Molecular Detection of Diarrheagenic Escherichia Coli Pathotypes Isolated From Children With Diarrhea in Mbarara City, South Western Uganda | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular Detection of Diarrheagenic Escherichia Coli Pathotypes Isolated From Children With Diarrhea in Mbarara City, South Western Uganda Phionah K. Akankunda, Jemimah Natuhwera, Halidi Kirunda, Charles Nkubi Bagenda, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7842018/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 13 You are reading this latest preprint version Abstract Background: Diarrheal diseases remain a global public health concern affecting children, with a high prevalence in resource-limited settings. In many poor nations, diarrheal diseases have been listed as 1 of the top 10 causes of mortality. Objective: This study aimed to determine the prevalence and antibiotic susceptibility profiles of diarrheagenic Escherichia coli ( E. coli ) pathotypes with diarrhea using Polymerase Chain Reaction in Mbarara City. Methodology: It was a cross section hospital-based study where 391 stool samples were collected from children aged six months and 12 years presenting with diarrhea and not taking any antibiotic treatment for diarrhea at the time of the investigation. Results: Out of 391 stool samples collected, 78 were positive for E. coli giving an overall prevalence of 19.95 %. Of the 78 (19.95 %) positive samples, males were 18 (54.55%) and females were 25 (55.56%). Among the 78 E. coli isolates still, 43 (55.13 %) were pathogenic and belonged to the three common pathotypes including Enteropathogenic E. coli (EPEC), which was the most prevalent pathotype ( 86.05 %), followed by Enterohaemorrhagic E . coli (EHEP) (9.30 %), while enter-invasive was the least (4.65 %). The E. coli isolates were most sensitive to chloramphenicol, followed by imipenem (70%), tetracycline (30%), ceftriaxone (28%) and amoxicillin (26%) was the most resistant Conclusion : Diarrheagenic E. coli (DEC) is prevalent in Mbarara City and is an important agent that should be considered in routine studies and surveillance for childhood acute diarrheal disease. Escherichia coli diarrheagenic pathotype Figures Figure 1 Figure 2 Figure 3 Introduction Diarrheal diseases remain a global public health concern affecting children, with a high prevalence in resource-limited settings (Omona et al., 2020 ). Diarrhea is characterized by stools of decreased consistency and increased volume due to imbalance of secretion and absorption of water and salts in the intestine (Saka et al., 2019 ). It is a major source of malnutrition in Low-Middle Income Countries (LMICs) (Saka et al., 2019 ). Diarrhea have been listed as 1 of the top 10 causes of mortality and disability-adjusted life-years for persons in all age groups, and 1 of the 5 leading causes of mortality and disability-adjusted life-years among children aged < 5 years (Troeger et al., 2018 ; Fenta, Alemu and Angaw, 2020 ). Globally, an estimated 1.6 million child mortality is recorded yearly due to chronic diarrhea, accounting for 1:5 child deaths (Manetu et al., 2021 ). Although global diarrhea mortality has decreased significantly over the last 25 years, diarrhea morbidity has not because of risk factors, including poor water supply, sanitation, and hygiene (WASH) in Sub-Saharan Africa (Thiam et al., 2017 ). Diarrhea represents a major cause of childhood mortality across Africa, With Substantial geographic variation and particularly high burden in East and Uganda. Geographic analysis reveals Eastern Africa has the highest disease incidence (114,389 cases per 100,000 children < 5), while Western Africa shows highest mortality rates (Thystrup et al., 2024 ). In Uganda specifically, diarrhea accounts for 22% of deaths in children under 5 (Omona et al. , 2019) with overall child mortality reaching 2 in 10 children (Tumusiime et al., 2024 ). Rotavirus , Cryptosporidium , Escherichia coli (E. coli) , enterotoxigenic E. coli ( ETEC ), and Shigella