The effect of umbilical cord blood mononucleated cells on knee osteoarthritis in rabbits

The effect of umbilical cord blood mononucleated cells on knee osteoarthritis in rabbits | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The effect of umbilical cord blood mononucleated cells on knee osteoarthritis in rabbits 玉行 傅, Φ 张, 勇 杨, 白水 周, 孟 杨, 郭帅 朱, 永林 朱 This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3926407/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Objective To investigate the effect of umbilical cord blood-mononuclear cells (UCB-MNC) on the treatment of knee osteoarthritis (KOA) in rabbits and its possible mechanism. Methods The rabbit knee osteoarthritis model was prepared by anterior cruciate ligament (ACLT) method. Fifty New Zealand white rabbits were randomly divided into the Control group, Model group, sodium hyaluronate (SH) group, platelet rich plasma (PRP) group, and UCB-MNC group. Knee cavity injection was performed once a week for 5 consecutive weeks. The gross view of the knee joint, the cartilage morphology of the knee joint, and the structural changes of the knee joint in imaging were observed by behavior, gross shape of the knee joint, HE staining, and CT. The levels of TNF-α and IL-1β in rabbit knee fluid were detected by ELISA. Western blot and QRT-PCR were used to detect the expression of MMP-13 and COL-II protein and mRNA in knee cartilage. Results From the behavioral Lequesne MG scores, morphological HE staining Mankin's scores, the scores of model group were significantly higher compared with that of control group. The SH, PRP, and UCB-MNC group had sequentially lower scores compared to theModel group. From CT, KOA features were more pronounced in the model group compared to other groups, and there was a slight improvement in imaging knee osteoarthritis in the CB-MNC group compared to the SH and PRP groups. Compared with the control group, the Model group had increased levels of TNF-α, Osteoarthritis Umbilical cord blood mononuclear cells Platelet-rich plasma Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Knee osteoarthritis (KOA), which is a kind of degenerative disease characterized by progressive breakdown of articular cartilage and the most frequent clinical type of osteoarthritis (OA), causes pain and limited function in the patient`s knee joint [ 1 , 2 ] . There are few medical treatment for KOA, including nonsteroidal anti-inflammatory drugs (NSAIDs), opioid drugs, and symptomatic slow-acting drugs (diacerein, glucosamine, etc.). Other treatment protocols include the injection of medications into the joint cavity (sodium hyaluronate, platelet-rich plasma, etc.) and surgical intervention (joint replacement, etc.) a. Surgery is usually the last resort for severe KOA [ 3 ] , with certain financial burden for both patients and society [ 4 ] . As a result, researches have recently been focused on creating novel strategies to promote cartilage regeneration, inhibit the progress of inflammation, and finally reverse the progression of KOA [ 5 ] . Due to their regenerative and anti-inflammatory properties, stem cells are widely utilized to treat a variety of illnesses like spinal cord damage and neonatal hypoxic-ischemic encephalopathy [ 6 ] . Human umbilical cord blood (hUCB) stem cells, an important source of stem cells, have the characteristics of high expansion potential, low immunogenicity and can be conveniently and easily isolated from cord blood [ 7 – 9 ] . Human umbilical cord blood mono nucleated cells (hUCB-MNCs) contain hemopoietic stem cells (HSCs), mesenchymal stem cells (MSCs), endothelial progenitor cells (EPCs), lymphocytes, and monocytes, which can accelerate tissue repair and play an anti-inflammatory role [ 10 ] . Several recent preclinical studies have shown that injection of MSCs into OA joints in small animals is beneficial for cartilage repair [ 11 , 12 ] . In addition, hUCB-MNC has been reported to have immunomodulatory effects on other inflammatory related diseases, such as renal tubulointerstitial fibrosis [ 13 ] and lipopolysaccharide induced acute kidney injury [ 14 ] . However, according to a systematic review, the results of the current basic experiments are insufficient to support the use of human umbilical cord blood single-nucleated cells (hUCB-MNCs) in clinical trials for KOA [ 15 ] . In addition, there are a limited number of high-quality clinical researches using stem cells to treat patients with OA [ 16 ] . Our experience fills the gap of injecting hUCB-MNCs into the cavity of knee in animals with KOA. Therefore, the main objective of our study is to clarify the efficacy of hUCB-MNCs in the treatment of KOA in rabbit knee joints. 2. Materials And Methods 2.1.1 Experimental Animal and Grouping. Fifty healthy 6-month-old male New Zealand white rabbits (2.5-3.0 kg) were purchased from Xilingjiao Breeding and Breeding Centre in Jinan, China, and the license number is SCXK (Lu) 20180010.The rabbits were housed in standard conditions: ambient temperature of 22±1°C, light/dark cycle of 12/12h, and humidity of 50%-70%. Adequate food and water was provided, and after acclimated for a week, 50 rabbits were randomly divided into 5 groups (Control group, Model group, SH group, PRP group, hUCB-MNC group) according to the random number table method. All experimental animals except the Control group were modeled by the ACLT method. All experiments were conducted under the Guidelines for Humanitarian Treatment of Laboratory Animals issued by the Ministry of Science and Technology of China in 2006 for the treatment of animals and were approved by the Animal Care and Use Committee of Binzhou Medical College. 2.1.2 Model construction and judgment. Anterior cruciate ligament transection and medial meniscectomy was used to establish the KOA model [17] The skin was opened by a median incision in the knee joint (about 4cm in length), and the joint cavity was opened by medial parapatellar approach. The patella was externally rotated, and the anterior cruciate ligament was cut off with the medial meniscus excised at the same time. After adequate hemostasis, the joint cavity was flushed twice with iodine povidone, peroxide, and physiological saline sequentially. After reducing the patella, a drawer test was done to prove the resect of anterior cruciate ligament function. The joint capsule and skin were sutured layer by layer, and the knee joint was wrapped with aseptic dressings with no immobilization. Postoperative daily intramuscular injection of penicillin 8.0*10 5 U for 3 days to prevent infection. According to the clinical characteristics of ultra-fatigue activities are prone to early onset of OA. One week after the operation, assist the experimental animals to move for half an hour twice a day. 6 weeks later, KOA rabbits model was established [18] . ( Figure 1 ). Figure 1: A: Opening the joint cavity, B: Cutting the ACL and resecting the medial meniscus, C: Arrow pointing to the side of the model shows visible swelling of the knee, D: Micro CT shows the formation of a bone capsule. 2.1.3 Cell source and intervention measures. hUCB-MNC and PRP were provided by the cord Blood hematopoietic stem cell Bank of Shandong Province. hUCB-MNC (0.5×10 8 /4ml) were removed from liquid nitrogen and resuscitated in a water bath at 37 degrees Celsius. The washing solution (normal saline + 20% human albumin) and mononuclear cells were mixed by 3:1 volume for 1200r, 10min, the supernatant was discarded, and new washing solution was injected, and then centrifuged for 1200r twice, and 4ml washing solution was added for 10min, and cell count was performed. The cell concentration was 4 ×10 6 cells/0.3ml.PRP (2.5×10 9 /4ml) was subjected to 1200g, 10min, supernatant was taken, and then suspended in normal saline to make the concentration of PRP 4.5 × 10 8 cells/0.3 ml. The drug administration started 6 weeks after surgery. Control group did not have any treatment, Model group injected 0.3 ml of saline into the knee joint, SH group injected 0.3 ml of sodium hyaluronate (Spectrum sodium hyaluronate Injection 20 mg/2 ml), PRP group injected 4.5 × 10 8 cells/0.3 ml of PRP, and hUCB-MNC group injected 4 × 10 6 cells/0.3 ml of cell suspension once a week for 5 weeks. 2.1.4 Behavioral assessment. Behavioral assessments in each group were carried out according to the Lequesne scoring scale [19] （ Table 1 ） including local pain stimulus-response, joint mobility, degree of joint swelling, and gait. All the assessments were done by two professional members. Table 1 Standard of Lequesne MG scores Standard of Lequesne MG scores Items Behavioral manifestation of animals Scores Local pain stimulation response No abnormal pain response. 0 Mild contraction of affected hind limb. 1 Contraction of affected hind limb with systemic reaction, such as shaking, turning head to lick. 2 Severe contraction of affected hind limb with shaking, struggling or escaping. 3 Gait changes Normal gait without limping. 0 Mild limping when running. 1 The affected hind limb could participate in walking but limped obviously. 2 The affected hind limb couldn't participate in walking, touch or pedal the ground. 3 Joint range of motion Above 90° 0 45°~ 90° 1 15°~ 45° 2 Below 15° 3 Degree of joint swelling No swelling, bone markers clearly visible. 0 Mild swelling, bone markers shallow. 1 Obvious swelling, disappearance of bone markers. 2 2.2 Reagents and Instruments. Hematoxylin, Eosin staining solution (Solarbio), Rabbit TNF-α ELISA KIT, Rabbit IL-1β ELISA KIT (Shanghai Yuanjang Biotechnology Centre), Primers (Accurate Biotechnology), Trizol (TAKARA), BCA Protein Concentration Determination Kit ( Solarbio PC0020), RIPA lysate (Meilunbio), SDS-PAGE gel preparation kit (Biyunbio), ECL chemiluminescence detection kit (Meilunbio), primary antibody: β-actin (Santa Cruz Biotechnology Sc-47778), MMP-13 Polyclonal Antibody (Proteintech 18165-1-AP), Collagen Type II Polyclonal Antibody (Proteintech 28459-1-AP), Rabbit Anti-AKT1+2+3 (Bioss, bs- 6951R), Rabbit Anti-phospho-AKT (Bioss, bs0876R), Rabbit Anti-PI3KCA (Bioss, 2067R), Rabbit Anti-PI3K p110 beta (Bioss, bs-10657R), secondary antibody: Anti-rabbit IgG, HRP-linked Antibody (Cell Signaling Technology #7074), Anti-mouse IgG, HRP-linked Antibody (Cell Signaling Technology #7076). Inverted Microscope (Olympus), Electrophoresis Instrument (BIO-RAD), UV Spectrophotometer (Thermo Scientific), Fluorescence Quantitative PCR Instrument (Applied Biosystems), Surgical Instruments (Ningbo Medical Suture Factory). 2.3 Micro CT. Micro-CT scanning of the right knee joint of experimental rabbits in each group was carried out by a small animal CT system using a tomographic thickness of 25um at 80kv, which was used to observe the recovery of knee joint in each group. 