collected at earlier time points, such as 4-hr, 8-hr, 12-hr post-treatment, will be examined for ITGB1 expression at both mRNA and protein level.\u003c/p\u003e \u003cp\u003eIn summary, we established human articular cartilage explant cultures and primary human chondrocyte monolayer cultures to test our hypothesis that telopeptides derived from human collagen type II could induce osteoarthritic cartilage damage by depleting PG content from the tissue and up-regulating MMP expression. This catabolic action could be mediated by membrane receptors for the native protein of those telopeptides. Our data supported this hypothesis by revealing that remarkable PG loss was induced by NT or CT at 7-D post-treatment and significant up-regulation of MMPs-3\u0026amp;13 was induced at 4-D and 7-D post-treatment. At 24-hr post-treatment, ITGB1 expression was elevated by CT but not by NT, implying that the catabolic action of CT might be mediated by ITGB1. Future studies will determine whether annexin V mediates the catabolic action of NT.\u003c/p\u003e \u003cp\u003eHere, we would like to clarify that the No. 195 amino acid in the sequence of NT used in this study was Gly (G) which should be Gln (Q) according to protein database (GenBank: KAI4065584.1 or UniProtKB/Swiss-Prot: P02458.3). We cited this amino acid sequence from a published paper authored by Guo et al [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This sequence was also used for synthesizing NT in a study conducted by Chowdhury et al. They observed similar catabolic effect of NT on porcine cartilage to what we observed in human cartilage [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. This indicated that the Q to G substitution at No. 195 position of NT primary structure did not affect the secondary structure of this peptide. This may be explained by the non-polar nature shared by those two amino acids. The corrigendum regarding to this NT amino acid sequence error will be published in Inflammation Research journal in which the original paper containing this amino acid sequence error was published.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u0026nbsp;\u003c/strong\u003eWe thank staff of Medical Research Facilities at Jiangnan University Wuxi College of Medicine for providing us technical assistances.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u0026nbsp;\u003c/strong\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding: \u0026nbsp;\u003c/strong\u003eThis work was supported by the Postgraduate Research \u0026amp; Practice Innovation Program of Jiangsu Province grant (KYCX22_2437) awarded to Jiamin Mao and by the Jiangsu Provincial Natural Science Foundation of China grant awarded to Lei Ding (BK20171143).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u0026nbsp;\u003c/strong\u003eThe authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eOuyang Z, Dong L, Yao F, Wang K, Chen Y, Li S, et al. Cartilage-Related Collagens in Osteoarthritis and Rheumatoid Arthritis: From Pathogenesis to Therapeutics. Int J Mol Sci 2023; 24.\u003c/li\u003e\n \u003cli\u003eVina ER, Kwoh CK. Epidemiology of osteoarthritis: literature update. Curr Opin Rheumatol 2018; 30:160-167.\u003c/li\u003e\n \u003cli\u003eMatyas JR, Atley L, Ionescu M, Eyre DR, Poole AR. Analysis of cartilage biomarkers in the early phases of canine experimental osteoarthritis. Arthritis Rheum 2004; 50:543-52.\u003c/li\u003e\n \u003cli\u003eDam EB, Byrjalsen I, Karsdal MA, Qvist P, Christiansen C. Increased urinary excretion of C-telopeptides of type II collagen (CTX-II) predicts cartilage loss over 21 months by MRI. Osteoarthritis Cartilage 2009; 17:384-9.\u003c/li\u003e\n \u003cli\u003eJennings L, Wu L, King KB, Hammerle H, Cs-Szabo G, Mollenhauer J. The effects of collagen fragments on the extracellular matrix metabolism of bovine and human chondrocytes. Connect Tissue Res 2001; 42:71-86.\u003c/li\u003e\n \u003cli\u003eFichter M, Korner U, Schomburg J, Jennings L, Cole AA, Mollenhauer J. Collagen degradation products modulate matrix metalloproteinase expression in cultured articular chondrocytes. J Orthop Res 2006; 24:63-70.\u003c/li\u003e\n \u003cli\u003eLucic D, Mollenhauer J, Kilpatrick KE, Cole AA. N-telopeptide of type II collagen interacts with annexin V on human chondrocytes. Connect Tissue Res 2003; 44:225-39.\u003c/li\u003e\n \u003cli\u003eGene AH, Lei D, Danping G. Extracellular Matrix Fragments as Regulators of Cartilage Metabolism in Health and Disease. Current Rheumatology Reviews 2007; 3:183-196.