are utmost the main etiological agents of diarrhea (Mokomane et al., 2018 ). Other causes include various genera of bacterial pathogens such as Salmonella , Shigella , Yersinia , Vibrio , Bacillus , Enterobacter , Plesiomonas , Klebsiella , Proteus , Serratia , Aeromonas (Onohuean and Igere, 2022 ). Diarrheagenic E. coli is classified into six major pathotypes (pathogenic variants), including enteroaggregative E. coli (EAEC), enteropathogenic Escherichia coli (EPEC), enterotoxigenic E. coli (ETEC), enter-invasive Escherichia coli (EIEC), enterohaemorrhagic E. coli (EHEC also known as Shiga-toxin producing E. coli ), and diffusely adherent Escherichia coli (DAEC) (Peirano et al., 2018 ). EAEC and EPEC are the foremost causes of acute diarrhea outbreaks or leading potentially fatal infant and children in underdeveloped nations, while ETEC is the prominent cause of travelers’ diarrhea. A large number of verotoxigenic E. coli serotypes are associated with human intestinal infections, and some of these serotypes are recognized as important foodborne pathogens that may cause mild to severe bloody diarrhea and hemolytic uremic syndrome (citation). Cattle and their environment are among the most important sources of pathogenic E. coli , and they may be the origin of contamination of meat and meat products (Elder et al., 2000 ; Midgley and Desmarchelier, 2001 ). In Uganda, E. coli is frequently linked to acute infantile diarrhea. In western Uganda, E. coli is commonly isolated from children who have diarrhea; however, the genetic background is not regularly assessed, thus it is unclear what percentage of diarrhea is caused by DEC. As a result, there is a dearth of research on the significance of DEC and particular DEC pathotypes as diarrheal disease causes in Mbarara Municipality and southwest Uganda. In order to provide baseline information on the circulating DEC pathotypes in the study locality and their clinical significance, this study examined the incidence and frequency of DEC as a cause of infectious diarrhea in children under the age of 12 in Mbarara City, as well as their pattern of antibiotic susceptibility. Methodology Study Design This study was a cross-sectional hospital-based study. Sample collection was carried out at health centers of Mbarara City including Mbarara Municipal Council Health Centre IV and Holy Innocents Children’s hospital. The study involved children of 6 months to 12 years old with diarrhea during the study time. Sample Collection Out of the 391 children aged 6 months to 12 years old with diarrhea at the study centers. Diarrhea was well-defined, according to World Health Organization guidelines as the occurrence of 3 or more, loose, liquid or watery stools within 24 hours, as this was done on triage of the children at different Health Centre’s. (Citation). The study included only those children who had no antibiotics exposure for the last two weeks. There is variability in the validity of antibiotics to remain in the body, some antibiotic’s have shorter half-life when compared to others (Kong et al. ,2019). The study excluded those who never had diarrhea but visited the health units at the time of the study was done by (Zelelie et al., 2023 ). Sample handling and transportation. Sterile stool sample containers were given to Children’s parents / guardians and were instructed on stool sample collection into a dry, clean stool container and for children below 3 years a sterile rectal swab was used to collect the specimen to avoid contamination of the sample with urine. To ensure optimum recovery of E. coli all specimens obtained were transported immediately to the Mbarara University Microbiology Laboratory. The samples were handled by the researcher and a research assistant following standard Operating Procedures on sample handling. The bacterial isolation and identification, DNA extraction and antimicrobial susceptibility test was carried out. Bacterial Isolation and Identification stool samples The stool samples collected