2.4 HE staining. After 5 weeks of drug intervention, the experimental animals in each group were executed by air embolism, and the cartilage specimens of femoral condyles of the knee joint on the modeling side were taken, fixed with 10% paraformaldehyde for 48h, decalcified with 10% EDTA for 8 weeks, dehydrated and paraffin-embedded, cut into 5um-thick paraffin sections, and then subjected to xylene permeabilization, deparaffinization, and rinsing in distilled water, and then subjected to hematoxylin-eosin staining, and the morphology of the cartilage tissues was observed with an inverted microscope, and 3 visual fields in each group were chosen to assess the damage of the cartilages based on Mankin's score scale [20] （ Table 2 ） . Table 2 Modified Mankin score Structure Normal 0 Irregular surface, including fissures into the radial layer 1 Pannus 2 Superficial cartilage layer(≥6) absent 3 Slight disorganization (cellular rows absent,some small superficial clusters) 4 Fissures into calcified cartilage layer 5 Disorganization(chaotic struture,clusters,osteoclast activity) 6 Cellular abnormalities Normal 0 Hypercellularity,including small superficial clusters 1 Clusters 2 Hypocellularity 3 Matrix staining Normal/slight reduction 0 Staining reduced in radial layer 1 Reduced in interterritorial matrix 2 Only present in pericellular matrix 3 Absent 4 2.5 ELISA. After 5 weeks of drug intervention, the synovial fluid of the knee joint on the model side of each group was obtained by centrifugation, the supernatant was taken, and the concentrations of TNF-α and IL-1β in the joint fluid were detected by Rabbit TNF-α ELISA KIT and Rabbit IL-1β ELISA KIT (Shanghai Yuangju Biotechnology Center),to evaluate the anti-inflammatory effect of hUCB-MNC on local joints. 2.6 Real-Time Quantitative PCR （qRT-PCR ）. Articular cartilage was excised from the medial femoral condyle of the right knee joint of experimental animals in each group and stored at -80°C. The expression of MMP-13 and COL-II mRNA in articular cartilage was detected by qRT-PCR. The tissues were weighed, and the articular cartilage was ground under liquid nitrogen. Total RNA was extracted from the articular cartilage with Trizol, and the concentration and purity of RNA were determined by a spectrophotometer, and then reverse transcribed to cDNA. qRT-PCR was performed using the cDNA as a template, the CT values of MMP-13 and COL-II were obtained, and the mRNA levels were normalized to GAPDH using the 2 -ΔΔCт method to analyze the relative expression. Primers were designed according to the corresponding sequences in GenBank using Premier 5.0 software, and the primer sequences are shown in (Table 3) . Table 3：Primer sequences for RT-PCR of target gene Primer sequence Primer name sequence GAPDH-F TCCTGCACCACCAACTGCTTA GAPDH-R GGTCTTCTGGGTGGCAGTGAT MMP13-F GGTCTTCTGGCTCACGCTTTTC MMP13-R ATGGGCAGCAACGAGAAACAAG COL-II-F GTGGTGACAAAGGCGAAAAGG COL-II-R CCAGCCTTCTCGTCAAATCCTC 2.7 Western blot Articular cartilage was excised from the medial femoral condyle of the right knee joint of experimental rabbits from all groups and stored at -80°C. It was used to detect the protein expression of MMP-13, COL-II, PI3K, and AKT as well as p-PI3K and p-AKT in the cartilage of rabbit knee joints. The total protein of knee cartilage tissues was extracted by RIPA lysate, protein concentration was determined by the BCA method, the protein samples of each protein were leveled, and the samples were subjected to SDS-PAGE after adding samples. The PAGE gel in which the target protein was located was cut off, the membrane was transferred, and it was ended After that, the membrane was closed with 5% skimmed milk for 1h, added primary antibody, shook the bed for 4°C overnight, and washed the membrane with TBST for 3 times, 10 minutes at a time.rr After incubation with a secondary antibody for 1h at room temperature, the membrane was washed 3 times with TBST and then developed and imaged by an ECL luminescence kit. The grey value of the protein bands was analyzed by using ImageJ software, and calibrated with the internal reference protein (β-actin), and the relative protein expression was calculated by the grey value of the target protein bands/the grey value of the internal reference protein. 2.8 Statistical analysis SPSS statistical software was adopted for analysis, and the measurement data were expressed as（`x±s）and the comparison of data in multiple groups was analyzed by one-way ANOVA. Differences were considered statistically significant at P<0.05. 3. Results 3.1 Behavioral assessment Behavioral scores of the treated groups Control group: 0, Model group: (8 ± 0.58), Sodium hyaluronate group: (6 ± 1), PRP group: (3.8 ± 0.69), CB-MNC group: (2.5 ± 0.5). Significantly higher scores were observed in the Model group as compared to the Control group indicating better behavioral improvement with lower scores. There was a statistically significant decrease in the scores of the Sodium hyaluronate group, PRP group, and CB-MNC group compared to the Model group, with the most significant decrease in CB-MNC group. The differences between the CB-MNC group and PRP and SH groups respectively were also statistically significant, indicating that the CB-MNC group had the best behavioral improvement ( Fig. 2 ) . 3.2 Gross morphology observation Each group’s femoral condyle was observed. In the Control group ( Fig. 3 -A ) , the surface of knee joint cartilage was bright, translucent, light blue and white in color, and elastic in touch. The joint surface was smooth, the cartilage thickness was normal, and there was no softening lesion on the surface and no osteophyteat the margin of the joint fracture. In the Model group ( Fig. 3 -B ) , the joint surface was rough and uneven, the joint surface was pale white and lost normal luster, part of the cartilage became thin, surface erosion and even ulcers were formed, cystic vacuolar feeling was felt, defective cartilage lesions were visible, and some even reached the deep layer of cartilage, exposed subchondral bone, and obvious osteophyte was formed at the joint edge, which was extremely irregular. In group SH ( Fig. 3 -C ) , the surface color of the joint was light white, the surface of the joint was obviously rough and uneven, and the cartilage surface had cracks and the feeling of vacuole, accompanied by the formation of osteophytes at the edge of the cartilage. In the PRP group ( Fig. 3 -D ) , the surface color of the joint was slightly brighter, superficial cracks were occasionally seen on the surface of the cartilage, and the joint edges were more regular. In the CB-MNC group ( Fig. 3 -E ) , the surface of the cartilage was bright in color, and occasionally rough local cartilage surface could be seen, and the joint edges were neat and regular ( Fig. 3 ) . 3.3 Micro CT Scan Results Micro-CT results showed that the experimental groups had some degree of improvement in the PRP group and CB-MNC group after 5 weeks of treatment. In the Model group, the medial articular surfaces of the femur and tibial plateau had varying degrees of defects and unevenness, the joint space was narrowed, and there was osteoporosis and the formation of bony encumbrances. After 5 weeks of treatment, there was little change in the SH group compared to the Model group, with bone defects and bone encumbrances, and in the PRP group, the articular surfaces were relatively smoother than those in the Model group, with less osteophytes and improved osteoporosis, while in the CB-MNC group, the articular surfaces of the CB-MNC group improved significantly compared to those of the Model group, with increased smoothness, no obvious bone encumbrances, and significantly improved osteoporosis. In addition, in the Control group, we can see that the articular surfaces of the femoral condyle and tibial plateau of the knee joint were smooth, the joint space was normal, and there was no osteophyte or osteoporosis. Overall, the repair effect shown by CT in the Model group, SH group, PRP group, and CB-MNC group was gradually enhanced ( Figure 4 ) . 3.4 Cartilage HE staining and Mankin's score In this experiment, HE staining was performed on the articular cartilage of the medial femoral condyle of the right knee of each group, and the injury of articular cartilage was evaluated with Mankin's score. The lower the score, the less severe the injury of articular cartilage, indicating the better treatment effect. In the Control group ( Fig. 5 -A ) , articular chondrocytes were closely arranged, columnar, and neatly arranged, with a clear four-layer structure, smooth surface, uniform chromatin distribution, and no obvious defects. Mankin's score of 0.67 ± 0.58 was significantly lower than that of the Model group (11 ± 1) (P < 0.01). The articular cartilage surface of the PRP group ( Fig. 5 -D ) and CB-MNC group ( Fig. 5 -E ) was relatively flat, and the chondrocytes of the CB-MNC group were arranged more neatly than those of the PRP group, and no clustered chondrocytes were found, and the four-layer structure was more clearly distinguished from each other. Mankin's scores in the PRP group (5.33 ± 1.15) and CB-MNC group (2.67 ± 0.58) were lower than those in the Model group (P < 0.01) At the same time, the Mankin's score of the CB-MNC group was also decreased compared with that of the PRP group and had statistical significance (P < 0.05). In group SH ( Fig. 5 -C ) , there were fractures on the surface of the articular cartilage, but only on the surface of the cartilage. The chondrocytes were arranged relatively irregularly, and clumpy chondrocytes appeared, distributed unevenly, and the four-layer structure was slightly distinguishable. Mankin's score in group SH (8.67 ± 0.58) was lower than that in the Model group (P < 0.05). In the Model group ( Fig. 5 -B ) , it was found that the articular cartilage was damaged and thin after staining. The four-layer structure was indistinguishable, the chondrocytes were arranged and disordered, and cracks appeared in them, chromatin thickened in some areas of necrotic cells, and the nucleus tilted to the cytoplasmic side. Mankin's score of the experimental group was found to be statistically significant compared with that of the Model group (P < 0.05) ( Fig. 5 -F ) . 3.5 IL-1β and TNF-α were detected in the joint fluid by ELISA The concentrations of IL-1β and TNF-α in the knee joint fluid of each experimental group were measured by ELISA, and the results showed that the concentrations of IL-1β and TNF-α in the Model group were significantly and statistically higher compared to the Control group (P < 0.01). The concentrations of IL-1β and TNF-α were down-regulated in the SH group, the PRP group, and the CB-MNC group, but the down-regulation result in the CB-MNC group was the most significant (P < 0.01), indicating that CB-MNC inhibited the concentrations of IL-1β and TNF-α in the joint fluid of each experimental group, and there were statistically significant differences compared to the SH and PRP groups. TNF-α concentrations, but the CB-MNC group had the most significant down-regulation results, and there was a statistically significant difference (P < 0.01) comparing the SH and PRP groups, indicating that CB-MNC inhibited the inflammatory factors of IL-1β, TNF-α in the joint fluid with the most significant effect ( Fig. 6 ) . 3.6 Comparison of the mRNA expression levels of MMP-13 and COL-II in rabbit cartilage tissue MMP-13 mRNA was significantly higher and COL-II mRNA was significantly lower in the Model group compared to the Control group (P < 0.01). Compared with the Model group, COL-II mRNA was significantly and statistically higher in the SH, PRP, and CB-MNC groups (P < 0.01), with a more significant up-regulation effect in CB-MNC than in the SH and PRP groups (P < 0.05). In addition, MMP-13 mRNA expression was down-regulated in SH, PRP, and CB-MNC groups with statistical significance (P < 0.01) compared with the Model group, with CB-MNC having a more significant down-regulation effect than SH and PRP groups (P < 0.01), ( Fig. 7 ) . 