The Role of the Striatin Family Proteins in Hippo Signaling and Cellular Regulation

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract The Striatin family proteins, including Striatin, SG2NA, and Zinedin, belong to the calmodulin-binding WD-40 repeat protein group and are components of the Striatin Interacting Phosphatase and Kinase (STRIPAK) complex. These proteins are known for their roles as scaffold proteins, facilitating various cellular pathways and regulating cell-cell interactions and signaling mechanisms. It has also been shown that Striatin is expressed in cell junctions, highlighting its potential role in maintaining cell integrity and communication. The current study aimed to elucidate the biological significance of the Striatin proteins by employing shRNA technology. This approach allowed us to modulate their expression levels and observe the resulting effects on cellular processes. Our data show that the Striatin family members significantly influence the Hippo signaling pathway by protecting phosphorylated YAP (pYAP) from proteasomal degradation, thus regulating the expression of Hippo target genes. This regulation impacts key cellular processes such as cell migration. RNA sequencing analyses of keratinocytes and fibroblasts depleted of Striatin proteins facilitated the identification of novel gene sets affected by the modulation of Striatin expression and provided insights into the broader impact of Striatin proteins and their roles in various cellular pathways.
Full text 179,836 characters · extracted from preprint-html · click to expand
The Role of the Striatin Family Proteins in Hippo Signaling and Cellular Regulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Role of the Striatin Family Proteins in Hippo Signaling and Cellular Regulation Rina Rosin-Arbesfeld, Yarden Shor-Nareznoy, Michal Caspi, Yan Lender, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6093370/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Aug, 2025 Read the published version in Cell & Bioscience → Version 1 posted 5 You are reading this latest preprint version Abstract The Striatin family proteins, including Striatin, SG2NA, and Zinedin, belong to the calmodulin-binding WD-40 repeat protein group and are components of the Striatin Interacting Phosphatase and Kinase (STRIPAK) complex. These proteins are known for their roles as scaffold proteins, facilitating various cellular pathways and regulating cell-cell interactions and signaling mechanisms. It has also been shown that Striatin is expressed in cell junctions, highlighting its potential role in maintaining cell integrity and communication. The current study aimed to elucidate the biological significance of the Striatin proteins by employing shRNA technology. This approach allowed us to modulate their expression levels and observe the resulting effects on cellular processes. Our data show that the Striatin family members significantly influence the Hippo signaling pathway by protecting phosphorylated YAP (pYAP) from proteasomal degradation, thus regulating the expression of Hippo target genes. This regulation impacts key cellular processes such as cell migration. RNA sequencing analyses of keratinocytes and fibroblasts depleted of Striatin proteins facilitated the identification of novel gene sets affected by the modulation of Striatin expression and provided insights into the broader impact of Striatin proteins and their roles in various cellular pathways. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION The Striatin family of proteins consists of Striatin (STRN1), SG2NA (STRN3), and Zinedin (STRN4), which are multi-domain scaffolding proteins that include a caveolin-binding domain, a coiled-coil region, a calmodulin-binding domain, and a WD-repeat domain [ 1 , 2 ]. The unique structural organization implies a defined function for these proteins, yet data show that their function, subcellular localization, and expression patterns varies in different scenarios [ 3 , 4 ]. The Striatin proteins are both cytosolic and membranal proteins that function in cell-cell adhesion [ 3 , 5 ] and are core components of the Striatin-interacting phosphatase and kinase (STRIPAK) complex, which is a large protein complex involved in cytoskeleton organization, cell migration, and neural development [ 6 – 10 ]. Although the three proteins share similar characteristics, some differences can be found. For example, while Striatin and Zinedin share more similarity regarding their function and cellular distribution (mainly dendritic spines), SG2NA is more ubiquitously distributed and can be found in all human tissues [ 4 ]. In addition, there is a slight change in the amino-acid sequence at the N-terminus of Striatin and Zinedin, which further distinguishes them from SG2NA [ 3 ]. The functions of the Striatin proteins and the STRIPAK complex are not entirely clear probably due to their number and pattern of the interacting partners, cell specificity, and timely expression. Striatin was shown to affect the Wnt pathway, by binding to the core Wnt signaling component adenomatous polyposis coli (APC) [ 11 ]. Recent data also link the STRIPAK complex to the Hippo pathway [ 12 , 13 ], a tumor suppressor signaling cascade and a major organ size and development regulator. The Hippo pathway is activated by various signals and factors, resulting in the nuclear localization of YAP/TAZ transcription factors, and the expression of target genes such as Cyclin D1, Connective Tissue Growth Factor (CTGF), Snail and Slug [ 14 ]. The cascade is initiated by autophosphorylation of MST1/2 and SAV1, which in turn phosphorylates LATS1/2 and the MOB complex. This phosphorylation regulates YAP/TAZ phosphorylation, which leads to proteasomal degradation following specific ubiquitination by E3 ligase. The STRIPAK complex is thought to negatively regulate the Hippo pathway as it interacts and dephosphorylates MST1/2, thus allowing for the entrance of YAP/TAZ to the nucleus and the transcription of target genes [ 13 ]. The Striatin proteins, which are part of the STRIPAK complex, have different roles, including cellular signaling, cardiovascular health, cell adhesion, and hormone signaling. By knocking down the different Striatin family members in primary keratinocytes and fibroblasts, we aimed to define the specific roles of each protein and provide insights into their common and distinct cellular functions. Interestingly, we found that silencing each Striatin member individually led to global gene expression changes unique to the silenced protein and specific to the cell type. Nevertheless, all three individual depletions had a common effect on some biological processes and a similar effect on the levels of phosphorylated Yap (pYAP), which suggests a role in stabilizing the Hippo pathway. RESULTS Reduced expression of the three Striatin members in fibroblasts and keratinocytes using shRNA. To better understand the functions of the different Striatin proteins, specific shRNA sequences were used to knockdown (KD) each of the three Striatin family members in both fibroblasts (Fig. 1A-C) and keratinocytes (KTs; Fig. 1D-F). Striatins are scaffolding proteins implicated in multiple cellular signaling pathways. Fibroblasts and keratinocytes were used as they are an excellent model system for studying Striatin proteins due to their unique biological roles and cellular characteristics. Keratinocytes play a major role in epithelial cell barrier formation, and we have previously shown that Striatn is involved in cell adhesion [5], while fibroblasts are non-adherent cells and may serve as a control. Both cell types are involved in several signaling pathways. Fourteen shRNA sequences (detailed in the Material section) targeting the three different Striatin family genes were purchased, cloned and used to infect the cells. The sequence that showed the most robust protein depletion for each Striatin member (shSTR-79, shSG2NA-17, shZinedin-68; Fig. S1) was used in further experiments. Figure 1 demonstrates the reduced expression of each Striatin-family protein on both the mRNA (Fig. 1C, F) and the protein level (Fig. 1A-B, D-E). To further demonstrate the ability of the chosen shRNAs to reduce the expression of their corresponding Striatin members, immunofluorescent assays were conducted. As shown in Figure 1G-H, a specific reduction of each Striatin protein was observed following shRNA infection in both fibroblasts (Fig. 1G) and keratinocytes (Fig. 1H). Expression of the three Striatin members in mouse fibroblasts and keratinocytes. The three Striatin family members are expressed in various cells and tissues, and while Striatin and Zinedin are more brain-specific, SG2NA is ubiquitously expressed [2]. Single-cell RNA-Seq analysis of published data on murine skin cells (Fig. 2) demonstrates unique expression patterns of the three Striatin members in mouse fibroblasts (left panels) and keratinocytes (right panels). Similar data has been previously shown [15], indicating that key biological functions and pathways are differentially expressed in the two cell types. We used RNA-seq analysis to test how the downregulation of each protein affected the expression levels of other genes. Principal Component analysis (PCA) indicates that in both cell types, the effects of Striatin and Zinedin are more closely related in terms of gene expression compared to SG2NA (Fig. S2). These findings agree with previous studies showing that Striatin and Zinedin share higher similarities in their function and cellular distribution in comparison to SG2NA [4]. Venn analysis was used to compare differentially expressed genes (DEGs) resulting from the effects of the shRNA vs the control (scrambled sequence; SCR). In fibroblasts (Fig. 3A), around 50% of DEGs that were affected by shSG2NA depletion are unique (159 out of 319), compared to smaller numbers in Striatin and Zinedin silencing. In keratinocytes (Fig. 3B), on the other hand, most of the DEGs were unique to each shRNA, and the effect of shZinedin was the most robust (224 DEGs). To validate the RNA-seq results, quantitative PCR (qPCR) analysis was conducted on several genes using specific primers (Fig. S3). In most cases, the results were similar to those obtained in the RNA-seq experiments. Only two genes with elevated expression common to all three knockdowns in keratinocytes were identified. ENDOU, an endoribonuclease [16, 17], and KRT16, a type I intermediate filament cytoskeletal protein that regulates innate immunity in response to epidermal barrier breach [18] (Fig.3 C-D). The upregulation of these two genes was examined by qPCR experiments in all three shRNAs treated keratinocytes (Fig. 3D). The results for KRT16 exhibit similar tendencies as the RNA-seq data. ENDOU upregulation was slightly different as the effects of shSTRN and SG2NA were insignificant, possibly arising from sensitivity differences or multiple gene variants [19]. Interestingly, comparing DEGs between fibroblasts and keratinocytes (Fig. 3E) revealed that many more genes were altered in fibroblasts (Fig. 3E, upper panel), and the silencing levels of all Striatin proteins (in red) were higher in keratinocytes than in fibroblasts (Fig. 3E, bottom panel). In addition, no common DEGs were detected following striatin depletion, and only a few genes were affected in both cell types after silencing SG2NA or Zinedin. The overlap between the SCR and shRNA varies significantly among the different Striatins, most likely due to distinct regulatory elements, cell types, or variable context and expression levels. Similar results were reported for other gene families (for example, the FOXP family [20]). Biological processes upregulated by depletion of Striatin-family proteins. As the depletion of the different Striatin proteins resulted in diverse changes in gene expression, we utilized Database for Annotation, Visualization and Integrated Discovery (DAVID) and Gene Set Enrichment (GSEA) analyses to better understand the affected biological processes and pathways. One common biological process shared by keratinocytes and fibroblasts is cellular development (Fig. 4A). Interestingly, cell differentiation was affected by the silencing of all three family members only in keratinocytes, whereas functions related to cell localization, migration, and motility were only upregulated in fibroblasts. It was previously reported that in some cases, differentiation and migration are mutually exclusive, as in wound healing, where migrating keratinocytes cease to differentiate, and normal differentiation resumes only after epidermal wound closure is achieved [21]. This result can provide some explanation for the inhibitory effect on keratinocyte migration rate observed following Striatins knockdown. GSEA analysis using additional databases [22] is presented in Figure 4B. It is clearly demonstrated that the response of keratinocytes and fibroblasts to shRNA treatments is cell-specific. The effects within each cell type also differ with the knockdown of the different Striatin proteins. Knockdown of the Striatin proteins increases the levels of APCDD1 but only modestly affects active b -catenin levels. Our results indicate that the Striatin proteins are more efficiently silenced in keratinocytes as compared to fibroblast (Fig. 3E). Since Striatin is known to be expressed in epithelial cell-cell junctions [4, 23-25] and keratinocytes have highly developed, functional junctions [26], we continued to examine the effects of Striatin protein loss in primary mouse keratinocytes. Striatin was shown to interact with APC [11, 27] a core negative regulator of the canonical Wnt signaling pathway [28]. We thus examined a possible connection between the different Striatins and the Wnt cascade. Z-scores of the RNA-seq data showed no direct effect on the overall Wnt signal transduction pathway, and no clear pattern shared by all three Striatin family members' downregulation could be detected (Not shown). Nevertheless, the levels of APCDD1, a known Wnt signaling inhibitor [29], were elevated in all Striatin knockdown cells. The depletion of SG2NA had a relatively minor effect in the RNA-Seq analysis (Fig. 5A). APCDD1 is a transmembrane protein that blocks the interaction between the LRP receptor and cognate Wnt ligand, thus inhibiting Wnt signaling activation [29]. We confirmed the effect of APCDD1 on the Wnt cascade by over-expressing the APCDD1 in fibroblasts that constitutively express Wnt3A (L-Wnt3A cells). As expected, APCDD1 upregulation led to reduced levels of active-β catenin in these cells (Figure S4). Next, we performed qPCR in the keratinocyte’s knockdown cells, demonstrating an increase in APCDD1 transcript levels, especially although much more subtle in both Striatin and Zinedin (Fig. 5B). When examining the effect of silencing the individual Striatins on the APCDD1 protein expression levels, a minor but significant increase was detected (Fig. 5C-D). A slight effect was also seen on the levels of active b-catenin protein most significantly by Striatin depletion. The Striatin proteins affect the Hippo pathway by stabilizing pYAP. Different studies have shown crosstalk between the STRIPAK complex and the Hippo signaling pathway, indicating their collaborative roles in governing cellular behavior and fate [13, 30-32]. We thus examined the effect of the Striatin proteins on Hippo signaling components. Our results demonstrate some distinctive patterns (Fig. 6A), implying that the Striatin family members may be involved in regulating the Hippo cascade. To better understand this involvement, we monitored known core components of the Hippo pathway following Striatin members’ silencing in keratinocytes. Neither Yes-associated protein (YAP) nor TAZ, which are the key effector proteins of the Hippo pathway, were affected by the treatment (thus excluded from the heat map). However, the two phosphorylated forms of YAP pYAP(127) and pYAP(397) were significantly downregulated by all three shRNAs (Fig. 6B, C). Several previous studies have shown similar findings: for example, cell-cell contact leads to increased YAP phosphorylation (pS127) while total YAP remains constant [33]; Serum concentration or LPA levels can also affect YAP phosphorylation without changing the levels of total YAP [34, 35]. In all reports, the Hippo pathway was activated by the increase of the pYAP form and the translocation of YAP between the nucleus and cytoplasm. We next examined the expression of Hippo target genes involved in cell survival and proliferation and found that Axin2 (that is also a Wnt target gene) [36] and Slug [37] were downregulated in knockdown cells of all three Striatin members (Fig. 6B, D). The results were not reproduced in knockdown fibroblasts (Fig. S5), which suggests that the Striatin/Hippo interplay is cell-specific and probably highly complex. The different phosphorylation sites of YAP were shown to govern the fate of the YAP protein; while pYAP(127) induces cytoplasmatic retention, pYAP(397) is sent to proteasomal degradation [38]. We thus tested whether the effect observed in the knockdown keratinocytes was due to induced proteasomal degradation of the pYAP variants. To this end, we treated the cells with MG132, a proteasomal inhibitor, and monitored the expression levels of total YAP and pYAP variants. As shown in Figures 6E-F, hindering protein degradation led to increased levels of both pYAP forms, suggesting that Striatin family proteins protect phosphorylated YAP from proteasomal degradation. Mass-spectrometry analysis of keratinocytes depleted of the Striatin proteins revealed a decrease in the levels of various members of the 14-3-3 proteins in both shStriatin and shSG2NA (Fig. 6G). This finding can partially explain the reduction in pYAP(127), as this form of YAP is usually bound to 14-3-3 proteins, leading to its cytoplasmatic retention[38]. Thus, a decrease in 14-3-3 protein levels may facilitate pYAP(127) proteasomal degradation. The levels of the Striatin proteins affect cell migration. Cell migration is crucial for correct development and maintaining the organization of multicellular organisms. In contrast, aberrant cell migration is found in many pathological disorders. Cell migration can be monitored using the wound healing assay, which involves growing a cell monolayer to confluence, creating a ‘wound’ (a cell-free zone in the monolayer) into which cells can migrate, and monitoring the recolonization of the scratched region to quantify cell migration [39]. Slug, which was affected by the Striains KD, is a known inducer of Endothelial-Mesenchymal transition (EMT) and has an important role in cell migration [40]. Since Striatin has been suggested to play a role in wound closure, we further investigated the possible effect on cell migration using an automated wound-healing assay. The results reveal that depletion of each of the Striatin family proteins led to a decrease in cell movement between 3-9 hrs after the wound generation (Fig. 7A-B). We also examined the cell proliferation status using the KI67 marker. Interestingly, only a minor reduction in cell proliferation was seen, most notably by Zinedin knockdown (Fig. 7C-D). DISCUSSION Striatin, SG2NA, and Zinedin comprise the calmodulin WD-40 repeat Striatin protein family and are part of the STRIPAK complex [2, 8]. These proteins are conserved signaling scaffolds that are expressed in different tissues [2]. Both SG2NA and Striatin undergo alternative splicing to