Abelson kinase’s intrinsically disordered linker plays important roles in protein function and protein stability

Abelson kinase’s intrinsically disordered linker plays important roles in protein function and protein stability | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Abelson kinase’s intrinsically disordered linker plays important roles in protein function and protein stability Edward M. Rogers , S. Colby Allred , View ORCID Profile Mark Peifer doi: https://doi.org/10.1101/2020.05.20.106708 Edward M. Rogers * Department of Biology, University of North Carolina at Chapel Hill , Chapel Hill, NC 27599, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site S. Colby Allred * Department of Biology, University of North Carolina at Chapel Hill , Chapel Hill, NC 27599, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mark Peifer * Department of Biology, University of North Carolina at Chapel Hill , Chapel Hill, NC 27599, USA † Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill , Chapel Hill, NC 27599, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Mark Peifer For correspondence: peifer{at}unc.edu Abstract Full Text Info/History Metrics Preview PDF Abstract The non-receptor tyrosine kinase Abelson (Abl) is a key player in oncogenesis, with kinase inhibitors serving as paradigms of targeted therapy. Abl also is a critical regulator of normal development, playing conserved roles in regulating cell behavior, brain development and morphogenesis. Drosophila offers a superb model for studying Abl’s normal function, because, unlike mammals, there is only a single fly Abl family member. Abl has multiple roles in embryonic morphogenesis, and we and others have begun to take Abl apart as a machine. This revealed many surprises. For instance, kinase activity, while important, is not crucial for all Abl activities, and the C-terminal F-actin binding domain plays a very modest role. This turned our attention to less well-known feature—the long intrinsically-disordered region (IDR) linking Abl’s kinase and F-actin binding domains. The past decade revealed unexpected, important roles for IDRs in diverse cell functions, by mediating multivalent interactions, enabling assembly of biomolecular condensates via phase separation. Previous work deleting conserved regions revealed an important role for a PXXP motif in the IDR, but did not identify any other essential regions. Here we extend this, deleting the entire IDR. This revealed essential roles for the IDR in embryonic and adult viability, and in cell shape changes and cytoskeletal regulation during embryonic morphogenesis. Strikingly, AblΔIDR acts as dominant negative, worsening the phenotype of the null mutant. AblΔIDR accumulates at >10-fold higher levels than wildtype Abl in both Drosophila embryos and cultured cells, suggesting important roles for the IDR in modulating protein stability. Introduction Biomedical research has dual goals: to uncover mechanisms underlying normal cellular function and to apply this understanding to develop better treatments in human disease. Perhaps no story better illustrates this than the discovery more than 60 years ago of the “Philadelphia chromosome”, a translocation between chromosomes 9 and 22 present only in leukocytes from patients with chronic myelogenous leukemia. It provided the first molecular link between genetics and cancer, and ultimately led to the realization that Abelson kinase (Abl) is the initiating oncogene in many cases of chronic myelogenous and acute lymphoblastic leukemia ( R en 2005 ). These translocations fuse the Bcr and Abl genes, removing a myristoylation sequence at Abl’s N-terminus that inhibits kinase activation, rendering the kinase constitutively active. Drugs targeting Abl kinase activity like Gleevec (Imatinib) have emerged as paradigms of targeted therapy ( S awyers et al . 2002 ; T alpaz et al . 2002 ), and spurred development of similar inhibitors of other oncogenic kinases. Of course, non-receptor tyrosine kinases like Src and Abl kinases did not evolve to cause cancer. Both play key roles in signal transduction, regulating embryonic development and tissue homeostasis. Abl family members regulate morphogenetic movements during embryogenesis in both mammals and Drosophila, and also play key roles in neural development, axon outgrowth, and synaptogenesis (reviewed in ( M oresco and K oleske 2003 ; B radley and K oleske 2009 ; K hatri et al . 2016 ; K annan and G iniger 2017 ). They act downstream of diverse receptors, including receptor tyrosine kinases or receptor serine/threonine kinases, as well as the cell-matrix and cell-cell adhesion receptors, integrins and cadherins. Downstream, Abl family members activate cytoskeletal effectors to directly regulate cell behavior, though transcriptional effectors are also important. Abl’s structure facilitates the link between cell signaling and cytoskeletal regulation. All Abl family members share a highly conserved set of N-terminal domains with Src ( Fig. 1A ). These include a Src homology 2 (SH2) domain that binds specific peptides carrying a phosphorylated tyrosine and an SH3 domain that binds specific proline-rich peptides, both allowing interactions with upstream receptors and downstream effectors. These are immediately followed by the conserved tyrosine kinase domain ( C olicelli 2010 ). However, unlike Src, Abl family members have long C-terminal extensions, with a C-terminal F-actin-binding domain (FABD) separated from the N-terminal module by a long, poorly conserved linker that is predicted to be intrinsically disordered (the intrinsically disordered region or IDR). Different family members share peptide motifs within the IDR that bind or are predicted to bind actin, microtubules, Ena/VASP family members, and SH3 domain containing proteins. The only peptide motif in the IDR clearly conserved between mammals and Drosophila is a PXXP motif that in mammals binds both SH2/SH3 adapters like Crk and NCK and the actin regulator Abl interacting protein (Abi) ( H ossain et al . 2012 ; G regor et al . 2019 ). Download figure Open in new tab Figure 1. Generating AblΔIDR and testing its ability to rescue adult and embryonic viability. A. Diagram of human Abl and Arg and Drosophila Abl, showing conserved domains/motifs as well as motifs in the IDR that vary between family members. B. Illustration of the mutant Abl proteins we previously tested and our new AblΔIDR mutant. It was designed to remove essentially the entire IDR, leaving only a few amino acids at each end to ensure we did not disrupt folding of the kinase domain or FABD. A 15 aa flexible linker was added in its place. C. Assessment of the ability of AblΔIDR to rescue the viability of abl 4 /DfAbl adults, normalized to rescue by our wildtype Abl transgene, and compared to rescue by some of our previously tested mutants. Full data sets with statistical significance for C-E are in Table 1 . D. Assessment of the ability of AblΔIDR to rescue embryonic viability of the progeny of abl 4 /DfAbl females mated to abl 4 /+ males, compared to rescue by some of our previously tested mutants. Line indicates 100% embryonic viability. E. Assessment of the ability of AblΔIDR to rescue embryonic viability of the progeny females with germlines homozygous for of abl 4 mated to abl 4 /+ males, compared to rescue by some of our previously tested mutants. Line indicates degree of rescue by our wildtype Abl transgene. Mammals have two Abl family members, Abl and Abl-related gene (Arg), with partially redundant functions in development and tissue homeostasis. Abl single mutant mice die neonatally with thymic and splenic atrophy, T and B cell lymphopenia, osteoporosis, and cardiac defects ( S chwartzberg et al . 1991 ; T ybulewicz et al . 1991 ; H ardin et al . 1995 ; H ardin et al . 1996 ; L i et al . 2000 ; Q iu et al . 2010b ). Conditional knockout confirmed roles in T cells ( Z ipfel et al . 2004 ; G u et al . 2007 ; H uang et al . 2008 ). Arg single mutant mice are viable with grossly normal brains, but exhibit multiple behavioral defects ( K oleske et al . 1998 ), likely linked to a reduced ability to maintain dendrites ( L in et al . 2013 ). Arg mutants also exhibit subtle defects in muscle development ( L ee et al . 2017 ). In contrast, loss of both Abl and Arg leads to embryonic lethality at day 11, with a failure to complete neural tube closure. Conditional double knockout has revealed additional important redundant roles in cerebellar ( Q iu et al . 2010a ), cerebral ( M oresco et al . 2005 ), and endothelial development and barrier function ( C hislock and P endergast 2013 ; C hislock et al . 2013 ). View this table: View inline View popup Download powerpoint Table 1. Drosophila has a single Abl family member, simplifying analysis of its roles in development. In the 1980s Michael Hoffmann and his lab identified the first mutations in fly Abl, as part of a pioneering effort to define the normal roles of human oncogenes ( H enkemeyer et al . 1987 ). Others built on these early efforts. Like its mammalian homologs, Abl plays important roles in embryonic and postembryonic neural development, with Abl acting downstream of diverse axon guidance receptors, including DCC/Frazzled, Robo, Plexin, Eph, and Notch (reviewed in ( K annan and G iniger 2017 ). Genetic and cell biological analyses also revealed Abl’s downstream effectors, the most prominent of which is Enabled (Ena), which binds the growing end of actin filaments and promotes their elongation. Abl negatively regulates Ena ( G ertler et al . 1990 ), through a mechanism that remains unclear. Trio, a GTP exchange factor (GEF) for the small GTPase Rac, is also an Abl effector. Subsequent analysis of embryos lacking both maternal and zygotic Abl revealed additional roles outside of the nervous system. Abl regulates diverse events ranging from the actin-dependent cellularization process, to apical constriction of mesoderm precursors, cell intercalation during germband elongation, and collective cell migration during germband retraction, dorsal closure, and head involution ( G revengoed et al . 2001 ; G revengoed et al . 2003 ; F ox and P eifer 2007 ; T amada et al . 2012 ). In these events, regulation by and of the cadherin-based cell adhesion machinery plays a role, while Ena remains a critical downstream target ( G revengoed et al . 2001 ; G revengoed et al . 