First Record of a Naso tergus Specimen Exhibiting Unilateral Absence of the Shield-shaped Bony Plates on the Caudal Peduncle

First Record of a Naso tergus Specimen Exhibiting Unilateral Absence of the Shield-shaped Bony Plates on the Caudal Peduncle | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article First Record of a Naso tergus Specimen Exhibiting Unilateral Absence of the Shield-shaped Bony Plates on the Caudal Peduncle Junjie Zheng, Yang He, Siyuan Li, Zhiqi Zou, Mingru Chen, Jiamei Xiao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9537167/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract A single adult male Naso tergus Ho, Shen & Chang, 2011 specimen with complete unilateral absence of the caudal peduncle shield-shaped bony plates was collected on 5 January 2026 at Seashine International Aquatic Trading Center in Xiamen, Fujian, China. It is the first malformation record in Nasinae, and the specimen exceeds the species’ maximum body size record, providing a reference for studying bony plate ecological functions and developmental mechanisms in Nasinae. malformation Naso tergus caudal peduncle bony plates Figures Figure 1 Figure 2 Introduction As a genus within the family Acanthuridae, Naso is characterized by the presence of one or two fixed shield-shaped bony plates on each side of the caudal peduncle. Species of the subgenus Axinurus possess only one fixed bony plate on each side of the caudal peduncle, whereas all other species of Naso have two (Randall, 1994 ). To date, studies on the function of these bony plates remain scarce. Previous research showed that the posterior caudal peduncle bony plates width of Naso unicornis exhibits sexual dimorphism and can serve as a sex predictor when combined with fork length (FL) (DeMartini, 2016 ). Ancestral Naso species were pelagic feeders, and benthic feeding represents a derived trait. All species of Naso retain the caudal fin propulsion unit characteristic of pelagic scombrid fishes (Klanten et al., 2004 ), yet no study has clarified whether the caudal peduncle bony plates in Naso contribute to drag reduction and enhanced swimming performance. DeMartini ( 2016 ) noted that the anterior bony plates of N. unicornis showed a higher proportion of wear and damage, but did not investigate the underlying causes. In contrast, the function of the caudal spines in Acanthurus has been documented. Schober & Ditrich ( 1992 ) demonstrated through behavioral observations that paired Acanthurus leucosternon use their caudal spines to attack intruders during territorial interactions, a behavior that has not yet been recorded in Nasinae. Intraspecific variation in caudal spines has been reported in Zebrasoma scopas (Cuvier, 1829): most individuals have smooth, sharp, and retractable caudal spines, whereas some individuals exhibit distinct anteriorly directed processes that occur in pairs (Tebbett & Bellwood, 2018 ). However, no records of caudal plate variation exist for any species of Naso . Here we report an anomalous individual of N. tergus , a species for which records and studies are still limited. The left caudal peduncle, which completely lacks the bony plate, showed no signs of injury, protuberance, or depression; the bony plates on the right side developed normally. This record supports future studies on the function of caudal peduncle bony plates in Nasinae and provides a basis for further understanding structure-function relationships. Materials and Methods The deceased specimen was collected on 5 January 2026 from a fish market in Xiamen, Fujian, China. According to the fishermen, the specimen was captured on 3 January in the northern South China Sea. The morphometric data of the fresh specimen were measured following the method of Randall & Bell (1992). Photos of the left and right lateral sides of the body were taken using a Nikon Z5 II camera with a Nikkor Z 24–50 mm lens. Close-up photographs of the dorsal view of caudal peduncle were also taken for comparison with X‑ray imaging results. For morphological identification, the taxonomic status of the specimen was determined according to the Key to Marine and Estuaries Fishes of China . Morphometric data were compared with the data of N. tergus in Ho et al. (2011). The specimen was preserved in absolute ethanol, cataloged under accession number SCSMBC110056, deposited in the South China Sea Marine Biological Collection/Museum. Twelve hours before DNA extraction, the samples preserved in 75% ethanol were thawed and soaked in ddH₂O for rehydration prior to DNA extraction. DNA extraction was performed using the Animal Genomic DNA Quick Extraction Kit for PCR Analysis from Beyotime. The extracted products were immediately subjected to PCR using 2× Taq Master Mix from Vazyme. The primers used were FishF2: TCGACTAATCATAAAGATATCGGCA and FishR2: ACTTCAGGGTGACCGAAGAATCAGAA (Ward et al. , 2005). The PCR program was as follows: pre-denaturation at 95 °C for 3 min, followed by 35 amplification cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 40 s, with a final extension at 72 °C for 10 min. The products were then immediately stored in a 4 °C refrigerator. Products were examined by 10% agarose gel electrophoresis at 140 V for 30 min to verify quality. After passing quality inspection, the PCR products and primers were sent to Sangon Biotech (Xiamen Sequencing Department) for single‑directional first‑generation sequencing. The sequencing results were uploaded to the National Library of Medicine (NCBI) database. For the observation of variable traits, with the assistance of the Department of Radiology at Xiang’an Hospital Affiliated to Xiamen University, the caudal peduncle of the individual was photographed in dorsal view using the Wandong Medical New Oriental 1000 Digital Medical X-ray Radiography System (DR) to examine the development of bony plates on the caudal peduncle. 