3.7 Comparison of the protein expression levels of MMP-13,COL-II, and PI3K/AKT signal pathway in rabbit cartilage : Compared with the Control group(n = 6), MMP-13 protein expression was significantly elevated in Model group, while down-regulated COL-II protein expression was statistically significant (P < 0.01). Meanwhile, compared with the Model group, PRP group, CB-MNC group down-regulation of MMP-13 protein expression was statistically different, CB-MNC group up-regulation of COL-II protein expression was statistically different, CB-MNC group down-regulation of MMP-13 protein expression and up-regulation of COL-II protein expression was more significant and statistically significant compared with SH group, PRP group (P < 0.05). We examined the PI3K/AKT signaling pathway and found a significant difference in the increased expression of p-PI3K and p-AKT in the CB-MNC group compared to the other groups (P < 0.05) ( Fig. 8 ) . 4. Discussion Progressive degeneration of articular cartilage is the core pathological mechanism in the development of OA [ 21 ] . Articular cartilage is a specialized connective tissue which is composed of chondrocytes and extracellular matrix (ECM). Among them, type II collagen is the main structural protein, and forms the network structure of the ECM together with aggregated proteoglycans [ 22 , 23 ] . Generally, the metabolism of these matrices is very slow and is regulated by chondrocytes, which synthesize the matrices, and by protein hydrolases, which break down the matrices. The homeostasis of cartilage catabolism and anabolism is mainly maintained by matrix metalloproteinase (MMP) and endogenous tissue inhibitors of metalloproteinases (TIMPs). Among these enzymes, matrix metalloproteinase 13 (MMP-13) is the key in the cleavage of COL-II, which is responsible for the destruction of articular cartilage in OA [ 24 – 26 ] . Under normal circumstances, there is a balance between catabolism and anabolism of articular cartilage. Under pathological conditions, nevertheless, fragmented chondrocytes are consumed by macrophages, and this phagocytosis could stimulate the A-type synoviocytes coming into an inflammatory state, generating a wide range of inflammatory factors and MMPs(TNF-α, IL-1β, and MMP-13), which in turn accelerates the decomposition of chondrocytes and the progression of OA [ 27 – 29 ] . Therefore, inhibiting the expression of TNF-α, IL-1β, and MMP-13, reducing the cleavage of COL-II, and suppressing inflammation have important roles in protecting articular cartilage. The choice of the method for preparation of OA rabbits, ACLT was based on the similar pathological progression in human and extensive usage in the study of OA [ 30 ] . In our study, significant changes in articular cartilage were observed in the rabbit KOA model group in the gross view, CT, and morphological HE staining, including damaged articular surfaces, narrowing of articular space, formation of bone osteophytes as well as disordered arrangement of chondrocytes and infiltration of inflammatory. In contrast, KOA rabbits treated in hUCB-MNC group exhibited smoother articular surfaces, more aligned chondrocytes, and relatively intact cartilage layers. One study reported that bone marrow mesenchymal stem cells reduced TNF-α, IL-1β in the joint fluid of rabbit KOA models, thereby reducing inflammation [ 31 ] . In the present study the concentration of TNF-α and IL-1β inflammatory factors detected in the joint fluid after hUCB-MNC intervention was significantly reduced compared to the model group, consistent with the results of aforementioned study. A cross-sectioned study on treatment of ACLT rabbits with human umbilical cord blood MSC demonstrated upregulation of COL-II expression in cartilage [ 32 ] . All COL-II mRNA and protein expression in articular cartilage was significantly elevated after hUCB-MNC treatment in our study, which concur with those in other studies, indicating that the intervention of hUCB-MNC suppressed intra-articular inflammation, repaired the damage of articular cartilage. The PI3K/AKT signaling pathway plays an important role in a variety of in vivo homeostatic and cellular activities, including cell cycle, cell viability, metabolism, inflammation, and apoptosis and has been implicated in the mechanisms of OA, protecting articular cartilage [ 33 , 34 ] . It has been shown that MMP-13 secretion was inhibited by activating the PI3K/AKT signaling pathway during the treatment of OA, thereby attenuating chondrocyte damage [ 35 ] . We found that the expression of p-PI3K, p-AKT protein in hUCB-MNC group was higher than that in other groups, and the difference was statistically significant. But its specific mechanism needs further study. There are some limitations in our experiments. In the study of PI3K/AKT pathway, the target of hUCB-MNC was not detected, and there is a lack of experiments to validate the phosphorylation of PI3K and AKT and the expression of MMP-13 in the hUCB-MNC group and the other groups by adding the inhibitor of the PI3K/AKT signaling pathway. Meanwhile, during hUCB-MNC intervention, the side knee joint of the rabbit model showed swelling. 5. Conclusion hUCB-MNCs could reduce the destruction of articular cartilage, alleviate the inflammatory response, and repair the damaged cartilage in KOA rabbits. However, there need more studies to explore the specific mechanism of hUCB-MNCs treating KOA. Declarations Competing interests All authors declare that they have no competing interests. Funding This study was supported by the Science Technology Foudation of Yantai City(2023YD055). Author Contribution Y.F conduct experiments and write the mian manuscriptC.Z design experiments and revise manuscriptY.Y and B.Z statistics and analysisM.Y and G.Z prepared figuresY.Z final revisions were made to the manuscriptAll authors reviewed the manuscript Availability of data and materials The datasets generated and analyzed in this study are available from the corresponding author on request. References QUINN R H, MURRAY J, PEZOLD R, et al. The American Academy of Orthopaedic Surgeons Appropriate Use Criteria for Surgical Management of Osteoarthritis of the Knee [J]. J Bone Joint Surg Am, 2017, 99(8): 697–9. ABBASI J. Can Exercise Prevent Knee Osteoarthritis? [J]. JAMA, 2017, 318(22): 2169–71. ZHANG W, OUYANG H, DASS C R, et al. Current research on pharmacologic and regenerative therapies for osteoarthritis [J]. Bone Res, 2016, 4: 15040. TANAKA E, DETAMORE M S, MERCURI L G. Degenerative disorders of the temporomandibular joint: etiology, diagnosis, and treatment [J]. J Dent Res, 2008, 87(4): 296–307. LIU L, LI Y. Chondroprotective and anti-nociceptive effects of caffeoylquinic acid in osteoarthritis by downregulating catabolic activity and oxidative damage in chondrocytes [J]. Biomed Pharmacother, 2017, 93: 985–94. BRUSCHETTINI M, ROMANTSIK O, MOREIRA A, et al. Stem cell-based interventions for the prevention of morbidity and mortality following hypoxic-ischaemic encephalopathy in newborn infants [J]. Cochrane Database Syst Rev, 2020, 8(8): CD013202. PENG X, SONG J, LI B, et al. Umbilical cord blood stem cell therapy in premature brain injury: Opportunities and challenges [J]. J Neurosci Res, 2020, 98(5): 815–25. WEISS M L, ANDERSON C, MEDICETTY S, et al. Immune Properties of Human Umbilical Cord Wharton's Jelly-Derived Cells [J]. Stem Cells, 2008, 26(11): 2865–74. TROYER D L, WEISS M L. Wharton's jelly-derived cells are a primitive stromal cell population [J]. Stem Cells, 2008, 26(3): 591–9. RALLAPALLI S, GUHATHAKURTA S, NARAYAN S, et al. Generation of clinical-grade red blood cells from human umbilical cord blood mononuclear cells [J]. Cell Tissue Res, 2019, 375(2): 437–49. KIM J E, LEE S M, KIM S H, et al. Effect of self-assembled peptide-mesenchymal stem cell complex on the progression of osteoarthritis in a rat model [J]. Int J Nanomedicine, 2014, 9 Suppl 1(Suppl 1): 141–57. CHIANG E R, MA H L, WANG J P, et al. Allogeneic Mesenchymal Stem Cells in Combination with Hyaluronic Acid for the Treatment of Osteoarthritis in Rabbits [J]. PLoS One, 2016, 11(2): e0149835. LI X W, FENG L X, ZHU X J, et al. Human umbilical cord blood mononuclear cells protect against renal tubulointerstitial fibrosis in cisplatin-treated rats [J]. Biomed Pharmacother, 2020, 121: 109662. PATON M C B, ALLISON B J, FAHEY M C, et al. Umbilical cord blood versus mesenchymal stem cells for inflammation-induced preterm brain injury in fetal sheep [J]. Pediatr Res, 2019, 86(2): 165–73. XING D, KWONG J, YANG Z, et al. Intra-articular injection of mesenchymal stem cells in treating knee osteoarthritis: a systematic review of animal studies [J]. Osteoarthritis Cartilage, 2018, 26(4): 445–61. JEVOTOVSKY D S, ALFONSO A R, EINHORN T A, et al. Osteoarthritis and stem cell therapy in humans: a systematic review [J]. Osteoarthritis Cartilage, 2018, 26(6): 711–29. FANG C, GUO J W, WANG Y J, et al. Diterbutyl phthalate attenuates osteoarthritis in ACLT mice via suppressing ERK/c-fos/NFATc1 pathway, and subsequently inhibiting subchondral osteoclast fusion [J]. Acta Pharmacol Sin, 2022, 43(5): 1299–310. HERMETO L C, ROSSI R, JARDIM P H, et al. Comparison between two different experimental models of osteoarthritis in rabbits. Intra-articular collagenase injection and anterior cruciate ligament transection [J]. Acta Cir Bras, 2016, 31(9): 602–7. LEQUESNE M G, SAMSON M. Indices of severity in osteoarthritis for weight bearing joints [J]. J Rheumatol Suppl, 1991, 27: 16–8. VAN DER SLUIJS J A, GEESINK R G, VAN DER LINDEN A J, et al. The reliability of the Mankin score for osteoarthritis [J]. J Orthop Res, 1992, 10(1): 58–61. CHOI M C, JO J, PARK J, et al. NF-kappaB Signaling Pathways in Osteoarthritic Cartilage Destruction [J]. Cells, 2019, 8(7). POOLE A R, KOBAYASHI M, YASUDA T, et al. Type II collagen degradation and its regulation in articular cartilage in osteoarthritis [J]. Ann Rheum Dis, 2002, 61 Suppl 2(Suppl 2): ii78-81. HUANG K, WU L D. Aggrecanase and aggrecan degradation in osteoarthritis: a review [J]. J Int Med Res, 2008, 36(6): 1149–60. MAN G S, MOLOGHIANU G. Osteoarthritis pathogenesis - a complex process that involves the entire joint [J]. J Med Life, 2014, 7(1): 37–41. ZHANG F J, YU W B, LUO W, et al. Effect of osteopontin on TIMP-1 and TIMP-2 mRNA in chondrocytes of human knee osteoarthritis in vitro [J]. Exp Ther Med, 2014, 8(2): 391–4. MITCHELL P G, MAGNA H A, REEVES L M, et al. Cloning, expression, and type II collagenolytic activity of matrix metalloproteinase-13 from human osteoarthritic cartilage [J]. J Clin Invest, 1996, 97(3): 761–8. MUELLER M B, TUAN R S. Anabolic/Catabolic balance in pathogenesis of osteoarthritis: identifying molecular targets [J]. PM R, 2011, 3(6 Suppl 1): S3-11. DI ROSA M, CASTROGIOVANNI P, MUSUMECI G. The Synovium Theory: Can Exercise Prevent Knee Osteoarthritis? The Role of "Mechanokines", A Possible Biological Key [J]. J Funct Morphol Kinesiol, 2019, 4(1). CASTROGIOVANNI P, DI ROSA M, RAVALLI S, et al. Moderate Physical Activity as a Prevention Method for Knee Osteoarthritis and the Role of Synoviocytes as Biological Key [J]. Int J Mol Sci, 2019, 20(3). YOSHIOKA M, COUTTS R D, AMIEL D, et al. Characterization of a model of osteoarthritis in the rabbit knee [J]. Osteoarthritis Cartilage, 1996, 4(2): 87–98. HUANG H, ZHANG P, XIANG C, et al. Effect of bone marrow mesenchymal stem cell transplantation combined with lugua polypeptide injection on osteoarthritis in rabbit knee joint [J]. Connect Tissue Res, 2022, 63(4): 370–81. JEON H J, YOON K A, AN E S, et al. Therapeutic Effects of Human Umbilical Cord Blood-Derived Mesenchymal Stem Cells Combined with Cartilage Acellular Matrix Mediated Via Bone Morphogenic Protein 6 in a Rabbit Model of Articular Cruciate Ligament Transection [J]. Stem Cell Rev Rep, 2020, 16(3): 596–611. CRAVERO J D, CARLSON C S, IM H J, et al. Increased expression of the Akt/PKB inhibitor TRB3 in osteoarthritic chondrocytes inhibits insulin-like growth factor 1-mediated cell survival and proteoglycan synthesis [J]. Arthritis Rheum, 2009, 60(2): 492–500. LITHERLAND G J, DIXON C, LAKEY R L, et al. Synergistic collagenase expression and cartilage collagenolysis are phosphatidylinositol 3-kinase/Akt signaling-dependent [J]. J Biol Chem, 2008, 283(21): 14221–9. LU J, FENG X, ZHANG H, et al. Maresin-1 suppresses IL-1beta-induced MMP-13 secretion by activating the PI3K/AKT pathway and inhibiting the NF-kappaB pathway in synovioblasts of an osteoarthritis rat model with treadmill exercise [J]. Connect Tissue Res, 2021, 62(5): 508–18. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 04 Mar, 2024 Reviews received at journal 14 Feb, 2024 Reviewers agreed at journal 10 Feb, 2024 Reviewers invited by journal 08 Feb, 2024 Editor assigned by journal 08 Feb, 2024 Submission checks completed at journal 07 Feb, 2024 First submitted to journal 04 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3926407","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":271801402,"identity":"1f7bbbd8-e085-4f56-babe-49f2e695549c","order_by":0,"name":"玉行 傅","email":"","orcid":"","institution":"The Second School of Clinical Medicine of Binzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"玉行","middleName":"","lastName":"傅","suffix":""},{"id":271801403,"identity":"31a4742d-cbde-4ebe-b4ac-95eee8b7f50e","order_by":1,"name":"Φ 张","email":"","orcid":"","institution":"Yantai Affiliated Hospital of Binzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Φ","middleName":"","lastName":"张","suffix":""},{"id":271801404,"identity":"3dab473e-3c4b-4842-9ac4-34a5913c0794","order_by":2,"name":"勇 杨","email":"","orcid":"","institution":"Yantai City Yantai Mountain Hospital","correspondingAuthor":false,"prefix":"","firstName":"勇","middleName":"","lastName":"杨","suffix":""},{"id":271801405,"identity":"54557e2f-ca98-46db-b25f-2ee22ec0c9b0","order_by":3,"name":"白水 周","email":"","orcid":"","institution":"Yantai Affiliated Hospital of Binzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"白水","middleName":"","lastName":"周","suffix":""},{"id":271801406,"identity":"cde81035-4059-49d5-a4c2-5c1ed7a91f1a","order_by":4,"name":"孟 杨","email":"","orcid":"","institution":"The Second School of Clinical Medicine of Binzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"孟","middleName":"","lastName":"杨","suffix":""},{"id":271801407,"identity":"18229cf2-6b24-41c7-95a9-ebd375e0a449","order_by":5,"name":"郭帅 朱","email":"","orcid":"","institution":"Yantai Affiliated Hospital of Binzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"郭帅","middleName":"","lastName":"朱","suffix":""},{"id":271801408,"identity":"0bb429fd-5dca-49a5-bc2c-7589c7b9227e","order_by":6,"name":"永林 朱","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYDACCQglw8bAfOBAQoUNDz9/A3FaeNgY2BIffDiTJiM54wCRWoDI2HBm22Ebg4YE/DrkZ/eYSXzcUcvDJ91gJs1z5jyPAcMBxg8fc3BrYZxzxkxy5pnjPGwyB9KkeSpu85gzNzBLztyGWwuzRI6ZNG/bMR42iYRjQFtu81g2HGBj5sWjhQ2hJbENyDjHY3AgAb8WHoiWGqCWZGag9w8Q1iIhkVZsCVLJJpHGCAzkZB7JGQeb8fpFfkbyxhsf2+rk5GfkfwBGpZ09P3/zwQ8f8WgBAhZg1BxGFmBswKseCJg/MDDUEVI0CkbBKBgFIxkAAJz7Tfhzvc3fAAAAAElFTkSuQmCC","orcid":"","institution":"Yantai Affiliated Hospital of Binzhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"永林","middleName":"","lastName":"朱","suffix":""}],"badges":[],"createdAt":"2024-02-04 05:44:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3926407/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3926407/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50928622,"identity":"c957a070-fba9-49b1-bd05-6f7ea5f38032","added_by":"auto","created_at":"2024-02-09 17:24:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":55065,"visible":true,"origin":"","legend":"\u003cp\u003eA: Opening the joint cavity, B: Cutting the ACL and resecting the medial meniscus, C: Arrow pointing to the side of the model shows visible swelling of the knee, D: Micro CT shows the formation of a bone capsule.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/64b9ecd5195f5dc5f6c8cf0e.jpg"},{"id":50927653,"identity":"84b862d5-2070-4d75-aeef-37c436b563b9","added_by":"auto","created_at":"2024-02-09 17:16:49","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":16556,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of CB-MNC on behavioral scores was significantly lower in the SH, PRP, and CB-MNC groups compared to the Model group after 5 weeks of treatment (P\u0026lt;0.01), as well as a significant decrease in scores in the CB-MNC group compared to the SH group (P\u0026lt;0.01), and a decrease in scores in the CB-MNC group compared to the PRP group (P\u0026lt;0.05). The Control group Scores were 0±0. Values are expressed as mean ± standard deviation (n=6). Compared with the CB-MNC group, #P\u0026lt;0.05 , ##P\u0026lt;0.01; compared with the Model group, *P\u0026lt;0.05 , **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/cb212eedb55524de3d03eb95.jpg"},{"id":50927768,"identity":"7dc52e71-5eb2-4c48-9196-e72c387adf0b","added_by":"auto","created_at":"2024-02-09 17:17:07","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":73852,"visible":true,"origin":"","legend":"\u003cp\u003eA: Control group, B: Model group, C: SH group, D: \u0026nbsp;PRP group, E: CB-MNC group\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/004e630c3d4ed275184371b0.jpg"},{"id":50927651,"identity":"469db1f2-c790-497a-9fd0-d89817cc5932","added_by":"auto","created_at":"2024-02-09 17:16:48","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":115785,"visible":true,"origin":"","legend":"\u003cp\u003eControl group, Model group, SH group, PRP group, and CB-MNC group. Coronal and cross-sectional CT of each group, with obvious pathological changes marked by arrows(n=3).\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/1d2fbe2a0ccfda5602925a3c.jpg"},{"id":50927689,"identity":"ca9b1f95-9b46-4001-845c-583aa6d67121","added_by":"auto","created_at":"2024-02-09 17:16:58","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":112959,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHE: \u003c/strong\u003eA: Control group, B: Model group, C: SH group, D: PRP group, E: CB-MNC group F: Mankin's score of each group(n=3), Control group (0.67±0.58), Model group (11±1), SH group (8.67±0.58), PRP group (5.33± 1.15), and CB-MNC group (2.67±0.58) compared with CB-MNC group, #P\u0026lt;0.05, ##P\u0026lt;0.01; compared with Model group, *P\u0026lt;0.05, **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/fb228f3fb37cbe7b171f5853.jpg"},{"id":50927695,"identity":"bb8f9d92-35d3-4889-a986-b7619ee86ca8","added_by":"auto","created_at":"2024-02-09 17:17:04","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":17458,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA: \u003c/strong\u003eIL-1β expression level in the joint fluid of each group(n=10), B: TNF-α expression level in the joint fluid of each group. Compared with CB-MNC group, #P\u0026lt;0.05 , ##P\u0026lt;0.01; compared with Model group, *P\u0026lt;0.05 , **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/adc54e41bc130a9910fd13f8.jpg"},{"id":50927688,"identity":"85256c12-070e-4ca4-a40b-eb62ffc13c62","added_by":"auto","created_at":"2024-02-09 17:16:58","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":18102,"visible":true,"origin":"","legend":"\u003cp\u003eA: Expression level of COL-II mRNA in articular cartilage of each group(n=6), B: Expression level of MMP-13 mRNA in articular cartilage of each group, Compared with CB-MNC group, #P\u0026lt;0.05, ##P\u0026lt;0.01; compared with Model group, *P\u0026lt;0.05, **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/26ca6230783268cb7376f83f.jpg"},{"id":50927654,"identity":"ef210327-9756-4a33-9b5b-54faeced960c","added_by":"auto","created_at":"2024-02-09 17:16:51","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":68599,"visible":true,"origin":"","legend":"\u003cp\u003eA: WB results. B: Statistical graph of MMP-13, COL-II, p-PI3K, p-AKT protein expression. compared with CB-MNC group, #P\u0026lt;0.05 , ##P\u0026lt;0.01; compared with Model group, *P\u0026lt;0.05 , **P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Picture8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/331d8f2ef02d272b159afb59.jpg"},{"id":50928623,"identity":"d6b0feee-2d17-4916-b798-ea5660995b80","added_by":"auto","created_at":"2024-02-09 17:25:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":701474,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3926407/v1/4d48786e-17f6-4ea9-884a-b10605f8e7d2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The effect of umbilical cord blood mononucleated cells on knee osteoarthritis in rabbits","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eKnee osteoarthritis (KOA), which is a kind of degenerative disease characterized by progressive breakdown of articular cartilage and the most frequent clinical type of osteoarthritis (OA), causes pain and limited function in the patient`s knee joint \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. There are few medical treatment for KOA, including nonsteroidal anti-inflammatory drugs (NSAIDs), opioid drugs, and symptomatic slow-acting drugs (diacerein, glucosamine, etc.). Other treatment protocols include the injection of medications into the joint cavity (sodium hyaluronate, platelet-rich plasma, etc.) and surgical intervention (joint replacement, etc.) a. Surgery is usually the last resort for severe KOA\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e, with certain financial burden for both patients and society\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. As a result, researches have recently been focused on creating novel strategies to promote cartilage regeneration, inhibit the progress of inflammation, and finally reverse the progression of KOA\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eDue to their regenerative and anti-inflammatory properties, stem cells are widely utilized to treat a variety of illnesses like spinal cord damage and neonatal hypoxic-ischemic encephalopathy\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Human umbilical cord blood (hUCB) stem cells, an important source of stem cells, have the characteristics of high expansion potential, low immunogenicity and can be conveniently and easily isolated from cord blood \u003csup\u003e[\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Human umbilical cord blood mono nucleated cells (hUCB-MNCs) contain hemopoietic stem cells (HSCs), mesenchymal stem cells (MSCs), endothelial progenitor cells (EPCs), lymphocytes, and monocytes, which can accelerate tissue repair and play an anti-inflammatory role\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Several recent preclinical studies have shown that injection of MSCs into OA joints in small animals is beneficial for cartilage repair\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. In addition, hUCB-MNC has been reported to have immunomodulatory effects on other inflammatory related diseases, such as renal tubulointerstitial fibrosis\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e and lipopolysaccharide induced acute kidney injury\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. However, according to a systematic review, the results of the current basic experiments are insufficient to support the use of human umbilical cord blood single-nucleated cells (hUCB-MNCs) in clinical trials for KOA\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. In addition, there are a limited number of high-quality clinical researches using stem cells to treat patients with OA\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Our experience fills the gap of injecting hUCB-MNCs into the cavity of knee in animals with KOA. Therefore, the main objective of our study is to clarify the efficacy of hUCB-MNCs in the treatment of KOA in rabbit knee joints.