2003 ; F ox and P eifer 2007 ). Abl kinase activity has been a focus of much attention, particularly after the success of Abl kinase inhibitors in the treatment of leukemia. However, the simplistic picture of Abl as a kinase acting solely by phosphorylating downstream proteins rapidly proved inaccurate. Kinase-dead Abl rescues defects in both adult viability and retinal development ( H enkemeyer et al . 1990 ). Analysis of its role in embryonic development suggests kinase activity is important for roles in both axon patterning and in morphogenesis, but a kinase-dead mutant retains significant residual function ( O ’donnell and B ashaw 2013 ; R ogers et al . 2016 ). More limited analysis implicated the SH2 domain in axon guidance ( O ’donnell and B ashaw 2013 ). The extended C-terminal region of Abl, including both the IDR and the C-terminal FABD, is essential for function, as abl 1 , which encodes a stable protein truncated soon after the kinase domain, behaves genetically as a null allele ( H enkemeyer et al . 1987 ). Similar results were seen in mice where a truncated protein resembled the null ( S chwartzberg et al . 1991 ; T ybulewicz et al . 1991 ). The simplest explanation would be that this reflected an essential function of the FABD. However, surprisingly Abl lacking the FABD fully rescues viability and fertility, though detailed analysis of axon patterning and synergistic effects with loss of kinase activity suggest the FABD does play a supporting role ( O ’donnell and B ashaw 2013 ; R ogers et al . 2016 ; C heong and V anberkum 2017 ). These data opened up potential roles for the IDR. The past decade revealed unexpected and important roles for IDRs in diverse cell functions ( O ldfield and D unker 2014 ), through their ability to mediate multivalent interactions, including those enabling assembly of “biomolecular condensates”. These condensates organize proteins and RNAs into non-membrane bound cellular compartments that perform diverse functions, ranging from regulating transcription to RNA processing/RNP assembly to the DNA damage response to cellular signaling ( B anani et al . 2017 ; H olehouse and P appu 2018 ). Biomolecular condensates assemble by multivalent interactions among their protein and RNA components, leading to “phase separation”. While not all proteins containing IDRs have been shown to form biomolecular condensates, intriguingly proteins containing SH2 and SH3 domains were among the first proteins shown to assemble by this mechanism ( L i et al . 2012 ), and Abl clearly can assemble into a large macromolecular complex (e.g. ( G regor et al . 2019 ). Abl’s IDR is not highly conserved in primary sequence, even between the two mammalian paralogs ( Fig. 1A ). Only a single peptide is conserved among fly and mammalian family members—the PXXP SH3-domain binding motif in the N-terminal quarter of the IDR. Other peptide motifs, including a predicted Ena binding site, are conserved over shorter phylogenetic distances; e.g., among insect Abl proteins. There are also functional motifs present only in single family members, including the microtubule and second actin interaction sites in mammalian Arg ( M iller et al . 2004 ; C ourtemanche et al . 2015 ). Two groups assessed the function of the Drosophila Abl IDR, taking different approaches. Our lab individually deleted short conserved regions of 12–56 amino acids (conserved regions 1 to 4 (CR1-CR4)), in the context of a GFP-tagged full length Abl protein driven by its endogenous promotor ( Fig. 1B ). We measured rescue of embryonic and adult viability, morphogenetic movements in the embryo, and axon outgrowth in the embryonic central nervous system ( R ogers et al . 2016 ). Cheong and VanBerkum took a more comprehensive approach, deleting successively smaller fractions of the C-terminal region, including the FABD. They began by dividing it in half, then in quarters and then focused in on two smaller regions, with smaller deletions and point mutations. They expressed their mutant proteins in the background of zygotic abl mutants using the GAL4-UAS system and assessed rescue of axon pathfinding ( C heong and V anberkum 2017 ). Both approaches led to similar surprising conclusions. Only a single region of the IDR plays a major role in Abl function—the region containing the conserved PXXP motif. Surprisingly, however, this motif was extremely important, as its deletion caused as reduced Abl function more than loss of kinase activity or even loss of both kinase activity and the FABD. Subsequent analyses support the idea that this motif acts by interactions with the adapter protein Crk ( S pracklen et al . 2019 ) and with the actin-regulatory WAVE-regulatory complex ( C heong et al . 2020 ). The fine-grained dissections of the IDR by Cheong and VanBerkum suggest other regions of the IDR may have more subtle roles in axon guidance. Our initial analyses did not fully probe the function of the IDR, as perhaps the simplest test of its function—completely deleting the IDR while leaving the FABD intact—was missed. We thus generated a mutation cleanly removing the IDR in the context of a GFP-tagged Abl construct driven by its endogenous promotor. This revealed surprising dominant-negative activity of AblΔIDR and a potential role for the IDR in regulation of Abl protein stability. These observations provide important insights into Abl function. Results Creating a mutant to test the role of the IDR in Abl function Abl is a multidomain protein which uses both its kinase activity and its protein interaction domains to create a signaling hub, integrating upstream signals and activating downstream effectors. Our lab previously created a series of abl mutants to assess the role of kinase activity and other domains and motifs in Drosophila ( Fig. 1B ; ( R ogers et al . 2016 ). The base construct was a P-element transgene containing a wild type abl gene driven by a 2kb fragment of the 5’ upstream endogenous abl promoter (Tn Abl WT:GFP), which can fully rescue ablMZ mutant embryos ( F ox and P eifer 2007 ). This construct has a C-terminal GFP tag that does not impair its rescuing ability, and which allows direct visualization of Abl localization in live embryos. These included mutants deleting short conserved regions in the IDR (AblΔCR1-ΔCR4, Fig 1B ), but we did not fully remove the IDR to assess its full set of roles. To do so, here we created a similar transgene that essentially deletes the entire IDR—below we refer to this as AblΔIDR ( Fig. 1B ; amino acids 679-1398 are deleted; see Methods for details). We added a 15 amino acid flexible linker (GGS) 5 ) in place of the IDR to reduce the likelihood of disrupting folding of the adjacent kinase domain and FABD ( V an R osmalen et al . 2017 ). We introduced this transgene into the Drosophila genome in two ways—by P element-based transformation (selecting an insertion on then second chromosome), and by site-specific integration on the left arm of the 2nd chromosome (at 22A3). We then used these transgenes to assess the roles of the IDR in Abl function. AblΔIDR does not rescue adult viability and has apparent dominant negative effects on embryonic morphogenesis Because of its critical roles in embryonic morphogenesis and neuronal development, Abl is essential for both embryonic and adult viability ( H enkemeyer et al . 1987 ; G revengoed et al . 2001 ). The ability to rescue viability thus offered an initial test for our AblΔIDR mutant protein. Abl is maternally contributed and this maternal contribution is sufficient for embryonic development ( G revengoed et al . 2001 ). However, most abl null mutants die as pupae—the few that escape are functionally sterile and die soon after eclosing ( H enkemeyer et al . 1987 ). We thus tested the ability of AblΔIDR to rescue adults that were heterozygous for the putative null allele abl 4 ( F ox and P eifer 2007 ) and a Deficiency, Df(3L)st-7 Ki . that removes the abl gene ( abl 4 /Df ), as we had for our earlier mutants ( R ogers et al . 2016 ). A targeted transgene encoding AblΔIDR provided partial but incomplete rescue of adult viability. While unrescued abl 4 /Df adults had only 20% the viability of those rescued by our wildtype abl transgene, AblΔIDR; abl 4 /Df adults eclosed at 48% the rate of those rescued by the wildtype transgene ( Fig.1C ; Table 1 ). In contrast, AblΔFABD fully rescued adult viability, and even a mutant lacking both kinase activity and the FABD provided substantial rescue ( R ogers et al . 2016 ); 82% of the wildtype transgene). However, AblΔCR1, lacking the PXXP motif in the IDR, did not provide substantial rescue (31% viability relative to the wildtype transgene; Fig. 1C ; Table 1 ; ( R ogers et al . 2016 ). These data suggest that the IDR is important for Abl function. Unlike the abl 4 /Df escapers, AblΔIDR; abl 4 /Df females lived long enough to mate and produce fertilized eggs. We thus asked whether AblΔIDR rescued the lethality of embryos lacking both maternal and zygotic Abl, by crossing these females to males who were heterozygous for abl 4 /+ and carried the transgene. AblΔIDR did not rescue the viability of maternal/zygotic mutants (50% of the progeny), and, surprisingly, even 30% of embryos that inherited a paternal zygotic wildtype abl gene died before hatching and the rest (20%) died as first instar larvae ( Fig. 1D , Table 1 ). In contrast, AblΔFABD provided full rescue of embryonic viability ( Fig. 1D ; Table 1 ; ( R ogers et al . 2016 ). To roughly assess the rescue of embryonic morphogenesis by AblΔIDR, we examined the cuticles of the dead embryos. To our surprise, the cuticle phenotype was extremely severe, with all embryos exhibiting strong disruption of epidermal integrity, including those in which only fragments of cuticle were secreted ( Fig. 2A vs B-D). These morphogenetic phenotypes are more severe than those characteristically seen in abl maternal/zygotic mutant embryos ( G revengoed et al . 2001 ; R ogers et al . 2016 ). However, the limitations of this approach are that since unrescued abl 4 /Df mutant females are sterile, we could not compare embryonic morphogenesis of their progeny to those rescued by AblΔIDR. Download figure Open in new tab Figure 2. AblΔIDR does not rescue embryonic morphogenesis. A-F. Cuticle preparations. Anterior up. A. Wildtype, ventral side right, revealing the segmental array of denticle belts and naked cuticle. Arrowhead: head involution was completed and there is a well-formed head skeleton. Arrow. Germband retraction was completed, positioning the spiracles at the posterior end. Scale bar=50 µm. B-D. Examples of cuticles from progeny of AblΔIDR; abl 4 /Df mothers crossed to abl 4 /+ fathers. B. Least severe phenotype. Head involution, dorsal closure (arrowhead) and germband retraction (arrow) failed. C. Intermediate phenotype, with large hole in the ventral cuticle. D. Severe phenotype. Only fragments of cuticle remain. F. Range of cuticle defects seen in the progeny of females whose germlines are homozygous for abl 4 crossed to abl 4 /+ fathers, carrying the transgenes indicated in G maternally and zygotically. Arrows and arrowheads as in A-D. Images in A and F are from R ogers et al., 2016 , where we developed this cuticle scoring scheme. G. Frequencies of each phenotype in the indicated genotypes. Statistical test used was Fisher’s Exact Test. To circumvent this, we used the FLP/FRT/DFS approach ( C hou et al . 