2.1 Ethical Statement The specimen examined in this study was purchased from local aquatic markets, and the specimen already deceased at the time of collection. No live specimens were captured, handled, or used in any experimental procedures throughout the research. Therefore, no ethical approval was required for this study. Results Table 1 Comparison of morphological data between the malformed and normal Naso tergus specimens Deformed specimen Normal specimens Ho et al. Mizuki Matsunuma* and Hiroyuki Motomura Standard length (SL, in mm) 412 275-335(n=13) 363 %SL Range Head length 23.2 24.6-26.6 23.7 Body depth 32.9 34.4-36.8 31.2 Body width 14.2 13.3-15.2 12.5 Predorsal length 24.5 25.2-28.7 25.5 Prepectoral length 22.5 23.5-27.6 23.2 Prepelvic length 27.1 29.3-33.2 27.6 Preanal length 36.7 38.6-41.3 36.6 Snout length 12.9 13.2-14.1 13.4 Eye diameter 4.7 6.3-7.2 6 Interorbital width 9.1 8.9-10.0 9.3 Upper jaw length 5.4 4.9-5.7 5.5 Suborbital width 8.8 8.6-10.0 8.1 1st dorsal-fin spine length 7.1 5.5-12.7 9.4 2nd dorsal-fin spine length 8.4 8.6-10.8 9.2 3rd dorsal-fin spine length 7.8 8.2-10.7 8.9 4th dorsal-fin spine length 8.4 8.1-10.3 9 5th dorsal-fin spine length 7.6 8.8-11.7 - 6th dorsal-fin spine length 7.1 8.4-9.7 8.6 Pectoral fi n length 13.6 14.0-15.7 15.8 Pelvic-fi n spine length 9 8.0-10.5 9.8 1st anal-fi n spine length 5.6 3.6-7.9 6.1 2nd anal-fi n spine length 4.4 5.6-8.6 6.6 Caudal peduncle length 14.2 7.8-9.9 8.2 Caudal peduncle depth 4.2 4.3-5.3 4 Caudal peduncle width 5 5.4-6.7 5.9 Caudal fork length 15.1 16.2-18.0 15.5 Caudal fin length 23.8 23.0-28.1 25.7 The COI sequences obtained in this study have been submitted to the NCBI database(Subject: GenBank PZ221057). As no reference COI sequences were available in NCBI for verification, the specimen was identified by morphological methods. The individual was identified as Naso tergus (Acanthuriformes: Acanthuridae: Nasinae) based on the following characters: snout not protrusible as a beak; caudal peduncle with bony plates; anal fin with 2 spines; ventral fin with 1 spine and 3 soft rays; dorsal fin with 6 spines and 28 soft rays; body sides without small dark markings; dorsal body bright green, ventral side pale; caudal fin dark brown. This individual possessed two bony plates on the right side of the caudal peduncle, while no bony plate on the left side. The two plates on the same side were nearly equal in size, semicircular, slightly pointed, with the tips projecting anteriorly. Accordingly, the specimen was inferred to be an adult male (Ho et al. 2011). The standard length of this specimen was 412 mm, with all morphometric measurements recorded in Table 1. No lesions, protuberances or depressions were observed on the epidermal surface of the left caudal peduncle where the shield-shaped bony plates were absent; the bony plates on the right side developed normally and their morphology was consistent with the descriptions in Ho et al. (2011). X-ray image (Fig. 2a) revealed that the subcutaneous portion of the bony plates on the right caudal peduncle was normally developed, whereas no fractured or undeveloped bony plate structures were detected in the subcutaneous tissue of the left caudal peduncle. Discussion This study records the first case of unilateral absence of shield-shaped bony plates on the caudal peduncle in the genus Naso . Additionally, the standard length (SL) of this variant individual reaches 412 mm, which exceeds the previously recorded maximum SL of N. tergus (363 mm) (M. & Motomura, 2013). These findings provide fundamental data for research on the morphological diversity of this species and the development of shield-shaped bony plates in the genus Naso . Determination of the nature of unilateral scutate bony plate absence Injury and malformation are distinct. The former refers to the direct physical damage to living tissues (Ellis et al. , 2008), while the latter denotes the congenital or acquired distortion of an organ or body part (Collins English Dictionary, 2025). X-ray image of the dorsal view of the specimen’s caudal peduncle revealed no residual tissues or scars indicative of abrasion or injury, ruling out physical damage. Thus, the bony plates absence is confirmed as a local malformation, which provides a reference for subsequent studies on bony plate development and skeletal malformations. Analysis of the causes of local skeletal malformation Skeletal malformations in fish are a research hotspot in aquatic biology. Previous studies and records of fish skeletal malformations have mostly focused on scoliosis, fin malformations and other variants (Chris Noble et al., 2012; Jawad, Ibrahim & Farrag, 2019), while records of malformations characterized by local skeletal absence are rare, with relevant research being insufficient. Panagiotis Berillis (2015) reviewed fish skeletal malformations and their influencing factors, pointing out that deficiencies in vitamin K or C, excessive vitamin A, swim bladder absence, water flow, gene mutations and other factors may directly induce skeletal malformations in fish. Due to the lack of research on the formation mechanism of bony plates in Naso , only inferences are made herein. Two potential causes for the malformation in this individual are proposed. Firstly, congenital developmental defects, whereby the molecular pathways regulating bony plates development were blocked during the embryonic stage, leading to a complete failure of bony plate formation (Haga et al ., 2002). Secondly, acquired bony plates loss caused by local infection, parasitism or other factors, where only the epidermal tissue healed at the loss site without regeneration of new bony plate tissue. If the first hypothesis is valid, the asymmetry of the malformation is presumably mainly due to the asymmetric effect of toxic substances in the environment during embryonic development (Haga et al ., 2002), which inhibited the asymmetric expression of genes associated with unilateral bony plates development and thus completely suppressed the development of bony plates on that side. This study only documents the variant based on morphological data, without comprehensive confirmation of its variation mechanism through molecular biology, histology, living environment monitoring or other methods. The exact influencing factors and mechanisms of this malformation remain to be investigated. Analysis of morphological data Morphometric data showed that the ratios of most measured parameters of this individual