produce several isoforms which are differentially regulated in a tissue-dependent manner. Although the Striatin family of proteins was discovered long ago, their functions are only now being revealed. They are known to be involved in different cellular functions including: cell cycle regulation, neuroprotection, estrogen signaling and cell-cell communication (for review, see [7]). Striatins are also connected to different pathologies such as heart failure and cancer [2], and a STRN-ALK fusion protein is found in aggressive forms of thyroid cancer [41] as well as in other cancer types. The different functions of the Striatin proteins are usually specific to each family member, and we aimed to understand whether these proteins have common functions. To this end, we created a lentiviral knockdown system that specifically silences the individual Striatin proteins. The system was utilized in both mouse fibroblast cells and primary keratinocytes. Keratinocytes and fibroblasts represent the major cell types in the epidermis and dermis of the skin. The two cell types respond to the inflammatory phase in the cutaneous repair/regeneration process, and inflammatory signals activate their proliferation and maturation, which is essential for wound healing [42]. Both keratinocytes and fibroblasts play a significant role in the maintenance of skin homeostasis. However, their distinct biological characteristics remain to be elucidated [15]. Further analysis demonstrated that several key biological functions and pathways are differentially expressed in the two cell types including: regulation of the actin cytoskeleton, focal adhesion and ECM-receptor interaction [15]. Striatin, SG2NA and Zinedin are abundantly expressed in both keratinocytes and fibroblasts, though scRNA-seq data demonstrate differential expression across these cells. Our results indicate that the roles of the Striatin members are also specific to each cell type. RNA-Seq results of the individual shRNAs revealed that depletion of each striatin member leads to changes in the expression of different gene sets. The silencing effect was cell-specific, and the knockdown was more robust in the differentiated primary keratinocytes. The Striatin family members share a similar structure and several motifs, and a subtle compensatory effect was detected in cells where Zinedin was silenced (not shown), leading to moderately increased Striatin protein levels. This is not surprising as Zinedin and Striatin share common features [4]. Interestingly, our results indicate that of the three Striatin knockdowns, shZinedin caused the most robust effects on global gene regulation, APDDC1, and cell proliferation. We speculate that specific modifications may significantly influence its interactions with other proteins, activity and localization, contributing to its distinct functional roles. Only two genes were altered by all three shRNAs in keratinocytes. ENDOU, an endoribonuclease that binds polyuridine-enriched single-stranded RNA [16, 17], and keratin16 (KRT16), an intermediate filament cytoskeletal protein that regulates danger signals, innate immunity, and barrier function of the skin epidermis [18]. Neither of these genes has been previously connected to the Striatin family. KRT16, which forms a complex with KRT6 may be of particular interest as it has important roles in cell migration [43, 44]. An additional study also demonstrated that KRT16 overexpression reduces the migration potential of human immortalized keratinocytes [45]. Several studies [5, 6, 9, 46-48], including the results shown here, demonstrate that Striatin proteins and the STRIPAK complex are involved in cell migration of different cell types. It is possible that in keratinocytes this effect is mediated, at least in part, through KRT16. Interestingly, a different skin filament protein, KRT14, interacts with 14-3-3 through a residue that is conserved in keratins, and affects Hippo signaling [49]. The increased levels of KRT16 in all three KDs suggest a common function for the Striatin proteins in protecting against skin injury or inflammatory conditions. Although striatin was shown to interact with the tumor suppressor gene APC [11, 27], a known inhibitor of the canonical Wnt signaling pathway, no global effect of Striatin members knockdown on Wnt signaling-related gene expression was observed. Nevertheless, APCDD1, a canonical Wnt signaling inhibitor [29], was upregulated by all three shRNAs (STRN- 4.58; SG2NA-1.82; Zinedin-10.12 fold). APCDD1 blocks the interaction between Wnt ligands and their LRP receptor, leading to ongoing degradation of active β-catenin. By inhibiting Wnt signaling, APCDD1 helps regulate cell proliferation and differentiation, maintaining tissue homeostasis and preventing uncontrolled cell growth [50]. The increase in APCDD1 mRNA levels detected by qPCR was much more moderate (1.5-2.5-fold) than those obtained by the RNA-Seq experiments (1.8-10-fold), again with the greatest increase in Zinedin knockdown cells. These differences between RNA-seq and qPCR results can arise from several factors, including sensitivity differences, normalization methods, and technical variability. In addition, RNA-seq captures the gene expression profile at the time of sampling, which can vary due to biological factors such as cell cycle stage, differentiation status, or environmental influences. If qPCR is conducted on a different sample or time point, results may not align. This is particularly true for primary cultures. The effect on the APCDD1 protein levels was even more subtle (less than 1.5 fold), which correlated with the minor decrease in b-catenin expression. It is possible that other factors affect the protein expression levels of APCDD1 as it was previously shown that miR-130, for example, is a posttranscriptional regulator of APCDD1 gene expression [51]. Our results suggest that the connection between the Striatin family proteins and the Wnt cascade are diverse and may not be direct. This agrees with previous findings showing the different effects of Striatin on the Wnt cascade. Apart from the interaction of Striatin with the negative regulator of the canonical Wnt pathway - APC [11], Striatin was also shown to inhibit Wnt1 expression in specific cells [52], and to co-localize with b-catenin in different pathological conditions [53]. Our results demonstrate reduced levels of active b-catenin following striatin depletion. It is possible that this observation is not directly related to changes in APCDD1 levels and can be attributed to other mechanisms, including the effect of shSTRN on cytoskeleton organization (Fig. 4A; STRN column), which was shown to influence b-catenin expression levels [54]. Our data also shows changes in adhesion and migration processes that may mediate the effect on b-catenin, independent of APCDD1. Striatin proteins and the STRIPAK complex are strongly connected to the Hippo signaling pathway [46, 55-58]. The Hippo pathway controls organ size, cell proliferation, and apoptosis, playing an essential role in maintaining tissue homeostasis and preventing tumorigenesis. At the core of this pathway is a kinase cascade that phosphorylates and inactivates the transcription co-activators YAP and TAZ. When YAP/TAZ are phosphorylated, they are retained in the cytoplasm and eventually targeted for degradation. When dephosphorylated, they translocate to the nucleus and promote gene expression [59]. The STRIPAK complex inhibits Hippo signaling by dephosphorylating and inactivating core Hippo components. This inactivation allows unphosphorylated YAP to enter the nucleus and promote the transcription of pro-growth genes. Conversely, in the absence of STRIPAK, YAP is phosphorylated and inhibited, thereby impacting downstream signaling cascades and cellular outcomes [56]. We show that silencing the different Striatin family members led to decreased phosphorylated levels of YAP, most likely due to increased proteasomal degradation. Since other upstream components of the Hippo pathway, such as the LATS1 kinase and SAV1, were unaffected by either KD, the possibility of reduced phosphorylation due to upstream cascade disruption is slight. In addition, our mass spectrometry analysis revealed a decrease in the expression of 14-3-3 protein variants, which are known to retain pYAP(127) in the cytoplasm. Reduced levels of 14-3-3 proteins may facilitate pYAP(127) degradation as well. In both cases, inhibiting proteasome activity restored the levels of pYAP(127) and pYAP(397) in single Striatin protein knockdown cells. Despite total YAP being unaffected by Striatin protein knockdowns, the target genes Slug and Axin2 were downregulated, indicating a downstream effect on Hippo pathway function. Consistent with our findings, others have also reported decreased YAP target gene expression in SG2NA or Zinedin-depleted cells [46]. Thus, it will be important to determine whether the negative effect on YAP signaling is due to reduced stability of the pYAP variants or another effect we have yet to uncover. Very little is currently known about the biological roles of Striatin family members and their unique role in various cell types and under different conditions. Our observations illuminate the complex relationships between the three Striatin proteins and their abilities to inhibit each other's effects potentially. We found that there were no or only slight changes in the expression of the non-knockdown Striatins in most compensatory experiments (not shown). This finding may be of interest as it suggests that functional redundancy can occur through mechanisms beyond simple gene expression increases. Instead, other genes or proteins with overlapping or complementary roles may adapt functionally to mitigate the loss, or there may be signaling pathway changes that achieve parallel outcomes. Similar findings were shown in other gene families; for example, when certain PI3K isoforms (such as PI3Kα or PI3Kβ) are knocked down, other isoforms (like PI3Kγ or PI3Kδ) are not upregulated, yet cells maintain downstream signaling to some extent. This compensation often occurs through pathway rewiring or by leveraging alternative PI3K-independent pathways, such as those involving Akt or mTOR [60-67]. The HOX gene family also exhibit partial compensation following a single HOX gene depletion by related HOX genes without altering their expression levels [68]. Akt Kinases - in some cases, knocking down Akt1 does not lead to an increased expression of Akt2 or Akt3, but these isoforms can compensate functionally to a certain extent [69]. In Wnt Signaling, knocking down specific Wnt ligands (such as Wnt3a) in certain cells may not lead to increased expression of other Wnt ligands. Instead, Wnt ligands supplied by neighboring cells compensate for the decrease of Wnt activity. Thus, the exchange of Wnt3a ligands appears to compensate for the rapid decrease in Wnt activity in individual cells [70]. Additionally, as the same catalytic subunit of PP2A is directed by different targeting subunits (including Striatin), PP2A heterotrimers with different regulatory subunits have altered functions in diverse signaling pathways [71], which may partly explain this result. Members of the Striatin family form a complex network of signaling hubs with different kinases, phosphatases, and other signaling proteins to execute their many roles. These functions are carried out by gene diversification and multiple post-transcriptional and post-translational modifications giving rise to varieties of final effector molecules. Some studies suggest that distinct isoforms of this family of proteins are differently expressed, depending on the cell cycle stages and/or tissue types, indicating that specific isoforms have differential functions. The Striatin proteins and the conserved Hippo and Wnt signaling pathways play unique roles in regulating cell growth, migration, proliferation, apoptosis, and stem cell maintenance [72, 73]. Understanding the interplay between these three biological elements offers a promising avenue for anti-cancer drug development. We propose that Striatins may act as regulatory hubs that influence both pathways and may be targeted to either upregulate Hippo activity or inhibit Wnt signaling in cancer cells. Targeting the Striatin family members to influence both pathways simultaneously could result in more robust inhibition of cancer growth while minimizing effects on non-cancerous cells. In addition, if specific Striatin-Wnt-Hippo interactions are associated with aggressive or treatment-resistant cancers, these proteins could serve as biomarkers. Monitoring their levels or activity in tumors could provide insight into cancer progression and treatment response, allowing for more personalized therapeutic strategies. In conclusion, using the shRNA knockdown approach, we show that Striatin, SG2NA, and Zinedin have some common functions, such as affecting cell migration, while other functions are completely distinct. Regarding the Hippo pathway, we have uncovered a potential novel role for Striatin proteins in stabilizing pYAP variants. Finally, our results reveal a complex interplay between the three Striatin family members that remain elucidated. Declarations ACKNOWLEDGMENTS This research was supported by Grant No 2017173 from the United States-Israel Binational Science Foundation (BSF) granted to Rina Rosin-Arbesfeld and David C. Pallas. Ethics approval and consent to participate: Not applicable Consent for publication: all authors have approved and have consented the manuscript Competing Interests: The authors have no relevant financial or non-financial interests to disclose. Availability of data and material: all data are present in the paper, the Supplementary Materials, or will be uploaded to the GEO. All materials used in this paper are listed and are commercially available. Funding and acknowledgments: This study was supported by Grant No 2017173 from the United States-Israel Binational Science Foundation (BSF) granted to Rina Rosin-Arbesfeld and David C. Pallas. Materials and Methods REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Striatin (m) BD # 610838 Striatin (Rb) Proteinech 21624-1-AP SG2NA Novus Biologicals NB110-74572 Ki67 Abcam Ab15580 APCDD1 Novus Biologicals NB110-92756 Active beta catenin Cell Signaling #8814 Hippo signaling kit Cell Signaling #8579 Axin2 Cell Signaling #2151 Slug Cell Signaling #9585 Tubulin Santa Cruz Sc-8035 Actin Abcam Ab205 DAPI Sigma, USA 28718-90-3 Alexa Fluor® 594 Jackson laboratories 711-585-152 Alexa Fluor® 488 Jackson laboratories 108-545-003 Chemicals MG132 Calbiochem 133407-82-6 DMSO Sigma, USA # D5879 Polybrene Sigma, USA #107689 Puromycin InvivoGen 58-58-2 Trizol BioLab-chemicals 009010233100 Commercial assays iTaq Universal SYBR Green Supermix BioRad, USA # L001752 B iScript cDNA synthesis kit BioRad, USA # 1708891 GeneJET Gel Extraction Kit Thermo Fischer K0691 Quick ligation kit NEB M2200S Cell lines L cells ATCC CRL-2648 L Wnt 3A ATCC CRL-2647 Mouse primary keratinocytes Mouse embryos HEK293FT cells ATCC CRL-11268 Oligonucleotides Striatin Fw TCACGCTAGAATCCAATGTTGA N/A Striatin Rv GGGTAGGATGGCTGATGACTC N/A SG2NA Fw GAGACCTTGCAGACTTGACGG N/A SG2NA Rv GAGGCAGTAACGAGCACAGG N/A Zinedin Fw TTCTGCGACAGTACCTGGAAG N/A Zinedin Rv CTCTTGATCTGTTCCTCGATC N/A APCDD1 Fw CGCCTGGAGGGCTTTCAAG N/A APCDD1 Rv GGACCCGACCTTACTTCACAG N/A Ppib Fw GTGAGCGCTTCCCAGATGAGA N/A Ppib Rv TGCCGGAGTCGACAATGATG N/A ACTB Fw CTAAGGCCAACCGTGAAAAG N/A ACTB Rv ACCAGAGGCATACAGGGACA N/A Krt16 Fw GGACCAGTATGAGCAGATGGCA NM_008470 OriGene KRT16 Rv TCGCTGCGGTTGCTCTGGATTA NM_008470 OriGene ENDOU Fw CTTGCCACTGTAATGACCGCTG NM_008902 OriGene ENDOU Rv CCTGTAGATGGTCTCGGAGATG NM_008902 OriGene Software GraphPad Prism GraphPad Software, San Diego, CA Version 9 Fusion-Capt software Vilber https://www.vilber.com/fusion-fx/ Incucyte program Sartorius https://www.sartorius.com/en/products/live-cell-imaging-analysis/live-cell-analysis-software Other IncucyteS3 Sartorius https://www.sartorius.com/en/products/live-cell-imaging-analysis/live-cell-analysis-software Laser scanning confocal focus microscope Zeiss https://www.zeiss.co.il/corporate/home.html Medium and cell line growing conditions All cell lines were maintained in high glucose DMEM w/o L-Glutamine, w/o Sodium Pyruvate (Biological Industries, Kibbutz Beit Haemek, Israel REF: 01-052-1A) supplemented with 10% fetalbovine serum (REF: 12657-029), 1% Sodium Bicarbonate Solution (REF: 03-040-1B), 1% L-Glutamine (Cat. 03-020-1B), 1% Sodium Pyruvate Solution (Biological Industries, Kibbutz Beit Haemek, Israel REF: 03-042-1B), and 1% PEN/STREP (REF: 03-031-1B) at 37 0 C in a humidified incubator 5% CO2. Keratinocytes were carried in DMEM/F12 3:1 (cat. 06-1170-65-1A) supplemented with 10% FBS, 1% pen/strep, 1% L-Glutamine (Cat. 03-020-1B), Additive mix (x100) containing 5mg/ml insulin, 5mg/ml of Transferrin, 10ml of 2X10-8 M of T3 (3,3’,5-triiodo-L-Thyronine), 56.3µl Hydrocortisone and 56.3µl cholera toxin. Mouse fibroblasts were purchased from ATCC (L-Cells #CRL-2648) and grown according to manufacturer's instructions. Mouse keratinocytes were a generous gift from Chen Luxenburg’s lab [77]. Western blot analysis Cells were washed with phosphate-buffered saline (PBS) and harvested in lysis buffer (100mM NaCl, 50mM Tris, pH7.5, 1% Triton X-100, 2mM EDTA) containing protease inhibitor cocktail (Sigma-Aldrich catalog #). Extracts were clarified by centrifugation at 14,000 rpm for 15 min at 4°C and protein concentration was determined by BRADFORD reagent (BioRad) according to the manufacturer’s instructions. Following SDS–polyacrylamide gel electrophoresis (SDS-PAGE) separation, proteins were transferred to nitrocellulose membranes and blocked with 5% non-fat milk. Membranes were incubated with specific primary antibodies, washed with PBS containing 0.001% Tween-20 (PBST) and incubated with the 9 appropriate horseradish peroxidase-conjugated secondary antibody. After washing in PBST, membranes were subjected to enhanced chemiluminescence (ECL) detection analysis. MG132 treatment Infected cells were treated with MG132 (50uM) reagent (Calbiochem) in different concentrations for 24h. Ctrl groups were treated with DMSO in the same volume. Cloning of shRNA sequences TRC Clone ID Validation Gene Symbol Gene ID Ref Seq TRCN0000366141 Validated STRN 268980 NM_011500 TRCN0000374647 Validated STRN 268980 NM_011500 TRCN0000374579* Validated STRN 268980 NM_011500 TRCN0000374580 STRN 268980 NM_011500 *CCGGT ACAAGATATGCTTGCTAATTT CTCGAGAAATTAGCAAGCATATCTTGTTTTTTG TRCN0000375117* Validated STRN3 94186 NM_052973 TRCN0000335452 Validated STRN3 94186 NM_052973 TRCN0000375064 Validated STRN3 94186 NM_052973 TRCN0000335383 STRN3 94186 NM_052973 RCN0000363788 Validated STRN3 94186 NM_052973 *CCGG AGCAAGGCAGACAGCTATTAA CTCGAGTTAATAGCTGTCTGCCTTGCTTTTTTG TRCN0000075628 STRN4 97387 NM_133789 TRCN0000327468* STRN4 97387 NM_133789 TRCN0000327469 STRN4 97387 NM_133789 TRCN0000327470 STRN4 97387 NM_133789 TRCN0000327392 STRN4 97387 NM_133789 *CCGG CCACGTTATCACTGTGTGATA CTCGAGTATCACACAGTGATAACGTGGTTTTTG Commercial shRNA sequences (purchases from Sigma for each of the Striatin transcripts) were ligated into pLKO.1 TRC vector (Addgene plasmid #10878) using EcorI (NEB #R3101S) and AgeI (NEB #R3552S) restriction enzyme digestion according to the recommended protocol. Digested sequences were loaded to 1% agarose gel for verification, purified using GeneJET Gel Extraction Kit (Thermo Fischer #K0691), and ligated using Quick ligation kit (NEB #M2200S) according to the suggested protocol. Bold and asterisks denote the sequences chosen for further experiments based on western blot results. The underlined nucleotides are the specific shRNAs for each STN family member. Lentivirus preparation Vesicular stomatitis virus G glycoprotein pseudotyped lentivirus was produced by transfection of 293FT cells. A week before transfection, 293-FT cells were grown in D10 medium with 0.5mgr/mL Geneticin sulfate (Millipore cat#345810). Cells were transfected on poly-l-lysine hydrobromide 0.02mgr/mL (cat. P2636-25mg, Sigma) coated plates using jetPEI (Polyplus Transfection, Illkirch, France). The medium was switched the following morning to D10 medium. 