1993 ) to generate females whose germlines are homozygous for abl 4 , either in the presence of one of our transgenes or in the absence of any transgene as a control. This approach allowed us to compare maternal/zygotic abl mutants ( ablMZ) , who are homozygous for the null allele, with similar mutants that have one of our transgenes contributed both maternally and zygotically. We used abl transgenes inserted at the same chromosomal location via phiC integrase. ablMZ mutants generated by the FLP/FRT/DFS approach are embryonic lethal ( G revengoed et al . 2001 ), and there is only partial rescue of viability in the 50% of embryos that receive a wild-type abl gene paternally (9% overall embryonic viability ( Fig. 1E ; Table 1 ). Strikingly, AblΔIDR; ablMZ mutants had an even higher embryonic lethality (1% overall embryonic viability; probability that viability is lower than ablMZ p<0.0001; by Fisher’s Exact test; Table 1 ). In contrast, our GFP-tagged wildtype transgene, provided strong rescue (39% viability ( R ogers et al . 2016 ); we attribute the lack of full rescue to other mutations that have accumulated on the abl 4 chromosome), as did the AblΔFABD transgene (35% viability; ( R ogers et al . 2016 ). We next examined embryonic cuticles, as they allow us to assess cell fate choice, major morphogenetic movements like germband retraction, head involution, and dorsal closure, along with epidermal integrity. ablMZ mutants have multiple defects in these processes ( G revengoed et al . 2001 ; R ogers et al . 2016 ); Fig 2F,G ), with smost exhibiting strong defects in head involution and failure of full germband retraction. Many also fail in dorsal closure, and a small fraction (15%) have defects in epidermal integrity. Our transgene encoding wildtype Abl largely rescued these defects ( Fig. 2F,G ; ( R ogers et al . 2016 ). Our previous analysis revealed that neither kinase activity nor the FABD is essential for rescuing these cuticle defects, while AblΔCR1, lacking the conserved PXXP motif in the IDR, largely rescued epidermal integrity but only partially rescued germband retraction and dorsal closure ( Fig. 2F,G ; ( R ogers et al . 2016 ). In contrast, however, AblΔIDR; ablMZ mutants had even more severe cuticle defects than unrescued ablMZ mutants. For example, the fraction of embryos with the more severe epidermal defects more than doubled, from 15% to 33% ( Fig. 2F,G ; probability that the cuticle defects are worse than ablMZ p<0.0001; by Fisher’s Exact test). This epidermal disruption phenotype was similar to that we observed in the progeny of AblΔIDR; abl 4 /Df females ( Fig. 2B-D ). Taken together, the increased embryonic lethality and higher proportion of severe cuticle defects in these experiments and the unexpectedly severe cuticle phenotype seen in our initial abl 4 /Df experiments, suggested to our surprise that expressing AblΔIDR not only fails to rescue loss of Abl, but actually worsens some aspects of the abl null mutant phenotype in embryonic development. AblΔIDR does not effectively rescue defects in cellularization or mesoderm invagination Abl has diverse roles in embryonic development, ranging from regulating actin dynamics during syncytial development and cellularization to regulating apical constriction of mesodermal cells to regulating cell shape change and collective cell migration during germband retraction and dorsal closure. Our cuticle data suggested that AblΔIDR was substantially impaired in morphogenesis. To examine this more closely, we used immunofluorescence and confocal microscopy to examine cell shape changes and cytoskeletal regulation during embryonic development, as we had done to assess the roles of kinase activity, the FABD, and the conserved motifs in the IDR ( R ogers et al . 2016 ). The first events of embryogenesis requiring Abl function are the characteristic dynamics of the actin cytoskeleton during the syncytial stages and cellularization. Maternal/zygotic abl mutants ( ablMZ) have defects in both processes, and thus accumulate multinucleate cells at the end of cellularization ( G revengoed et al . 2003 ); Fig. 3A vs B, red arrows). AblΔIDR did not rescue these defects, and thus AblΔIDR; ablMZ mutants accumulated multinucleate cells ( Fig. 3A vs C, red arrows). Abl is also required for the first event of gastrulation, in which cells along the ventral midline apically constrict in a coordinated way and invaginate as a tube ( F ox and P eifer 2007 ). The invaginating cells then go on to become mesoderm, while the ectodermal cells close the gap and form a straight midline. In ablMZ mutants, apical constriction is poorly coordinated, leaving some mesodermal cells on the surface. Ectodermal cells eventually close the gap, but the resulting midline is not straight ( Fig.3D vs. E, blue arrows). Once again, AblΔIDR did not fully rescue these defects ( Fig. 3F ). This latter phenotype is particularly interesting as AblΔCR1 did rescue mesoderm invagination ( R ogers et al . 2016 ). Download figure Open in new tab Figure 3. AblΔIDR does not effectively rescue defects in cellularization or mesoderm invagination. Embryos, genotypes indicated, anterior left. A-C. Cellularization, Phalloidin stained to reveal f-actin. A. Wildtype. Cellularization was completed normally, producing solely mononucleate cells. B. ablMZ mutant. Defects in actin regulation during syncytial development and cellularization led to the formation of multinucleate cells (red arrows). C. AblΔIDR; ablMZ mutant. AblΔIDR fails to rescue the defect in cellularization, and thus multiple multinucleate cells are observed. D-F. Stage 8 embryos, stained with antibodies to Ecad to visualize cell shapes. D. In wildtype mesoderm invagination is completed normally leaving a straight and even midline (blue arrows). E. ablMZ mutant. Defects in mesoderm invagination leave the ventral midline wavy and uneven (blue arrows). Also note the continued presence of multinucleate cells (red arrows). F. AblΔIDR; ablMZ mutant. AblΔIDR fails to fully rescue the defect in mesoderm invagination, leaving a wavy midline (blue arrows). Multinucleate cells remain (red arrows). Scale bar=15 µm. AblΔIDR does not rescue defects in germband retraction or dorsal closure The morphogenetic events in which Abl’s roles have been analyzed in greatest detail are two of the final morphogenetic movements of embryogenesis: germband retraction and dorsal closure ( G revengoed et al . 2001 ; R ogers et al . 2016 ). These events are easily visualized by staining embryos with antibodies to E-cadherin (Ecad) to outline cells. At the end of stage 11 of wildtype embryogenesis, the caudal end of the embryo is curled up on the dorsal side. During stage 12, the germband retracts, ultimately positioning the tail end of the embryo at the posterior end of the egg, and thus leaving structures like the spiracles at the posterior end ( Fig. 2A , arrow) and out of the dorsal view. At this stage, the ventral and lateral side of the embryo are enclosed in epidermis, but the dorsal side is covered by a “temporary” tissue, the amnioserosa (AS, Fig. 4A ). During dorsal closure, the epidermis and the amnioserosa work in parallel to completely enclose the embryo in epidermis (reviewed in ( H ayes and S olon 2017 ; K iehart et al . 2017 ). Pulsatile apical constriction of the amnioserosal cells exerts force on the epidermis. In parallel, cells at the leading edge of the epidermis assemble a contractile actin cable, anchored cell-cell at leading edge tricellular junctions--this keeps the leading edge straight (LE, Fig. 4A,B blue arrows) and is important for zippering the epidermis together as the sheets meet at the canthi ( Fig. 4A,B , red arrows). Actin=based protrusions from leading edge cells also aid in cell matching/alignment between the two sheets. ablMZ mutants have defects in both germband retraction and dorsal closure ( G revengoed et al . 2001 ; R ogers et al . 2016 ). Germband retraction is not completed and the spiracles are thus positioned dorsally ( Fig. 4C , green arrow). Dorsal closure proceeds very abnormally and often fails to go to completion. The leading edge is highly wavy rather than straight ( Fig. 4C , blue arrows) and zippering at the two canthi is slowed ( Fig. 4C , red arrows). Tissue tearing is often observed at the border between the leading edge and amnioserosa, leaving underlying tissue exposed ( Fig 4C , asterisk). Download figure Open in new tab Figure 4. AblΔIDR does not rescue defects in germband retraction or dorsal closure. Embryos stage 13-14, anterior left, dorsal (A-G) or lateral (H-J) views, stained with antibodies to Ecad to visualize cell shapes. A,B. Wildtype embryos, dorsal view, at successively later stages of dorsal closure. The embryo is enclosed ventrally and laterally by epidermis but the dorsal surface remains covered by the amnioserosa (AS). The leading edge is straight (blue arrows) and as closure proceeds the epidermis meets and zips at the canthi (red arrows). C. Representative ablMZ mutant. Dorsal closure and germband retraction are disrupted. The spiracles remain dorsal (green arrow), the leading edge is wavy rather than straight (blue arrows), zipping at the canthi is slowed or halted (red arrows), and in places the amnioserosa has ripped from the leading edge, exposing underlying tissue (asterisk). D-G. AblΔIDR; ablMZ mutants, illustrating the range of defects in dorsal closure. D. Relatively mild phenotype, with closure nearly completed. However, the leading edge is wavy (blue arrows) and the spiracles are present dorsally, revealing failure to complete germband retraction. E,F. More typical AblΔIDR; ablMZ mutants, with a very wavy leading edge (blue arrows), slowed zippering at the canthi (red arrows), and ripping of the amnioserosa from the epidermis (asterisk). G. AblΔIDR; ablMZ mutants where zippering has happened at the posterior canthus but not the anterior one (red arrows). H-J. Most severe class of AblΔIDR; ablMZ mutants, in which the epidermis is reduced in extent, very deep and persistent segmental grooves remain (green arrows) and multinucleate cells are often observed (J, yellow arrows). Scale bar = 15 µm. We thus asked whether these defects are rescued by AblΔIDR. Occasional AblΔIDR; ablMZ embryos succeeded in proceeding through closure, but even these exhibited defects in germband retraction, with the spiracles positioned dorsally ( Fig. 4D , green arrow). In most embryos closure was highly aberrant. The leading edge was wavy instead of straight ( Fig. 4D,E,F vs. A,B,blue arrows). Zippering at the canthi was slowed ( Fig. 4E,F red arrows) and often did not proceed uniformly, with zippering slower or absent at the anterior end ( Fig. 4G , red arrows). As we observed in unrescued ablMZ mutants, tearing occurred between the leading edge and the amnioserosa ( Fig. 4F , asterisk). In a subset of AblΔIDR; ablMZ embryos, the phenotype at stage 13/14 was even more severe. These embryos had reduced epidermal coverage ( Fig. 4H-J ), suggesting earlier cell death. They also exhibited deep, un-retracted segmental grooves during dorsal closure ( Fig. 4H,I , green arrows), another known phenotype of ablMZ mutants ( R ogers et al . 