were less than or close to the lower limit of the recorded range for this species (Ho et al. , 2011). However, conventional comparative evaluation of the morphometric data was not feasible due to the coexistence of super-record body size and skeletal malformation as variables. The survival and growth of this malformed individual to a standard length exceeding the species’ maximum record indicate that the absence of unilateral bony plates on the caudal peduncle does not severely affect the individual’s survival. Nevertheless, the function of shield-shaped bony plates on the caudal peduncle has not yet been clarified, and their impact on the survival and reproduction of fish remains unknown. Future research can be supplemented by the discovery and analysis of more variant specimens, as well as the tracking and recording of living samples. Declarations AUTHOR CONTRIBUTIONS J.Z., Y.H. and S.L were jointly responsible for morphological data measurement, photographing and manuscript preparation. J.Z and Y.H conducted sample collection. M.C contributed to data interpretation and manuscript revision. All authors have reviewed and approved the final manuscript. ACKNOWLEDGEMENTS We would like to express our sincere gratitude to Qian Jiang, Xinyu Zhang and Associate Professor Zhi Wang from the Biology of Marine Benthic Invertebrates Group for their valuable guidance and assistance during the sequencing process. We are also thankful to the director and physicians from the Department of Radiology, Siming Campus, Xiang’an Hospital Affiliated to Xiamen University for their patient support in X-ray imaging of the specimens. Funding No funding was received for conducting this study. CONFLICT OF INTER EST STATEMENT There are no conflicts of interest. References Berillis, P. (2015). Factors that can lead to the development of skeletal deformities in fishes: A review. Journal of Fisheries Sciences.com, 9(3), 017-023. https://www.fisheriessciences.com/ Collins English Dictionary. (2025). Deformity. In Collins English Dictionary . HarperCollins. DeMartini, E. E. (2016). Sexual Dimorphisms in the Bluespine Unicornfish, Naso unicornis (Acanthuridae): External Metrics for Movement Ecology and Life History. Copeia, 104(2), 498–505. https://doi.org/10.1643/CE-15-270 Ellis, T., Oidtmann, B., St‐Hilaire, S., Turnbull, J. F., North, B. P., MacIntyre, C. M., & Knowles, T. G. (2008). Fin erosion in farmed fish. Fish welfare , 121-149.https://doi.org/10.1002/9780470697610.ch9Digital Object Identifier Haga, Y., Suzuki, T., & Takeuchi, T. (2002). Retinoic acid isomers produce malformations in postembryonic development of the Japanese flounder, Paralichthys olivaceus . Zoological Science , 19 (10), 1105–1112. https://doi.org/10.2108/zsj.19.1105 Ho, H.-C., Shen, K.-N., & Chang, C.-W. (2011). A new species of the unicornfish genus Naso (Teleostei: Acanthuridae) from Taiwan, with comments on its phylogenetic relationship. The Raffles Bulletin of Zoology , 59 (2), 205–211. Jawad, L. A., Ibrahim, M., & Farrag, M. M. S. (2019). Severe scoliosis and fin deformities in three fish species collected from Jubail Vicinity, Saudi Arabia, Arabian Gulf. Thalassas, 35 , 591–598. https://doi.org/10.1007/s41208-019-00145-3 Klanten, S., Bermingham, E., & Choat, J. H. (2004). Molecular phylogeny of the reef fish genus Naso (F. Acanthuridae): Evolution of feeding modes, body shape and timing of lineages. Molecular Phylogenetics and Evolution, 32(2), 494-513. https://doi.org/10.1016/j.ympev.2004.03.009 Mizuki, M.* and Hiroyuki, M. 2013. First Japanese record of Naso tergus (Perciformes: Acanthuridae) from the Tokara Islands, southern Japan. Japan J. Ichthyol., 60 (2): 103–110. https://doi.org/10.11369/jji.60.103 Noble, C., Cañon Jones, H. A., Damsgård, B., et al. (2012). Injuries and deformities in fish: their potential impacts upon aquacultural production and welfare. Fish Physiology and Biochemistry, 38 , 61–83. https://doi.org/10.1007/s10695-011-9557-1 Randall, J. E. 1994. Unicornfishes of the Subgenus Axinurus (Perciformes: Acanthuridae: Naso), with Description of a New Species. Copeia, 1994(1): 116-124. https://doi.org/10.2307/1446677. Randall, J. E., & Bell, L. J. (1992). Naso caesius , a new acanthurid fish from the central Pacific. Schober, U. M., & Ditrich, H. (1992). Anatomy and use of the caudal spines in the aggressive behaviour of a surgeonfish (Osteichthyes: Acanthuridae). Marine Behaviour and Physiology , 21 (4), 277–284. https://doi.org/10.1080/10236249209378831 Tebbett, S. B., & Bellwood, D. R. (2018). Unusual caudal spines in the surgeonfish Zebrasoma scopas. Coral Reefs , 37 , 251. https://doi.org/10.1007/s00338-017-1652-z Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R., & Hebert, P. D. N. (2005). DNA barcoding Australia's fish species. Philosophical Transactions of the Royal Society B: Biological Sciences , 360 (1462), 1847–1857. https://doi.org/10.1098/rstb.2005.1716 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviewers invited by journal 01 May, 2026 Editor assigned by journal 01 May, 2026 Submission checks completed at journal 29 Apr, 2026 First submitted to journal 27 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9537167","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":637320947,"identity":"21322a6d-4d31-4d49-9ab7-4be1a15f6ec6","order_by":0,"name":"Junjie Zheng","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Junjie","middleName":"","lastName":"Zheng","suffix":""},{"id":637320950,"identity":"152753a6-63ba-4435-93a1-4af359f4bd4a","order_by":1,"name":"Yang He","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"He","suffix":""},{"id":637320952,"identity":"fe452e43-570a-44fa-921b-b39242693738","order_by":2,"name":"Siyuan Li","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Siyuan","middleName":"","lastName":"Li","suffix":""},{"id":637320954,"identity":"4b84caab-cab3-4a5e-9a11-7e0532c55f3c","order_by":3,"name":"Zhiqi