24hrs later the medium was collected, centrifuged at 500xg/10min/25°C and filtered using a 0.45 PES filter. The viral supernatant was homogenized, divided into aliquots and frozen at -80°C. Lentivirus infection and selection Target cells were counted and seeded the day before infection in 6 well plates. Infection mix was prepared using 1.8ml media, 180ul FBS, and 20ul polybrene (10mg\ml stock) and distributed to each well. Then 200ul of each lentivirus was added and the plates were incubated for 30 min at 37 0 C followed by 30min spinaculation at 1100xG. Target cells were selected using Puromycin. Scratch assay Cells were plated on 96 well plate 24h prior to the assay. Scratch wound was created using Incucyte® WoundMaker followed by PBSX1 wash and media change. Images were taken every 2h for 24h using IncuCyteS3 and analyzed using Incucyte program (Sartorius). RNA extraction Total RNA was isolated from the cultured cells according to the protocol supplied with TRI Reagent (Sigma-Aldrich). The concentration and purity of the RNA samples were determined, and total RNA was reverse transcribed (RT) with the iScript cDNA Synthesis Kit (BioRad) according to the manufacturer’s instructions RNA-seq analysis Libraries were prepared using the NEBNext Ultra II RNA Library Prep kit with the NEBNext Poly(A) mRNA Magnetic Isolation Module, starting with ~1000 ng of total RNA During library amplification, 10 PCR cycles were performed. Each experiment was conducted in triplicates. Libraries were sequenced on a NextSeq 500 instrument using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kit. The count matrix was analyzed using R language for differentially expressed (DE) genes using DESeq2. The RNA-seq data was analyzed as follows: Twenty-four FastQ files were uploaded to Partek Flow (Build version 10.0.21.1116; https://www.partek.com) for processing. Poly-A/T stretches, and Illumina adapters were trimmed from the reads. Aligned reads (over 96%) were filtered for low-quality mapping Phred<20. Reads were mapped to the mouse GRCm39 reference genome using STAR 2.7.8a with default parameters to reveal ~ 20 million reads per sample. The annotation model was quantified using the Partek Expectation/Maximization (E/M) algorithm. Differentially expressed genes with cutoff p-value<0.05 were further analyzed. Mass-Spectrometry analysis Samples were digested by trypsin and analyzed by LC-MS/MS on Exploris 480 (Thermo). Data analysis includes Maxquant 2.4 analysis and identification with the Andromeda search algorithms against the mouse proteome from the Uniprot database and a decoy database (to determine the false discovery rate). All the identified peptides were filtered with high confidence -1% FDR threshold. (*FDR =false discovery rate, is the estimated fraction of false positives in a list of peptides) Real-Time PCR RNA extraction (using Direct-zol RNA MiniPrep kit) and cDNA synthesis (iScript cDNA Synthesis Kit) were done according to the manufacturer's protocol. Data were acquired using the CFX Connect Real-Time PCR Detection System using iTaq Universal SYBR Green Supermix. The thermal cycling conditions were composed of an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 60 seconds, and plate read. Finally, a melt curve step was performed at temperatures ranging from 65-95°C with plate read at every 0.5°C increments. A No Template Control (NTC) was added for each primer in all the experiments. Cq was set by the CFX Maestro program (Bio-Rad Laboratories). The ΔΔCq technique was used to calculate gene expression. Analysis of the data was done using both CFX Maestro and Microsoft Excel. Primers were based on previous publications or designed based on the UCSC genome browser sequence using the ApE program and verified using the USCS In-Silico PCR Tool. Statistical analysis Data were analyzed using GraphPad Prism software (version 8.0, GraphPad, La Jolla, CA) and are presented as the mean with standard deviation. For relevant datasets, normality was validated using the Shapiro-Wilk test, followed by ANOVA tests to assess the significance of variations, using the appropriate post-hoc multiple comparisons noted in each legend. P values are as indicated. References Benoist M, Gaillard S, Castets F. The striatin family: a new signaling platform in dendritic spines. J Physiol Paris. 2006;99:146–53. Tanti GK, Pandey P, Shreya S, Jain BP. Striatin family proteins: The neglected scaffolds. Biochim Biophys Acta Mol Cell Res. 2023;1870:119430. Castets F, Rakitina T, Gaillard S, Moqrich A, Mattei MG, Monneron A, Zinedin. SG2NA, and striatin are calmodulin-binding, WD repeat proteins principally expressed in the brain. J Biol Chem. 2000;275:19970–7. Li AX, Martin TA, Lane J, Jiang WG. Cellular Impacts of Striatins and the STRIPAK Complex and Their Roles in the Development and Metastasis in Clinical Cancers (Review), Cancers (Basel), 16 (2023). Lahav-Ariel L, Caspi M, Nadar-Ponniah PT, Zelikson N, Hofmann I, Hanson KK, Franke WW, Sklan EH, Avraham KB. Rosin-Arbesfeld, Striatin is a novel modulator of cell adhesion. FASEB J. 2019;33:4729–40. Bazzi H, Soroka E, Alcorn HL, Anderson KV. STRIP1, a core component of STRIPAK complexes, is essential for normal mesoderm migration in the mouse embryo. Proc Natl Acad Sci U S A. 2017;114:E10928–36. Hwang J, Pallas DC. STRIPAK complexes: Structure, biological function, and involvement in human diseases. Int J Biochem Cell Biol. 2014;47:118–48. Kuck U, Radchenko D, Teichert I. STRIPAK, a highly conserved signaling complex, controls multiple eukaryotic cellular and developmental processes and is linked with human diseases. Biol Chem. 2019;400:1005–22. Madsen CD, Hooper S, Tozluoglu M, Bruckbauer A, Fletcher G, Erler JT, Bates PA, Thompson B, Sahai E. STRIPAK Compon determine mode cancer cell migration metastasis Nat Cell Biol. 2015;17:68–80. Sakuma C, Kawauchi T, Haraguchi S, Shikanai M, Yamaguchi Y, Gelfand VI, Luo L, Miura M, Chihara T. Drosophila Strip serves as a platform for early endosome organization during axon elongation. Nat Commun. 2014;5:5180. Breitman M, Zilberberg A, Caspi M, Rosin-Arbesfeld R. The armadillo repeat domain of the APC tumor suppressor protein interacts with Striatin family members, Biochimica et biophysica acta, 1783 (2008) 1792–802. Sakuma C, Saito Y, Umehara T, Kamimura K, Maeda N, Mosca TJ, Miura M, Chihara T. The Strip-Hippo Pathway Regulates Synaptic Terminal Formation by Modulating Actin Organization at the Drosophila Neuromuscular Synapses. Cell Rep. 2016;16:2289–97. Chen R, Xie R, Meng Z, Ma S, Guan KL. STRIPAK integrates upstream signals to initiate the Hippo kinase cascade. Nat Cell Biol. 2019;21:1565–77. Moya IM, Halder G. Hippo-YAP/TAZ signalling in organ regeneration and regenerative medicine, Nature reviews. Mol cell biology. 2019;20:211–26. Wang T, Zhou Z, Luo E, Zhong J, Zhao D, Dong H, Yao B. Comprehensive RNA sequencing in primary murine keratinocytes and fibroblasts identifies novel biomarkers and provides potential therapeutic targets for skin-related diseases. Cell Mol Biol Lett. 2021;26:42. Gioia U, Laneve P, Dlakic M, Arceci M, Bozzoni I, Caffarelli E. Functional characterization of XendoU, the endoribonuclease involved in small nucleolar RNA biosynthesis. J Biol Chem. 2005;280:18996–9002. Laneve P, Altieri F, Fiori ME, Scaloni A, Bozzoni I, Caffarelli E. Purification, cloning, and characterization of XendoU, a novel endoribonuclease involved in processing of intron-encoded small nucleolar RNAs in Xenopus laevis. J Biol Chem. 2003;278:13026–32. Lessard JC, Pina-Paz S, Rotty JD, Hickerson RP, Kaspar RL, Balmain A, Coulombe PA. Keratin 16 regulates innate immunity in response to epidermal barrier breach. Proc Natl Acad Sci U S A. 2013;110:19537–42. Sanghamitra M, Talukder I, Singarapu N, Sindhu KV, Kateriya S, Goswami SK. WD-40 repeat protein SG2NA has multiple splice variants with tissue restricted and growth responsive properties. Gene. 2008;420:48–56. Norton P, Barschke P, Scharff C, Mendoza E. Differential Song Deficits after Lentivirus-Mediated Knockdown of FoxP1, FoxP2, or FoxP4 in Area X of Juvenile Zebra Finches. J Neurosci. 2019;39:9782–96. Usui ML, Mansbridge JN, Carter WG, Fujita M, Olerud JE. Keratinocyte migration, proliferation, and differentiation in chronic ulcers from patients with diabetes and normal wounds. J Histochem cytochemistry: official J Histochem Soc. 2008;56:687–96. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545–50. Domke LM, Rickelt S, Dorflinger Y, Kuhn C, Winter-Simanowski S, Zimbelmann R, Rosin-Arbesfeld R, Heid H, Franke WW. The cell-cell junctions of mammalian testes: I. The adhering junctions of the seminiferous epithelium represent special differentiation structures. Cell Tissue Res. 2014;357:645–65. Franke WW, Rickelt S, Zimbelmann R, Dorflinger Y, Kuhn C, Frey N, Heid H, Rosin-Arbesfeld R. Striatins as plaque molecules of zonulae adhaerentes in simple epithelia, of tessellate junctions in stratified epithelia, of cardiac composite junctions and of various size classes of lateral adherens junctions in cultures of epithelia- and carcinoma-derived cells. Cell Tissue Res. 2015;359:779–97. Nadar-Ponniah PT, Taiber S, Caspi M, Koffler-Brill T, Dror AA, Siman-Tov R, Rubinstein M, Padmanabhan K, Luxenburg C, Lang RA, Avraham KB. Rosin-Arbesfeld, Striatin Is Required for Hearing and Affects Inner Hair Cells and Ribbon Synapses. Front Cell Dev Biol. 2020;8:615. Bazzoni G, Dejana E. Keratinocyte junctions and the epidermal barrier: how to make a skin-tight dress. J Cell Biol. 2002;156:947–9. Tran H, Hamada F, Schwarz-Romond T, Bienz M. Trabid, a new positive regulator of Wnt-induced transcription with preference for binding and cleaving K63-linked ubiquitin chains. Genes Dev. 2008;22:528–42. Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Kinzler KW, Vogelstein B, Clevers H. Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science. 1997;275:1784–7. Shimomura Y, Agalliu D, Vonica A, Luria V, Wajid M, Baumer A, Belli S, Petukhova L, Schinzel A, Brivanlou AH, Barres BA, Christiano AM. APCDD1 is a novel Wnt inhibitor mutated in hereditary hypotrichosis simplex. Nature. 2010;464:1043–7. Jeong BC, Bae SJ, Ni L, Zhang X, Bai XC, Luo X. Cryo-EM structure of the Hippo signaling integrator human STRIPAK. Nat Struct Mol Biol. 2021;28:290–9. Seo G, Han H, Vargas RE, Yang B, Li X, Wang W. MAP4K Interactome Reveals STRN4 as a Key STRIPAK Complex Component in Hippo Pathway Regulation. Cell Rep. 2020;32:107860. Tang Y, Chen M, Zhou L, Ma J, Li Y, Zhang H, Shi Z, Xu Q, Zhang X, Gao Z, Zhao Y, Cheng Y, Jiao S, Zhou Z. Architecture, substructures, and dynamic assembly of STRIPAK complexes in Hippo signaling. Cell Discov. 2019;5:3. Dupont S, Morsut L, Aragona M, Enzo E, Giulitti S, Cordenonsi M, Zanconato F, Le Digabel J, Forcato M, Bicciato S, Elvassore N, Piccolo S. Role of YAP/TAZ in mechanotransduction. Nature. 2011;474:179–83. Cai H, Xu Y. The role of LPA and YAP signaling in long-term migration of human ovarian cancer cells. Cell Commun Signal. 2013;11:31. Yu FX, Zhao B, Panupinthu N, Jewell JL, Lian I, Wang LH, Zhao J, Yuan H, Tumaneng K, Li H, Fu XD, Mills GB, Guan KL. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell. 2012;150:780–91. Garcia G Jr., Wang Y, Ignatius Irudayam J, Jeyachandran AV, Cario SC, Sen C, Li S, Li Y, Kumar A, Nielsen-Saines K, French SW, Shah PS, Morizono K, Gomperts B, Deb A, Ramaiah A. V. Arumugaswami, Hippo Signaling Pathway Activation during SARS-CoV-2 Infection Contributes to Host Antiviral Response, bioRxiv, (2022). Cheng D, Jin L, Chen Y, Xi X, Guo Y. YAP promotes epithelial mesenchymal transition by upregulating Slug expression in human colorectal cancer cells. Int J Clin Exp Pathol. 2020;13:701–10. Zhao B, Li L, Tumaneng K, Wang CY, Guan KL. A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(beta-TRCP). Genes Dev. 2010;24:72–85. Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc. 2007;2:329–33. Chandler HL, Colitz CM, Lu P, Saville WJ, Kusewitt DF. The role of the slug transcription factor in cell migration during corneal re-epithelialization in the dog. Exp Eye Res. 2007;84:400–11. Kelly LM, Barila G, Liu P, Evdokimova VN, Trivedi S, Panebianco F, Gandhi M, Carty SE, Hodak SP, Luo J, Dacic S, Yu YP, Nikiforova MN, Ferris RL, Altschuler DL, Nikiforov YE. Identification of the transforming STRN-ALK fusion as a potential therapeutic target in the aggressive forms of thyroid cancer. Proc Natl Acad Sci U S A. 2014;111:4233–8. Wojtowicz AM, Oliveira S, Carlson MW, Zawadzka A, Rousseau CF, Baksh D. The importance of both fibroblasts and keratinocytes in a bilayered living cellular construct used in wound healing. Wound Repair Regen. 2014;22:246–55. Rotty JD, Coulombe PA. A wound-induced keratin inhibits Src activity during keratinocyte migration and tissue repair. J Cell Biol. 2012;197:381–9. Wang F, Chen S, Liu HB, Parent CA, Coulombe PA. Keratin 6 regulates collective keratinocyte migration by altering cell-cell and cell-matrix adhesion. J Cell Biol. 2018;217:4314–30. Trost A, Desch P, Wally V, Haim M, Maier RH, Reitsamer HA, Hintner H, Bauer JW, Onder K. Aberrant heterodimerization of keratin 16 with keratin 6A in HaCaT keratinocytes results in diminished cellular migration. Mech Ageing Dev. 2010;131:346–53. Migliavacca J, Zullig B, Capdeville C, Grotzer MA, Baumgartner M. Cooperation of Striatin 3 and MAP4K4 promotes growth and tissue invasion. Commun Biol. 2022;5:795. Qiu LM, Sun YH, Chen TT, Chen JJ, Ma HT. STRIP2, a member of the striatin-interacting phosphatase and kinase complex, is implicated in lung adenocarcinoma cell growth and migration. FEBS Open Bio. 2020;10:351–61. Zheng S, Chen X, Hong S, Long L, Xu Y, Simoncini T, Fu X. 17beta-Estradiol inhibits vascular smooth muscle cell migration via up-regulation of striatin protein. Gynecol Endocrinol. 2015;31:618–24. Guo Y, Redmond CJ, Leacock KA, Brovkina MV, Ji S, Jaskula-Ranga V, Coulombe PA. Keratin 14-dependent disulfides regulate epidermal homeostasis and barrier function via 14-3-3sigma and YAP1. Elife; 2020. p. 9. Cho SG. APC downregulated 1 inhibits breast cancer cell invasion by inhibiting the canonical WNT signaling pathway. Oncol Lett. 2017;14:4845–52. Yiew NKH, Chatterjee TK, Tang YL, Pellenberg R, Stansfield BK, Bagi Z, Fulton DJ, Stepp DW, Chen W, Patel V, Kamath VM, Litwin SE, Hui DY, Rudich SM, Kim HW, Weintraub NL. A novel role for the Wnt inhibitor APCDD1 in adipocyte differentiation: Implications for diet-induced obesity. J Biol Chem. 2017;292:6312–24. Schad EG, Petersen CP. STRIPAK Limits Stem Cell Differentiation of a WNT Signaling Center to Control Planarian Axis Scaling. Curr Biol. 2020;30:254–e263252. Oxford EM, Danko CG, Fox PR, Kornreich BG, Moise NS. Change in beta-catenin localization suggests involvement of the canonical Wnt pathway in Boxer dogs with arrhythmogenic right ventricular cardiomyopathy. J Vet Intern Med. 2014;28:92–101. Galli C, Piemontese M, Lumetti S, Ravanetti F, Macaluso GM, Passeri G. Actin cytoskeleton controls activation of Wnt/beta-catenin signaling in mesenchymal cells on implant surfaces with different topographies. Acta Biomater. 2012;8:2963–8. Bae SJ, Ni L, Osinski A, Tomchick DR, Brautigam CA, Luo X. SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK, Elife, 6 (2017). Huang W, Leonard D, Taylor DJ. Pack a STRIPAK with hubs inside a hub. Nat Struct Mol Biol. 2021;28:232–3. Kim JW, Berrios C, Kim M, Schade AE, Adelmant G, Yeerna H, Damato E, Iniguez AB, Florens L, Washburn MP, Stegmaier K, Gray NS, Tamayo P, Gjoerup O, Marto JA, DeCaprio J, Hahn WC. STRIPAK directs PP2A activity toward MAP4K4 to promote oncogenic transformation of human cells. Elife, 9 (2020). Tang Y, Fang G, Guo F, Zhang H, Chen X, An L, Chen M, Zhou L, Wang W, Ye T, Zhou L, Nie P, Yu H, Lin M, Zhao Y, Lin X, Yuan Z, Jiao S, Zhou Z. Selective Inhibition of STRN3-Containing PP2A Phosphatase Restores Hippo Tumor-Suppressor Activity in Gastric Cancer, Cancer Cell, 38 (2020) 115–128 e119. Misra JR, Irvine KD. The Hippo Signaling Network and Its Biological Functions. Annu Rev Genet. 2018;52:65–87. Arcucci S, Ramos-Delgado F, Cayron C, Therville N, Gratacap MP, Basset C, Thibault B. Guillermet-Guibert, Organismal roles for the PI3Kalpha and beta isoforms: their specificity, redundancy or cooperation is context-dependent. Biochem J. 2021;478:1199–225. Costa C, Ebi H, Martini M, Beausoleil SA, Faber AC, Jakubik CT, Huang A, Wang Y, Nishtala M, Hall B, Rikova K, Zhao J, Hirsch E, Benes CH, Engelman JA. Measurement of PIP3 levels reveals an unexpected role for p110beta in early adaptive responses to p110alpha-specific inhibitors in luminal breast cancer. Cancer Cell. 2015;27:97–108. Foukas LC, Berenjeno IM, Gray A, Khwaja A, Vanhaesebroeck B. Activity of any class IA PI3K isoform can sustain cell proliferation and survival. Proc Natl Acad Sci U S A. 2010;107:11381–6. Guillermet-Guibert J, Bjorklof K, Salpekar A, Gonella C, Ramadani F, Bilancio A, Meek S, Smith AJ, Okkenhaug K, Vanhaesebroeck B. The p110beta isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110gamma. Proc Natl Acad Sci U S A. 2008;105:8292–7. Juric D, Castel P, Griffith M, Griffith OL, Won HH, Ellis H, Ebbesen SH, Ainscough BJ, Ramu A, Iyer G, Shah RH, Huynh T, Mino-Kenudson M, Sgroi D, Isakoff S, Thabet A, Elamine L, Solit DB, Lowe SW, Quadt C, Peters M, Derti A, Schegel R, Huang A, Mardis ER, Berger MF, Baselga J, Scaltriti M. Convergent loss of PTEN leads to clinical resistance to a PI(3)Kalpha inhibitor. Nature. 2015;518:240–4. Pons-Tostivint E, Thibault B, Guillermet-Guibert J. Targeting PI3K Signaling in Combination Cancer Therapy. Trends Cancer. 2017;3:454–69. Schwartz S, Wongvipat J, Trigwell CB, Hancox U, Carver BS, Rodrik-Outmezguine V, Will M, Yellen P, de Stanchina E, Baselga J, Scher HI, Barry ST, Sawyers CL, Chandarlapaty S, Rosen N. Feedback suppression of PI3Kalpha signaling in PTEN-mutated tumors is relieved by selective inhibition of PI3Kbeta. Cancer Cell. 2015;27:109–22. Thibault B, Ramos-Delgado F, Guillermet-Guibert J. Targeting Class I-II-III PI3Ks in Cancer Therapy: Recent Advances in Tumor Biology and Preclinical Research. Cancers (Basel), 15 (2023). Tvrdik P, Capecchi MR. Reversal of Hox1 gene subfunctionalization in the mouse. Dev Cell. 2006;11:239–50. Gonzalez E, McGraw TE. The Akt kinases: isoform specificity in metabolism and cancer. Cell Cycle. 