2016 ). Some AblΔIDR; ablMZ embryos had numerous very large cells ( Fig. 4J ), which we suspect are a remnant of the multinucleate cells that arise during cellularization and gastrulation. This severe class of embryos likely represents the subset whose cuticles show substantial epithelial disruption ( Fig. 2 ). Together, these data reveal that AblΔIDR fails to rescue defects in germband retraction or dorsal closure. Intriguingly, our previous analysis revealed that kinase activity and the FABD are largely dispensable for these morphogenetic events, while the CR1 PXXP motif in the IDR plays a role ( R ogers et al . 2016 ). AblΔIDR does not rescue defects in leading edge cell shape or in actin regulation We next explored the role of Abl’s IDR at the cellular and subcellular level. During dorsal closure the leading edge cells assemble a contractile actin cable that exerts tension along the dorsal cell margin. This cable maintains a straight leading edge and together with amnioserosal apical constriction elongates epidermal cells along the dorsal-ventral axis (reviewed in ( H ayes and S olon 2017 ; K iehart et al . 2017 ). The cable is anchored cell-to-cell at leading edge adherens junctions. In wildtype embryos tension along the cable is balanced among the cells and thus they exhibit relatively uniform shapes ( Fig. 5A , arrows), with slight deviation at the segmental grooves ( Fig. 5A , arrowheads). Loss of Abl disrupts leading edge cell shapes, with some cells hyper-constricted and other splayed open, presumably due to failure of the leading edge actin cable in some cells ( G revengoed et al . 2001 ; R ogers et al . 2016 ). We thus examined if AblΔIDR rescued these cell shape defects. It did not. AblΔIDR; ablMZ embryos exhibited penetrant defects in leading edge cell shape, with splayed open and hyperconstricted cells ( Fig. 5B,C magenta vs. yellow arrows). We also observed groups of cells that failed to elongate ( Fig 5B,C,E red asterisks), as we had previously observed in ablMZ mutants ( G revengoed et al . 2001 ; R ogers et al . 2016 ). Finally, most embryos exhibited another ablMZ mutant phenotype ( G revengoed et al . 2001 ; G revengoed et al . 2003 ): large, presumably multinucleate cells, which in some embryos were very frequent ( Fig. 5D , yellow asterisks; the frequency of multinucleate cells appeared substantially higher than was seen in un-rescued ablM Z mutants). Cell shape defects and multinucleate cells were even observed in the occasional embryos which managed to close dorsally ( Fig. 5E ). From these data we conclude that Abl’s IDR is essential for regulating leading edge cell shape. Download figure Open in new tab Figure 5. AblΔIDR does not rescue defects leading edge cell shape. Leading edge, stage 13-14 embryos, anterior left, dorsal up, stained with antibodies to Ecad to visualize cell shapes. A. Wildtype. The leading edge is straight, with even cell widths at the leading edge (blue arrows), excepting the slightly increased width at the positions of segmental grooves (red arrowheads). Scale bar=10µm. B,C. Representative AblΔIDR; ablMZ mutants. Leading edge cells are uneven in width, with some splayed open (magenta arrows) and some hyperconstricted (yellow arrows). Groups of cells also fail to elongate (red asterisks). D. AblΔIDR; ablMZ mutant. Green asterisks indicate large multinucleate cells. E. AblΔIDR; ablMZ mutant. Similar cell shape defects are seen in embryos that have completed or almost completed closure. One of the key roles of Abl family kinases is regulation of the cytoskeleton. Drosophila Abl regulates the actin cytoskeleton through effectors like the actin polymerase Enabled (Ena). Our previous analysis suggests an important role for Abl regulation of Ena and actin at the leading edge during dorsal closure ( G revengoed et al . 2001 ; G ates et al . 2007 ; R ogers et al . 2016 ). In wildtype embryos Ena localizes to the cell junctions of both amnioserosal and epidermal cells, but is strongly enriched in the tricellular junctions of leading edge cells, where the actin cable is anchored ( Fig. 6A , red arrows; ( G ates et al . 2007 ; M anning et al . 2019 ). Ena is also somewhat enriched at tricellular junctions of more ventral epidermal cells ( Fig. 6A , yellow arrows). In ablMZ mutants the uniform localization of Ena to leading edge tricellular junctions is lost ( R ogers et al . 2016 ). We thus asked whether AblΔIDR can restore leading edge Ena localization. While Ena remained enriched at some leading edge tricellular junctions of AblΔIDR; ablMZ mutants ( Fig 6B,C,D red arrows), its uniform enrichment was lost, even though enrichment at lateral epidermal tricellular junctions remained ( Fig 6B,C,D yellow arrows). At many leading edge tricellular junctions Ena was weak or absent ( Fig 6B,C,D cyan arrows), and at other places Ena spread across the leading edge ( Fig 6B,C,D green arrows), all features we previously observed in ablMZ mutants and in embryos lacking the CR1 PXXP motif ( R ogers et al . 2016 ). Download figure Open in new tab Figure 6. AblΔIDR does not rescue defects in Ena localization or actin regulation. Leading edge, stage 13-14 embryos, anterior left, dorsal up, stained to visualize Ecad and Ena (A-D) or Ecad and F-actin (F,G). A. Wildtype. Ena localizes cortically in both amnioserosal and epidermal cells. Ena is prominently enriched at leading edge tricellular junctions (red arrows), and is enriched at lower levels at tricellular junctions in the lateral epidermis (yellow arrows). Scale bar=10µm. B-D. AblΔIDR; ablMZ mutants. While Ena remains cortical and is enriched at lateral epidermal tricellular junctions (yellow arrows), uniform Ena enrichment at leading edge tricellular junctions is lost. While some tricellular junctions retain Ena enrichment (red arrows), at others Ena enrichment is reduced (cyan arrows) or Ena is found all along the leading edge (green arrows). E. Wildtype. Actin is found cortically in all epidermal cells but is enriched in the leading edge actin cable (red arrows). F. AblΔIDR; ablMZ mutant. While most cells still have actin along the leading edge, actin intensity varies from lower (blue arrows) to much higher than normal (green arrows). Actin is also elevated at tricellular junctions of lateral epidermal cells (yellow arrows). The altered cell shapes observed in ablMZ mutants reflect defects in the leading edge actin cable ( R ogers et al . 2016 ). In wildtype embryos the actin cable extends relatively uniformly across the leading edge ( Fig. 6E , arrows), joined cell to cell at leading edge tricellular junctions. In contrast, in AblΔIDR; ablMZ embryos, the leading edge actin cable was discontinuous, with regions of reduced intensity ( Fig. 6F , cyan arrows) interspersed with regions of elevated actin intensity ( Fig. 6F , green arrows), as we previously observed in ablMZ mutants ( R ogers et al . 2016 ). Actin levels were also elevated at many lateral epidermal tricellular junctions ( Fig. 6F , yellow arrows) a featured shared by ablMZ mutants ( R ogers et al . 2016 ) and by embryos in which Ena levels were artificially elevated ( N owotarski et al . 2014 ). These results indicate that AblΔIDR does not rescue the defects in Ena localization or actin regulation seen after loss of Abl. AblΔIDR protein is more stable than WT Abl protein Perhaps the most surprising aspect of our phenotypic analysis of AblΔIDR were the indications that expression of this protein actually enhanced rather than rescued the phenotype of ablMZ mutants. We first examined the possibility that this reflected destabilization of the protein or a change in subcellular localization. Wildtype Abl is found in a cytoplasmic pool and is enriched at the cell cortex. Cortical enrichment is strong in early embryos and gradually reduces through the end of dorsal closure ( G revengoed et al . 2001 ; G revengoed et al . 2003 ; F ox and P eifer 2007 ). Our previous analysis revealed that kinase activity and the FABD are dispensable for cortical localization, as are each of the four conserved motifs within the IDR ( R ogers et al . 2016 ). To determine if there are redundant motifs in the IDR that lead to this result, we asked if AblΔIDR retained the ability to localize to the cortex. We examined this in the background of ablMZ mutants to eliminate the possibility of cortical recruitment via interaction with the wildtype Abl protein. At the extended germband stage endogenous Abl is enriched at the cortex, and this is mimicked by our wildtype Abl:GFP protein ( Fig. 7A ; ( F ox and P eifer 2007 ; R ogers et al . 