Zou","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Zhiqi","middleName":"","lastName":"Zou","suffix":""},{"id":637320956,"identity":"f6ae3287-1a96-48f1-a818-295782e7363c","order_by":4,"name":"Mingru Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArElEQVRIiWNgGAWjYHACNiC2gTB5SNCSRrqWwyRo0Z19+NmDjzvOJ66dkcD44G0bg7w5IS1m59LMDWeeuW1sdiOB2XBuG4PhzgZCWs7wsEnztt2WA2oBMRgSDA4Qo+Vv2zkeoBb238RrYWw7ALaFmUgtbGaSvW3JxmZnHjZLzjknYbiBsBbmZxI/2+wStx1PPvjhTZmNPEFbkABjA5CQIF79KBgFo2AUjALcAAC8fTwdVOrZmwAAAABJRU5ErkJggg==","orcid":"","institution":"Xiamen University","correspondingAuthor":true,"prefix":"","firstName":"Mingru","middleName":"","lastName":"Chen","suffix":""},{"id":637320958,"identity":"f87cbf1f-82c6-4c33-9efe-8553a1609d6f","order_by":5,"name":"Jiamei Xiao","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Jiamei","middleName":"","lastName":"Xiao","suffix":""}],"badges":[],"createdAt":"2026-04-27 06:24:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9537167/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9537167/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":108940467,"identity":"b7e686dd-7fbb-4a26-b7e1-a63a29857db1","added_by":"auto","created_at":"2026-05-11 05:13:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":751451,"visible":true,"origin":"","legend":"\u003cp\u003ePhotos of \u003cem\u003eNaso tergus\u003c/em\u003e. Left lateral view without shield-shaped bony plates(a) and right lateral view with normal shield-shaped bony plates (b)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9537167/v1/2b8eb92ae37e8823df764567.png"},{"id":108977999,"identity":"d958ea3a-688f-4792-91f1-b555be49597d","added_by":"auto","created_at":"2026-05-11 11:33:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1203578,"visible":true,"origin":"","legend":"\u003cp\u003eX-ray image (a) and photo (b) of the dorsal view of caudal peduncle of \u003cem\u003eNaso tergus\u003c/em\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9537167/v1/9c751f1d02a0b0cd85a00bd0.png"},{"id":108979862,"identity":"1b38ad03-79b5-41e8-8c69-2268cd6f0109","added_by":"auto","created_at":"2026-05-11 12:02:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2514052,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9537167/v1/3b67d2d8-f708-4e47-9d9e-6719e30ba139.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"First Record of a Naso tergus Specimen Exhibiting Unilateral Absence of the Shield-shaped Bony Plates on the Caudal Peduncle","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAs a genus within the family Acanthuridae, \u003cem\u003eNaso\u003c/em\u003e is characterized by the presence of one or two fixed shield-shaped bony plates on each side of the caudal peduncle. Species of the subgenus \u003cem\u003eAxinurus\u003c/em\u003e possess only one fixed bony plate on each side of the caudal peduncle, whereas all other species of \u003cem\u003eNaso\u003c/em\u003e have two (Randall, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). To date, studies on the function of these bony plates remain scarce. Previous research showed that the posterior caudal peduncle bony plates width of \u003cem\u003eNaso unicornis\u003c/em\u003e exhibits sexual dimorphism and can serve as a sex predictor when combined with fork length (FL) (DeMartini, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Ancestral \u003cem\u003eNaso\u003c/em\u003e species were pelagic feeders, and benthic feeding represents a derived trait. All species of \u003cem\u003eNaso\u003c/em\u003e retain the caudal fin propulsion unit characteristic of pelagic scombrid fishes (Klanten et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), yet no study has clarified whether the caudal peduncle bony plates in \u003cem\u003eNaso\u003c/em\u003e contribute to drag reduction and enhanced swimming performance. DeMartini (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) noted that the anterior bony plates of \u003cem\u003eN. unicornis\u003c/em\u003e showed a higher proportion of wear and damage, but did not investigate the underlying causes. In contrast, the function of the caudal spines in \u003cem\u003eAcanthurus\u003c/em\u003e has been documented. Schober \u0026amp; Ditrich (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1992\u003c/span\u003e) demonstrated through behavioral observations that paired \u003cem\u003eAcanthurus leucosternon\u003c/em\u003e use their caudal spines to attack intruders during territorial interactions, a behavior that has not yet been recorded in Nasinae.\u003c/p\u003e \u003cp\u003eIntraspecific variation in caudal spines has been reported in \u003cem\u003eZebrasoma scopas\u003c/em\u003e (Cuvier, 1829): most individuals have smooth, sharp, and retractable caudal spines, whereas some individuals exhibit distinct anteriorly directed processes that occur in pairs (Tebbett \u0026amp; Bellwood, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, no records of caudal plate variation exist for any species of \u003cem\u003eNaso\u003c/em\u003e. Here we report an anomalous individual of \u003cem\u003eN. tergus\u003c/em\u003e, a species for which records and studies are still limited. The left caudal peduncle, which completely lacks the bony plate, showed no signs of injury, protuberance, or depression; the bony plates on the right side developed normally. This record supports future studies on the function of caudal peduncle bony plates in Nasinae and provides a basis for further understanding structure-function relationships.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eThe deceased specimen was collected on 5 January 2026 from a fish market in Xiamen, Fujian, China. According to the fishermen, the specimen was captured on 3 January in the northern South China Sea. The morphometric data of the fresh specimen were measured following the method of Randall \u0026amp; Bell (1992). Photos of the left and right lateral sides of the body were taken using a Nikon Z5 II camera with a Nikkor Z 24\u0026ndash;50 mm lens. Close-up photographs of the dorsal view of caudal peduncle were also taken for comparison with X‑ray imaging results. For morphological identification, the taxonomic status of the specimen was determined according to the \u003cem\u003eKey to Marine and Estuaries Fishes of China\u003c/em\u003e. Morphometric data were compared with the data of \u003cem\u003eN. tergus\u003c/em\u003e in Ho \u003cem\u003eet al.