2009;8:2502–8. Hatakeyama Y, Saito N, Mii Y, Takada R, Shinozuka T, Takemoto T, Naoki H, Takada S. Intercellular exchange of Wnt ligands reduces cell population heterogeneity during embryogenesis, Nat Commun, 14 (2023) 1924. Seshacharyulu P, Pandey P, Datta K, Batra SK. Phosphatase: PP2A structural importance, regulation and its aberrant expression in cancer, Cancer Lett, 335 (2013) 9–18. Azzolin L, Panciera T, Soligo S, Enzo E, Bicciato S, Dupont S, Bresolin S, Frasson C, Basso G, Guzzardo V, Fassina A, Cordenonsi M, Piccolo S. YAP/TAZ incorporation in the beta-catenin destruction complex orchestrates the Wnt response, Cell, 158 (2014) 157–170. Pan D. The hippo signaling pathway in development and cancer. Dev Cell. 2010;19:491–505. Zhu Y, Wu Z, Yan W, Shao F, Ke B, Jiang X, Gao J, Guo W, Lai Y, Ma H, Chen D, Xu Q, Sun Y. Allosteric inhibition of SHP2 uncovers aberrant TLR7 trafficking in aggravating psoriasis. EMBO Mol Med. 2022;14:e14455. Ding Y, Ouyang Z, Zhang C, Zhu Y, Xu Q, Sun H, Qu J, Sun Y. Tyrosine phosphatase SHP2 exacerbates psoriasis-like skin inflammation in mice via ERK5-dependent NETosis, MedComm (2020), 3 (2022) e120. Guo D, Li X, Wang J, Liu X, Wang Y, Huang S, Dang N. Single-cell RNA-seq reveals keratinocyte and fibroblast heterogeneity and their crosstalk via epithelial-mesenchymal transition in psoriasis. Cell Death Dis. 2024;15:207. Soffer A, Mahly A, Padmanabhan K, Cohen J, Adir O, Loushi E, Fuchs Y, Williams SE, Luxenburg C. Apoptosis and tissue thinning contribute to symmetric cell division in the developing mouse epidermis in a nonautonomous way. PLoS Biol. 2022;20:e3001756. Supplementary Files STRNFigures.pptx Fig. S1. Testing shRNA sequences for optimal gene depletion of Striatins. Fibroblasts were infected with lentivirus particles expressing shRNA sequences directed to each Striatin family member (Sigma) and subjected to puromycin selection. The cells were harvested for WB analysis using the indicated antibodies. The most effective shRNA construct, as identified by reduced target protein expression compared to the control, was selected for subsequent experiments. Fig. S2. Principal Component analysis (PCA) presents sample homogeneity. RNA-seq results were analyzed as described. PCA analysis demonstrates the similarities between the three treatment replications for each shRNA. Figure S3. qPCR validation of RNA-seq results. Infected keratinocytes were analyzed by RNA-seq as described (left panels) or qPCR (right panel), using specific primers. A one-way ANOVA test (P <0.0009) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: ***P < 0.0007. Fig. S4. APCDD1 reduces the levels of active b-catenin. L-Wnt3A cells were transfected with either APCDD1 or control HA plasmid for 48h. (A) The cells were then harvested and subjected to western blot analysis using the indicated antibodies. (B) The graph represents the protein/Tubulin band intensity (in arbitrary units), calculated by the Fusion-Capt software. Results are mean values ± SD from 3 independent experiments. Paired t-test was used (*P=0.0487). Fig. S5. The effect of the Striatin proteins on the Hippo pathway is cell-type specific. Infected Fibroblasts were harvested for western blot analysis. The graph represents the protein/Tubulin band intensity (in arbitrary units), calculated by the Fusion-Capt software. Results are mean values ± SD from 3 independent experiments. A two-way ANOVA test (P <0.05) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: **P < 0.01. Cite Share Download PDF Status: Published Journal Publication published 19 Aug, 2025 Read the published version in Cell & Bioscience → Version 1 posted Editorial decision: Major revision 16 Apr, 2025 Reviewers agreed at journal 14 Apr, 2025 Reviewers invited by journal 12 Mar, 2025 Editor assigned by journal 24 Feb, 2025 First submitted to journal 23 Feb, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6093370","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":428089455,"identity":"a3702e63-0084-4ed4-8380-83356e9fc6d8","order_by":0,"name":"Rina Rosin-Arbesfeld","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIiWNgGAWjYFACHiC2YZBhOMB8AMiSkCFSSxqQPMCWANLCQ4oWHgMYFz/gn3324MMfCTY8fLfPfH51o8aCh4H98NEN+LRInMtLNuZJSOORPJe7zTrnGNBhPGlpN/Bac4bHTJrxx2EegzO824xz2IBaJHjM8GqRP8Nj/vNHwn+gFp5nxjn/iNACVGnGwJNwAKSF+XFuGxFaDM/wJUvzJCTzSJ5hM2PO7ZPgYSPkF7kzvAc//kiwk+M7w/z4c863Ojl+9sPH8HsfCbBJgElilYMA8wdSVI+CUTAKRsHIAQA5RUNbZ39JuAAAAABJRU5ErkJggg==","orcid":"","institution":"Tel Aviv University","correspondingAuthor":true,"prefix":"","firstName":"Rina","middleName":"","lastName":"Rosin-Arbesfeld","suffix":""},{"id":428089456,"identity":"7c3c3108-eccd-4c3f-9930-a15992cae497","order_by":1,"name":"Yarden Shor-Nareznoy","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Yarden","middleName":"","lastName":"Shor-Nareznoy","suffix":""},{"id":428089457,"identity":"9b5bb44b-e383-4d2e-9ec6-68d56b0f5185","order_by":2,"name":"Michal Caspi","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Michal","middleName":"","lastName":"Caspi","suffix":""},{"id":428089458,"identity":"721a601c-0a98-432c-aee3-eacc3144d3a8","order_by":3,"name":"Yan Lender","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Lender","suffix":""},{"id":428089459,"identity":"d4469bf7-ff77-415c-9d70-002d71e06251","order_by":4,"name":"Amnon Wittenstein","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Amnon","middleName":"","lastName":"Wittenstein","suffix":""},{"id":428089460,"identity":"055d0615-ac01-4b5e-974e-a54d669107b2","order_by":5,"name":"Arad Sofer","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Arad","middleName":"","lastName":"Sofer","suffix":""},{"id":428089461,"identity":"2b3ece9f-5010-43ff-99cc-c8d1c088a0fa","order_by":6,"name":"Hanin Elias","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Hanin","middleName":"","lastName":"Elias","suffix":""},{"id":428089462,"identity":"562d04e0-2a54-430d-8968-67c260c3f900","order_by":7,"name":"Natalie Zelikson","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Natalie","middleName":"","lastName":"Zelikson","suffix":""},{"id":428089463,"identity":"92093830-8ab4-452d-8126-d2f4dbf96867","order_by":8,"name":"Rana Masri","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Rana","middleName":"","lastName":"Masri","suffix":""},{"id":428089464,"identity":"41ea929e-82b1-434f-a0cf-a9cd73e598d2","order_by":9,"name":"David Pallads","email":"","orcid":"","institution":"Emory University","correspondingAuthor":false,"prefix":"","firstName":"David","middleName":"","lastName":"Pallads","suffix":""},{"id":428089465,"identity":"fe6677a0-df62-4361-b702-3909b8590e4a","order_by":10,"name":"Metsada Pasmanik-Chor","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Metsada","middleName":"","lastName":"Pasmanik-Chor","suffix":""},{"id":428089466,"identity":"1e5bb1e9-8728-4aee-bae3-6c3374868063","order_by":11,"name":"Chen Luxenburg","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Luxenburg","suffix":""}],"badges":[],"createdAt":"2025-02-24 05:19:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6093370/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6093370/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13578-025-01461-3","type":"published","date":"2025-08-19T16:29:17+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":78662501,"identity":"837b7d63-8bee-4ec0-834e-d89e52ece71d","added_by":"auto","created_at":"2025-03-17 10:26:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":378801,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReduced expression of the three Striatin members in fibroblasts and keratinocytes using shRNA\u003c/strong\u003e. Fibroblasts (A-C) and keratinocytes (D-F) were infected with specific shRNA lentivirus and selected by using 3mg/ml puromycin for one week. (A, D) The cells were then harvested and subjected to western blot analysis using the indicated antibodies – anti-Strn m that identifies both STRN and Zinedin, anti- SG2NA and anti-Zinedin. (B, E) The graphs represent the Striatins/Tubulin band intensity (in arbitrary units) calculated by the Fusion-Capt software normalized to the SCR control. (C, F) Treated cells were harvested using TRIzol reagent for RNA isolation. The graphs represent each Straitin/Ppib fold change using 2\u003csup\u003eDD\u003c/sup\u003eCt calculation. Results are mean values ± SD from 3–4 independent experiments. A one-way ANOVA test (P \u0026lt;0.0001) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: ****P \u0026lt; 0.0001. (G-H) Infected Fibroblasts (G) and keratinocytes (H) were fixed and stained using the indicated antibodies. Images were taken using confocal microscopy.\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/9d05ecb202b252733defb538.png"},{"id":78662509,"identity":"76180e5b-f8d9-415b-b971-e81716bc1baf","added_by":"auto","created_at":"2025-03-17 10:26:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":364426,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression of the three Striatin members in moues fibroblasts and keratinocytes.\u003c/strong\u003eSingle-cell skin data from untreated (normal) mice were downloaded from the Gene Expression Omnibus (GEO) under accession GSE188954 [74, 75] and preprocessed using standard analysis protocols of the Scanpy package in Python (ver. 1.9.6). Scrambled was utilized to remove doublets. For UMAP clustering, the Louvain algorithm was used, and cells were annotated based on the previous report [76]. The fibroblasts (blue circle) and keratinocytes (red circles) clusters were further analyzed for the expression of the three Striatin family members.\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/c0bf804f6ab86662fbd998db.png"},{"id":78662502,"identity":"cc097b7e-6201-437b-b213-f1fb93df2dc7","added_by":"auto","created_at":"2025-03-17 10:26:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":87692,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene expression pattern in fibroblasts and keratinocytes following depletion of Striatin members. \u003c/strong\u003eCells were infected with the different shRNA particles, harvested for RNA extraction and sent for RNA-seq analysis in three biological replicas. Libraries were prepared using the NEBNext Ultra II RNA Library Prep kit with the NEBNext Poly(A) mRNA Magnetic Isolation Module, starting with ~1000 ng of total RNA. Libraries were sequenced on a NextSeq 500 instrument using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kit. (A-B) Venn diagrams comparing between the differentially expressed genes (DEGs) that result from the different shRNAs compared to SCR control in fibroblasts (A) and keratinocytes (B).\u003c/p\u003e\n\u003cp\u003e(Cutoff: pFDR\u0026lt;0.05 and fold-change difference (FC)=2). \u0026nbsp;(C) Expression levels of the 2 genes upregulated in all three knockdowns. (D) RNA from infected cells was used for qPCR analysis. A one-way ANOVA test (P(KRT16)=0.0102, P(ENDOU)\u0026lt;0.0001) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: *P \u0026lt;0.05; **P \u0026lt;0.01; ****P\u0026lt;0.0001. The graphs represent qPCR of KRT16/Actin (left) or ENDO/Actin (right) fold change using 2\u003csup\u003eDD\u003c/sup\u003eCt calculation. Results are mean values ± SD from 3-4 independent experiments. (E) Venn diagrams illustrate the low number of shared genes between the fibroblasts and keratinocytes, with charts depicting the gene names and their expression levels.\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/a2f6cd943ac8cc9d55f85dc3.png"},{"id":78662870,"identity":"2b4c4d6f-be89-4b63-b33b-07889c962db0","added_by":"auto","created_at":"2025-03-17 10:34:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":179937,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBiological processes upregulated following depletion of Striatin-family proteins. \u003c/strong\u003eThe enriched functions and biological relevance of upregulated DEGs were identified by using (A) the Database for Annotation, Visualization and Integrated Discovery (DAVID) tool (pFDR\u0026lt;0.05 and FC\u0026gt;=2) (Dark – common to the 3 family members. Light – common to 2 family members). (B) GSEA utilizing the M2 curated gene sets (including Reactome database) and the M5 Gene Ontology database (Biological Process (GOBP; Cellular Component (GOCC); Molecular Function (GOMF) with the cutoff of NES \u0026gt; 1.7.\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/c45c0f80e9ef0f58d5f60a85.png"},{"id":78662506,"identity":"d9a53f87-a28d-4219-879e-1ebd07082171","added_by":"auto","created_at":"2025-03-17 10:26:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":52383,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of the Striatin proteins increases the expression of APCDD1, but only modestly affects active \u0026nbsp;b-catenin levels. \u003c/strong\u003e(A) RNA-seq analysis of APCDD1 expression in keratinocytes infected with the different shRNAs particles. Asterisks represent adjusted FDR values from left to right: 9*10\u003csup\u003e-10\u003c/sup\u003e, 8*10\u003csup\u003e-25\u003c/sup\u003e. FDR for SG2NA was 0.08. (B) RNA from infected cells was also used for qPCR analysis. The graph represents qPCR of APCDD1/Ppib fold change using 2\u003csup\u003eDD\u003c/sup\u003eCt calculation.\u0026nbsp; A one-way ANOVA test (P \u0026lt;0.0001) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: ****P \u0026lt; 0.0001, **P \u0026lt;0.01. (C) Infected keratinocytes were harvested and subjected to western blot analysis using the indicated antibodies. (D) The graph represents the protein/Tubulin band intensity (in arbitrary units), calculated by the Fusion-Capt software. Results are mean values ± SD from 3 independent experiments. A two-way ANOVA test (P \u0026lt;0.05) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: **P \u0026lt;0.01, *P \u0026lt;0.05.\u003c/p\u003e","description":"","filename":"Slide5.png","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/e5e25950925a3bc624a16d5f.png"},{"id":78662504,"identity":"86fe6780-1c87-4a6c-b23d-d81d894841cd","added_by":"auto","created_at":"2025-03-17 10:26:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":155705,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Striatin proteins affect the Hippo pathway by stabilizing pYAP.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were infected with the different shRNA virus particles, harvested for RNA extraction and sent for RNA-seq analysis as described above. (A) A heat map of selected Hippo-related genes is shown. (B) The keratinocytes were harvested and subjected to western blot analysis using the indicated antibodies. (C-D) The graphs represent the protein/Tubulin band intensity (in arbitrary units relative to SCR control cells), calculated by the Fusion-Capt software. Results are mean values ± SD from 3 independent experiments. A two-way ANOVA test (P \u0026lt;0.05) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: ****P \u0026lt; 0.0001, ***P \u0026lt; 0.001, **P \u0026lt; 0.01. (E-F) Keratinocyte knockdown for each strain were plated and treated with either 10uM MG132 or DMSO and subjected to western blot analysis using the indicated antibodies. The graph represents the protein/Tubulin band intensity (in arbitrary units relative to SCR control) of MG132 treated cells calculated by the Fusion-Capt software. Results are mean values ± SD from 3 independent experiments. A two-way ANOVA test (P \u0026lt;0.05) was used. Asterisks denote the statistical significance of scrambled vs shRNA in a Dunnett’s multiple comparisons test: ****P \u0026lt; 0.0001, ***P \u0026lt; 0.001. (G) Mass-spectrometry analysis of protein expression levels (fold change) of 14-3-3 protein variants.\u003c/p\u003e","description":"","filename":"Slide6.png","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/e2d77778340761a1cdccbc4c.png"},{"id":78662869,"identity":"d54f0281-d1f1-490a-87fc-d608cb65fd5d","added_by":"auto","created_at":"2025-03-17 10:34:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":209558,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe levels of the Striatin proteins affect cell migration.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInfected cells were plated on 96 well plate and scratch was made using Incucyte® WoundMaker. Images were taken every 2h for 24h using IncuCyteS3. (A) Live images of wound closure in selected time points. (B) The graph represents the wound closure rate of 3 biological repeats using the Incucyte program. (C) Infected cells were fixed and stained using KI67 as a proliferation marker and Dapi to stain the nuclei. Pictures were taken using confocal microscopy. (D) The graph represents KI67/Dapi signal intensity quantification using an independent script. A one-way ANOVA test (P \u0026lt;0.05) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: **P = 0.0020.\u003c/p\u003e","description":"","filename":"Slide7.png","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/c9d56a97f30e7d7dcd47b3cd.png"},{"id":89847237,"identity":"741e152e-8f24-4491-ab12-8f4a78cbb4d6","added_by":"auto","created_at":"2025-08-25 16:42:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2623229,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/b8da8017-993d-449a-8b40-027dbc1dc654.pdf"},{"id":78662516,"identity":"12541e11-8181-4210-9559-493ed090e896","added_by":"auto","created_at":"2025-03-17 10:26:10","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":39368766,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S1. Testing shRNA sequences for optimal gene depletion of Striatins. \u003c/strong\u003eFibroblasts were infected with lentivirus particles expressing shRNA sequences directed to each Striatin family member (Sigma) and subjected to puromycin selection. The cells were harvested for WB analysis using the indicated antibodies. The most effective shRNA construct, as identified by reduced target protein expression compared to the control, was selected for subsequent experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. S2. Principal Component analysis (PCA) presents sample homogeneity. \u003c/strong\u003eRNA-seq results were analyzed as described. PCA analysis demonstrates the similarities between the three treatment replications for each shRNA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S3. qPCR validation of RNA-seq results.\u003c/strong\u003e Infected keratinocytes were analyzed by RNA-seq as described (left panels) or qPCR (right panel), using specific primers. A one-way ANOVA test (P \u0026lt;0.0009) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: ***P \u0026lt; 0.0007.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. S4. APCDD1 reduces the levels of active b-catenin. \u003c/strong\u003eL-Wnt3A cells were transfected with either APCDD1 or control HA plasmid for 48h. (A) The cells were then harvested and subjected to western blot analysis using the indicated antibodies. (B) The graph represents the protein/Tubulin band intensity (in arbitrary units), calculated by the Fusion-Capt software. Results are mean values ± SD from 3 independent experiments. Paired t-test was used (*P=0.0487).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. S5. The effect of the Striatin proteins on the Hippo pathway is cell-type specific\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eInfected Fibroblasts were harvested for western blot analysis. The graph represents the protein/Tubulin band intensity (in arbitrary units), calculated by the Fusion-Capt software. Results are mean values ± SD from 3 independent experiments. A two-way ANOVA test (P \u0026lt;0.05) was used. Asterisks denote the statistical significance of SCR vs shRNA in a Dunnett’s multiple comparisons test: **P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"STRNFigures.