\u003c/li\u003e\n \u003cli\u003eGuo D, Ding L, Homandberg GA. Telopeptides of type II collagen upregulate proteinases and damage cartilage but are less effective than highly active fibronectin fragments. Inflamm Res 2009; 58:161-9.\u003c/li\u003e\n \u003cli\u003eXiong L, Cui M, Zhou Z, Wu M, Wang Q, Song H, et al. Primary culture of chondrocytes after collagenase IA or II treatment of articular cartilage from elderly patients undergoing arthroplasty. Asian Biomedicine 2021; 15:91-99.\u003c/li\u003e\n \u003cli\u003eMao J, Huang L, Ding Y, Ma X, Wang Q, Ding L. Insufficiency of collagenases in establishment of primary chondrocyte culture from cartilage of elderly patients receiving total joint replacement. Cell Tissue Bank 2023; 24:759-768.\u003c/li\u003e\n \u003cli\u003eBurrage PS, Mix KS, Brinckerhoff CE. Matrix metalloproteinases: role in arthritis. Front Biosci 2006; 11:529-43.\u003c/li\u003e\n \u003cli\u003eHu Q, Ecker M. Overview of MMP-13 as a Promising Target for the Treatment of Osteoarthritis. Int J Mol Sci 2021; 22.\u003c/li\u003e\n \u003cli\u003ePlsikova Matejova J, Spakova T, Harvanova D, Lacko M, Filip V, Sepitka R, et al. A Preliminary Study of Combined Detection of COMP, TIMP-1, and MMP-3 in Synovial Fluid: Potential Indicators of Osteoarthritis Progression. Cartilage 2021; 13:1421S-1430S.\u003c/li\u003e\n \u003cli\u003eYasuda T, Tchetina E, Ohsawa K, Roughley PJ, Wu W, Mousa A, et al. Peptides of type II collagen can induce the cleavage of type II collagen and aggrecan in articular cartilage. Matrix Biol 2006; 25:419-29.\u003c/li\u003e\n \u003cli\u003eLoeser RF. Chondrocyte integrin expression and function. Biorheology 2000; 37:109-16.\u003c/li\u003e\n \u003cli\u003eLoeser RF, Carlson CS, McGee MP. Expression of beta 1 integrins by cultured articular chondrocytes and in osteoarthritic cartilage. Exp Cell Res 1995; 217:248-57.\u003c/li\u003e\n \u003cli\u003eChowdhury TT, Schulz RM, Rai SS, Thuemmler CB, Wuestneck N, Bader A, et al. Biomechanical modulation of collagen fragment-induced anabolic and catabolic activities in chondrocyte/agarose constructs. Arthritis Res Ther 2010; 12:R82.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Telopeptides, Collagen, Cartilage, MMPs, Chondrocytes, Total arthroplasty","lastPublishedDoi":"10.21203/rs.3.rs-5086390/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5086390/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjective and design:\u003c/strong\u003e To determine whether telopeptides of collagen type II could induce osteoarthritic cartilage damage via receptor for the native protein by using human articular cartilage.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterial or subjects:\u003c/strong\u003e Cartilage slices were harvested from patients receiving total arthroplasty.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTreatment: \u003c/strong\u003eCartilage tissue cultures or primary chondrocyte cultures were treated with 30 µM N- or C-telopeptide (NT or CT) for 7 days or for 24 hrs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e Loss of proteoglycan (PG) from cartilage were evaluated with DMMB assay. Conditioned media or cell lysates were measured for levels of MMPs-3\u0026amp;13 or integrin beta1 (ITGB1) with Western blotting or real-time PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Both NT and CT could induce significant loss of PG from cartilage than controls (12.96 ± 5.38 µg PG/mg wet cartilage in CT group vs. 22.33 ± 7.75 µg PG/mg wet cartilage in scrambled CT group; P = 0.047). Up-regulation of MMPs-3 \u0026amp;13 was induced by either NT or CT at 24 hr (chondrocyte cultures) or Days 4 and 7 post-treatment (cartilage cultures). CT induced stronger expression of ITGB1 in chondrocytes than did NT.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eTelopeptides of collagen type II could damage human articular cartilage and up-regulate MMPs-3 and -13. The proinflammatory effect of CT might be mediated by ITGB1.\u003c/p\u003e","manuscriptTitle":"Proinflammatory effect of telopeptides derived from collagen type II on articular cartilage of patients receiving total arthroplasty","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-02 15:09:04","doi":"10.21203/rs.3.rs-5086390/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"becfa315-f59d-4ae7-8fca-dccaffa106c0","owner":[],"postedDate":"October 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-02T15:09:04+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-02 15:09:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5086390","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5086390","identity":"rs-5086390","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}