\u003c/em\u003e (2011). The specimen was preserved in absolute ethanol, cataloged under accession number SCSMBC110056, deposited in the South China Sea Marine Biological Collection/Museum.\u003c/p\u003e\n\u003cp\u003eTwelve hours before DNA extraction, the samples preserved in 75% ethanol were thawed and soaked in ddH₂O for rehydration prior to DNA extraction. DNA extraction was performed using the Animal Genomic DNA Quick Extraction Kit for PCR Analysis from Beyotime. The extracted products were immediately subjected to PCR using 2\u0026times; Taq Master Mix from Vazyme. The primers used were FishF2: TCGACTAATCATAAAGATATCGGCA and FishR2: ACTTCAGGGTGACCGAAGAATCAGAA (Ward \u003cem\u003eet al.\u003c/em\u003e, 2005). The PCR program was as follows: pre-denaturation at 95 \u0026deg;C for 3 min, followed by 35 amplification cycles of denaturation at 95 \u0026deg;C for 30 s, annealing at 58 \u0026deg;C for 30 s, and extension at 72 \u0026deg;C for 40 s, with a final extension at 72 \u0026deg;C for 10 min. The products were then immediately stored in a 4 \u0026deg;C refrigerator. Products were examined by 10% agarose gel electrophoresis at 140 V for 30 min to verify quality. After passing quality inspection, the PCR products and primers were sent to Sangon Biotech (Xiamen Sequencing Department) for single‑directional first‑generation sequencing. The sequencing results were uploaded to the National Library of Medicine (NCBI) database.\u003c/p\u003e\n\u003cp\u003eFor the observation of variable traits, with the assistance of the Department of Radiology at Xiang\u0026rsquo;an Hospital Affiliated to Xiamen University, the caudal peduncle of the individual was photographed in dorsal view using the Wandong Medical New Oriental 1000 Digital Medical X-ray Radiography System (DR) to examine the development of bony plates on the caudal peduncle.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.1 Ethical Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe specimen examined in this study was purchased from local aquatic markets, and the specimen already deceased at the time of collection. No live specimens were captured, handled, or used in any experimental procedures throughout the research. Therefore, no ethical approval was required for this study.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eTable 1 Comparison of morphological data between the malformed and normal \u003cem\u003eNaso tergus\u003c/em\u003e specimens\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"616\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003eDeformed specimen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" colspan=\"2\" style=\"width: 45.2922%;\"\u003e\n \u003cp\u003eNormal specimens\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003eHo \u003cem\u003eet al.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003eMizuki Matsunuma* and Hiroyuki Motomura\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eStandard length (SL, in mm)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e412\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e275-335(n=13)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e363\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e%SL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003eRange\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eHead length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e23.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e24.6-26.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e23.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eBody depth\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e32.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e34.4-36.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e31.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eBody width\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e14.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e13.3-15.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e12.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003ePredorsal length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e24.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e25.2-28.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e25.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003ePrepectoral length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e22.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e23.5-27.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e23.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003ePrepelvic length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e27.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e29.3-33.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e27.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003ePreanal length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e36.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e38.6-41.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e36.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eSnout length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e12.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e13.2-14.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e13.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eEye diameter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e4.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e6.3-7.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eInterorbital width\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e9.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e8.9-10.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e9.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eUpper jaw length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e5.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e4.9-5.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e5.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eSuborbital width\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e8.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e8.6-10.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e8.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e1st dorsal-fin spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e7.