2016 ). AblΔIDR:GFP showed a similar degree of cortical enrichment at this stage ( Fig. 7B,C ). Cortical enrichment of both wildtype Abl:GFP and AblΔIDR:GFP was diminished during dorsal closure ( Fig. 7D,E ). Thus AblΔIDR encodes an apparently stable protein that retains the ability to associate with the cortex. Download figure Open in new tab Figure 7. AblΔIDR:GFP protein is still enriched at the cell cortex, like wildtype Abl. A-E. Embryos, stages indicated, anterior left. Fixed and stained for Ecad, with the GFP-tagged Abl proteins directly visualized by GFP fluorescence. Scale bars=15µm. A-C. During the extended germband stage, both wildtype Abl:GFP and AblΔIDR:GFP have a cytoplasmic pool and are enriched at the cell cortex, as we previously observed is the case for endogenous Abl. D,E. Cortical enrichment of both wildtype Abl:GFP and AblΔIDR:GFP is reduced during dorsal closure. F,G. Live imaging of syncytial stage embryos. Wildtype Abl:GFP is clearly cortical but AblΔIDR:GFP is found throughout the cell. We next visualized the Abl:GFP and AblΔIDR:GFP proteins live, without fixation. While cortical enrichment was obvious for Abl:GFP ( Fig. 7F ), it was much less apparent for AblΔIDR:GFP ( Fig. 7G )—instead, the entire cell appeared to be filled with protein. These data suggested a second possibility: a difference in expression or accumulation levels. All of our transgenes were driven by the endogenous abl promotor, which drives expression of transgenes at normal levels ( F ox and P eifer 2007 ) and in our second set of transgenes we targeted all to the same chromosomal location to reduce the possibility of position effects. Immunoblotting had previously revealed that our wildtype GFP-tagged Abl and each of our previously analyzed mutants accumulate at levels similar to endogenous wildtype Abl ( R ogers et al . 2016 ). We thus repeated this analysis with AblΔIDR. To our surprise, in embryos, AblΔIDR protein accumulates to substantially higher levels than that of wildtype GFP-tagged Abl ( Fig. 8A ); quantitative immunoblots revealed that protein levels are elevated 11-fold ( Fig. 8B ). This cannot be attributed to chromosomal position effects, as we observed similar elevation in protein levels with flies carrying two independently generated AblΔIDR transgenes (flies carrying the P-element -mediated transgenes generated for our initial experiments and the phiC targeted transgenes). Because this result was so surprising, also we expressed our transgenic proteins in a well-characterized Drosophila cultured cell line, S2 cells, where they were driven by the heterologous metallothionein promotor. Strikingly, AblΔIDR protein also accumulated to a significantly higher level than wildtype Abl protein in transfected S2 cells ( Fig. 8C ). This observation ruled out the possibility that the higher levels of AblΔIDR protein accumulation are solely due to differences in transcription, since in the embryos, transcription of both wildtype and AblΔIDR transgenes are driven by the same 2kb upstream abl promoter region, while in S2 cells, transcription of transgenes encoding wild type Abl and AblΔIDR was driven by the same metallothionein promoter and the plasmids encoding them had essentially identical transfection efficiencies. Consistent with what we observed in live embryos, the enrichment of Abl:GFP in the S2 cell lamellipodium was obscured when we examined AblΔIDR ( Fig. 8D ), consistent with the possibility that its elevated levels saturated normal binding sites in the lamellipodium and filled the cell. These data suggest that AblΔIDR protein is more stable and resistant to degradation than wildtype Abl, and that Abl’s IDR contains an element important for regulating Abl protein levels. Download figure Open in new tab Figure 8. AblΔIDR protein accumulates at much higher levels than wildtype Abl. A. Immunoblot of 0-6 hr embryonic extracts, blotted with antibody to GFP to detect our transgenic proteins. Tubulin serves as a loading control. Despite the fact that both transgenes are driven by the same endogenous abl promotor, AblΔIDR protein accumulates at much higher levels than wildtype Abl. B. Quantification of mean protein levels from four immunoblots, normalized to both wildtype Abl:GFP and using the loading controls. Colored dots indicate values of the individual blots (Values: 8.2, 11.4, 12.3, and 15.2, Mean: 11.7; Red dot indicates blot shown in A). Error bar = standard error of the mean. C. Immunoblot of extracts of Drosophila S2 cells expressing transgenes encoding wildtype Abl:GFP or AblΔIDR, both under control of the metallothionine promotor, blotted with antibody to GFP to detect our transgenic proteins. D. Representative images of transfected S2 cells stained to visualize F-actin and our transgenic Abl proteins. Wildtype Abl:GFP is enriched in the lamellipodium (arrowhead; highlighted by F-actin) and excluded from nuclei (arrow), while AblΔIDR:GFP is not enriched in the lamellipodium or excluded from nuclei. Scale Bar=10µm. Discussion The important roles of Abl kinase in embryonic development, the nervous system, adult homeostasis and oncogenesis make understanding its molecular function essential for both basic scientists and clinicians. Abl is a complex multidomain protein and we and others have assessed the roles of kinase activity and its many protein interaction domains. Here we further explore the roles of its intrinsically disordered linker (IDR), revealing this region to be essential for protein function in Drosophila morphogenesis, and important in regulating protein stability. As one of the first protein kinases implicated in cancer, attention initially focused on Abl’s kinase activity. This clearly is critical for function of the Bcr-Abl fusion protein found in chronic myeloid and acute lymphocytic leukemia, and drugs targeting kinase activity revolutionized treatment of these disorders ( S awyers et al . 2002 ; T alpaz et al . 2002 ). However, studies of Abl’s normal roles in both Drosophila and in mammals suggest kinase activity, while important, is not essential, as proteins lacking kinase activity retain residual function in vivo ( H enkemeyer et al . 1990 ; M iller et al . 2004 ; R ogers et al . 2016 ). In a similar fashion, the C-terminal f-actin binding domain and other cytoskeletal interaction motifs serve important functions in some contexts, but are not essential for protein function in others ( M iller et al . 2004 ; O ’donnell and B ashaw 2013 ; R ogers et al . 2016 ; C heong and V anberkum 2017 ). Abl’s IDR is an interesting but poorly understood feature of Abl. IDRs are found in diverse proteins and have attracted increasing interest as regions mediating multivalent interactions, thus playing a role in some cases in phase transitions leading to the assembly of biomolecular condensates ( B anani et al . 2017 ; H olehouse and P appu 2018 ). They contain regions of low-complexity sequence that are not well conserved, which mediate relatively non-specific interactions. IDRs also can contain short conserved motifs that mediate specific protein interactions, as is the case in Abl. Our previous analysis focused on four motifs that are well conserved among different insects, which we referred to as CR1 to CR4 ( R ogers et al . 2016 ). To our surprise, three of these, including a putative consensus binding site for the Abl effector Ena, are dispensable for rescuing viability and fertility ( R ogers et al . 2016 ). However, the PXXP motif embedded in CR1 proved important for function—AblΔCR1 mutants exhibited reduced adult and embryonic viability and had defects in most but not all aspects of Abl function during embryonic morphogenesis. Cheong and VanBerkum similarly found important functions for this motif in supporting adult viability and embryonic axon guidance ( C heong and V anberkum 2017 ). However, the data from both groups reveal that AblΔCR1 retains residual function. Cheong and VanBerkum extended this analysis by deleting larger regions of the IDR, singly and in combination. These data further support the idea that the PXXP motif is the only individually essential region of the IDR. However, their gain-of-function assays and analysis of effects on protein localization suggest that the region containing the Ena-binding motif also contributes to axon localization and subtly to function. Here we cleanly deleted the IDR while leaving the FABD intact, allowing us to directly determine whether other regions of the IDR have additional functions. Our new data strongly support this idea. In our assays of embryonic morphogenetic events in which Abl has a known role, AblΔIDR failed to rescue mesoderm invagination and maintenance of epidermal integrity, whereas AblΔCR1, lacking only the PXXP motif, retained full or substantial function ( R ogers et al . 2016 ). Consistent with our data, Cheong and VanBerkum found that deleting the first quarter of the IDR had stronger effects than simply mutating the PXXP motif ( C heong and V anberkum 2017 ; C heong et al . 2020 ). In fact, loss of the IDR reduced Abl function more substantially than any of our other previous alterations, including simultaneously eliminating kinase activity and the FABD ( R ogers et al . 2016 ), demonstrating its critical role in Abl function. Surprisingly, in our assays of embryonic morphogenesis, expressing AblΔIDR actually worsened the phenotype of ablMZ mutants, substantially elevating the frequency of embryos with severe disruption of epidermal integrity. We similarly observed drastic disruption of epidermal integrity when we used the AblΔIDR transgene to rescue the progeny of abl 4 /Df females, once again a phenotype more severe than that of ablMZ mutants. The disruption of epidermal integrity we observe is likely a consequence of the early defects in syncytial development and cellularization, leading to the formation of multinucleate cells. Other mutants, including those that disrupt syncytial development and cellularization in different ways, as is seen in embryos mutant for the septin peanut , lead to a similarly disrupted cuticle phenotype ( A dam et al . 2000 ). Intriguingly, embryos maternally and zygotically mutant for the adapter protein Crk, which in mammals can bind the Abl PXXP motif ( H ossain et al . 2012 ; G regor et al . 2019 ), also have strong defects in syncytial development and cellularization, leading to strong disruption of epithelial integrity ( S pracklen et al . 2019 ), as we observed here. Crk regulates actin dynamics in the early Drosophila embryo by recruiting SCAR to the cortex ( S pracklen et al . 2019 ), and the PXXP motif in Abl’s IDR can bind proteins in the WAVE regulatory complex ( C heong et al . 