were inoculated on MacConkey medium and Levin eosin methylene blue media. All stool samples were processed in less than 6 hours from the time of specimen collection. The Plates were incubated for 18–24 hours at 37 o C in an aerobic environment. The isolates of E. coli were identified by Gram-stain for morphology; the biochemical tests (indole, Simmons citrate, urea, triple sugar iron agar) was carried out to identify E. coli . DNA extraction and pathotype identification. DNA was extracted at DC Molecular Laboratories in Mbarara city from the isolates using the boiling method by boiling at 100°C for 10 minutes in a preheated heating block as described by (Onohuean and Igere, 2022 ); and following the established standard operating procedure for DNA extraction. The different DEC pathotypes were speciated by Polymerase Chain reaction (PCR) techniques using the primers as shown in Table 1 . The Fresh overnight cultures were placed in a sterile 1.5 ml Eppendorf tube and centrifuged for 10 minutes at 13,000 rpm. The cell pellets were then rinsed twice with phosphate-buffered saline pH 7.4 and suspended in 500 ml sterile and distilled water before lysed for DNA release. After centrifuging the suspension for 5 minutes at 15,000 rpm, the supernatant was cautiously pipetted into sterile cryogenic tubes and kept at 20°C for use as probable genomic DNA E. coli spp . for PCR tests. Antimicrobial Susceptibility test For all DEC pathotypes were assessed using the disc diffusion method (kirby-bauer method) according to clinical and laboratory standard institute guidelines (CLSI). Antibiotics for the study were selected based CLSI guidelines for enterobacterales. The bacterias tested were chloramphenicol (30NgC30), Ceftriaxone(30NgCR30), Tetracycline (30NgTE30), Imipenum (10mcgIPM10), Ciprofloxacin (30NgCIP30), Amoxicillin (20NgAMC30). The results were interpreted using CLSI guidelines. E. coli ATCC (American type culture collection) 25922 was used as quality control strained for Antimicrobial Susceptibility strain testing. Pathotype identification. About 2.5 ml of crude template DNA in a 25-L reaction volume, 10 mM Tris-HCl, 2 mM MgCl2, 1.5 U Taq polymerase (HybriPol Bioline, UK), 0.2 mM dNTPs, 0.2 mM primers (SBS Genetech Co, Ltd), and a Gene Amp 2700 thermocycler were used for the amplifications (Periano et al 2018). 30 cycles of 1 minute at 94°C, 1 minute at different annealing temperatures, and 1 minute at 72°C were conducted under similar conditions for all reactions, which included a 5-minute denaturation at 94°C. A 10 minutes at 72°C was the final extension period. To see the PCR bands, the resulting PCR products were subsequently electrophoresed with 0.5X T ethidium bromide stain on 2 percent agarose gels (Periano et al., 2018). The first PCR screens employed stx1/stx2 and eae primers to see if STEC or EPEC DEC were present. To distinguish between tEPEC and aEPEC, DNA with positive eae and negative stx1/stx2 PCR was examined using bfp primers. Negative eae and stx1/stx2 extracts were tested using pCVD432 primers for plasmidic EAEC sequences, ipaH primers for detecting genes coding the invasion plasmid antigen of EIEC (and Shigella), and PCR assays for ETEC labile and stable enterotoxins (Periano et al 2018). Table 1 shows the summary of the primers and the Sequence employed. Table 1 Genes for PCR amplification, Primers and Their characteristics. GENE PRIMER Sequence 5 1 -3 1 Amplicon size (bp). Annealing temp (°C). eae EAE 1 EAE 2 GAGAATGAAATAGAAGTCGT GCGGTATCTTTCGCGTAATCGCC 775 55 bfp EP1 EP2 AATGGTGCTTGCGCTTGCTGC GCCGCTTTATCCAACCTGGTA 324 55 Stx1 VT1-A VT2-B GAAGAGTCCGTGGATTACG AGCGATGCAGCTATTAATAA 131 55 Stx2 VT2-a VT2-b TTAACCACACCCCACCGGGCAGT GCTCTGGATGCATCTCTGGT 348 55 pCDV EAEC1 EAEC2 CTGGCGAAAGACTGTATCAT CAATGTATAGAAATCCGCTGTT 630 60 ipaH EI1 EI2 GTTCCTTGACCGCCTTTCCGATACCGTC GCCGGTCAGCCCTCTGAGAGTAC 620 55 eltA LT-A-1 LT-A-2 GGCGACAGATTATACCGTGC CCGAATTCTGTTATATATGTC 332 55 estA STA-1 STA-2 ATTTTTATTTCTGTATTGTCTTT GGATTACAACACAGTTCACAGCAG 147 55 Data