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e5.5-12.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e9.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e2nd dorsal-fin spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e8.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e8.6-10.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e9.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e3rd dorsal-fin spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e7.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e8.2-10.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e8.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e4th dorsal-fin spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e8.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e8.1-10.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e5th dorsal-fin spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e7.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e8.8-11.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e6th dorsal-fin spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e7.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e8.4-9.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e8.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003ePectoral fi n length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e13.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e14.0-15.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e15.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003ePelvic-fi n spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e8.0-10.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e9.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e1st anal-fi n spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e5.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e3.6-7.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e6.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003e2nd anal-fi n spine length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e4.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e5.6-8.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e6.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eCaudal peduncle length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e14.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e7.8-9.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e8.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eCaudal peduncle depth\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e4.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e4.3-5.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eCaudal peduncle width\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e5.4-6.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e5.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eCaudal fork length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e15.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e16.2-18.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e15.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd nowrap=\"\" style=\"width: 32.1429%;\"\u003e\n \u003cp\u003eCaudal fin length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 22.5649%;\"\u003e\n \u003cp\u003e23.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 17.0455%;\"\u003e\n \u003cp\u003e23.0-28.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd nowrap=\"\" style=\"width: 28.2468%;\"\u003e\n \u003cp\u003e25.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe COI sequences obtained in this study have been submitted to the NCBI database(Subject: GenBank PZ221057). As no reference COI sequences were available in NCBI for verification, the specimen was identified by morphological methods. The individual was identified as \u003cem\u003eNaso tergus\u003c/em\u003e (Acanthuriformes: Acanthuridae: Nasinae) based on the following characters: snout not protrusible as a beak; caudal peduncle with bony plates; anal fin with 2 spines; ventral fin with 1 spine and 3 soft rays; dorsal fin with 6 spines and 28 soft rays; body sides without small dark markings; dorsal body bright green, ventral side pale; caudal fin dark brown. This individual possessed two bony plates on the right side of the caudal peduncle, while no bony plate on the left side. The two plates on the same side were nearly equal in size, semicircular, slightly pointed, with the tips projecting anteriorly. Accordingly, the specimen was inferred to be an adult male (Ho \u003cem\u003eet al.\u003c/em\u003e 2011).\u003c/p\u003e\n\u003cp\u003eThe standard length of this specimen was 412 mm, with all morphometric measurements recorded in Table 1.\u003c/p\u003e\n\u003cp\u003eNo lesions, protuberances or depressions were observed on the epidermal surface of the left caudal peduncle where the shield-shaped bony plates were absent; the bony plates on the right side developed normally and their morphology was consistent with the descriptions in Ho \u003cem\u003eet al.\u003c/em\u003e (2011). X-ray image (Fig. 2a) revealed that the subcutaneous portion of the bony plates on the right caudal peduncle was normally developed, whereas no fractured or undeveloped bony plate structures were detected in the subcutaneous tissue of the left caudal peduncle.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study records the first case of unilateral absence of shield-shaped bony plates on the caudal peduncle in the genus \u003cem\u003eNaso\u003c/em\u003e. Additionally, the standard length (SL) of this variant individual reaches 412 mm, which exceeds the previously recorded maximum SL of \u003cem\u003eN. tergus\u003c/em\u003e (363 mm) (M. \u0026amp; Motomura, 2013). These findings provide fundamental data for research on the morphological diversity of this species and the development of shield-shaped bony plates in the genus \u003cem\u003eNaso\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of the nature of unilateral scutate bony plate absence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInjury and malformation are distinct. The former refers to the direct physical damage to living tissues (Ellis \u003cem\u003eet al.