2020 ), of which Scar is a part. Together these data support an important role for the IDR in mediating Abl’s regulation of actin. What accounts for these seemingly “dominant negative” effects of AblΔIDR? In our view, there are several possibilities, which are not mutually exclusive. First, it is possible that the allele we use as an abl null allele ( F ox and P eifer 2007 ), abl 4 , actually encodes a very low levels of partially functional protein, via readthrough of the stop codon or a low level of downstream re-start. This could explain why the phenotype of the progeny of AblΔIDR; abl 4 /Df females is even worse than the phenotype of AblΔIDR; ablMZ mutants. In this scenario, AblΔIDR could interfere with the function of this residual Abl protein by forming inactive complexes with it or with some of its effectors or regulators. Consistent with this, Cheong and VanBerkum saw strong dominant enhancement of mutants lacking the axon guidance modulators Frazzled and Slit when they overexpressed an Abl mutant lacking the first quarter of the IDR ( C heong and V anberkum 2017 ). It also is possible that the Deficiency we used, Df(3L)st-7 Ki , also deletes a gene that enhances the abl null phenotype, as there are many known mutants that exhibit this phenotype (e.g.,( G ertler et al . 1989 ; G ertler et al . 1990 ; F orsthoefel et al . 2005 ). The AblΔIDR protein has an additional property that may account for its dominant negative effects and which also casts light on the regulation of Abl activity: it accumulates at levels substantially higher than wildtype Abl. We observed this effect with two different transgenes driven by the endogenous abl promotor inserted at different chromosomal locations, and, importantly, also observed it when we expressed AblΔIDR in cultured Drosophila cells driven by a heterologous promotor. These data imply that the IDR contains sequences that regulate Abl protein stability. None of our previous deletions of conserved motifs within the IDR (CR1-CR4) affected Abl levels ( R ogers et al . 2016 ), nor did the larger deletions of portions of the IDR made by Cheong and VanBerkum ( C heong and V anberkum 2017 ) suggesting this effect either involves a different region of the IDR or that it is a property of the IDR as a whole. IDRs have clearly defined roles in regulating protein stability. Almost 80% of known degrons reside in disordered regions ( G uharoy et al . 2016 ), while computational predictions suggest a large fraction of ubiquitylation sites are in disordered regions ( R adivojac et al . 2010 ; P ejaver et al . 2014 ). When we used the computational prediction software UbPred to identify potential ubiquitination sites within Abl ( R adivojac et al . 2010 ), 19 of 24 medium and high confidence predicted ubiquitination sites were located within Abl’s IDR, and three more were in the unstructured N-terminal region ( Figure 9A,B ). The presence of an IDR in a protein also accelerates proteasomal degradation, and they can act as initiation sites for proteolysis ( P rakash et al . 2004 ). Additionally, Ng et al. found that presence of IDRs may serve an important role in mediating ubiquitination in response to heat shock (Ng et al, 2013). Taken together, this evidence strongly suggests that Abl’s IDR may play a role in ubiquitin-mediated protein turnover as a mechanism for Abl proteostasis. It will be interesting to determine whether this is a conserved property of the IDR across the Abl family, and by what mechanism this occurs. Mammalian Abl is regulated by the ubiquitin-proteasome system ( E charri and P endergast 2001 ) and Abl can be ubiquitinated by the E3 ligase Cbl ( S oubeyran et al . 2003 ). Mammalian Arg is also ubiquitinated in response to oxidative stress ( C ao et al . 2005 ). Future work will determine if this is a conserved property of the IDR across the Abl family, and by what mechanism this occurs. Download figure Open in new tab Figure 9. Many computationally predicted ubiqutination sites in Abl are in the IDR. Output of UbPred, computational prediction software to identify potential ubiquitination sites within Abl Abl ( R adivojac et al . 2010 ). A. Diagrammatic representation, showing high (red), medium (blue) and low (green) confidence predictions. B. Table of amino acid positions of potential ubiquitination sites. Author contributions E.M. Rogers and M. Peifer designed the project, E.M. Rogers and S.C. Allred carried out the experiments, E.M. Rogers, S.C. Allred and M. Peifer analyzed the data, and E.M. Rogers, S.C. Allred and M. Peifer wrote the manuscript. Materials and Methods Transgenic Fly Lines To create the AblΔIDR transgene, a pair of overlapping PCR products were generated with Phusion high fidelity DNA polymerase (NEB) using pUAS-Abl:GFP ( F ox and P eifer 2007 ) as a template. pUAS-Abl:GFP contains 2kb of 5’ upstream promoter from the endogenous abl gene as well as an in frame eGFP tag. The ΔIDR deletion was introduced by mutagenic DNA oligonucleotide primers in the overlapping section of the PCR products. In addition, a 15 amino acid flexible linker (GGS) 5 ) was added at the location of the deletion –the hydrophilic glycine and serine residues are unlikely to form secondary structures, reducing the likelihood that the linker will interfere with the folding and function of the adjacent kinase and FABD domains. The two overlapping PCR products were joined by PCR stitching and cloned into the Xba/Not fragment of pUASg-Abl:GFP to make pUASg-AblΔIDR:GFP. The primers used for mutagenesis were as follows : AblΔIDR Forward: 5’ GGTGGATCCGGTGGATCAGGTGGATCCGGTGGTAGTGGTGGATCC GCCACGCCTATTGCCAAACTGA CCGAA 3’ AblΔIDR Reverse: 5’ GGATCCACCACTACCACCGGATCCACCTGATCCACCGGATCCACCG GCTCCTCCGCCGGTGGCCACGCC CGA3 ’ Italicized regions contain the code for the 15 aa flexible linker and the bold regions are complementary to the abl sequence. The resulting coding sequence spanning the deletion is: …TSGVATGGGAGGSGGSGGSGGSGGSATPIAKLTEP… The pUASg-AblΔIDR:GFP transgene was inserted via P-element transposition, and we were able obtain multiple independent lines, including on the 2 nd chromosome. To make the targeted ΔIDR transgene, the insert was excised from pUASg-AblΔIDR:GFP with Xba1 and Not1 and ligated into pUASt-attP to make pUASt-attP-AblΔIDR:GFP. The targeted transgene was targeted to the left arm of the 2nd chromosome by phiC31 integrase-mediated transgenesis into PBac{yellow[+]-attP-3B}VK00037 (cytogenetic map position: 22A3; ( B ischof et al . 2007 ). Injections of transgenic constructs were performed by BestGene Inc. Fly Stocks, viability and phenotypic analysis of abl mutants and statistical tests All experiments were done at 25°C unless noted. y w served as wildtype in our experiments. For assessing rescue of adult viability, we generated zygotic abl mutants by crossing Df(3L)st-7 Ki/TM3 Sb females to transgene/transgene; abl 4 /TM3 Sb males, and selecting for Ki and against Sb ( abl 4 /Df(3L)st-7 Ki ). We set the fraction of progeny with this genotype seen when using the wildtype abl transgene (AblWT; 27%) as 100%, and other genotypes were normalized to this. Adult viabilities were compared by Fisher’s Exact test (GraphPad). For this, the number of viable mutant adult flies (# of abl 4 /Df adults) was compared to the estimated number of non-viable flies. The number of non-viable flies was estimated by subtracting the number of viable mutant adult flies from the expected number if they were fully viable (# of abl 4 /TM3 plus Df/TM3 divided by 2 ). We used two methods to generate embryos maternally and zygotically abl mutant ( ablMZ ): 1) using the dominant female sterile method (Chou and Perrimon, 1996) to make abl 4 clones in the female germline and 2) using a deficiency spanning the abl locus transheterozygous to abl 4 . To generate abl germline clones, w; Tn[Abl]/Tn[Abl];FRT 79 D-F abl 4 / TM3 females were crossed with hs::Flp;;FRT 79 D-F ovoD/TM3 males. 48-72 hr old progeny were heat shocked for three hours at 37° C and allowed to develop to adulthood. Virgin female progeny of the genotype hs::FLP/+;Tn[Abl]/+; FRT 79 D-F abl4/ FRT 79 D-F ovoD were crossed with w ; Tn[Abl]/Tn[Abl];FRT 79 D-F abl 4 / TM3, twi-GAL4,UAS-EGFP males, embryos collected from cups with apple juice/agar plates and yeast paste As one approach, we generated embryos maternally and zygotically mutant for abl using a deficiency: Df(3L) st-j7, Ki/ TM6b (Bloomington #5416, Deletes73A2-73B2). For generation of ablMZ mutants by this approach w; Df(3L) st-j7, Ki/ TM3, twi-GAL4,UAS-EGFP females were crossed with w; Tn[Abl]/Tn[Abl];FRT 79 D-F abl 4 / TM3 males. The resulting w; Tn[Abl]/+;FRT 79 D-F abl 4 / Df(3L) st-j7, Ki females were crossed to w; Tn[Abl]/Tn[Abl];FRT 79 D-F abl 4 / TM3, twi-GAL4,UAS-EGFP males and embryos collected. Assessment of embryonic lethality and preparation of embryonic cuticles were done as in Wieschaus and Nüsslein-Volhard (1986) ( WIESCHAUS AND NÜSSLEIN-VOLHARD 1986 ). For both approaches, embryonic viabilities were compared by Fisher’s Exact test (GraphPad). To compare cuticle phenotypes of abl 4 MZ mutants and embryos expressing different Abl transgenes in the abl 4 MZ mutant background, we used Fisher’s Exact test (GraphPad). For each genotype, the number of cuticles falling into the two more severe classes (i.e. Dorsal closure failure, and Epidermal integrity defect) were grouped to a single defective category, and compared to the number of cuticles in the two less severe categories (wildtype and Strong defects in germband retraction). Similarly, cuticle scores of each mutant transgene in the abl 4 mutant background were compared to the wildtype transgene (AblWT) using the same approach. Embryo live imaging Embryos from flies that homozygous for either the transgene encoding Abl WT or AblΔIDR were dechorionated in 50% bleach and mounted in halocarbon oil (series 700; Halocarbon Products, River Edge, NJ) between a gas-permeable membrane (Petriperm; Sartorius, Edgewood,NJ) and a glass coverslip and imaged in a Z-series of 1μM slices on a Zeiss LSM-5 Pascal confocal microscope. Immunofluorescence To examine embryos by immunofluorescence, flies were allowed to lay eggs on apple juice/agar plates with yeast paste for times calculated to obtain embryos at the right stages. Embryos were collected, dechorionated in 50% bleach, washed in 0.1% Triton-X, and fixed in 1:1 Heptane/3.7% Formaldehyde diluted in PBS for 20 minutes at room temperature. Embryos were then devitillenized by shaking in 1:1 heptane /methanol, when prepared for phalloidin staining, hand-devitillenized. Embryos were then blocked in Blocking Solution (PBS/0.1% Triton-X/1% Normal Goat Serum) for ≥ 30 min, incubated in primary antibody diluted in Blocking Solution overnight at 4°C and washed 3X in Blocking Solution. Embryos were then incubated in secondary antibody in Blocking Solution for 2 hours at room temperature and washed 3X in Blocking Solution. Embryos were mounted on glass slides in Aquapolymount (Polysciences, Inc). Primary and secondary antibodies were: (anti-Dcad, 1:100; anti-Enabled, 1:500 (all from the Developmental Studies Hybridoma Bank and anti-mouse and anti-rat IgG Alexa Fluors 568 