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cp\u003e2.1.1 \u003cstrong\u003eExperimental Animal and Grouping.\u003c/strong\u003e Fifty healthy 6-month-old male New Zealand white rabbits (2.5-3.0 kg) were purchased from Xilingjiao Breeding and Breeding Centre in Jinan, China, and the license number is SCXK (Lu) 20180010.The rabbits were housed in standard conditions: ambient temperature of 22\u0026plusmn;1\u0026deg;C, light/dark cycle of 12/12h, and humidity of 50%-70%. Adequate food and water was provided, and after acclimated for a week, 50 rabbits were randomly divided into 5 groups (Control group, Model group, SH group, PRP group, hUCB-MNC group) according to the random number table method. All experimental animals except the Control group were modeled by the ACLT method. All experiments were conducted under the Guidelines for Humanitarian Treatment of Laboratory Animals issued by the Ministry of Science and Technology of China in 2006 for the treatment of animals and were approved by the Animal Care and Use Committee of Binzhou Medical College.\u003c/p\u003e\n\u003cp\u003e2.1.2\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eModel construction and judgment.\u003c/strong\u003e Anterior cruciate ligament transection and medial meniscectomy was used to establish the KOA model \u003csup\u003e[17]\u003c/sup\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003eThe skin was opened by a median incision in the knee joint (about 4cm in length), and the joint cavity was opened by medial parapatellar approach. The patella was externally rotated, and the anterior cruciate ligament was cut off with the medial meniscus excised at the same time. After adequate hemostasis, the joint cavity was flushed twice with iodine povidone, peroxide, and physiological saline sequentially. After reducing the patella, a drawer test was done to prove the resect of anterior cruciate ligament function. The joint capsule and skin were sutured layer by layer, and the knee joint was wrapped with aseptic dressings with no immobilization. Postoperative daily intramuscular injection of penicillin 8.0*10\u003csup\u003e5\u003c/sup\u003eU for 3 days to prevent infection. According to the clinical characteristics of ultra-fatigue activities are prone to early onset of OA. One week after the operation, assist the experimental animals to move for half an hour twice a day. 6 weeks later, KOA rabbits model was established\u003csup\u003e[18]\u003c/sup\u003e.\u0026nbsp;(\u003cstrong\u003eFigure 1\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure 1:\u0026nbsp;\u003c/strong\u003eA: Opening the joint cavity, B: Cutting the ACL and resecting the medial meniscus, C: Arrow pointing to the side of the model shows visible swelling of the knee, D: Micro CT shows the formation of a bone capsule.\u003c/p\u003e\n\u003cp\u003e2.1.3 \u003cstrong\u003eCell source and intervention measures.\u003c/strong\u003e hUCB-MNC and PRP were provided by the cord Blood hematopoietic stem cell Bank of Shandong Province. hUCB-MNC (0.5\u0026times;10\u003csup\u003e8\u003c/sup\u003e/4ml) were removed from liquid nitrogen and resuscitated in a water bath at 37 degrees Celsius. The washing solution (normal saline + 20% human albumin) and mononuclear cells were mixed by 3:1 volume for 1200r, 10min, the supernatant was discarded, and new washing solution was injected, and then centrifuged for 1200r twice, and 4ml washing solution was added for 10min, and cell count was performed. The cell concentration was 4 \u0026times;10\u003csup\u003e6\u003c/sup\u003ecells/0.3ml.PRP (2.5\u0026times;10\u003csup\u003e9\u003c/sup\u003e/4ml) was subjected to 1200g, 10min, supernatant was taken, and then suspended in normal saline to make the concentration of PRP 4.5 \u0026times; 10\u003csup\u003e8\u003c/sup\u003ecells/0.3 ml.\u0026nbsp;The drug administration started 6 weeks after surgery. Control group did not have any treatment, Model group injected 0.3 ml of saline into the knee joint, SH group injected 0.3 ml of\u0026nbsp;sodium hyaluronate\u0026nbsp;(Spectrum\u0026nbsp;sodium hyaluronate\u0026nbsp;Injection 20 mg/2 ml), PRP group injected 4.5 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e cells/0.3 ml of PRP, and hUCB-MNC group injected 4 \u0026times; 10\u003csup\u003e6\u003c/sup\u003ecells/0.3 ml of cell suspension once a week for 5 weeks.\u003c/p\u003e\n\u003cp\u003e2.1.4\u003cstrong\u003e\u0026nbsp;Behavioral assessment.\u003c/strong\u003e Behavioral assessments in each group were carried out according to the Lequesne scoring scale\u003csup\u003e[19]\u003c/sup\u003e\u003cstrong\u003e（\u003c/strong\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e\u003cstrong\u003e）\u003c/strong\u003eincluding local pain stimulus-response, joint mobility, degree of joint swelling, and gait. All the assessments were done by two professional members.\u003c/p\u003e\n\u003cp\u003eTable 1 Standard of Lequesne MG scores\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"548\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"5\"\u003e\n \u003cp\u003eStandard of Lequesne MG scores\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eBehavioral manifestation of animals\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eScores\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLocal pain stimulation response\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNo abnormal pain response.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMild contraction of affected hind limb.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eContraction of affected hind limb with systemic reaction, such as shaking, turning head to lick.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSevere contraction of affected hind limb with shaking, struggling or escaping.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGait changes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNormal gait without limping.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMild limping when running.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eThe affected hind limb could participate in walking but limped obviously.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eThe affected hind limb couldn\u0026apos;t participate in walking, touch or pedal the ground.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eJoint range of motion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAbove 90\u0026deg;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e45\u0026deg;~ 90\u0026deg;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e15\u0026deg;~ 45\u0026deg;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eBelow 15\u0026deg;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eDegree of joint swelling\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNo swelling, bone markers clearly visible.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMild swelling, bone markers shallow.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eObvious swelling, disappearance of bone markers.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e2.2 \u003cstrong\u003eReagents and Instruments.\u003c/strong\u003e Hematoxylin, Eosin staining solution (Solarbio), Rabbit TNF-\u0026alpha; ELISA KIT, Rabbit IL-1\u0026beta; ELISA KIT (Shanghai Yuanjang Biotechnology Centre), Primers (Accurate Biotechnology), Trizol (TAKARA), BCA Protein Concentration Determination Kit ( Solarbio PC0020), RIPA lysate (Meilunbio), SDS-PAGE gel preparation kit (Biyunbio), ECL chemiluminescence detection kit (Meilunbio), primary antibody: \u0026beta;-actin (Santa Cruz Biotechnology Sc-47778), MMP-13 Polyclonal Antibody (Proteintech 18165-1-AP), Collagen Type II Polyclonal Antibody (Proteintech 28459-1-AP), Rabbit Anti-AKT1+2+3 (Bioss, bs- 6951R), Rabbit Anti-phospho-AKT (Bioss, bs0876R), Rabbit Anti-PI3KCA (Bioss, 2067R), Rabbit Anti-PI3K p110 beta (Bioss, bs-10657R), secondary antibody: Anti-rabbit IgG, HRP-linked Antibody (Cell Signaling Technology #7074), Anti-mouse IgG, HRP-linked Antibody (Cell Signaling Technology #7076). Inverted Microscope (Olympus), Electrophoresis Instrument (BIO-RAD), UV Spectrophotometer (Thermo Scientific), Fluorescence Quantitative PCR Instrument (Applied Biosystems), Surgical Instruments (Ningbo Medical Suture Factory).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Micro CT.\u003c/strong\u003e Micro-CT scanning of the right knee joint of experimental rabbits in each group was carried out by a small animal CT system using a tomographic thickness of 25um at 80kv, which was used to observe the recovery of knee joint in each group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 HE staining.\u0026nbsp;\u003c/strong\u003eAfter 5 weeks of drug intervention, the experimental animals in each group were executed by air embolism, and the cartilage specimens of femoral condyles of the knee joint on the modeling side were taken, fixed with 10% paraformaldehyde for 48h, decalcified with 10% EDTA for 8 weeks, dehydrated and paraffin-embedded, cut into 5um-thick paraffin sections, and then subjected to xylene permeabilization, deparaffinization, and rinsing in distilled water, and then subjected to hematoxylin-eosin staining, and the morphology of the cartilage tissues was observed with an inverted microscope, and 3 visual fields in each group were chosen to assess the damage of the cartilages based on Mankin\u0026apos;s score scale\u003csup\u003e[20]\u003c/sup\u003e\u003cstrong\u003e（\u003c/strong\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e\u003cstrong\u003e）\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTable 2\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"576\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"5\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Modified Mankin score\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"89.60138648180242%\"\u003e\n \u003cp\u003eStructure\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.946273830155979%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.946273830155979%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"2.946273830155979%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.559792027729636%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eNormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eIrregular surface, including fissures into the radial layer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003ePannus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eSuperficial cartilage layer(\u0026ge;6) absent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eSlight disorganization (cellular rows absent,some small superficial clusters)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eFissures into calcified cartilage layer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eDisorganization(chaotic struture,clusters,osteoclast activity)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"5\"\u003e\n \u003cp\u003eCellular abnormalities\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eNormal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eHypercellularity,including small superficial clusters\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eClusters\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eHypocellularity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"5\"\u003e\n \u003cp\u003eMatrix staining\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eNormal/slight reduction\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eStaining reduced in radial layer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eReduced in interterritorial matrix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eOnly present in pericellular matrix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"98.4375%\" colspan=\"4\"\u003e\n \u003cp\u003eAbsent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"1.5625%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e2.5\u003cstrong\u003e\u0026nbsp;ELISA.