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6093370/v1/cdb786fcbaf6964d232bfbb4.pptx"}],"financialInterests":"","formattedTitle":"The Role of the Striatin Family Proteins in Hippo Signaling and Cellular Regulation","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eThe Striatin family of proteins consists of Striatin (STRN1), SG2NA (STRN3), and Zinedin (STRN4), which are multi-domain scaffolding proteins that include a caveolin-binding domain, a coiled-coil region, a calmodulin-binding domain, and a WD-repeat domain [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The unique structural organization implies a defined function for these proteins, yet data show that their function, subcellular localization, and expression patterns varies in different scenarios [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The Striatin proteins are both cytosolic and membranal proteins that function in cell-cell adhesion [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] and are core components of the Striatin-interacting phosphatase and kinase (STRIPAK) complex, which is a large protein complex involved in cytoskeleton organization, cell migration, and neural development [\u003cspan additionalcitationids=\"CR7 CR8 CR9\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Although the three proteins share similar characteristics, some differences can be found. For example, while Striatin and Zinedin share more similarity regarding their function and cellular distribution (mainly dendritic spines), SG2NA is more ubiquitously distributed and can be found in all human tissues [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In addition, there is a slight change in the amino-acid sequence at the N-terminus of Striatin and Zinedin, which further distinguishes them from SG2NA [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The functions of the Striatin proteins and the STRIPAK complex are not entirely clear probably due to their number and pattern of the interacting partners, cell specificity, and timely expression. Striatin was shown to affect the Wnt pathway, by binding to the core Wnt signaling component adenomatous polyposis coli (APC) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Recent data also link the STRIPAK complex to the Hippo pathway [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], a tumor suppressor signaling cascade and a major organ size and development regulator. The Hippo pathway is activated by various signals and factors, resulting in the nuclear localization of YAP/TAZ transcription factors, and the expression of target genes such as Cyclin D1, Connective Tissue Growth Factor (CTGF), Snail and Slug [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The cascade is initiated by autophosphorylation of MST1/2 and SAV1, which in turn phosphorylates LATS1/2 and the MOB complex. This phosphorylation regulates YAP/TAZ phosphorylation, which leads to proteasomal degradation following specific ubiquitination by E3 ligase. The STRIPAK complex is thought to negatively regulate the Hippo pathway as it interacts and dephosphorylates MST1/2, thus allowing for the entrance of YAP/TAZ to the nucleus and the transcription of target genes [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The Striatin proteins, which are part of the STRIPAK complex, have different roles, including cellular signaling, cardiovascular health, cell adhesion, and hormone signaling. By knocking down the different Striatin family members in primary keratinocytes and fibroblasts, we aimed to define the specific roles of each protein and provide insights into their common and distinct cellular functions.\u003c/p\u003e \u003cp\u003eInterestingly, we found that silencing each Striatin member individually led to global gene expression changes unique to the silenced protein and specific to the cell type. Nevertheless, all three individual depletions had a common effect on some biological processes and a similar effect on the levels of phosphorylated Yap (pYAP), which suggests a role in stabilizing the Hippo pathway.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eReduced expression of the three Striatin members in fibroblasts and keratinocytes using shRNA.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo better understand the functions of the different Striatin proteins, specific shRNA sequences were used to knockdown (KD) each of the three Striatin family members in both fibroblasts (Fig. 1A-C) and keratinocytes (KTs; Fig. 1D-F). Striatins are scaffolding proteins implicated in multiple cellular signaling pathways. Fibroblasts and keratinocytes were used as they are an excellent model system for studying Striatin proteins due to their unique biological roles and cellular characteristics. Keratinocytes play a major role in epithelial cell barrier formation, and we have previously shown that Striatn is involved in cell adhesion [5], while fibroblasts are non-adherent cells and may serve as a control. Both cell types are involved in several signaling pathways.\u0026nbsp;Fourteen\u0026nbsp;shRNA sequences (detailed in the Material section) targeting the three different Striatin family genes were purchased, cloned and used to infect the cells. The sequence that showed the most robust protein depletion for each Striatin member (shSTR-79, shSG2NA-17, shZinedin-68; Fig. S1) was used in further experiments. Figure 1 demonstrates the reduced expression of each Striatin-family protein on both the mRNA (Fig. 1C, F) and the protein level (Fig. 1A-B, D-E). To further demonstrate the ability of the chosen shRNAs to reduce the expression of their corresponding Striatin members, immunofluorescent assays were conducted. \u0026nbsp;As shown in Figure 1G-H, a specific reduction of each Striatin protein was observed following shRNA infection in both fibroblasts (Fig. 1G) and keratinocytes (Fig. 1H). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExpression of the three Striatin members in mouse fibroblasts and keratinocytes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe three Striatin family members are expressed in various cells and tissues, and while Striatin and Zinedin are more brain-specific, SG2NA is ubiquitously expressed [2]. Single-cell RNA-Seq analysis of published data on murine skin cells (Fig. 2) demonstrates unique expression patterns of the three Striatin members in mouse fibroblasts (left panels) and keratinocytes (right panels).\u0026nbsp;Similar data has been previously shown\u0026nbsp;[15], indicating that key biological functions and pathways are differentially expressed in the two cell types. We used RNA-seq analysis to test how the downregulation of each protein affected the expression levels of other genes. Principal Component analysis (PCA) indicates that in both cell types, the effects of Striatin and Zinedin are more closely related in terms of gene expression compared to SG2NA (Fig. S2). These findings agree with previous studies showing that Striatin and Zinedin share higher similarities in their function and cellular distribution in comparison to SG2NA\u0026nbsp;[4]. Venn analysis was used to compare differentially expressed genes (DEGs) resulting from the effects of the shRNA vs the control (scrambled sequence; SCR). \u0026nbsp; In fibroblasts (Fig. 3A), around 50% of DEGs that were affected by shSG2NA depletion are unique (159 out of 319), compared to smaller numbers in Striatin and Zinedin silencing. In keratinocytes (Fig. 3B), on the other hand, most of the DEGs were unique to each shRNA, and the effect of shZinedin was the most robust (224 DEGs). To validate the RNA-seq results, quantitative PCR (qPCR) analysis was conducted on several genes using specific primers (Fig. S3). In most cases, the results were similar to those obtained in the RNA-seq experiments. Only two genes with elevated expression common to all three knockdowns in keratinocytes were identified. \u0026nbsp;ENDOU, an endoribonuclease\u0026nbsp;[16, 17], and KRT16, a type I intermediate filament cytoskeletal protein that regulates innate immunity in response to epidermal barrier breach\u0026nbsp;[18]\u0026nbsp;(Fig.3 C-D). The upregulation of these two genes was examined by qPCR experiments in all three shRNAs treated keratinocytes (Fig. 3D). The results for KRT16 exhibit similar tendencies as the RNA-seq data. ENDOU upregulation was slightly different as the effects of shSTRN and SG2NA were insignificant, possibly arising from sensitivity differences or multiple gene variants\u0026nbsp;[19].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInterestingly, comparing DEGs between fibroblasts and keratinocytes (Fig. 3E) revealed that many more genes were altered in fibroblasts (Fig. 3E, upper panel), and the silencing levels of all Striatin proteins (in red) were higher in keratinocytes than in fibroblasts (Fig. 3E, bottom panel). In addition, no common DEGs were detected following striatin depletion, and only a few genes were affected in both cell types after silencing SG2NA or Zinedin. The overlap between the SCR and shRNA varies significantly among the different Striatins, most likely due to distinct regulatory elements, cell types, or variable context and expression levels. Similar results were reported for other gene families (for example, the FOXP family [20]).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiological processes upregulated by depletion of Striatin-family proteins.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs the depletion of the different Striatin proteins resulted in diverse changes in gene expression, we utilized Database for Annotation, Visualization and Integrated Discovery (DAVID) and Gene Set Enrichment (GSEA) analyses to better understand the affected biological processes and pathways. One common biological process shared by keratinocytes and fibroblasts is cellular development (Fig. 4A). Interestingly, cell differentiation was affected by the silencing of all three family members only in keratinocytes, whereas functions related to cell localization, migration, and motility were only upregulated in fibroblasts. It was previously reported that in some cases, differentiation and migration are mutually exclusive, as in wound healing, where migrating keratinocytes cease to differentiate, and normal differentiation resumes only after epidermal wound closure is achieved [21]. This result can provide some explanation for the inhibitory effect on keratinocyte migration rate observed following Striatins knockdown. GSEA analysis using additional databases [22] is presented in Figure 4B. It is clearly demonstrated that the response of keratinocytes and fibroblasts to shRNA treatments is cell-specific. The effects within each cell type also differ with the knockdown of the different Striatin proteins.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eKnockdown of the Striatin proteins increases the levels of APCDD1 but only modestly affects active\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003cstrong\u003e-catenin levels.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur results indicate that the Striatin proteins are more efficiently silenced in keratinocytes as compared to fibroblast (Fig. 3E). Since Striatin is known to be expressed in epithelial cell-cell junctions [4, 23-25] and keratinocytes have highly developed, functional junctions [26], we continued to examine the effects of Striatin protein loss in primary mouse keratinocytes. Striatin was shown to interact with APC [11, 27] a core negative regulator of the canonical Wnt signaling pathway [28].\u0026nbsp;We thus examined a possible connection between the different Striatins and the Wnt cascade. Z-scores of the RNA-seq data showed no direct effect on the overall Wnt signal transduction pathway, and no clear pattern shared by all three Striatin family members' downregulation could be detected (Not shown). Nevertheless, the levels of APCDD1, a known Wnt signaling inhibitor\u0026nbsp;[29], were elevated in all Striatin knockdown cells. \u0026nbsp;The depletion of SG2NA had a relatively minor effect in the RNA-Seq analysis (Fig. 5A). APCDD1 is a transmembrane protein that blocks the interaction between the LRP receptor and cognate Wnt ligand, thus inhibiting Wnt signaling activation\u0026nbsp;[29].\u0026nbsp;We confirmed the effect of APCDD1 on the Wnt cascade by over-expressing the APCDD1 in fibroblasts that constitutively express Wnt3A (L-Wnt3A cells). As expected, APCDD1 upregulation led to reduced levels of active-β catenin in these cells (Figure S4). Next, we performed qPCR in the keratinocyte’s knockdown cells, demonstrating an increase in APCDD1 transcript levels, especially although much more subtle in both Striatin and Zinedin (Fig. 5B). When examining the effect of silencing the individual Striatins on the APCDD1 protein expression levels, a minor but significant increase was detected (Fig. 5C-D). A slight effect was also seen on the levels of active\u0026nbsp;b-catenin protein most significantly by Striatin depletion.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe Striatin proteins affect the Hippo pathway by stabilizing pYAP.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferent studies have shown crosstalk between the STRIPAK complex and the Hippo signaling pathway, indicating their collaborative roles in governing cellular behavior and fate [13, 30-32]. We thus examined the effect of the Striatin proteins on Hippo signaling components. Our results demonstrate some distinctive patterns (Fig. 6A), implying that the Striatin family members may be involved in regulating the Hippo cascade. To better understand this involvement, we monitored known core components of the Hippo pathway following Striatin members’ silencing in keratinocytes. Neither Yes-associated protein (YAP) nor TAZ, which are the key effector proteins of the Hippo pathway, were affected by the treatment (thus excluded from the heat map). However, the two phosphorylated forms of YAP pYAP(127) and pYAP(397) were significantly downregulated by all three shRNAs (Fig. 6B, C). Several previous studies have shown similar findings: for example, cell-cell contact leads to increased YAP phosphorylation (pS127) while total YAP remains constant\u0026nbsp;[33]; Serum concentration or LPA levels can also affect YAP phosphorylation without changing the levels of total YAP [34, 35]. In all reports, the Hippo pathway was activated by the increase of the pYAP form and the translocation of YAP between the nucleus and cytoplasm.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe next examined the expression of Hippo target genes involved in cell survival and proliferation and found that Axin2 (that is also a Wnt target gene) [36] and Slug [37] were downregulated in knockdown cells of all three Striatin members (Fig. 6B, D). The results were not reproduced in knockdown fibroblasts (Fig. S5), which suggests that the Striatin/Hippo interplay is cell-specific and probably highly complex. The different phosphorylation sites of YAP were shown to govern the fate of the YAP protein; while pYAP(127) induces cytoplasmatic retention, pYAP(397) is sent to proteasomal degradation [38]. We thus tested whether the effect observed in the knockdown keratinocytes was due to induced proteasomal degradation of the pYAP variants. To this end, we treated the cells with MG132, a proteasomal inhibitor, and monitored the expression levels of total YAP and pYAP variants. As shown in Figures 6E-F, hindering protein degradation led to increased levels of both pYAP forms, suggesting that Striatin family proteins protect phosphorylated YAP from proteasomal degradation. Mass-spectrometry analysis of keratinocytes depleted of the Striatin proteins revealed a decrease in the levels of various members of the 14-3-3 proteins in both shStriatin and shSG2NA (Fig. 6G). This finding can partially explain the reduction in pYAP(127), as this form of YAP is usually bound to 14-3-3 proteins, leading to its cytoplasmatic retention[38]. Thus, a decrease in 14-3-3 protein levels may facilitate pYAP(127) proteasomal degradation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe levels of the Striatin proteins affect cell migration.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell migration is crucial for correct development and maintaining the organization of multicellular organisms. In contrast, aberrant cell migration is found in many pathological disorders. Cell migration can be monitored using the wound healing assay, which involves growing a cell monolayer to confluence, creating a ‘wound’ (a cell-free zone in the monolayer) into which cells can migrate, and monitoring the recolonization of the scratched region to quantify cell migration [39]. Slug, which was affected by the Striains KD, is a known inducer of Endothelial-Mesenchymal transition (EMT) and has an important role in cell migration [40]. Since Striatin has been suggested to play a role in wound closure, we further investigated the possible effect on cell migration using an automated wound-healing assay. The results reveal that depletion of each of the Striatin family proteins led to a decrease in cell movement between 3-9 hrs after the wound generation (Fig. 7A-B). We also examined the cell proliferation status using the KI67 marker. Interestingly, only a minor reduction in cell proliferation was seen, most notably by Zinedin knockdown (Fig. 7C-D).\u0026nbsp;\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eStriatin, SG2NA, and Zinedin comprise the calmodulin WD-40 repeat Striatin protein family and are part of the STRIPAK complex [2, 8]. These proteins are conserved signaling scaffolds that are expressed in different tissues [2]. Both SG2NA and Striatin undergo alternative splicing to produce several isoforms which are differentially regulated in a tissue-dependent manner. Although the Striatin family of proteins was discovered long ago, their functions are only now being revealed. They are known to be involved in different cellular functions including: cell cycle regulation, neuroprotection, estrogen signaling and cell-cell communication (for review, see [7]). Striatins are also connected to different pathologies such as heart failure and cancer [2], and a STRN-ALK fusion protein is found in\u0026nbsp;aggressive forms of thyroid cancer\u0026nbsp;[41]\u0026nbsp;as well as in other cancer types. The different functions of the Striatin proteins are usually specific to each family member, and we aimed to understand whether these proteins have common functions. To this end,\u0026nbsp;we created a lentiviral knockdown system that specifically silences the individual Striatin proteins. The system was utilized in both mouse fibroblast cells and primary keratinocytes. Keratinocytes and fibroblasts represent the major cell types in the epidermis and dermis of the skin. The two cell types respond to the inflammatory phase in the cutaneous repair/regeneration process, and inflammatory signals activate their proliferation and maturation, which is essential for wound healing\u0026nbsp;[42]. Both keratinocytes and fibroblasts play a significant role in the maintenance of skin homeostasis. However, their distinct biological characteristics remain to be elucidated\u0026nbsp;[15]. Further analysis demonstrated that several key biological functions and pathways are differentially expressed in the two cell types including: regulation of the actin cytoskeleton, focal adhesion and ECM-receptor interaction\u0026nbsp;[15]. Striatin, SG2NA and Zinedin are abundantly expressed in both keratinocytes and fibroblasts, though scRNA-seq data demonstrate differential expression across these cells. Our results indicate that the roles of the Striatin members are also specific to each cell type.