\u003c/em\u003e, 2008), while the latter denotes the congenital or acquired distortion of an organ or body part (Collins English Dictionary, 2025).\u003c/p\u003e\n\u003cp\u003eX-ray image of the dorsal view of the specimen’s caudal peduncle revealed no residual tissues or scars indicative of abrasion or injury, ruling out physical damage. Thus, the bony plates absence is confirmed as a local malformation, which provides a reference for subsequent studies on bony plate development and skeletal malformations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of the causes of local skeletal malformation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSkeletal malformations in fish are a research hotspot in aquatic biology. Previous studies and records of fish skeletal malformations have mostly focused on scoliosis, fin malformations and other variants (Chris Noble \u003cem\u003eet al.,\u003c/em\u003e 2012; Jawad, Ibrahim \u0026amp; Farrag, 2019), while records of malformations characterized by local skeletal absence are rare, with relevant research being insufficient. Panagiotis Berillis (2015) reviewed fish skeletal malformations and their influencing factors, pointing out that deficiencies in vitamin K or C, excessive vitamin A, swim bladder absence, water flow, gene mutations and other factors may directly induce skeletal malformations in fish.\u003c/p\u003e\n\u003cp\u003eDue to the lack of research on the formation mechanism of bony plates in \u003cem\u003eNaso\u003c/em\u003e, only inferences are made herein. Two potential causes for the malformation in this individual are proposed. Firstly, congenital developmental defects, whereby the molecular pathways regulating bony plates development were blocked during the embryonic stage, leading to a complete failure of bony plate formation (Haga \u003cem\u003eet al\u003c/em\u003e., 2002). Secondly, acquired bony plates loss caused by local infection, parasitism or other factors, where only the epidermal tissue healed at the loss site without regeneration of new bony plate tissue. If the first hypothesis is valid, the asymmetry of the malformation is presumably mainly due to the asymmetric effect of toxic substances in the environment during embryonic development (Haga \u003cem\u003eet al\u003c/em\u003e., 2002), which inhibited the asymmetric expression of genes associated with unilateral bony plates development and thus completely suppressed the development of bony plates on that side.\u003c/p\u003e\n\u003cp\u003eThis study only documents the variant based on morphological data, without comprehensive confirmation of its variation mechanism through molecular biology, histology, living environment monitoring or other methods. The exact influencing factors and mechanisms of this malformation remain to be investigated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of morphological data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMorphometric data showed that the ratios of most measured parameters of this individual were less than or close to the lower limit of the recorded range for this species (Ho \u003cem\u003eet al.\u003c/em\u003e, 2011). However, conventional comparative evaluation of the morphometric data was not feasible due to the coexistence of super-record body size and skeletal malformation as variables.\u003c/p\u003e\n\u003cp\u003eThe survival and growth of this malformed individual to a standard length exceeding the species’ maximum record indicate that the absence of unilateral bony plates on the caudal peduncle does not severely affect the individual’s survival. Nevertheless, the function of shield-shaped bony plates on the caudal peduncle has not yet been clarified, and their impact on the survival and reproduction of fish remains unknown. Future research can be supplemented by the discovery and analysis of more variant specimens, as well as the tracking and recording of living samples.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJ.Z., Y.H. and S.L were jointly responsible for morphological data measurement, photographing and manuscript preparation. J.Z and Y.H conducted sample collection. M.C contributed to data interpretation and manuscript revision. All authors have reviewed and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to express our sincere gratitude to Qian Jiang, Xinyu Zhang and Associate Professor Zhi Wang from the Biology of Marine Benthic Invertebrates Group for their valuable guidance and assistance during the sequencing process. We are also thankful to the director and physicians from the Department of Radiology, Siming Campus, Xiang’an Hospital Affiliated to Xiamen University for their patient support in X-ray imaging of the specimens.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo funding was received for conducting this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTER EST STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere are no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBerillis, P. (2015). Factors that can lead to the development of skeletal deformities in fishes: A review. Journal of Fisheries Sciences.com, 9(3), 017-023. https://www.fisheriessciences.com/\u003c/li\u003e\n \u003cli\u003eCollins English Dictionary. (2025). Deformity. In \u003cem\u003eCollins English Dictionary\u003c/em\u003e. HarperCollins.\u003c/li\u003e\n \u003cli\u003eDeMartini, E. E. (2016). Sexual Dimorphisms in the Bluespine Unicornfish, Naso unicornis (Acanthuridae): External Metrics for Movement Ecology and Life History. Copeia, 104(2), 498\u0026ndash;505. https://doi.org/10.1643/CE-15-270\u003c/li\u003e\n \u003cli\u003eEllis, T., Oidtmann, B., St‐Hilaire, S., Turnbull, J. F., North, B. P., MacIntyre, C. M., \u0026amp; Knowles, T. G. (2008). Fin erosion in farmed fish. \u003cem\u003eFish welfare\u003c/em\u003e, 121-149.https://doi.org/10.1002/9780470697610.ch9Digital Object Identifier\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHaga, Y., Suzuki, T., \u0026amp; Takeuchi, T. (2002). Retinoic acid isomers produce malformations in postembryonic development of the Japanese flounder, \u003cem\u003eParalichthys olivaceus\u003c/em\u003e. \u003cem\u003eZoological Science\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(10), 1105\u0026ndash;1112.