and 647, from Molecular Probes); some secondary antibodies were preabsorbed with fixed y w embryos. For F-actin staining TRITC labeled phalloidin (Sigma) was used at a dilution of 1:500 to 1:1000. For S2 cells, resuspended cells were allowed to attach for 1 hour onto a ConcanavalinA coated glass coverslip. Cells were then fixed 10 minutes in 10% formaldehyde HL3 buffer (70 mM NaCl; 5 mM KCl; 1.5 mM CaCl2-2H2O; 20 mM; MgCl2-6H2O; 10 mM NaHCO3; 5 mM trehalose; 115 mM sucrose; 5 mM HEPES; pH 7.2) followed by four 10 minute washes in PBS with 0.1% Triton-X (PBST) and two brief washes with ddH2O. During the last PBST wash, TRITC, labeled phalloidin was added to a dilution of 1:1000. A drop of Aquapolymount was added to the coverslips, and the coverslips were mounted on pedestals of dried nail polish on a glass slide, and sealed with nail polish. Imaging of embryos and S2 cells was done on a Zeiss LSM-5 Pascal or Zeiss 710 scanning confocal microscopes. Images were processed using ZEN 2009 software. Photoshop CS6 (Adobe) was used to adjust input levels so that the signal spanned the entire output grayscale and to adjust brightness and contrast. Immunoblotting Embryonic extracts for immunoblotting were prepared by resuspending embryos in an equal volume of 2X SDS-PAGE Sample buffer(100 mM Tris-Cl (pH 6.8);4% SDS; 0.2% bromophenol blue; 20% glycerol; 200 mM B-mercaptoethanol) and homogenizing with a pestle in a microfuge tube. To make S2 cell extracts 1mL of resuspended S2 cells were spun down in a microfuge tube, the media was removed, and the pellet resuspended in an equal volume of 2X SDS PAGE Sample buffer. The samples were boiled for 5 min, spun to clear debris, and 10 ul of the resulting extract run on a 7.5% SDS-PAGE gel, and transferred to a nitrocellulose membrane. To detect the transgenic GFP-tagged Abl proteins we used anti-GFP (JL-8, 1:500 or 1:1000, Clontech). Anti-αTubulin (Sigma, 1:10000) or anti-Pnut (Developmental studies Hybridoma Bank,1:30) were used as loading controls. Detection was done using HRP-conjugated anti-mouse IgG secondary antibody (Pierce, 1:50000), and the ECL plus substrate kit (Pierce). Quantification of Abl ΔIDR and Abl WT protein levels Four immunoblots of embryo extracts from homozygous stocks of the targeted Abl WT and Abl ΔIDR transgenes were used to quantify relative levels of Abl WT and Abl ΔIDR proteins in the embryos. Scans of Western blot film exposures were opened and converted to grayscale images in Adobe Photoshop. The resulting image was opened in ImageJ as a JPEG and the pixels were inverted. Rectangular ROIs of the exact same dimensions, and just large enough to contain the thickest band were drawn around the Abl protein and loading control bands. An ROI was also drawn around an unexposed area of the film for background subtraction. The mean gray value (MGV) of the ROIs for Abl and loading control proteins, and background were determined. The background subtracted MGVs of the AblΔIDR and Abl WT bands were adjusted for any loading differences by dividing them by the MGVs of their background subtracted loading controls. The background and loading control adjusted AblΔIDR and Abl WT levels were expressed as a ratio of AblΔIDR/Abl WT, normalized to the level of Abl WT which was assigned a value of 1. To determine statistical significance an unpaired t-test was used (GraphPad). Expression of Abl proteins in S2 cells To express Abl and Abl ΔIDR proteins in S2 cells, the Abl and Abl ΔIDR coding regions were cloned by Gateway Technology(Invitrogen) into pMT, a vector for metal inducible protein synthesis via the metallothionein promoter. To make pMT Abl::GFP and pMT AblΔIDR::GFP, Phusion Polymerase was used to amplify the Abl and Abl ΔIDR coding regions using pUASt-attP-Abl:GFP and pUASt-attP-AblΔIDR:GFP as a template with the following primers: AblGFP Gateway Forward: 5’CACCATGGGGGCTCAGCAGGGCAA 3’ AblGFP Gateway Reverse: 5’CCTGTTAAGCGCATTGGAGATCTGA3’ pMT Abl or pMT AblΔIDR::GFP DNAs were transfected into S2 cells grown in Sf-900 II SFM medium (Invitrogen) in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions. Six hours after the transfection, CuSO 4 was added to 500 mM to induce expression of the transgenes. Cells were allowed to induce for 24 hrs and were used for both Western Blots and Immunufluorescence microscopy. Transfection efficiency was estimated by counting GFP positive cells on a dozen 143um X 143um fields on slides for immunofluorescence and dividing by the total number of cell (for blot in Fig 7c transfection efficiency: Abl WT= 65%(n=205) and AblΔIDR=57%(n=109) Acknowledgements We are grateful to John Poulton for statistical advice, to Kia Perez-Vale for advice on quantifying immunoblots, to Lilia Iakoucheva for a helpful discussion of IDRs and ubiquitination, and to Steve Rogers for thoughtful comments on the manuscript. We thank the Developmental Studies Hybridoma Bank and the Bloomington Drosophila Stock Center for reagents and our lab members for thoughtful conversations. This work was supported by National Institutes of Health Grants R01 GM47957 and R35 GM118096 to M.P., and E.M.R was supported by a Leukemia and Lymphoma Society Career Development Program Fellowship Grant 5339-08. Footnotes Text and Figures updated after comments from readers. References ↵ Adam , J. C. , J. R. Pringle and M. Peifer , 2000 Evidence for functional differentiation among Drosophila septins in cytokinesis and cellularization . Molecular Biology of the Cell 11 : 3123 – 3135 . OpenUrl Abstract / FREE Full Text ↵ Banani , S. F. , H. O. Lee , A. A. Hyman and M. K. Rosen , 2017 Biomolecular condensates: organizers of cellular biochemistry . Nat Rev Mol Cell Biol 18 : 285 – 298 . OpenUrl CrossRef PubMed ↵ Bischof , J. , R. K. Maeda , M. Hediger , F. Karch and K. Basler , 2007 An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases . Proc Natl Acad Sci U S A 104 : 3312 – 3317 . OpenUrl Abstract / FREE Full Text ↵ Bradley , W. D. , and A. J. Koleske , 2009 Regulation of cell migration and morphogenesis by Abl-family kinases: emerging mechanisms and physiological contexts . Journal of Cell Science 122 : 3441 – 3454 . OpenUrl Abstract / FREE Full Text ↵ Cao , C. , Y. Li , Y. Leng , P. Li , Q. Ma et al. , 2005 Ubiquitination and degradation of the Arg tyrosine kinase is regulated by oxidative stress . Oncogene 24 : 2433 – 2440 . OpenUrl CrossRef PubMed Web of Science ↵ Cheong , H. S. J. , M. Nona , S. B. Guerra and M. F. VanBerkum , 2020 The first quarter of the C-terminal domain of Abelson regulates the WAVE regulatory complex and Enabled in axon guidance . Neural Dev 15 : 7 . OpenUrl ↵ Cheong , H. S. J. , and M. F. A. VanBerkum , 2017 Long disordered regions of the C-terminal domain of Abelson tyrosine kinase have specific and additive functions in regulation and axon localization . PLoS One 12 : e0189338 . OpenUrl ↵ Chislock , E. M. , and A. M. Pendergast , 2013 Abl family kinases regulate endothelial barrier function in vitro and in mice . PLoS One 8 : e85231 . OpenUrl CrossRef PubMed ↵ Chislock , E. M. , C. Ring and A. M. Pendergast , 2013 Abl kinases are required for vascular function, Tie2 expression, and angiopoietin-1-mediated survival . Proc Natl Acad Sci U S A 110 : 12432 – 12437 . OpenUrl Abstract / FREE Full Text ↵ Chou , T.-B. , E. Noll and N. Perrimon , 1993 Autosomal P[ovoD1] dominant female-sterile insertions in Drosophila and their use in generating female germ-line chimeras . Development 119 : 1359 – 1369 . OpenUrl Abstract / FREE Full Text ↵ Colicelli , J. , 2010 ABL tyrosine kinases: evolution of function, regulation, and specificity . Sci Signal 3 : re6 . OpenUrl Abstract / FREE Full Text ↵ Courtemanche , N. , S. M. Gifford , M. A. Simpson , T. D. Pollard and A. J. Koleske , 2015 Abl2/Abl-related gene stabilizes actin filaments, stimulates actin branching by actin-related protein 2/3 complex, and promotes actin filament severing by cofilin . J Biol Chem 290 : 4038 – 4046 . OpenUrl Abstract / FREE Full Text ↵ Echarri , A. , and A. M. Pendergast , 2001 Activated c-Abl is degraded by the ubiquitin-dependent proteasome pathway . Curr Biol 11 : 1759 – 1765 . OpenUrl CrossRef PubMed ↵ Forsthoefel , D. J. , E. C. Liebl , P. A. Kolodziej and M. A. Seeger , 2005 The Abelson tyrosine kinase, the Trio GEF and Enabled interact with the Netrin receptor Frazzled in Drosophila . Development 132 : 1983 – 1994 . OpenUrl Abstract / FREE Full Text ↵ Fox , D. T. , and M. Peifer , 2007 Abelson kinase (Abl) and RhoGEF2 regulate actin organization during cell constriction in Drosophila . Development 134 : 567 – 578 . OpenUrl Abstract / FREE Full Text ↵ Gates , J. , J. P. Mahaffey , S. L. Rogers , M. Emerson , E. M. Rogers et al. , 2007 Enabled plays key roles in embryonic epithelial morphogenesis in Drosophila . Development 134 : 2027 – 2039 . OpenUrl Abstract / FREE Full Text ↵ Gertler , F. , R. Bennett , M. Clark and F. Hoffmann , 1989 Drosophila abl tyrosine kinase in embryonic CNS axons: a role in axonogenesis is revealed through dosage-sensitive interactions with disabled . Cell 58 : 103 – 113 . OpenUrl CrossRef PubMed Web of Science ↵ Gertler , F. B. , J. S. Doctor and F. M. Hoffmann , 1990 Genetic suppression of mutations in the Drosophila abl proto-oncogene homolog . Science 248 : 857 – 860 . OpenUrl Abstract / FREE Full Text ↵ Gregor , T. , M. K. Bosakova , A. Nita , S. P. Abraham , B. Fafilek et al. , 2019 Elucidation of protein interactions necessary for the maintenance of the BCR-ABL signaling complex . Cell Mol Life Sci . ↵ Grevengoed , E. E. , D. T. Fox , J. Gates and M. Peifer , 2003 Balancing different types of actin polymerization at distinct sites: roles for Abelson kinase and Enabled . J. Cell Biol . 