Analysis The complete data was then verified for completeness, uniformity and accuracy to remove outliers. The data was coded and exported to MS Excel spreadsheets and STATA version 2.0). The analysis was done based on the study objectives and results were presented in tables and charts using frequency, proportion, percentages and bar charts. CLSI guidelines was used to classify the isolates based on the susceptible patterns (S, I, R) to determine variations in susceptibility of the isolates of E.coli from different patients. RESULTS A total of 391 stool samples were collected from children aged 6 months to 12 years of presenting with diarrhea. About 78 tested positive for E . coli with an overall prevalence of 19.95% (CI = 95%, 16.27–24.22). Of the 78 (19.95%) positives, the highest prevalence of E . coli by sex was found in females representing 55.56%. The overall proportion of Pathogenic E. coli isolated based on pathotypes was 55.13% (43.84–65.91, 95% CI) as shown in Table 1 . Table 2 Prevalence of E. coli based on sex and status. E. coli Status Frequency (n) Percentage Negative 313 80.05 (75.78–83.73)* Positive 78 19.95 (16.20 -24.22)* Sex Pathogenic Non-pathogenic Total Male 18 (54.55%) 15 (45.45%) 33 (100%) Female 25 (55.56%) 20 (44.44%) 45 (100%) Total 43 (55.13%) 35 (44.87%) 78 (100%) * (95% Confidence Interval) The Proportion of different pathogenic E. coli Pathotypes was identified. About 43 (55.13%) pathogenic E. coli belonged to the three common pathotypes as shown Table Fig. 2 . The different pathotypes isolated were Enteropathogenic E. coli ( EPEC) as the most prevalent pathotype representing 86.05%, followed by Entero-haemorrhagic E. coli (EHEP) with 9.30%. The Antimicrobial Profile on DEC Pathotypes as shown in Table 3 . Drug susceptibility patterns were done on the pathogenic E. coli using the Kirby-Bauer disc diffusion method as described by the Clinical Laboratory Standards Institute (CLSI, 2022) to determine sensitivity, intermediate and resistance to different drugs that are commonly used to treat E. coli infections. The drug sensitivity indicate that the most sensitive drug was Imipenum with 79% (EPEC; 29/43,), followed by Chloramphenicol representing (EPEC; 27/43) The most resistant drug was amoxicillin with 70% (EPEC;25/43), followed by ciprofloxacin with 60% (EPEC; 25/43) as shown in Table 3 . Table 3 Antimicrobial Profile on DEC Pathotypes. Drug Category Total n = 43 EHEC n = 4 EPEC n = 37 EIEC n = 2 Chlorophenical30NgC-30 Sensitive 33 (72%) 2 (50%) 27 (73%) 2 (100%) Resistant 12 (28%) 2 (50%) 10 (27%) 0 (0%) Ceftriaxone30Ng CR-30 Sensitive 23 (53%) 1 (25%) 19 (51%) 2 (100%) Resistant 2 0 (47%) 2 (50%) 18 (49%) 0 (0%) Tetracycline30Ng TE-30 Sensitive 1 8 (42%) 1(25%) 15 (41%) 2 (100%) Resistant 25 (58%) 3(75%) 22 (59%) 0 (0%) Imepenum10mcg IPM-10 Sensitive 34 (79%) 3 (75%) 29 (78%) 2 (100%) Resistant 9 (21%) 1(25%) 8 (22%) 0 (0%) Ciprofloxacin30Ng CIP-30 Sensitive 17 (40%) 3(75%) 12 (32%) 2 (100%) Resistant 26 (60%) 1(25%) 25 (68%) 0 (0%) Amoxacillin20Ng AMC-30 Sensitive 13 (30%) 1(25%) 12 (32%) 0 (0%) Resistant 30 (70%) 3 (75%) 25 (68%) 2 (100%) Discussion Diarrheagenic E. coli infections are indistinguishable from gastroenteritis due to other bacterial or viral infection, and therefore isolation and identification of the specific DEC associated with a clinical case could allow caregivers to provide appropriate treatment (Saka et al .,2019). This study examined the incidence and frequency of DEC as a cause of infectious diarrhea in children under the age of 12 in Mbarara City, as well as their pattern of antibiotic susceptibility. Of the 391 stool samples collected from children with diarrhea aged 6 months to 12 years at two health facilities in Mbarara, 78 tested positive for E. coli given an overall prevalence of 19.95% with a 95% confidence interval of 16.27% to 24.22%. This is a low prevalence compared to the studies done Central Ethiopia (Zelelie et al .,2023) and Northwest Ethiopia, where 194 samples consisting of 