\u0026nbsp;https://doi.org/10.2108/zsj.19.1105\u003c/li\u003e\n \u003cli\u003eHo, H.-C., Shen, K.-N., \u0026amp; Chang, C.-W. (2011). A new species of the unicornfish genus \u003cem\u003eNaso\u003c/em\u003e (Teleostei: Acanthuridae) from Taiwan, with comments on its phylogenetic relationship. \u003cem\u003eThe Raffles Bulletin of Zoology\u003c/em\u003e, \u003cem\u003e59\u003c/em\u003e(2), 205\u0026ndash;211.\u003c/li\u003e\n \u003cli\u003eJawad, L. A., Ibrahim, M., \u0026amp; Farrag, M. M. S. (2019). Severe scoliosis and fin deformities in three fish species collected from Jubail Vicinity, Saudi Arabia, Arabian Gulf.\u0026nbsp;\u003cem\u003eThalassas, 35\u003c/em\u003e, 591\u0026ndash;598.\u0026nbsp;https://doi.org/10.1007/s41208-019-00145-3\u003c/li\u003e\n \u003cli\u003eKlanten, S., Bermingham, E., \u0026amp; Choat, J. H. (2004). Molecular phylogeny of the reef fish genus Naso (F. Acanthuridae): Evolution of feeding modes, body shape and timing of lineages. Molecular Phylogenetics and Evolution, 32(2), 494-513. https://doi.org/10.1016/j.ympev.2004.03.009\u003c/li\u003e\n \u003cli\u003eMizuki, M.* and Hiroyuki, M. 2013. First Japanese record of\u0026nbsp;\u003cem\u003eNaso tergus\u0026nbsp;\u003c/em\u003e(Perciformes: Acanthuridae) from the Tokara Islands, southern Japan. Japan J. Ichthyol., 60 (2): 103\u0026ndash;110.\u0026nbsp;https://doi.org/10.11369/jji.60.103\u003c/li\u003e\n \u003cli\u003eNoble, C., Ca\u0026ntilde;on Jones, H. A., Damsg\u0026aring;rd, B., et al. (2012). Injuries and deformities in fish: their potential impacts upon aquacultural production and welfare. \u003cem\u003eFish Physiology and Biochemistry, 38\u003c/em\u003e, 61\u0026ndash;83.\u0026nbsp;https://doi.org/10.1007/s10695-011-9557-1\u003c/li\u003e\n \u003cli\u003eRandall, J. E. 1994. Unicornfishes of the Subgenus Axinurus (Perciformes: Acanthuridae: Naso), with Description of a New Species. Copeia, 1994(1): 116-124. https://doi.org/10.2307/1446677.\u003c/li\u003e\n \u003cli\u003eRandall, J. E., \u0026amp; Bell, L. J. (1992).\u0026nbsp;\u003cem\u003eNaso caesius\u003c/em\u003e, a new acanthurid fish from the central Pacific.\u003c/li\u003e\n \u003cli\u003eSchober, U. M., \u0026amp; Ditrich, H. (1992). Anatomy and use of the caudal spines in the aggressive behaviour of a surgeonfish (Osteichthyes: Acanthuridae). \u003cem\u003eMarine Behaviour and Physiology\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e(4), 277\u0026ndash;284.\u0026nbsp;https://doi.org/10.1080/10236249209378831\u003c/li\u003e\n \u003cli\u003eTebbett, S. B., \u0026amp; Bellwood, D. R. (2018). Unusual caudal spines in the surgeonfish Zebrasoma scopas. \u003cem\u003eCoral Reefs\u003c/em\u003e, \u003cem\u003e37\u003c/em\u003e, 251. https://doi.org/10.1007/s00338-017-1652-z\u003c/li\u003e\n \u003cli\u003eWard, R. D., Zemlak, T. S., Innes, B. H., Last, P. R., \u0026amp; Hebert, P. D. N. (2005). DNA barcoding Australia\u0026apos;s fish species. \u003cem\u003ePhilosophical Transactions of the Royal Society B: Biological Sciences\u003c/em\u003e, \u003cem\u003e360\u003c/em\u003e(1462), 1847\u0026ndash;1857. https://doi.org/10.1098/rstb.2005.1716\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"thalassas-an-international-journal-of-marine-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"thal","sideBox":"Learn more about [Thalassas: An International Journal of Marine Sciences](http://link.springer.com/journal/41208)","snPcode":"41208","submissionUrl":"https://submission.nature.com/new-submission/41208/3","title":"Thalassas: An International Journal of Marine Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"malformation, Naso tergus, caudal peduncle, bony plates","lastPublishedDoi":"10.21203/rs.3.rs-9537167/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9537167/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eA single adult male \u003cem\u003eNaso tergus \u003c/em\u003eHo, Shen \u0026amp; Chang, 2011 specimen with complete unilateral absence of the caudal peduncle shield-shaped bony plates was collected on 5 January 2026 at Seashine International Aquatic Trading Center in Xiamen, Fujian, China. It is the first malformation record in Nasinae, and the specimen exceeds the species’ maximum body size record, providing a reference for studying bony plate ecological functions and developmental mechanisms in Nasinae.\u003c/p\u003e","manuscriptTitle":"First Record of a Naso tergus Specimen Exhibiting Unilateral Absence of the Shield-shaped Bony Plates on the Caudal Peduncle","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-11 05:13:16","doi":"10.21203/rs.3.rs-9537167/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewersInvited","content":"","date":"2026-05-01T12:16:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-05-01T12:15:28+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-30T01:11:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"Thalassas: An International Journal of Marine Sciences","date":"2026-04-27T06:18:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"thalassas-an-international-journal-of-marine-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"thal","sideBox":"Learn more about [Thalassas: An International Journal of Marine Sciences](http://link.springer.com/journal/41208)","snPcode":"41208","submissionUrl":"https://submission.nature.com/new-submission/41208/3","title":"Thalassas: An International Journal of Marine Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"02df4165-1a09-414f-b138-f57fd75d6e3f","owner":[],"postedDate":"May 11th, 2026","published":true,"recentEditorialEvents":[{"type":"reviewersInvited","content":"12","date":"2026-05-01T12:16:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-05-01T12:15:28+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-30T01:11:13+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-11T05:13:16+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-11 05:13:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9537167","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9537167","identity":"rs-9537167","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}