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRNA-Seq results of the individual shRNAs revealed that depletion of each striatin member leads to changes in the expression of different gene sets. The silencing effect was cell-specific, and the knockdown was more robust in the differentiated primary keratinocytes. The Striatin family members share a similar structure and several motifs, and a subtle compensatory effect was detected in cells where Zinedin was silenced (not shown), leading to moderately increased Striatin protein levels. This is not surprising as Zinedin and Striatin share common features [4].\u003c/p\u003e\n\u003cp\u003eInterestingly, our results indicate that of the three Striatin knockdowns, shZinedin caused the most robust effects on global gene regulation, APDDC1, and cell proliferation. We speculate that specific modifications may significantly influence its interactions with other proteins, activity and localization, contributing to its distinct functional roles.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOnly two genes were altered by all three shRNAs in keratinocytes. ENDOU, an endoribonuclease that binds polyuridine-enriched single-stranded RNA [16, 17], and keratin16 (KRT16), an intermediate filament cytoskeletal protein that regulates danger signals, innate immunity, and barrier function of the skin epidermis [18]. Neither of these genes has been previously connected to the Striatin family. KRT16, which forms a complex with KRT6 may be of particular interest as it has important roles in cell migration [43, 44]. An additional study also demonstrated that KRT16 overexpression reduces the migration potential of human immortalized keratinocytes [45]. Several studies [5, 6, 9, 46-48], including the results shown here, demonstrate that Striatin proteins and the STRIPAK complex are involved in cell migration of different cell types. It is possible that in keratinocytes this effect is mediated, at least in part, through KRT16. Interestingly, a different skin filament protein, KRT14, interacts with 14-3-3 through a residue that is conserved in keratins, and affects Hippo signaling [49]. The increased levels of KRT16 in all three KDs suggest a common function for the Striatin proteins in protecting against skin injury or inflammatory conditions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlthough striatin was shown to interact with the tumor suppressor gene APC\u0026nbsp;[11, 27],\u0026nbsp;a known inhibitor of the canonical Wnt signaling pathway, no global effect of Striatin members knockdown on Wnt signaling-related gene expression was observed. Nevertheless, APCDD1, a canonical Wnt signaling inhibitor [29], was upregulated by all three shRNAs (STRN- 4.58; SG2NA-1.82; Zinedin-10.12 fold).\u0026nbsp;APCDD1 blocks the interaction between Wnt ligands and their LRP receptor, leading to ongoing degradation of active β-catenin. By inhibiting Wnt signaling, APCDD1 helps regulate cell proliferation and differentiation, maintaining tissue homeostasis and preventing uncontrolled cell growth\u0026nbsp;[50]. The increase in APCDD1 mRNA levels detected by qPCR was much more moderate (1.5-2.5-fold) than those obtained by the RNA-Seq experiments (1.8-10-fold), again with the greatest increase in Zinedin knockdown cells. These differences between RNA-seq and qPCR results can arise from several factors, including sensitivity differences, normalization methods, and technical variability. In addition, RNA-seq captures the gene expression profile at the time of sampling, which can vary due to biological factors such as cell cycle stage, differentiation status, or environmental influences. If qPCR is conducted on a different sample or time point, results may not align. This is particularly true for primary cultures. \u0026nbsp;The effect on the APCDD1 protein levels was even more subtle (less than 1.5 fold), which correlated with the minor decrease in\u0026nbsp;b-catenin expression. It is possible that other factors affect the protein expression levels of APCDD1 as it was previously shown that miR-130, for example, is a posttranscriptional regulator of APCDD1 gene expression\u0026nbsp;[51]. Our results suggest that the connection between the Striatin family proteins and the Wnt cascade are diverse and may not be direct. This agrees with previous findings showing the different effects of Striatin on the Wnt cascade. Apart from the interaction of Striatin with the negative regulator of the canonical Wnt pathway - APC\u0026nbsp;[11], Striatin was also shown to inhibit \u003cem\u003eWnt1\u003c/em\u003e expression in specific cells\u0026nbsp;[52], and to co-localize with\u0026nbsp;b-catenin in different pathological conditions\u0026nbsp;[53]. Our results demonstrate reduced levels of active\u0026nbsp;b-catenin following striatin depletion. It is possible that this observation is not directly related to changes in APCDD1 levels and can be attributed to other mechanisms, including the effect of shSTRN on cytoskeleton organization (Fig. 4A; STRN column), which was shown to influence\u0026nbsp;b-catenin expression levels\u0026nbsp;[54]. Our data also shows changes in adhesion and migration processes that may mediate the effect on\u0026nbsp;b-catenin, independent of APCDD1.\u003c/p\u003e\n\u003cp\u003eStriatin proteins and the STRIPAK complex are strongly connected to the Hippo signaling pathway [46, 55-58]. The Hippo pathway controls organ size, cell proliferation, and apoptosis, playing an essential role in maintaining tissue homeostasis and preventing tumorigenesis. At the core of this pathway is a kinase cascade that phosphorylates and inactivates the transcription co-activators YAP and TAZ. When YAP/TAZ are phosphorylated, they are retained in the cytoplasm and eventually targeted for degradation. When dephosphorylated, they translocate to the nucleus and promote gene expression [59]. The STRIPAK complex inhibits Hippo signaling by dephosphorylating and inactivating core Hippo components. This inactivation allows unphosphorylated YAP to enter the nucleus and promote the transcription of pro-growth genes. Conversely, in the absence of STRIPAK, YAP is phosphorylated and inhibited, thereby impacting downstream signaling cascades and cellular outcomes [56]. We show that silencing the different Striatin family members led to decreased phosphorylated levels of YAP, most likely due to increased proteasomal degradation. Since other upstream components of the Hippo pathway, such as the LATS1 kinase and SAV1, were unaffected by either KD, the possibility of reduced phosphorylation due to upstream cascade disruption is slight. In addition, our mass spectrometry analysis revealed a decrease in the expression of 14-3-3 protein variants, which are known to retain pYAP(127) in the cytoplasm. Reduced levels of 14-3-3 proteins may facilitate pYAP(127) degradation as well. In both cases, inhibiting proteasome activity restored the levels of pYAP(127) and pYAP(397) in single Striatin protein knockdown cells. Despite total YAP being unaffected by Striatin protein knockdowns, the target genes Slug and Axin2 were downregulated, indicating a downstream effect on Hippo pathway function. Consistent with our findings, others have also reported decreased YAP target gene expression in SG2NA or Zinedin-depleted cells [46]. Thus, it will be important to determine whether the negative effect on YAP signaling is due to reduced stability of the pYAP variants or another effect we have yet to uncover.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eVery little is currently known about the biological roles of Striatin family members and their unique role in various cell types and under different conditions. Our observations illuminate the complex relationships between the three Striatin proteins and their abilities to inhibit each other's effects potentially. We found\u0026nbsp;that there were no or only slight changes in the expression of the non-knockdown Striatins in most compensatory experiments (not shown). This finding may be of interest as it suggests that functional redundancy can occur through mechanisms beyond simple gene expression increases. Instead, other genes or proteins with overlapping or complementary roles may adapt functionally to mitigate the loss, or there may be signaling pathway changes that achieve parallel outcomes. Similar findings were shown in other gene families; for example, when certain PI3K isoforms (such as PI3Kα or PI3Kβ) are knocked down, other isoforms (like PI3Kγ or PI3Kδ) are not upregulated, yet cells maintain downstream signaling to some extent. This compensation often occurs through pathway rewiring or by leveraging alternative PI3K-independent pathways, such as those involving Akt or mTOR\u0026nbsp;[60-67]. The HOX gene family also exhibit partial compensation\u0026nbsp;following a single HOX gene depletion by related HOX genes without altering their expression levels\u0026nbsp;[68]. Akt Kinases - in some cases, knocking down Akt1 does not lead to an increased expression of Akt2 or Akt3, but these isoforms can compensate functionally to a certain extent\u0026nbsp;[69].\u0026nbsp;In\u0026nbsp;Wnt Signaling, knocking down specific Wnt ligands (such as Wnt3a) in certain cells may not lead to increased expression of other Wnt ligands. Instead, Wnt ligands supplied by neighboring cells compensate for the decrease of Wnt activity. Thus, the exchange of Wnt3a ligands appears to compensate for the rapid decrease in Wnt activity in individual cells\u0026nbsp;[70]. \u0026nbsp;Additionally, as the same catalytic subunit of PP2A is directed by different targeting subunits (including Striatin), PP2A heterotrimers with different regulatory subunits have altered functions in diverse signaling pathways\u0026nbsp;[71], which may partly explain this result.\u003c/p\u003e\n\u003cp\u003eMembers of the Striatin family form a complex network of signaling hubs with different kinases, phosphatases, and other signaling proteins to execute their many roles. These functions are carried out by gene diversification and multiple post-transcriptional and post-translational modifications giving rise to varieties of final effector molecules. Some studies suggest that distinct isoforms of this family of proteins are differently expressed, depending on the cell cycle stages and/or tissue types, indicating that specific isoforms have differential functions.\u003c/p\u003e\n\u003cp\u003eThe Striatin proteins and the conserved Hippo and Wnt signaling pathways play unique roles in regulating cell growth, migration, proliferation, apoptosis, and stem cell maintenance [72, 73]. Understanding the interplay between these three biological elements offers a promising avenue for anti-cancer drug development. We propose that Striatins may act as regulatory hubs that influence both pathways and may be targeted to either upregulate Hippo activity or inhibit Wnt signaling in cancer cells. Targeting the Striatin family members to influence both pathways simultaneously could result in more robust inhibition of cancer growth while minimizing effects on non-cancerous cells. In addition, if specific Striatin-Wnt-Hippo interactions are associated with aggressive or treatment-resistant cancers, these proteins could serve as biomarkers. Monitoring their levels or activity in tumors could provide insight into cancer progression and treatment response, allowing for more personalized therapeutic strategies.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, using the shRNA knockdown approach, we show that Striatin, SG2NA, and Zinedin have some common functions, such as affecting cell migration, while other functions are completely distinct. Regarding the Hippo pathway, we have uncovered a potential novel role for Striatin proteins in stabilizing pYAP variants. Finally, our results reveal a complex interplay between the three Striatin family members that remain elucidated.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by Grant No 2017173 from the United States-Israel Binational Science Foundation (BSF) granted to Rina Rosin-Arbesfeld and David C. Pallas.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eall authors have approved and have consented the manuscript\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u0026nbsp;\u003c/strong\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material:\u0026nbsp;\u003c/strong\u003eall data are present in the paper, the Supplementary Materials, or will be uploaded to the GEO. All materials used in this paper are listed and are commercially available.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding and acknowledgments:\u0026nbsp;\u003c/strong\u003eThis study was supported by Grant No 2017173 from the United States-Israel Binational Science Foundation (BSF) granted to Rina Rosin-Arbesfeld and David C. Pallas.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"109%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eREAGENT or RESOURCE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSOURCE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIDENTIFIER\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAntibodies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eStriatin (m)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBD\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e# 610838\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eStriatin (Rb)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eProteinech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e21624-1-AP\u003cbr\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSG2NA\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNovus Biologicals\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNB110-74572\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;Ki67\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAb15580\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAPCDD1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNovus Biologicals\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNB110-92756\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eActive beta catenin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCell Signaling\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e#8814\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHippo signaling kit\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCell Signaling\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e#8579\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAxin2\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCell Signaling\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e#2151\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSlug\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCell Signaling\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e#9585\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTubulin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSanta Cruz\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSc-8035\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eActin\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAb205\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDAPI\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSigma, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28718-90-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAlexa Fluor\u0026reg; 594\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eJackson laboratories\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;711-585-152\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAlexa Fluor\u0026reg; 488\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eJackson laboratories\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e108-545-003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eChemicals\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMG132\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCalbiochem\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e133407-82-6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDMSO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSigma, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e# D5879\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePolybrene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSigma, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e#107689\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePuromycin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInvivoGen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e58-58-2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTrizol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBioLab-chemicals\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e009010233100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCommercial assays\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eiTaq Universal SYBR Green Supermix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBioRad, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e# L001752 B\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eiScript cDNA synthesis kit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBioRad, USA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e# 1708891\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGeneJET Gel Extraction Kit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eThermo Fischer\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eK0691\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eQuick ligation kit \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNEB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eM2200S\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCell lines\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eL cells\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCRL-2648\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eL Wnt 3A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCRL-2647\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMouse primary keratinocytes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMouse embryos\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHEK293FT cells\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCRL-11268\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eOligonucleotides\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eStriatin Fw TCACGCTAGAATCCAATGTTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eStriatin Rv GGGTAGGATGGCTGATGACTC\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSG2NA Fw GAGACCTTGCAGACTTGACGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSG2NA Rv GAGGCAGTAACGAGCACAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eZinedin Fw TTCTGCGACAGTACCTGGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eZinedin Rv CTCTTGATCTGTTCCTCGATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAPCDD1 Fw CGCCTGGAGGGCTTTCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAPCDD1 Rv GGACCCGACCTTACTTCACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePpib Fw GTGAGCGCTTCCCAGATGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePpib Rv TGCCGGAGTCGACAATGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eACTB Fw\u003c/p\u003e\n \u003cp\u003eCTAAGGCCAACCGTGAAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eACTB Rv\u003c/p\u003e\n \u003cp\u003eACCAGAGGCATACAGGGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eKrt16 Fw\u003c/p\u003e\n \u003cp\u003eGGACCAGTATGAGCAGATGGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_008470\u003c/p\u003e\n \u003cp\u003eOriGene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eKRT16 Rv\u003c/p\u003e\n \u003cp\u003eTCGCTGCGGTTGCTCTGGATTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_008470\u003c/p\u003e\n \u003cp\u003eOriGene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eENDOU Fw CTTGCCACTGTAATGACCGCTG\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_008902\u003c/p\u003e\n \u003cp\u003eOriGene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eENDOU Rv CCTGTAGATGGTCTCGGAGATG\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_008902\u003c/p\u003e\n \u003cp\u003eOriGene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSoftware\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGraphPad Prism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGraphPad Software, San Diego, CA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eVersion 9\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFusion-Capt software\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eVilber\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ehttps://www.vilber.com/fusion-fx/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIncucyte program\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSartorius\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ehttps://www.sartorius.com/en/products/live-cell-imaging-analysis/live-cell-analysis-software\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eOther\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIncucyteS3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSartorius\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ehttps://www.sartorius.com/en/products/live-cell-imaging-analysis/live-cell-analysis-software\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eLaser scanning confocal focus microscope\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eZeiss\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ehttps://www.zeiss.co.il/corporate/home.html\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003ch2 id=\"_Toc172379966\"\u003e\u003cstrong\u003eMedium and cell line growing conditions\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eAll cell lines were maintained in high glucose DMEM w/o L-Glutamine, w/o Sodium Pyruvate (Biological Industries, Kibbutz Beit Haemek, Israel REF: 01-052-1A) supplemented with 10% fetalbovine serum (REF: 12657-029), 1% Sodium Bicarbonate Solution (REF: 03-040-1B), 1% L-Glutamine (Cat. 03-020-1B), 1% Sodium Pyruvate Solution (Biological Industries, Kibbutz Beit Haemek, Israel REF: 03-042-1B), and 1% PEN/STREP (REF: 03-031-1B) at 37\u003csup\u003e0\u003c/sup\u003eC in a humidified incubator 5% CO2.