144 stool samples from children and 50 fecal samples from calves were studied, presumptive E. coli isolates were identified from 74 (38.3%) of the samples (Belete, Demlie et al. 2022 ) and in Mozambique (35.7%) by (Manhique-Coutinho, Chiani et al. 2022 ) and in Branzil (Robins-browne et al., 2016 ), The variability in the prevalence could be due to climate variability, study population, water supply that will influence DEC incidence (Zelelie et al., 2023 ). Of the 391 samples, 187 (47.83%) were males and 204 (52.17%) were females. Of the 78 (19.95%) E. coli positives, prevalence of E. coli by gender, males were 18 (54.55%) and females were 25 (55.56%). The P - value for chi - square test was above 0.05 therefore, there was no significant difference in the prevalence of E. coli by gender i.e. the prevalence of E. coli in males did not significantly differ from the prevalence of E. coli in females, this is in line with the study done in North East Ethiopia (Belete, Demlie et al. 2022 ). Though E. coli is a microbe that can be found in both humans, animals and animal gut, normally, it is not harmful. However, some E. coli variants can acquire virulence genes and cause gastroenteritis, which can be deadly if left untreated. These strains are classified as diarrheagenic E. coli (DEC), and of six subtypes (Rodrigues et a l., 2016).In this study, the 78 (19.95%) E. coli positives isolates were subjected to multiplex PCR to identify the DEC. Of the 78 E.coli isolates, 43 were pathogenic giving prevalence percentage of pathogenic E.coli as 55.13% with a 95% CI of 43.84% to 65.91%. This was higher compared to the studies done in Rakai hospital, Southern Uganda ( 38.2%) by (Masiga, Kigozi et al. 2022) higher than that done in informal settlements in Nairobi Kenya where the prevalence was 27%, and in Mozambique (48.6%) by (Manhique-Coutinho, Chiani et al. 2022 ) but lower compared to studies done in Amatole District Municipality of Eastern Cape, South Africa (Omolajaiye, Afolabi et al. 2020), this could be due to distribution of DEC pathotypes which varies geographically due to seasonal variations, animal interactions and poor sanitation and hygiene. The 43 (55.13%) pathogenic E. coli belonged to the three common pathotypes i.e. Enteropathogenic E. coli (EPEC) was the most prevalent pathotype with 86.05%, followed by Enterohaemorrhagic E.coli (EHEP) with 9.30% and enter-invasive E. coli (EIEC) was the least with a prevalence percentage of 4.65%. The other pathotypes like Enterotoxigenic E. coli (ETEC), Enteroaggregative E. coli (EAEC), Adherent-Invasive E. coli (AIEC) and diffusely adhesion E. coli (DAEC) were not found. EPEC being the most prevalent is in agreement with other studies done in developing countries where it’s classified as the leading cause of diarrhea and death in children, particularly in developing nations (Robins-browne et al., 2016 ). Also in agreement with results reported in West Africa where higher recovery rates for EPEC and EHEP have been found significantly associated with childhood diarrhea (Okeke I, et al , 2017). Though majority of the previous studies carried out also implicate enteroaggregative E. coli (EAEC) as the most prevalent like in Nigeria (Saka, Dabo et al. 2019 ), and in Eastern Cape town in South Africa (Omolajaiye, Afolabi et al . 2020). Antibiotic resistance is quickly becoming one of the most concerning public health issues today (Mobarki, Almerabi and Hattan, 2019 ), The rise of multi-drug resistance is due to the over-prescription, antimicrobial misuse in medicine, and their rampant use for agricultural purposes (Ayukekbong, Ntemgwa and Atabe, 2017 ). In this study, the highly sensitive drug Imepenum with 79%, followed by Chlorophenical with 72%, This is not in agreement with a study done in Bahir Dar city, Northwest Ethiopia (where antibiotics results indicated that norfloxacin was found the most effective drug with 85.1% sensitivity (norfloxacin is quinolone like ciprofloxacin which was the least sensitive) followed