\u003c/strong\u003e After 5 weeks of drug intervention, the synovial fluid of the knee joint on the model side of each group was obtained by centrifugation, the supernatant was taken, and the concentrations of TNF-\u0026alpha; and IL-1\u0026beta; in the joint fluid were detected by Rabbit TNF-\u0026alpha; ELISA KIT and Rabbit IL-1\u0026beta; ELISA KIT (Shanghai Yuangju Biotechnology Center),to evaluate the anti-inflammatory effect of hUCB-MNC on local joints.\u003c/p\u003e\n\u003cp\u003e2.6 \u003cstrong\u003eReal-Time Quantitative PCR\u003c/strong\u003e\u003cstrong\u003e（qRT-PCR\u003c/strong\u003e\u003cstrong\u003e）.\u003c/strong\u003e Articular cartilage was excised from the medial femoral condyle of the right knee joint of experimental animals in each group and stored at -80\u0026deg;C. The expression of MMP-13 and COL-II mRNA in articular cartilage was detected by qRT-PCR. The tissues were weighed, and the articular cartilage was ground under liquid nitrogen. Total RNA was extracted from the articular cartilage with Trizol, and the concentration and purity of RNA were determined by a spectrophotometer, and then reverse transcribed to cDNA. qRT-PCR was performed using the cDNA as a template, the CT values of MMP-13 and COL-II were obtained, and the mRNA levels were normalized to GAPDH using the 2\u003csup\u003e-\u0026Delta;\u0026Delta;Cт\u003c/sup\u003e method to analyze\u0026nbsp;the relative expression. Primers were designed according to the corresponding sequences in GenBank using Premier 5.0 software, and the primer sequences are shown in \u003cstrong\u003e(Table 3)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eTable 3：Primer sequences for RT-PCR of target gene\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"544\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"2\" style=\"width: 86.8144%;\"\u003e\n \u003cp\u003ePrimer sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.9434%;\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 2.0957%;\"\u003e\n \u003cp\u003esequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.9434%;\"\u003e\n \u003cp\u003eGAPDH-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 65.4901%;\"\u003e\n \u003cp\u003eTCCTGCACCACCAACTGCTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.9434%;\"\u003e\n \u003cp\u003eGAPDH-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 65.4901%;\"\u003e\n \u003cp\u003eGGTCTTCTGGGTGGCAGTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.9434%;\"\u003e\n \u003cp\u003eMMP13-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 65.4901%;\"\u003e\n \u003cp\u003eGGTCTTCTGGCTCACGCTTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.9434%;\"\u003e\n \u003cp\u003eMMP13-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 65.4901%;\"\u003e\n \u003cp\u003eATGGGCAGCAACGAGAAACAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.9434%;\"\u003e\n \u003cp\u003eCOL-II-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 65.4901%;\"\u003e\n \u003cp\u003eGTGGTGACAAAGGCGAAAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 21.9434%;\"\u003e\n \u003cp\u003eCOL-II-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 65.4901%;\"\u003e\n \u003cp\u003eCCAGCCTTCTCGTCAAATCCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e2.7\u003cstrong\u003e\u0026nbsp;Western blot\u003c/strong\u003e Articular cartilage was excised from the medial femoral condyle of the right knee joint of experimental rabbits from all groups and stored at -80\u0026deg;C. It was used to detect the protein expression of MMP-13, COL-II, PI3K, and AKT as well as p-PI3K and p-AKT in the cartilage of rabbit knee joints. The total protein of knee cartilage tissues was extracted by RIPA lysate, protein concentration was determined by the BCA method, the protein samples of each protein were leveled, and the samples were subjected to SDS-PAGE after adding samples. The PAGE gel in which the target protein was located was cut off, the membrane was transferred, and it was ended After that, the membrane was closed with 5% skimmed milk for 1h, added primary antibody, shook the bed for 4\u0026deg;C overnight, and washed the membrane with TBST for 3 times, 10 minutes at a time.rr After incubation with a secondary antibody for 1h at room temperature, the membrane was washed 3 times with TBST and then developed and imaged by an ECL luminescence kit. The grey value of the protein bands was analyzed by using ImageJ software, and calibrated with the internal reference protein (\u0026beta;-actin), and the relative protein expression was calculated by the grey value of the target protein bands/the grey value of the internal reference protein.\u003c/p\u003e\n\u003cp\u003e2.8\u003cstrong\u003e\u0026nbsp;Statistical analysis\u0026nbsp;\u003c/strong\u003eSPSS statistical software was adopted for analysis, and the measurement data were expressed as（`x\u0026plusmn;s）and the comparison of data in multiple groups was analyzed by one-way ANOVA. Differences were considered statistically significant at P\u0026lt;0.05.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e3.1 \u003cb\u003eBehavioral assessment\u003c/b\u003e Behavioral scores of the treated groups Control group: 0, Model group: (8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58), Sodium hyaluronate group: (6\u0026thinsp;\u0026plusmn;\u0026thinsp;1), PRP group: (3.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69), CB-MNC group: (2.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5). Significantly higher scores were observed in the Model group as compared to the Control group indicating better behavioral improvement with lower scores. There was a statistically significant decrease in the scores of the Sodium hyaluronate group, PRP group, and CB-MNC group compared to the Model group, with the most significant decrease in CB-MNC group. The differences between the CB-MNC group and PRP and SH groups respectively were also statistically significant, indicating that the CB-MNC group had the best behavioral improvement \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.2 \u003cb\u003eGross morphology observation\u003c/b\u003e Each group\u0026rsquo;s femoral condyle was observed. In the Control group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-A\u003cb\u003e)\u003c/b\u003e, the surface of knee joint cartilage was bright, translucent, light blue and white in color, and elastic in touch. The joint surface was smooth, the cartilage thickness was normal, and there was no softening lesion on the surface and no osteophyteat the margin of the joint fracture. In the Model group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-B\u003cb\u003e)\u003c/b\u003e, the joint surface was rough and uneven, the joint surface was pale white and lost normal luster, part of the cartilage became thin, surface erosion and even ulcers were formed, cystic vacuolar feeling was felt, defective cartilage lesions were visible, and some even reached the deep layer of cartilage, exposed subchondral bone, and obvious osteophyte was formed at the joint edge, which was extremely irregular. In group SH \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-C\u003cb\u003e)\u003c/b\u003e, the surface color of the joint was light white, the surface of the joint was obviously rough and uneven, and the cartilage surface had cracks and the feeling of vacuole, accompanied by the formation of osteophytes at the edge of the cartilage. In the PRP group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-D\u003cb\u003e)\u003c/b\u003e, the surface color of the joint was slightly brighter, superficial cracks were occasionally seen on the surface of the cartilage, and the joint edges were more regular. In the CB-MNC group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-E\u003cb\u003e)\u003c/b\u003e, the surface of the cartilage was bright in color, and occasionally rough local cartilage surface could be seen, and the joint edges were neat and regular \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.3 \u003cb\u003eMicro CT Scan Results\u003c/b\u003e Micro-CT results showed that the experimental groups had some degree of improvement in the PRP group and CB-MNC group after 5 weeks of treatment. In the Model group, the medial articular surfaces of the femur and tibial plateau had varying degrees of defects and unevenness, the joint space was narrowed, and there was osteoporosis and the formation of bony encumbrances. After 5 weeks of treatment, there was little change in the SH group compared to the Model group, with bone defects and bone encumbrances, and in the PRP group, the articular surfaces were relatively smoother than those in the Model group, with less osteophytes and improved osteoporosis, while in the CB-MNC group, the articular surfaces of the CB-MNC group improved significantly compared to those of the Model group, with increased smoothness, no obvious bone encumbrances, and significantly improved osteoporosis. In addition, in the Control group, we can see that the articular surfaces of the femoral condyle and tibial plateau of the knee joint were smooth, the joint space was normal, and there was no osteophyte or osteoporosis. Overall, the repair effect shown by CT in the Model group, SH group, PRP group, and CB-MNC group was gradually enhanced\u003cb\u003e(\u003c/b\u003eFigure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.4 \u003cb\u003eCartilage HE staining and Mankin's score\u003c/b\u003e In this experiment, HE staining was performed on the articular cartilage of the medial femoral condyle of the right knee of each group, and the injury of articular cartilage was evaluated with Mankin's score. The lower the score, the less severe the injury of articular cartilage, indicating the better treatment effect. In the Control group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-A\u003cb\u003e)\u003c/b\u003e, articular chondrocytes were closely arranged, columnar, and neatly arranged, with a clear four-layer structure, smooth surface, uniform chromatin distribution, and no obvious defects. Mankin's score of 0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58 was significantly lower than that of the Model group (11\u0026thinsp;\u0026plusmn;\u0026thinsp;1) (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The articular cartilage surface of the PRP group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-D\u003cb\u003e)\u003c/b\u003e and CB-MNC group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-E\u003cb\u003e)\u003c/b\u003e was relatively flat, and the chondrocytes of the CB-MNC group were arranged more neatly than those of the PRP group, and no clustered chondrocytes were found, and the four-layer structure was more clearly distinguished from each other. Mankin's scores in the PRP group (5.