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eKeratinocytes were carried in DMEM/F12 3:1 (cat. 06-1170-65-1A) supplemented with 10% FBS, 1% pen/strep, 1% L-Glutamine (Cat. 03-020-1B), Additive mix (x100) containing 5mg/ml insulin, 5mg/ml of Transferrin, 10ml of 2X10-8 M of T3 (3,3\u0026rsquo;,5-triiodo-L-Thyronine), 56.3\u0026micro;l Hydrocortisone and 56.3\u0026micro;l cholera toxin.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMouse fibroblasts were purchased from ATCC (L-Cells #CRL-2648) and grown according to manufacturer\u0026apos;s instructions. Mouse keratinocytes were a generous gift from Chen Luxenburg\u0026rsquo;s lab [77].\u0026nbsp;\u003c/p\u003e\n\u003ch2 id=\"_Toc172379967\"\u003e\u003cstrong\u003eWestern\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eblot analysis\u0026nbsp;\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eCells were washed with phosphate-buffered saline (PBS) and harvested in lysis buffer (100mM NaCl, 50mM Tris, pH7.5, 1% Triton X-100, 2mM EDTA) containing protease inhibitor cocktail (Sigma-Aldrich catalog #). Extracts were clarified by centrifugation at 14,000 rpm for 15 min at 4\u0026deg;C and protein concentration was determined by BRADFORD reagent (BioRad) according to the manufacturer\u0026rsquo;s instructions. Following SDS\u0026ndash;polyacrylamide gel electrophoresis (SDS-PAGE) separation, proteins were transferred to nitrocellulose membranes and blocked with 5% non-fat milk. Membranes were incubated with specific primary antibodies, washed with PBS containing 0.001% Tween-20 (PBST) and incubated with the 9 appropriate horseradish peroxidase-conjugated secondary antibody. After washing in PBST, membranes were subjected to enhanced chemiluminescence (ECL) detection analysis.\u0026nbsp;\u003c/p\u003e\n\u003ch2 id=\"_Toc172379968\"\u003e\u003cstrong\u003eMG132 treatment\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eInfected cells were treated with MG132 (50uM) reagent (Calbiochem) in different concentrations for 24h. Ctrl groups were treated with DMSO in the same volume.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCloning of shRNA sequences\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"642\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTRC Clone ID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eValidation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene Symbol\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene ID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRef Seq\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000366141\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eValidated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e268980\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_011500\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000374647\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eValidated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e268980\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_011500\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTRCN0000374579*\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eValidated\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSTRN\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e268980\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNM_011500\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000374580\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e268980\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_011500\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\"\u003e\n \u003cp\u003e*CCGGT\u003cu\u003eACAAGATATGCTTGCTAATTT\u003c/u\u003eCTCGAGAAATTAGCAAGCATATCTTGTTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTRCN0000375117*\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eValidated\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSTRN3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e94186\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNM_052973\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000335452\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eValidated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e94186\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_052973\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000375064\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eValidated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e94186\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_052973\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000335383\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e94186\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_052973\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eRCN0000363788\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eValidated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e94186\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_052973\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e*CCGG\u003cu\u003eAGCAAGGCAGACAGCTATTAA\u003c/u\u003eCTCGAGTTAATAGCTGTCTGCCTTGCTTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000075628\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e97387\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_133789\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTRCN0000327468*\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSTRN4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e97387\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNM_133789\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000327469\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e97387\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_133789\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000327470\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e97387\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_133789\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTRCN0000327392\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSTRN4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e97387\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNM_133789\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e*CCGG\u003cu\u003eCCACGTTATCACTGTGTGATA\u003c/u\u003eCTCGAGTATCACACAGTGATAACGTGGTTTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eCommercial shRNA sequences (purchases from Sigma for each of the Striatin transcripts) were ligated into pLKO.1 TRC vector (Addgene plasmid #10878) using EcorI (NEB #R3101S) and AgeI (NEB #R3552S) restriction enzyme digestion according to the recommended protocol. Digested sequences were loaded to 1% agarose gel for verification, purified using GeneJET Gel Extraction Kit (Thermo Fischer #K0691), and ligated using Quick ligation kit (NEB #M2200S) according to the suggested protocol.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBold and asterisks denote the sequences chosen for further experiments based on western blot results. The underlined nucleotides are the specific shRNAs for each STN family member.\u003c/p\u003e\n\u003ch2 id=\"_Toc172379973\"\u003e\u003cstrong\u003eLentivirus preparation\u003c/strong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eVesicular stomatitis virus G glycoprotein pseudotyped lentivirus was produced by transfection of 293FT cells. A week before transfection, 293-FT cells were grown in D10 medium with 0.5mgr/mL Geneticin sulfate (Millipore cat#345810). Cells were transfected on poly-l-lysine hydrobromide 0.02mgr/mL (cat. P2636-25mg, Sigma) coated plates using jetPEI (Polyplus Transfection, Illkirch, France). The medium was switched the following morning to D10 medium. 24hrs later the medium was collected, centrifuged at 500xg/10min/25\u0026deg;C and filtered using a 0.45 PES filter. The viral supernatant was homogenized, divided into aliquots and frozen at -80\u0026deg;C.\u003c/p\u003e\n\u003ch2 id=\"_Toc172379974\"\u003e\u003cstrong\u003eLentivirus infection\u003c/strong\u003e \u003cstrong\u003eand selection \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eTarget cells were counted and seeded the day before infection in 6 well plates. Infection mix was prepared using 1.8ml media, 180ul FBS, and 20ul polybrene (10mg\\ml stock) and distributed to each well. \u0026nbsp; Then 200ul of each lentivirus was added and the plates were incubated for 30 min at 37\u003csup\u003e0\u003c/sup\u003eC followed by 30min spinaculation at 1100xG. Target cells were selected using Puromycin.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003eScratch assay\u0026nbsp;\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eCells were plated on 96 well plate 24h prior to the assay. Scratch wound was created using Incucyte\u0026reg; WoundMaker followed by PBSX1 wash and media change. \u0026nbsp;Images were taken every 2h for 24h using IncuCyteS3 and analyzed using Incucyte program (Sartorius).\u003c/p\u003e\n\u003ch2 id=\"_Toc172379977\"\u003e\u003cstrong\u003eRNA extraction\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eTotal RNA was isolated from the cultured cells according to the protocol supplied with TRI Reagent (Sigma-Aldrich). The concentration and purity of the RNA samples were determined, and total RNA was reverse transcribed (RT) with the iScript cDNA Synthesis Kit (BioRad) according to the manufacturer\u0026rsquo;s instructions\u003c/p\u003e\n\u003ch2 id=\"_Toc172379978\"\u003e\u003cstrong\u003eRNA-seq\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;analysis\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eLibraries were prepared using the NEBNext Ultra II RNA Library Prep kit with the NEBNext Poly(A) mRNA Magnetic Isolation Module, starting with ~1000 ng of total RNA\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDuring library amplification, 10 PCR cycles were performed. Each experiment was conducted in triplicates.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLibraries were sequenced on a NextSeq 500 instrument using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kit. The count matrix was analyzed using R language for differentially expressed (DE) genes using DESeq2. The RNA-seq data was analyzed as follows: Twenty-four FastQ files were uploaded to Partek Flow (Build version 10.0.21.1116; https://www.partek.com) for processing. Poly-A/T stretches, and Illumina adapters were trimmed from the reads. Aligned reads (over 96%) were filtered for low-quality mapping Phred\u0026lt;20. Reads were mapped to the mouse GRCm39 reference genome using STAR 2.7.8a with default parameters to reveal ~ 20 million reads per sample. The annotation model was quantified using the Partek Expectation/Maximization (E/M) algorithm. Differentially expressed genes with cutoff p-value\u0026lt;0.05 were further analyzed. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003ch2 id=\"_Toc172379979\"\u003e\u003cstrong\u003eMass-Spectrometry\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;analysis\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003e\u0026nbsp;Samples were digested by trypsin and analyzed by LC-MS/MS on Exploris 480 (Thermo). Data analysis includes Maxquant 2.4 analysis and identification with the Andromeda search algorithms against the mouse proteome from the Uniprot database and a decoy database (to determine the false discovery rate).\u003c/p\u003e\n\u003cp\u003eAll the identified peptides were filtered with high confidence -1% FDR threshold. (*FDR =false discovery rate, is the estimated fraction of false positives in a list of peptides)\u003c/p\u003e\n\u003ch2 id=\"_Toc172379980\"\u003e\u003cstrong\u003eReal-Time PCR\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eRNA extraction (using Direct-zol RNA MiniPrep kit) and cDNA synthesis (iScript cDNA Synthesis Kit) were done according to the manufacturer\u0026apos;s protocol. Data were acquired using the CFX Connect Real-Time PCR Detection System using iTaq Universal SYBR Green Supermix. The thermal cycling conditions were composed of an initial denaturation step at 95\u0026deg;C for 10 minutes, followed by 40 cycles of 95\u0026deg;C for 15 seconds, 60\u0026deg;C for 60 seconds, and plate read. Finally, a melt curve step was performed at temperatures ranging from 65-95\u0026deg;C with plate read at every 0.5\u0026deg;C increments. A No Template Control (NTC) was added for each primer in all the experiments. Cq was set by the CFX Maestro program (Bio-Rad Laboratories). The \u0026Delta;\u0026Delta;Cq technique was used to calculate gene expression. Analysis of the data was done using both CFX Maestro and Microsoft Excel.\u003c/p\u003e\n\u003cp\u003ePrimers were based on previous publications or designed based on the UCSC genome browser sequence using the ApE program and verified using the USCS In-Silico PCR Tool.\u0026nbsp;\u003c/p\u003e\n\u003ch2 id=\"_Toc172379981\"\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eData were analyzed using GraphPad Prism software (version 8.0, GraphPad, La Jolla, CA) and are presented as the mean with standard deviation. For relevant datasets, normality was validated using the Shapiro-Wilk test, followed by ANOVA tests to assess the significance of variations, using the appropriate post-hoc multiple comparisons noted in each legend. P values are as indicated.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBenoist M, Gaillard S, Castets F. The striatin family: a new signaling platform in dendritic spines. J Physiol Paris. 2006;99:146\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanti GK, Pandey P, Shreya S, Jain BP. Striatin family proteins: The neglected scaffolds. Biochim Biophys Acta Mol Cell Res. 2023;1870:119430.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCastets F, Rakitina T, Gaillard S, Moqrich A, Mattei MG, Monneron A, Zinedin. SG2NA, and striatin are calmodulin-binding, WD repeat proteins principally expressed in the brain. J Biol Chem. 2000;275:19970\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi AX, Martin TA, Lane J, Jiang WG. Cellular Impacts of Striatins and the STRIPAK Complex and Their Roles in the Development and Metastasis in Clinical Cancers (Review), Cancers (Basel), 16 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLahav-Ariel L, Caspi M, Nadar-Ponniah PT, Zelikson N, Hofmann I, Hanson KK, Franke WW, Sklan EH, Avraham KB. Rosin-Arbesfeld, Striatin is a novel modulator of cell adhesion. FASEB J. 2019;33:4729\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBazzi H, Soroka E, Alcorn HL, Anderson KV. STRIP1, a core component of STRIPAK complexes, is essential for normal mesoderm migration in the mouse embryo. Proc Natl Acad Sci U S A. 2017;114:E10928\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHwang J, Pallas DC. STRIPAK complexes: Structure, biological function, and involvement in human diseases. Int J Biochem Cell Biol. 2014;47:118\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuck U, Radchenko D, Teichert I. STRIPAK, a highly conserved signaling complex, controls multiple eukaryotic cellular and developmental processes and is linked with human diseases. Biol Chem. 2019;400:1005\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadsen CD, Hooper S, Tozluoglu M, Bruckbauer A, Fletcher G, Erler JT, Bates PA, Thompson B, Sahai E. STRIPAK Compon determine mode cancer cell migration metastasis Nat Cell Biol. 2015;17:68\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakuma C, Kawauchi T, Haraguchi S, Shikanai M, Yamaguchi Y, Gelfand VI, Luo L, Miura M, Chihara T. Drosophila Strip serves as a platform for early endosome organization during axon elongation. Nat Commun. 2014;5:5180.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBreitman M, Zilberberg A, Caspi M, Rosin-Arbesfeld R. The armadillo repeat domain of the APC tumor suppressor protein interacts with Striatin family members, Biochimica et biophysica acta, 1783 (2008) 1792\u0026ndash;802.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakuma C, Saito Y, Umehara T, Kamimura K, Maeda N, Mosca TJ, Miura M, Chihara T. The Strip-Hippo Pathway Regulates Synaptic Terminal Formation by Modulating Actin Organization at the Drosophila Neuromuscular Synapses. Cell Rep. 2016;16:2289\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R, Xie R, Meng Z, Ma S, Guan KL. STRIPAK integrates upstream signals to initiate the Hippo kinase cascade. Nat Cell Biol. 2019;21:1565\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoya IM, Halder G. Hippo-YAP/TAZ signalling in organ regeneration and regenerative medicine, Nature reviews. Mol cell biology. 