163 : 1267 – 1279 . OpenUrl Abstract / FREE Full Text ↵ Grevengoed , E. E. , J. J. Loureiro , T. L. Jesse and M. Peifer , 2001 Abelson kinase regulates epithelial morphogenesis in Drosophila . J Cell Biol 155 : 1185 – 1198 . OpenUrl Abstract / FREE Full Text ↵ Gu , J. J. , N. Zhang , Y. W. He , A. J. Koleske and A. M. Pendergast , 2007 Defective T cell development and function in the absence of Abelson kinases . J Immunol 179 : 7334 – 7343 . OpenUrl Abstract / FREE Full Text ↵ Guharoy , M. , P. Bhowmick and P. Tompa , 2016 Design Principles Involving Protein Disorder Facilitate Specific Substrate Selection and Degradation by the Ubiquitin-Proteasome System . J Biol Chem 291 : 6723 – 6731 . OpenUrl Abstract / FREE Full Text ↵ Hardin , J. D. , S. Boast , P. L. Schwartzberg , G. Lee , F. W. Alt et al. , 1995 Bone marrow B lymphocyte development in c-abl-deficient mice . Cell Immunol 165 : 44 – 54 . OpenUrl CrossRef PubMed Web of Science ↵ Hardin , J. D. , S. Boast , P. L. Schwartzberg , G. Lee , F. W. Alt et al. , 1996 Abnormal peripheral lymphocyte function in c-abl mutant mice . Cell Immunol 172 : 100 – 107 . OpenUrl CrossRef PubMed Web of Science ↵ Hayes , P. , and J. Solon , 2017 Drosophila dorsal closure: An orchestra of forces to zip shut the embryo . Mech Dev 144 : 2 – 10 . OpenUrl CrossRef ↵ Henkemeyer , M. , F. Gertler , W. Goodman and F. Hoffmann , 1987 The Drosophila Abelson proto-oncogene homolog: identification of mutant alleles that have pleiotropic effects late in development . Cell 51 : 821 – 828 . OpenUrl CrossRef PubMed Web of Science ↵ Henkemeyer , M. , S. West , F. Gertler and F. Hoffmann , 1990 A novel tyrosine kinase-independent function of Drosophila abl correlates with proper subcellular localization . Cell 63 : 949 – 960 . OpenUrl CrossRef PubMed Web of Science ↵ Holehouse , A. S. , and R. V. Pappu , 2018 Functional Implications of Intracellular Phase Transitions . Biochemistry 57 : 2415 – 2423 . OpenUrl CrossRef PubMed ↵ Hossain , S. , P. M. Dubielecka , A. F. Sikorski , R. B. Birge and L. Kotula , 2012 Crk and ABI1: binary molecular switches that regulate abl tyrosine kinase and signaling to the cytoskeleton . Genes Cancer 3 : 402 – 413 . OpenUrl CrossRef PubMed ↵ Huang , Y. , E. O. Comiskey , R. S. Dupree , S. Li , A. J. Koleske et al. , 2008 The c-Abl tyrosine kinase regulates actin remodeling at the immune synapse . Blood 112 : 111 – 119 . OpenUrl Abstract / FREE Full Text ↵ Kannan , R. , and E. Giniger , 2017 New perspectives on the roles of Abl tyrosine kinase in axon patterning . Fly (Austin) 11 : 260 – 270 . OpenUrl ↵ Khatri , A. , J. Wang and A. M. Pendergast , 2016 Multifunctional Abl kinases in health and disease . J Cell Sci 129 : 9 – 16 . OpenUrl Abstract / FREE Full Text ↵ Kiehart , D. P. , J. M. Crawford , A. Aristotelous , S. Venakides and G. S. Edwards , 2017 Cell Sheet Morphogenesis: Dorsal Closure in Drosophila melanogaster as a Model System . Annu Rev Cell Dev Biol 33 : 169 – 202 . OpenUrl CrossRef ↵ Koleske , A. J. , A. M. Gifford , M. L. Scott , M. Nee , R. T. Bronson et al. , 1998 Essential roles for the Abl and Arg tyrosine kinases in neurulation . Neuron 21 : 1259 – 1272 . OpenUrl CrossRef PubMed Web of Science ↵ Lee , J. K. , P. T. Hallock and S. J. Burden , 2017 Abelson tyrosine-protein kinase 2 regulates myoblast proliferation and controls muscle fiber length . Elife 6 . ↵ Li , B. , S. Boast , K. de los Santos , I. Schieren , M. Quiroz et al. , 2000 Mice deficient in Abl are osteoporotic and have defects in osteoblast maturation . Nat Genet 24 : 304 – 308 . OpenUrl CrossRef PubMed Web of Science ↵ Li , P. , S. Banjade , H. C. Cheng , S. Kim , B. Chen et al. , 2012 Phase transitions in the assembly of multivalent signalling proteins . Nature 483 : 336 – 340 . OpenUrl CrossRef PubMed Web of Science ↵ Lin , Y. C. , M. F. Yeckel and A. J. Koleske , 2013 Abl2/Arg controls dendritic spine and dendrite arbor stability via distinct cytoskeletal control pathways . J Neurosci 33 : 1846 – 1857 . OpenUrl Abstract / FREE Full Text ↵ Manning , L. A. , K. Z. Perez-Vale , K. N. Schaefer , M. T. Sewell and M. Peifer , 2019 The Drosophila Afadin and ZO-1 homologues Canoe and Polychaetoid act in parallel to maintain epithelial integrity when challenged by adherens junction remodeling . Mol Biol Cell 30 : 1938 – 1960 . OpenUrl CrossRef ↵ Miller , A. L. , Y. Wang , M. S. Mooseker and A. J. Koleske , 2004 The Abl-related gene (Arg) requires its F-actin-microtubule cross-linking activity to regulate lamellipodial dynamics during fibroblast adhesion . J Cell Biol 165 : 407 – 419 . OpenUrl Abstract / FREE Full Text ↵ Moresco , E. M. , S. Donaldson , A. Williamson and A. J. Koleske , 2005 Integrin-mediated dendrite branch maintenance requires Abelson (Abl) family kinases . J Neurosci 25 : 6105 – 6118 . OpenUrl Abstract / FREE Full Text ↵ Moresco , E. M. , and A. J. Koleske , 2003 Regulation of neuronal morphogenesis and synaptic function by Abl family kinases . Curr Opin Neurobiol 13 : 535 – 544 . OpenUrl CrossRef PubMed Web of Science ↵ Nowotarski , S. H. , N. McKeon , R. J. Moser and M. Peifer , 2014 The actin regulators Enabled and Diaphanous direct distinct protrusive behaviors in different tissues during Drosophila development . Mol Biol Cell 25 : 3147 – 3165 . OpenUrl Abstract / FREE Full Text ↵ O’Donnell , M. P. , and G. J. Bashaw , 2013 Distinct functional domains of the Abelson tyrosine kinase control axon guidance responses to Netrin and Slit to regulate the assembly of neural circuits . Development 140 : 2724 – 2733 . OpenUrl Abstract / FREE Full Text ↵ Oldfield , C. J. , and A. K. Dunker , 2014 Intrinsically disordered proteins and intrinsically disordered protein regions . Annu Rev Biochem 83 : 553 – 584 . OpenUrl CrossRef PubMed ↵ Pejaver , V. , W. L. Hsu , F. Xin , A. K. Dunker , V. N. Uversky et al. , 2014 The structural and functional signatures of proteins that undergo multiple events of post-translational modification . Protein Sci 23 : 1077 – 1093 . OpenUrl CrossRef PubMed ↵ Prakash , S. , L. Tian , K. S. Ratliff , R. E. Lehotzky and A. Matouschek , 2004 An unstructured initiation site is required for efficient proteasome-mediated degradation . Nat Struct Mol Biol 11 : 830 – 837 . OpenUrl CrossRef PubMed Web of Science ↵ Qiu , Z. , Y. Cang and S. P. Goff , 2010a Abl family tyrosine kinases are essential for basement membrane integrity and cortical lamination in the cerebellum . J Neurosci 30 : 14430 – 14439 . OpenUrl Abstract / FREE Full Text ↵ Qiu , Z. , Y. Cang and S. P. Goff , 2010b c-Abl tyrosine kinase regulates cardiac growth and development . Proc Natl Acad Sci U S A 107 : 1136 – 1141 . OpenUrl Abstract / FREE Full Text ↵ Radivojac , P. , V. Vacic , C. Haynes , R. R. Cocklin , A. Mohan et al. , 2010 Identification, analysis, and prediction of protein ubiquitination sites . Proteins 78 : 365 – 380 . OpenUrl CrossRef PubMed Web of Science ↵ Ren , R. , 2005 Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukaemia . Nat Rev Cancer 5 : 172 – 183 . OpenUrl CrossRef PubMed Web of Science ↵ Rogers , E. M. , A. J. Spracklen , C. G. Bilancia , K. D. Sumigray , S. C. Allred et al. , 2016 Abelson kinase acts as a robust, multifunctional scaffold in regulating embryonic morphogenesis . Mol Biol Cell 27 : 2613 – 2631 . OpenUrl Abstract / FREE Full Text ↵ Sawyers , C. L. , A. Hochhaus , E. Feldman , J. M. Goldman , C. B. Miller et al. , 2002 Imatinib induces hematologic and cytogenetic responses in patients with chronic myelogenous leukemia in myeloid blast crisis: results of a phase II study . Blood 99 : 3530 – 3539 . OpenUrl Abstract / FREE Full Text ↵ Schwartzberg , P. L. , E. J. Robertson and S. P. Goff , 1991 A Substitution Mutation in the C-Abl Gene Introduced into the Murine Germ Line by Targeted Gene Disruption in Embryonic Stem-Cells . Human Gene Transfer 219 : 217 – 226 . OpenUrl ↵ Soubeyran , P. , A. Barac , I. Szymkiewicz and I. Dikic , 2003 Cbl-ArgBP2 complex mediates ubiquitination and degradation of c-Abl . Biochem J 370 : 29 – 34 . OpenUrl Abstract / FREE Full Text ↵ Spracklen , A. J. , E. M. Thornton-Kolbe , A. N. Bonner , A. Florea , P. J. Compton et al. , 2019 The Crk adapter protein is essential for Drosophila embryogenesis, where it regulates multiple actin-dependent morphogenic events . Mol Biol Cell 30 : 2399 – 2421 . OpenUrl ↵ Talpaz , M. , R. T. Silver , B. J. Druker , J. M. Goldman , C. Gambacorti-Passerini et al. , 2002 Imatinib induces durable hematologic and cytogenetic responses in patients with accelerated phase chronic myeloid leukemia: results of a phase 2 study . Blood 99 : 1928 – 1937 . OpenUrl Abstract / FREE Full Text ↵ Tamada , M. , D. L. Farrell and J. A. Zallen , 2012 Abl regulates planar polarized junctional dynamics through beta-catenin tyrosine phosphorylation . Dev Cell 22 : 309 – 319 . OpenUrl CrossRef PubMed Web of Science ↵ Tybulewicz , V. L. J. , C. E. Crawford , P. K. Jackson , R. T. Bronson and R. C. Mulligan , 1991 Neonatal Lethality and Lymphopenia in Mice with a Homozygous Disruption of the C-Abl Protooncogene . Cell 65 : 1153 – 1163 . OpenUrl CrossRef PubMed Web of Science ↵ van Rosmalen , M. , M. Krom and M. Merkx , 2017 Tuning the Flexibility of Glycine-Serine Linkers To Allow Rational Design of Multidomain Proteins . Biochemistry 56 : 6565 – 6574 . OpenUrl ↵ D. B. Roberts Wieschaus , E. , and C. Nüsslein-Volhard , 1986 Looking at embryos , pp. 199 – 228 in Drosophila, A Practical Approach , edited by D. B. Roberts . IRL Press , Oxford, England . ↵ Zipfel , P. A. , W. Zhang , M. Quiroz and A. M. Pendergast , 2004 Requirement for Abl kinases in T cell receptor signaling . Curr Biol 14 : 1222 – 1231 . OpenUrl CrossRef PubMed Web of Science Back to top Previous Next Posted June 29, 2020. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Abelson kinase’s intrinsically disordered linker plays important roles in protein function and protein stability Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Abelson kinase’s intrinsically disordered linker plays important roles in protein function and protein stability Edward M. Rogers , S. Colby Allred , Mark Peifer bioRxiv 2020.05.20.106708; doi: https://doi.org/10.1101/2020.05.20.106708 Share This Article: Copy Citation Tools Abelson kinase’s intrinsically disordered linker plays important roles in protein function and protein stability Edward M. Rogers , S. Colby Allred , Mark Peifer bioRxiv 2020.05.20.106708; doi: https://doi.org/10.1101/2020.05.20.106708 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7969) Biochemistry (18634) Bioengineering (14770) Bioinformatics (44158) Biophysics (22459) Cancer Biology (19594) Cell Biology (26747) Clinical Trials (138) Developmental Biology (13903) Ecology (20890) Epidemiology (2067) Evolutionary Biology (25317) Genetics (16100) Genomics (23401) Immunology (18609) Microbiology (42232) Molecular Biology (17948) Neuroscience (92896) Paleontology (693) Pathology (2969) Pharmacology and Toxicology (5063) Physiology (8066) Plant Biology (15909) Scientific Communication and Education (2091) Synthetic Biology (4538) Systems Biology (10188) Zoology (2376) window.__CF$cv$params={r:'a37bd264d9b433e5',t:'MTc4ODg0ODE1OQ==',u:'01a07fa8c8ac76718596769906191ea0',ut:'mBDEoEcpNxAIpON2e_e7CS1yNdfRNkBRHQlb_jWxJic-1788848162-1.2.1.1-FG1R6bhdcdGUBuDjwNegEe8_aclvGJhroJlpz23kynWIvzwoPkayx64XPqoC8II0DI7dZvNQ9WEuRlH1cvg9IXNkUjXacNKb.su16dhx2H0',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();