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15) and CB-MNC group (2.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58) were lower than those in the Model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) At the same time, the Mankin's score of the CB-MNC group was also decreased compared with that of the PRP group and had statistical significance (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In group SH \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-C\u003cb\u003e)\u003c/b\u003e, there were fractures on the surface of the articular cartilage, but only on the surface of the cartilage. The chondrocytes were arranged relatively irregularly, and clumpy chondrocytes appeared, distributed unevenly, and the four-layer structure was slightly distinguishable. Mankin's score in group SH (8.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58) was lower than that in the Model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the Model group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-B\u003cb\u003e)\u003c/b\u003e, it was found that the articular cartilage was damaged and thin after staining. The four-layer structure was indistinguishable, the chondrocytes were arranged and disordered, and cracks appeared in them, chromatin thickened in some areas of necrotic cells, and the nucleus tilted to the cytoplasmic side. Mankin's score of the experimental group was found to be statistically significant compared with that of the Model group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e-F\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.5 \u003cb\u003eIL-1β and TNF-α were detected in the joint fluid by ELISA\u003c/b\u003e The concentrations of IL-1β and TNF-α in the knee joint fluid of each experimental group were measured by ELISA, and the results showed that the concentrations of IL-1β and TNF-α in the Model group were significantly and statistically higher compared to the Control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The concentrations of IL-1β and TNF-α were down-regulated in the SH group, the PRP group, and the CB-MNC group, but the down-regulation result in the CB-MNC group was the most significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that CB-MNC inhibited the concentrations of IL-1β and TNF-α in the joint fluid of each experimental group, and there were statistically significant differences compared to the SH and PRP groups. TNF-α concentrations, but the CB-MNC group had the most significant down-regulation results, and there was a statistically significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) comparing the SH and PRP groups, indicating that CB-MNC inhibited the inflammatory factors of IL-1β, TNF-α in the joint fluid with the most significant effect \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.6 \u003cb\u003eComparison of the mRNA expression levels of MMP-13 and COL-II in rabbit cartilage tissue\u003c/b\u003e MMP-13 mRNA was significantly higher and COL-II mRNA was significantly lower in the Model group compared to the Control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with the Model group, COL-II mRNA was significantly and statistically higher in the SH, PRP, and CB-MNC groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), with a more significant up-regulation effect in CB-MNC than in the SH and PRP groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In addition, MMP-13 mRNA expression was down-regulated in SH, PRP, and CB-MNC groups with statistical significance (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) compared with the Model group, with CB-MNC having a more significant down-regulation effect than SH and PRP groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.7 \u003cb\u003eComparison of the protein expression levels of MMP-13,COL-II, and PI3K/AKT signal pathway in rabbit cartilage\u003c/b\u003e: Compared with the Control group(n\u0026thinsp;=\u0026thinsp;6), MMP-13 protein expression was significantly elevated in Model group, while down-regulated COL-II protein expression was statistically significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Meanwhile, compared with the Model group, PRP group, CB-MNC group down-regulation of MMP-13 protein expression was statistically different, CB-MNC group up-regulation of COL-II protein expression was statistically different, CB-MNC group down-regulation of MMP-13 protein expression and up-regulation of COL-II protein expression was more significant and statistically significant compared with SH group, PRP group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). We examined the PI3K/AKT signaling pathway and found a significant difference in the increased expression of p-PI3K and p-AKT in the CB-MNC group compared to the other groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"4. Discussion","content":" \u003cp\u003eProgressive degeneration of articular cartilage is the core pathological mechanism in the development of OA\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Articular cartilage is a specialized connective tissue which is composed of chondrocytes and extracellular matrix (ECM). Among them, type II collagen is the main structural protein, and forms the network structure of the ECM together with aggregated proteoglycans \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Generally, the metabolism of these matrices is very slow and is regulated by chondrocytes, which synthesize the matrices, and by protein hydrolases, which break down the matrices. The homeostasis of cartilage catabolism and anabolism is mainly maintained by matrix metalloproteinase (MMP) and endogenous tissue inhibitors of metalloproteinases (TIMPs). Among these enzymes, matrix metalloproteinase 13 (MMP-13) is the key in the cleavage of COL-II, which is responsible for the destruction of articular cartilage in OA \u003csup\u003e[\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Under normal circumstances, there is a balance between catabolism and anabolism of articular cartilage. Under pathological conditions, nevertheless, fragmented chondrocytes are consumed by macrophages, and this phagocytosis could stimulate the A-type synoviocytes coming into an inflammatory state, generating a wide range of inflammatory factors and MMPs(TNF-α, IL-1β, and MMP-13), which in turn accelerates the decomposition of chondrocytes and the progression of OA \u003csup\u003e[\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Therefore, inhibiting the expression of TNF-α, IL-1β, and MMP-13, reducing the cleavage of COL-II, and suppressing inflammation have important roles in protecting articular cartilage.\u003c/p\u003e \u003cp\u003eThe choice of the method for preparation of OA rabbits, ACLT was based on the similar pathological progression in human and extensive usage in the study of OA \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. In our study, significant changes in articular cartilage were observed in the rabbit KOA model group in the gross view, CT, and morphological HE staining, including damaged articular surfaces, narrowing of articular space, formation of bone osteophytes as well as disordered arrangement of chondrocytes and infiltration of inflammatory. In contrast, KOA rabbits treated in hUCB-MNC group exhibited smoother articular surfaces, more aligned chondrocytes, and relatively intact cartilage layers. One study reported that bone marrow mesenchymal stem cells reduced TNF-α, IL-1β in the joint fluid of rabbit KOA models, thereby reducing inflammation\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. In the present study the concentration of TNF-α and IL-1β inflammatory factors detected in the joint fluid after hUCB-MNC intervention was significantly reduced compared to the model group, consistent with the results of aforementioned study. A cross-sectioned study on treatment of ACLT rabbits with human umbilical cord blood MSC demonstrated upregulation of COL-II expression in cartilage \u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. All COL-II mRNA and protein expression in articular cartilage was significantly elevated after hUCB-MNC treatment in our study, which concur with those in other studies, indicating that the intervention of hUCB-MNC suppressed intra-articular inflammation, repaired the damage of articular cartilage.\u003c/p\u003e \u003cp\u003eThe PI3K/AKT signaling pathway plays an important role in a variety of in vivo homeostatic and cellular activities, including cell cycle, cell viability, metabolism, inflammation, and apoptosis and has been implicated in the mechanisms of OA, protecting articular cartilage \u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. It has been shown that MMP-13 secretion was inhibited by activating the PI3K/AKT signaling pathway during the treatment of OA, thereby attenuating chondrocyte damage \u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. We found that the expression of p-PI3K, p-AKT protein in hUCB-MNC group was higher than that in other groups, and the difference was statistically significant. But its specific mechanism needs further study.\u003c/p\u003e \u003cp\u003eThere are some limitations in our experiments. In the study of PI3K/AKT pathway, the target of hUCB-MNC was not detected, and there is a lack of experiments to validate the phosphorylation of PI3K and AKT and the expression of MMP-13 in the hUCB-MNC group and the other groups by adding the inhibitor of the PI3K/AKT signaling pathway. Meanwhile, during hUCB-MNC intervention, the side knee joint of the rabbit model showed swelling.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003ehUCB-MNCs could reduce the destruction of articular cartilage, alleviate the inflammatory response, and repair the damaged cartilage in KOA rabbits. However, there need more studies to explore the specific mechanism of hUCB-MNCs treating KOA.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eAll authors declare that they have no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was supported by the Science Technology Foudation of Yantai City(2023YD055).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eY.F conduct experiments and write the mian manuscriptC.Z design experiments and revise manuscriptY.Y and B.Z statistics and analysisM.Y and G.Z prepared figuresY.Z final revisions were made to the manuscriptAll authors reviewed the manuscript\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e \u003cp\u003eThe datasets generated and analyzed in this study are available from the corresponding author on request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eQUINN R H, MURRAY J, PEZOLD R, et al. The American Academy of Orthopaedic Surgeons Appropriate Use Criteria for Surgical Management of Osteoarthritis of the Knee [J]. J Bone Joint Surg Am, 2017, 99(8): 697\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eABBASI J. Can Exercise Prevent Knee Osteoarthritis? [J]. JAMA, 2017, 318(22): 2169\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG W, OUYANG H, DASS C R, et al. Current research on pharmacologic and regenerative therapies for osteoarthritis [J]. Bone Res, 2016, 4: 15040.