by chloramphenicol 83.8% which is in line with this study where chloramphenicol was the most sensitive (100%) (Belete, Demlie et al. 2022 ). This study has several limitations; first was inability to determine prior use of antibiotics using laboratory techniques and only relied on information given by the parents or guardians. Secondly, the study did not consider the socio-economic variables of the participants. DEC is prevalent in children with diarrhea in Mbarara City western Uganda and its identification in children should be considered among strategies for combatting childhood diarrhea in Uganda. Conclusion The findings indicate that diarrheagenic E. coli (DEC), particularly EPEC , could contribute to childhood acute diarrheal disease. These observations highlight the need for further research to clarify the epidemiologic significance of DEC pathotypes in Uganda Declarations Competing interests The author declared that there was not conflicting interest. Acknowledgement We acknowledges Mwesigye Fred, James Mwesigye, the Microbiology laboratory technician, Mbarara Municipal Health Centre IV OPD team, Holly Innocents Children’s Hospital OPD team, DC laboratory staff, Mbarara ZARDI for their positive contributions. Consent for Publication Not Applicable Author Contributions Statement Study Conceptualization: Phionah KA, Jemimah N., Halid K., Joel B., Charles NB. Data Analysis and presentation: Phionah KA, Jemimah N., Halid K., Joel B., Charles NB. Results and discussion: Phionah KA, Jemimah N., Halid K., Joel B., Charles NB and UMS Manuscript draft and final revision: Phionah KA, Jemimah N., Halid K., Joel B., Charles NB and UMS Funding The authors did not receive funding from any source. Data Availability Data used in the study were captured in the main text and also supplementary materials was provided. Ethical Approval An institutional review Board (IRB) approval (MUST-2023-799) was obtained from the Research Ethics Committee (REC) of Mbarara University Science and Technology. In line with Helsinki declaration all human participants were treated with utmost confidentiality. Informed consent was obtained from the parent or guardian of each participant prior to participation in the study and sample collection. References Ayukekbong, J.A., Ntemgwa, M. and Atabe, A.N., (2017). The threat of antimicrobial resistance in developing countries: causes and control strategies. Antimicrobial Resistance & Infection Control , 6 (1), p.47. https://doi.org/10.1186/s13756-017-0208-x Belete, M.A., Demlie, T.B., Chekole, W.S. and Sisay Tessema, T., (2022). Molecular identification of diarrheagenic Escherichia coli pathotypes and their antibiotic resistance patterns among diarrheic children and in contact calves in Bahir Dar city, Northwest Ethiopia. Plos one , 17 (9), p.e0275229. https://doi.org/10.1371/journal.pone.0275229 Fenta, A., Alemu, K. and Angaw, D.A., (2020). Prevalence and associated factors of acute diarrhea among under-five children in Kamashi district, western Ethiopia: community-based study. BMC pediatrics , 20 (1), p.236. https://doi.org/10.1186/s12887-020-02138-1 Mokomane, M., Kasvosve, I., Melo, E.D., Pernica, J.M. and Goldfarb, D.M., (2018). The global problem of childhood diarrhoeal diseases: emerging strategies in prevention and management. Therapeutic advances in infectious disease , 5 (1), pp.29-43.https://doi.org/10.1177/2049936117744429 Manetu, W. , M’masi, S. and Recha, C. (2021) Diarrhea Disease among Children under 5 Years of Age: A Global Systematic Review. Open Journal of Epidemiology , 11 , 207-221. doi: 10.4236/ojepi.2021.113018. Manhique-Coutinho, L., Chiani, P., Michelacci, V., Taviani, E., Bauhofer, A. F. L., Chissaque, A., ... & De Deus, N. (2022). Molecular characterization of diarrheagenic Escherichia coli isolates from children with diarrhea: A cross-sectional study in four provinces of Mozambique: Diarrheagenic Escherichia coli in Mozambique. International Journal of Infectious Diseases , 121 , 190-194.https://doi.org/10.1016/j.ijid.2022.04.054 