2019;20:211\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang T, Zhou Z, Luo E, Zhong J, Zhao D, Dong H, Yao B. Comprehensive RNA sequencing in primary murine keratinocytes and fibroblasts identifies novel biomarkers and provides potential therapeutic targets for skin-related diseases. Cell Mol Biol Lett. 2021;26:42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGioia U, Laneve P, Dlakic M, Arceci M, Bozzoni I, Caffarelli E. Functional characterization of XendoU, the endoribonuclease involved in small nucleolar RNA biosynthesis. J Biol Chem. 2005;280:18996\u0026ndash;9002.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaneve P, Altieri F, Fiori ME, Scaloni A, Bozzoni I, Caffarelli E. Purification, cloning, and characterization of XendoU, a novel endoribonuclease involved in processing of intron-encoded small nucleolar RNAs in Xenopus laevis. J Biol Chem. 2003;278:13026\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLessard JC, Pina-Paz S, Rotty JD, Hickerson RP, Kaspar RL, Balmain A, Coulombe PA. Keratin 16 regulates innate immunity in response to epidermal barrier breach. Proc Natl Acad Sci U S A. 2013;110:19537\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanghamitra M, Talukder I, Singarapu N, Sindhu KV, Kateriya S, Goswami SK. WD-40 repeat protein SG2NA has multiple splice variants with tissue restricted and growth responsive properties. Gene. 2008;420:48\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNorton P, Barschke P, Scharff C, Mendoza E. Differential Song Deficits after Lentivirus-Mediated Knockdown of FoxP1, FoxP2, or FoxP4 in Area X of Juvenile Zebra Finches. J Neurosci. 2019;39:9782\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUsui ML, Mansbridge JN, Carter WG, Fujita M, Olerud JE. Keratinocyte migration, proliferation, and differentiation in chronic ulcers from patients with diabetes and normal wounds. J Histochem cytochemistry: official J Histochem Soc. 2008;56:687\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDomke LM, Rickelt S, Dorflinger Y, Kuhn C, Winter-Simanowski S, Zimbelmann R, Rosin-Arbesfeld R, Heid H, Franke WW. The cell-cell junctions of mammalian testes: I. The adhering junctions of the seminiferous epithelium represent special differentiation structures. Cell Tissue Res. 2014;357:645\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranke WW, Rickelt S, Zimbelmann R, Dorflinger Y, Kuhn C, Frey N, Heid H, Rosin-Arbesfeld R. Striatins as plaque molecules of zonulae adhaerentes in simple epithelia, of tessellate junctions in stratified epithelia, of cardiac composite junctions and of various size classes of lateral adherens junctions in cultures of epithelia- and carcinoma-derived cells. Cell Tissue Res. 2015;359:779\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNadar-Ponniah PT, Taiber S, Caspi M, Koffler-Brill T, Dror AA, Siman-Tov R, Rubinstein M, Padmanabhan K, Luxenburg C, Lang RA, Avraham KB. Rosin-Arbesfeld, Striatin Is Required for Hearing and Affects Inner Hair Cells and Ribbon Synapses. Front Cell Dev Biol. 2020;8:615.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBazzoni G, Dejana E. Keratinocyte junctions and the epidermal barrier: how to make a skin-tight dress. J Cell Biol. 2002;156:947\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTran H, Hamada F, Schwarz-Romond T, Bienz M. Trabid, a new positive regulator of Wnt-induced transcription with preference for binding and cleaving K63-linked ubiquitin chains. Genes Dev. 2008;22:528\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Kinzler KW, Vogelstein B, Clevers H. Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science. 1997;275:1784\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShimomura Y, Agalliu D, Vonica A, Luria V, Wajid M, Baumer A, Belli S, Petukhova L, Schinzel A, Brivanlou AH, Barres BA, Christiano AM. APCDD1 is a novel Wnt inhibitor mutated in hereditary hypotrichosis simplex. Nature. 2010;464:1043\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeong BC, Bae SJ, Ni L, Zhang X, Bai XC, Luo X. Cryo-EM structure of the Hippo signaling integrator human STRIPAK. Nat Struct Mol Biol. 2021;28:290\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo G, Han H, Vargas RE, Yang B, Li X, Wang W. MAP4K Interactome Reveals STRN4 as a Key STRIPAK Complex Component in Hippo Pathway Regulation. Cell Rep. 2020;32:107860.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Y, Chen M, Zhou L, Ma J, Li Y, Zhang H, Shi Z, Xu Q, Zhang X, Gao Z, Zhao Y, Cheng Y, Jiao S, Zhou Z. Architecture, substructures, and dynamic assembly of STRIPAK complexes in Hippo signaling. Cell Discov. 2019;5:3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDupont S, Morsut L, Aragona M, Enzo E, Giulitti S, Cordenonsi M, Zanconato F, Le Digabel J, Forcato M, Bicciato S, Elvassore N, Piccolo S. Role of YAP/TAZ in mechanotransduction. Nature. 2011;474:179\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai H, Xu Y. The role of LPA and YAP signaling in long-term migration of human ovarian cancer cells. Cell Commun Signal. 2013;11:31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu FX, Zhao B, Panupinthu N, Jewell JL, Lian I, Wang LH, Zhao J, Yuan H, Tumaneng K, Li H, Fu XD, Mills GB, Guan KL. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell. 2012;150:780\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia G Jr., Wang Y, Ignatius Irudayam J, Jeyachandran AV, Cario SC, Sen C, Li S, Li Y, Kumar A, Nielsen-Saines K, French SW, Shah PS, Morizono K, Gomperts B, Deb A, Ramaiah A. V. Arumugaswami, Hippo Signaling Pathway Activation during SARS-CoV-2 Infection Contributes to Host Antiviral Response, bioRxiv, (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng D, Jin L, Chen Y, Xi X, Guo Y. YAP promotes epithelial mesenchymal transition by upregulating Slug expression in human colorectal cancer cells. Int J Clin Exp Pathol. 2020;13:701\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao B, Li L, Tumaneng K, Wang CY, Guan KL. A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(beta-TRCP). Genes Dev. 2010;24:72\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc. 2007;2:329\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChandler HL, Colitz CM, Lu P, Saville WJ, Kusewitt DF. The role of the slug transcription factor in cell migration during corneal re-epithelialization in the dog. Exp Eye Res. 2007;84:400\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelly LM, Barila G, Liu P, Evdokimova VN, Trivedi S, Panebianco F, Gandhi M, Carty SE, Hodak SP, Luo J, Dacic S, Yu YP, Nikiforova MN, Ferris RL, Altschuler DL, Nikiforov YE. Identification of the transforming STRN-ALK fusion as a potential therapeutic target in the aggressive forms of thyroid cancer. Proc Natl Acad Sci U S A. 2014;111:4233\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWojtowicz AM, Oliveira S, Carlson MW, Zawadzka A, Rousseau CF, Baksh D. The importance of both fibroblasts and keratinocytes in a bilayered living cellular construct used in wound healing. Wound Repair Regen. 2014;22:246\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRotty JD, Coulombe PA. A wound-induced keratin inhibits Src activity during keratinocyte migration and tissue repair. J Cell Biol. 2012;197:381\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang F, Chen S, Liu HB, Parent CA, Coulombe PA. Keratin 6 regulates collective keratinocyte migration by altering cell-cell and cell-matrix adhesion. J Cell Biol. 2018;217:4314\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrost A, Desch P, Wally V, Haim M, Maier RH, Reitsamer HA, Hintner H, Bauer JW, Onder K. Aberrant heterodimerization of keratin 16 with keratin 6A in HaCaT keratinocytes results in diminished cellular migration. Mech Ageing Dev. 2010;131:346\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMigliavacca J, Zullig B, Capdeville C, Grotzer MA, Baumgartner M. Cooperation of Striatin 3 and MAP4K4 promotes growth and tissue invasion. Commun Biol. 2022;5:795.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiu LM, Sun YH, Chen TT, Chen JJ, Ma HT. STRIP2, a member of the striatin-interacting phosphatase and kinase complex, is implicated in lung adenocarcinoma cell growth and migration. FEBS Open Bio. 2020;10:351\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng S, Chen X, Hong S, Long L, Xu Y, Simoncini T, Fu X. 17beta-Estradiol inhibits vascular smooth muscle cell migration via up-regulation of striatin protein. Gynecol Endocrinol. 2015;31:618\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Y, Redmond CJ, Leacock KA, Brovkina MV, Ji S, Jaskula-Ranga V, Coulombe PA. Keratin 14-dependent disulfides regulate epidermal homeostasis and barrier function via 14-3-3sigma and YAP1. Elife; 2020. p. 9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho SG. APC downregulated 1 inhibits breast cancer cell invasion by inhibiting the canonical WNT signaling pathway. Oncol Lett. 2017;14:4845\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYiew NKH, Chatterjee TK, Tang YL, Pellenberg R, Stansfield BK, Bagi Z, Fulton DJ, Stepp DW, Chen W, Patel V, Kamath VM, Litwin SE, Hui DY, Rudich SM, Kim HW, Weintraub NL. A novel role for the Wnt inhibitor APCDD1 in adipocyte differentiation: Implications for diet-induced obesity. J Biol Chem. 2017;292:6312\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchad EG, Petersen CP. STRIPAK Limits Stem Cell Differentiation of a WNT Signaling Center to Control Planarian Axis Scaling. Curr Biol. 2020;30:254\u0026ndash;e263252.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOxford EM, Danko CG, Fox PR, Kornreich BG, Moise NS. Change in beta-catenin localization suggests involvement of the canonical Wnt pathway in Boxer dogs with arrhythmogenic right ventricular cardiomyopathy. J Vet Intern Med. 2014;28:92\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalli C, Piemontese M, Lumetti S, Ravanetti F, Macaluso GM, Passeri G. Actin cytoskeleton controls activation of Wnt/beta-catenin signaling in mesenchymal cells on implant surfaces with different topographies. Acta Biomater. 2012;8:2963\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBae SJ, Ni L, Osinski A, Tomchick DR, Brautigam CA, Luo X. SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK, Elife, 6 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang W, Leonard D, Taylor DJ. Pack a STRIPAK with hubs inside a hub. Nat Struct Mol Biol. 2021;28:232\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim JW, Berrios C, Kim M, Schade AE, Adelmant G, Yeerna H, Damato E, Iniguez AB, Florens L, Washburn MP, Stegmaier K, Gray NS, Tamayo P, Gjoerup O, Marto JA, DeCaprio J, Hahn WC. STRIPAK directs PP2A activity toward MAP4K4 to promote oncogenic transformation of human cells. Elife, 9 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Y, Fang G, Guo F, Zhang H, Chen X, An L, Chen M, Zhou L, Wang W, Ye T, Zhou L, Nie P, Yu H, Lin M, Zhao Y, Lin X, Yuan Z, Jiao S, Zhou Z. Selective Inhibition of STRN3-Containing PP2A Phosphatase Restores Hippo Tumor-Suppressor Activity in Gastric Cancer, Cancer Cell, 38 (2020) 115\u0026ndash;128 e119.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMisra JR, Irvine KD. The Hippo Signaling Network and Its Biological Functions. Annu Rev Genet. 2018;52:65\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArcucci S, Ramos-Delgado F, Cayron C, Therville N, Gratacap MP, Basset C, Thibault B. Guillermet-Guibert, Organismal roles for the PI3Kalpha and beta isoforms: their specificity, redundancy or cooperation is context-dependent. Biochem J. 2021;478:1199\u0026ndash;225.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCosta C, Ebi H, Martini M, Beausoleil SA, Faber AC, Jakubik CT, Huang A, Wang Y, Nishtala M, Hall B, Rikova K, Zhao J, Hirsch E, Benes CH, Engelman JA. Measurement of PIP3 levels reveals an unexpected role for p110beta in early adaptive responses to p110alpha-specific inhibitors in luminal breast cancer. Cancer Cell. 2015;27:97\u0026ndash;108.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFoukas LC, Berenjeno IM, Gray A, Khwaja A, Vanhaesebroeck B. Activity of any class IA PI3K isoform can sustain cell proliferation and survival. Proc Natl Acad Sci U S A. 2010;107:11381\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuillermet-Guibert J, Bjorklof K, Salpekar A, Gonella C, Ramadani F, Bilancio A, Meek S, Smith AJ, Okkenhaug K, Vanhaesebroeck B. The p110beta isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110gamma. Proc Natl Acad Sci U S A. 2008;105:8292\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJuric D, Castel P, Griffith M, Griffith OL, Won HH, Ellis H, Ebbesen SH, Ainscough BJ, Ramu A, Iyer G, Shah RH, Huynh T, Mino-Kenudson M, Sgroi D, Isakoff S, Thabet A, Elamine L, Solit DB, Lowe SW, Quadt C, Peters M, Derti A, Schegel R, Huang A, Mardis ER, Berger MF, Baselga J, Scaltriti M. Convergent loss of PTEN leads to clinical resistance to a PI(3)Kalpha inhibitor. Nature. 2015;518:240\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePons-Tostivint E, Thibault B, Guillermet-Guibert J. Targeting PI3K Signaling in Combination Cancer Therapy. Trends Cancer. 2017;3:454\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchwartz S, Wongvipat J, Trigwell CB, Hancox U, Carver BS, Rodrik-Outmezguine V, Will M, Yellen P, de Stanchina E, Baselga J, Scher HI, Barry ST, Sawyers CL, Chandarlapaty S, Rosen N. Feedback suppression of PI3Kalpha signaling in PTEN-mutated tumors is relieved by selective inhibition of PI3Kbeta. Cancer Cell. 2015;27:109\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThibault B, Ramos-Delgado F, Guillermet-Guibert J. Targeting Class I-II-III PI3Ks in Cancer Therapy: Recent Advances in Tumor Biology and Preclinical Research. Cancers (Basel), 15 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTvrdik P, Capecchi MR. Reversal of Hox1 gene subfunctionalization in the mouse. Dev Cell. 2006;11:239\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonzalez E, McGraw TE. The Akt kinases: isoform specificity in metabolism and cancer. Cell Cycle. 2009;8:2502\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHatakeyama Y, Saito N, Mii Y, Takada R, Shinozuka T, Takemoto T, Naoki H, Takada S. Intercellular exchange of Wnt ligands reduces cell population heterogeneity during embryogenesis, Nat Commun, 14 (2023) 1924.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeshacharyulu P, Pandey P, Datta K, Batra SK. Phosphatase: PP2A structural importance, regulation and its aberrant expression in cancer, Cancer Lett, 335 (2013) 9\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzzolin L, Panciera T, Soligo S, Enzo E, Bicciato S, Dupont S, Bresolin S, Frasson C, Basso G, Guzzardo V, Fassina A, Cordenonsi M, Piccolo S. YAP/TAZ incorporation in the beta-catenin destruction complex orchestrates the Wnt response, Cell, 158 (2014) 157\u0026ndash;170.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan D. The hippo signaling pathway in development and cancer. Dev Cell. 2010;19:491\u0026ndash;505.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Y, Wu Z, Yan W, Shao F, Ke B, Jiang X, Gao J, Guo W, Lai Y, Ma H, Chen D, Xu Q, Sun Y. Allosteric inhibition of SHP2 uncovers aberrant TLR7 trafficking in aggravating psoriasis. EMBO Mol Med. 2022;14:e14455.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing Y, Ouyang Z, Zhang C, Zhu Y, Xu Q, Sun H, Qu J, Sun Y. Tyrosine phosphatase SHP2 exacerbates psoriasis-like skin inflammation in mice via ERK5-dependent NETosis, MedComm (2020), 3 (2022) e120.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo D, Li X, Wang J, Liu X, Wang Y, Huang S, Dang N. Single-cell RNA-seq reveals keratinocyte and fibroblast heterogeneity and their crosstalk via epithelial-mesenchymal transition in psoriasis. Cell Death Dis. 2024;15:207.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoffer A, Mahly A, Padmanabhan K, Cohen J, Adir O, Loushi E, Fuchs Y, Williams SE, Luxenburg C. Apoptosis and tissue thinning contribute to symmetric cell division in the developing mouse epidermis in a nonautonomous way. PLoS Biol. 2022;20:e3001756.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-and-bioscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cbio","sideBox":"Learn more about [Cell \u0026 Bioscience](http://cellandbioscience.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cbio/default.aspx","title":"Cell \u0026 Bioscience","twitterHandle":"@OACellBiology","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6093370/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6093370/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe Striatin family proteins, including Striatin, SG2NA, and Zinedin, belong to the calmodulin-binding WD-40 repeat protein group and are components of the Striatin Interacting Phosphatase and Kinase (STRIPAK) complex. These proteins are known for their roles as scaffold proteins, facilitating various cellular pathways and regulating cell-cell interactions and signaling mechanisms. It has also been shown that Striatin is expressed in cell junctions, highlighting its potential role in maintaining cell integrity and communication.\u003c/p\u003e \u003cp\u003eThe current study aimed to elucidate the biological significance of the Striatin proteins by employing shRNA technology. This approach allowed us to modulate their expression levels and observe the resulting effects on cellular processes. Our data show that the Striatin family members significantly influence the Hippo signaling pathway by protecting phosphorylated YAP (pYAP) from proteasomal degradation, thus regulating the expression of Hippo target genes. This regulation impacts key cellular processes such as cell migration. RNA sequencing analyses of keratinocytes and fibroblasts depleted of Striatin proteins facilitated the identification of novel gene sets affected by the modulation of Striatin expression and provided insights into the broader impact of Striatin proteins and their roles in various cellular pathways.\u003c/p\u003e","manuscriptTitle":"The Role of the Striatin Family Proteins in Hippo Signaling and Cellular Regulation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-17 10:26:05","doi":"10.21203/rs.3.rs-6093370/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2025-04-17T01:52:49+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-04-14T13:17:11+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-13T02:40:31+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-02-24T09:54:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell \u0026 Bioscience","date":"2025-02-24T00:18:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-and-bioscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cbio","sideBox":"Learn more about [Cell \u0026 Bioscience](http://cellandbioscience.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cbio/default.aspx","title":"Cell \u0026 Bioscience","twitterHandle":"@OACellBiology","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1640c24c-3c09-4226-97fb-5a7a5cb07826","owner":[],"postedDate":"March 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-25T16:33:56+00:00","versionOfRecord":{"articleIdentity":"rs-6093370","link":"https://doi.org/10.1186/s13578-025-01461-3","journal":{"identity":"cell-and-bioscience","isVorOnly":false,"title":"Cell \u0026 Bioscience"},"publishedOn":"2025-08-19 16:29:17","publishedOnDateReadable":"August 19th, 2025"},"versionCreatedAt":"2025-03-17 10:26:05","video":"","vorDoi":"10.1186/s13578-025-01461-3","vorDoiUrl":"https://doi.org/10.1186/s13578-025-01461-3","workflowStages":[]},"version":"v1","identity":"rs-6093370","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6093370","identity":"rs-6093370","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00