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTANAKA E, DETAMORE M S, MERCURI L G. Degenerative disorders of the temporomandibular joint: etiology, diagnosis, and treatment [J]. J Dent Res, 2008, 87(4): 296\u0026ndash;307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLIU L, LI Y. Chondroprotective and anti-nociceptive effects of caffeoylquinic acid in osteoarthritis by downregulating catabolic activity and oxidative damage in chondrocytes [J]. Biomed Pharmacother, 2017, 93: 985\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBRUSCHETTINI M, ROMANTSIK O, MOREIRA A, et al. Stem cell-based interventions for the prevention of morbidity and mortality following hypoxic-ischaemic encephalopathy in newborn infants [J]. Cochrane Database Syst Rev, 2020, 8(8): CD013202.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePENG X, SONG J, LI B, et al. Umbilical cord blood stem cell therapy in premature brain injury: Opportunities and challenges [J]. J Neurosci Res, 2020, 98(5): 815\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWEISS M L, ANDERSON C, MEDICETTY S, et al. Immune Properties of Human Umbilical Cord Wharton's Jelly-Derived Cells [J]. Stem Cells, 2008, 26(11): 2865\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTROYER D L, WEISS M L. Wharton's jelly-derived cells are a primitive stromal cell population [J]. Stem Cells, 2008, 26(3): 591\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRALLAPALLI S, GUHATHAKURTA S, NARAYAN S, et al. Generation of clinical-grade red blood cells from human umbilical cord blood mononuclear cells [J]. Cell Tissue Res, 2019, 375(2): 437\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKIM J E, LEE S M, KIM S H, et al. Effect of self-assembled peptide-mesenchymal stem cell complex on the progression of osteoarthritis in a rat model [J]. Int J Nanomedicine, 2014, 9 Suppl 1(Suppl 1): 141\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHIANG E R, MA H L, WANG J P, et al. Allogeneic Mesenchymal Stem Cells in Combination with Hyaluronic Acid for the Treatment of Osteoarthritis in Rabbits [J]. PLoS One, 2016, 11(2): e0149835.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI X W, FENG L X, ZHU X J, et al. Human umbilical cord blood mononuclear cells protect against renal tubulointerstitial fibrosis in cisplatin-treated rats [J]. Biomed Pharmacother, 2020, 121: 109662.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePATON M C B, ALLISON B J, FAHEY M C, et al. Umbilical cord blood versus mesenchymal stem cells for inflammation-induced preterm brain injury in fetal sheep [J]. Pediatr Res, 2019, 86(2): 165\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXING D, KWONG J, YANG Z, et al. Intra-articular injection of mesenchymal stem cells in treating knee osteoarthritis: a systematic review of animal studies [J]. Osteoarthritis Cartilage, 2018, 26(4): 445\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJEVOTOVSKY D S, ALFONSO A R, EINHORN T A, et al. Osteoarthritis and stem cell therapy in humans: a systematic review [J]. Osteoarthritis Cartilage, 2018, 26(6): 711\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFANG C, GUO J W, WANG Y J, et al. Diterbutyl phthalate attenuates osteoarthritis in ACLT mice via suppressing ERK/c-fos/NFATc1 pathway, and subsequently inhibiting subchondral osteoclast fusion [J]. Acta Pharmacol Sin, 2022, 43(5): 1299\u0026ndash;310.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHERMETO L C, ROSSI R, JARDIM P H, et al. Comparison between two different experimental models of osteoarthritis in rabbits. Intra-articular collagenase injection and anterior cruciate ligament transection [J]. Acta Cir Bras, 2016, 31(9): 602\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLEQUESNE M G, SAMSON M. Indices of severity in osteoarthritis for weight bearing joints [J]. J Rheumatol Suppl, 1991, 27: 16\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVAN DER SLUIJS J A, GEESINK R G, VAN DER LINDEN A J, et al. The reliability of the Mankin score for osteoarthritis [J]. J Orthop Res, 1992, 10(1): 58\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHOI M C, JO J, PARK J, et al. NF-kappaB Signaling Pathways in Osteoarthritic Cartilage Destruction [J]. Cells, 2019, 8(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePOOLE A R, KOBAYASHI M, YASUDA T, et al. Type II collagen degradation and its regulation in articular cartilage in osteoarthritis [J]. Ann Rheum Dis, 2002, 61 Suppl 2(Suppl 2): ii78-81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHUANG K, WU L D. Aggrecanase and aggrecan degradation in osteoarthritis: a review [J]. J Int Med Res, 2008, 36(6): 1149\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMAN G S, MOLOGHIANU G. Osteoarthritis pathogenesis - a complex process that involves the entire joint [J]. J Med Life, 2014, 7(1): 37\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHANG F J, YU W B, LUO W, et al. Effect of osteopontin on TIMP-1 and TIMP-2 mRNA in chondrocytes of human knee osteoarthritis in vitro [J]. Exp Ther Med, 2014, 8(2): 391\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMITCHELL P G, MAGNA H A, REEVES L M, et al. Cloning, expression, and type II collagenolytic activity of matrix metalloproteinase-13 from human osteoarthritic cartilage [J]. J Clin Invest, 1996, 97(3): 761\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMUELLER M B, TUAN R S. Anabolic/Catabolic balance in pathogenesis of osteoarthritis: identifying molecular targets [J]. PM R, 2011, 3(6 Suppl 1): S3-11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDI ROSA M, CASTROGIOVANNI P, MUSUMECI G. The Synovium Theory: Can Exercise Prevent Knee Osteoarthritis? The Role of \"Mechanokines\", A Possible Biological Key [J]. J Funct Morphol Kinesiol, 2019, 4(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCASTROGIOVANNI P, DI ROSA M, RAVALLI S, et al. Moderate Physical Activity as a Prevention Method for Knee Osteoarthritis and the Role of Synoviocytes as Biological Key [J]. Int J Mol Sci, 2019, 20(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYOSHIOKA M, COUTTS R D, AMIEL D, et al. Characterization of a model of osteoarthritis in the rabbit knee [J]. Osteoarthritis Cartilage, 1996, 4(2): 87\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHUANG H, ZHANG P, XIANG C, et al. Effect of bone marrow mesenchymal stem cell transplantation combined with lugua polypeptide injection on osteoarthritis in rabbit knee joint [J]. Connect Tissue Res, 2022, 63(4): 370\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJEON H J, YOON K A, AN E S, et al. Therapeutic Effects of Human Umbilical Cord Blood-Derived Mesenchymal Stem Cells Combined with Cartilage Acellular Matrix Mediated Via Bone Morphogenic Protein 6 in a Rabbit Model of Articular Cruciate Ligament Transection [J]. Stem Cell Rev Rep, 2020, 16(3): 596\u0026ndash;611.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCRAVERO J D, CARLSON C S, IM H J, et al. Increased expression of the Akt/PKB inhibitor TRB3 in osteoarthritic chondrocytes inhibits insulin-like growth factor 1-mediated cell survival and proteoglycan synthesis [J]. Arthritis Rheum, 2009, 60(2): 492\u0026ndash;500.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLITHERLAND G J, DIXON C, LAKEY R L, et al. Synergistic collagenase expression and cartilage collagenolysis are phosphatidylinositol 3-kinase/Akt signaling-dependent [J]. J Biol Chem, 2008, 283(21): 14221\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLU J, FENG X, ZHANG H, et al. Maresin-1 suppresses IL-1beta-induced MMP-13 secretion by activating the PI3K/AKT pathway and inhibiting the NF-kappaB pathway in synovioblasts of an osteoarthritis rat model with treadmill exercise [J]. Connect Tissue Res, 2021, 62(5): 508\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-orthopaedic-surgery-and-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"josr","sideBox":"Learn more about [Journal of Orthopaedic Surgery and Research](http://josr-online.biomedcentral.com)","snPcode":"13018","submissionUrl":"https://submission.nature.com/new-submission/13018/3","title":"Journal of Orthopaedic Surgery and Research","twitterHandle":"@MSKmedBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Osteoarthritis, Umbilical cord blood mononuclear cells, Platelet-rich plasma","lastPublishedDoi":"10.21203/rs.3.rs-3926407/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3926407/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eTo investigate the effect of umbilical cord blood-mononuclear cells (UCB-MNC) on the treatment of knee osteoarthritis (KOA) in rabbits and its possible mechanism.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThe rabbit knee osteoarthritis model was prepared by anterior cruciate ligament (ACLT) method. Fifty New Zealand white rabbits were randomly divided into the Control group, Model group, sodium hyaluronate (SH) group, platelet rich plasma (PRP) group, and UCB-MNC group. Knee cavity injection was performed once a week for 5 consecutive weeks. The gross view of the knee joint, the cartilage morphology of the knee joint, and the structural changes of the knee joint in imaging were observed by behavior, gross shape of the knee joint, HE staining, and CT. The levels of TNF-α and IL-1β in rabbit knee fluid were detected by ELISA. Western blot and QRT-PCR were used to detect the expression of MMP-13 and COL-II protein and mRNA in knee cartilage.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eFrom the behavioral Lequesne MG scores, morphological HE staining Mankin's scores, the scores of model group were significantly higher compared with that of control group. The SH, PRP, and UCB-MNC group had sequentially lower scores compared to theModel group. From CT, KOA features were more pronounced in the model group compared to other groups, and there was a slight improvement in imaging knee osteoarthritis in the CB-MNC group compared to the SH and PRP groups. Compared with the control group, the Model group had increased levels of TNF-α,\u003c/p\u003e","manuscriptTitle":"The effect of umbilical cord blood mononucleated cells on knee osteoarthritis in rabbits","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-09 17:16:20","doi":"10.21203/rs.3.rs-3926407/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-03-04T11:28:13+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-14T11:54:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"0bba2c0b-9ae5-45d3-907b-4fe9fda00b0b","date":"2024-02-10T15:54:38+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-09T03:59:49+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-08T15:03:24+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-07T16:40:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Orthopaedic Surgery and Research","date":"2024-02-04T05:35:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-orthopaedic-surgery-and-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"josr","sideBox":"Learn more about [Journal of Orthopaedic Surgery and Research](http://josr-online.biomedcentral.com)","snPcode":"13018","submissionUrl":"https://submission.nature.com/new-submission/13018/3","title":"Journal of Orthopaedic Surgery and Research","twitterHandle":"@MSKmedBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c7b330cc-3b2e-4792-8621-35c8145d7b8b","owner":[],"postedDate":"February 9th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-05-27T22:53:11+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-09 17:16:20","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3926407","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3926407","identity":"rs-3926407","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}