Mobarki, N., Almerabi, B., & Hattan, A. (2019). Antibiotic resistance crisis. Int. J. Med. Dev. Ctries , 40 (4), 561-564. https://doi.org/10.24911/IJMDC.2.1.7 Omona, S., Malinga, G.M., Opoke, R., Openy, G. and Opiro, R., (2020). Prevalence of diarrhoea and associated risk factors among children under five years old in Pader District, northern Uganda. BMC infectious diseases , 20 (1), p.37. https://doi.org/10.1186/s12879-020-4770-0 Onohuean, H. and Igere, B.E., (2022). Occurrence, antibiotic susceptibility and genes encoding antibacterial resistance of Salmonella spp. and Escherichia coli from milk and meat sold in markets of Bushenyi District, Uganda. Microbiology insights , 15 , p.11786361221088992. https://doi.org/10.1177/11786361221088992 Troeger, C., Blacker, B.F., Khalil, I.A., Rao, P.C., Cao, S., Zimsen, S.R., Albertson, S.B., Stanaway, J.D., Deshpande, A., Abebe, Z. and Alvis-Guzman, N., 2018. Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for the Global Burden of Disease Study 2016. The Lancet Infectious Diseases , 18 (11), pp.1211-1228. https://doi.org/10.1016/S1473-3099(18)30362-1 Thiam, S., Diène, A.N., Fuhrimann, S., Winkler, M.S., Sy, I., Ndione, J.A., Schindler, C., Vounatsou, P., Utzinger, J., Faye, O. and Cissé, G., 2017. Prevalence of diarrhoea and risk factors among children under five years old in Mbour, Senegal: a cross-sectional study. Infectious diseases of poverty , 6 (04), pp.43-54. Robins-Browne, R.M., Holt, K.E., Ingle, D.J., Hocking, D.M., Yang, J. and Tauschek, M., 2016. Are Escherichia coli pathotypes still relevant in the era of whole-genome sequencing?. Frontiers in cellular and infection microbiology , 6 , p.141. https://doi.org/10.3389/fcimb.2016.00141 Aslam, M., Nattress, F., Greer, G., Yost, C., Gill, C. and McMullen, L., 2003. Origin of contamination and genetic diversity of Escherichia coli in beef cattle. Applied and environmental microbiology , 69 (5), pp.2794-2799. https://doi.org/10.1128/AEM.69.5.2794-2799.2003 Elder, R.O., Keen, J.E., Siragusa, G.R., Barkocy-Gallagher, G.A., Koohmaraie, M. and Laegreid, W.W., 2000. Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. Proceedings of the National Academy of Sciences , 97 (7), pp.2999-3003. https://doi.org/10.1073/pnas.97.7.2999 Midgley and Desmarchelier, 2001. Pre‐slaughter handling of cattle and Shiga toxin‐producing Escherichia coli (STEC). Letters in Applied Microbiology , 32 (5), pp.307-311. https://doi.org/10.1046/j.1472-765X.2001.00912.x Rice, D.H., Hancock, D.D., Vetter, R.L. and Besser, T.E., 1996. Escherichia coli O157 infection in a human linked to exposure to infected livestock. Shere, J.A., Bartlett, K.J. and Kaspar, C.W., 1998. Longitudinal study of Escherichia coli O157: H7 dissemination on four dairy farms in Wisconsin. Applied and Environmental Microbiology , 64 (4), pp.1390-1399. https://doi.org/10.1128/AEM.64.4.1390-1399.1998 Saka HK, Dabo NT, Muhammad B, García-Soto S, Ugarte-Ruiz M and Alvarez J (2019) Diarrheagenic Escherichia coli Pathotypes From Children Younger Than 5 Years in Kano State, Nigeria. Front. Public Health 7:348. https://doi.org/10.3389/fpubh.2019.00348 Thystrup, C., Majowicz, S. E., Kitila, D. B., Desta, B. N., Fayemi, O. E., Ayolabi, C. I., ... & Pires, S. M. (2024). Etiology-specific incidence and mortality of diarrheal diseases in the African region: a systematic review and meta-analysis. BMC Public Health , 24 (1), 1864. https://mednexus.org/doi/epdf/10.1186/s40249-017-0323-1 Thystrup, C., Majowicz, S.E., Kitila, D.B., Desta, B.N., Fayemi, O.E., Ayolabi, C.I., Hugho, E., Buys, E.M., Akanni, G.B., Machava, N.E. and Monjane, C., 2024. Etiology-specific incidence and mortality of diarrheal diseases in the African region: a systematic review and meta-analysis. BMC Public Health , 24 (1), p.1864. https://doi.org/10.1186/s12889-024-19334-8 Tumusiime, S., Asimwe, J.B., Atuhaire, L., Wasswa, R., Nsimbe, D. and Kayera, B., 2024. Time to treatment-seeking by caretakers of children under-five with diarrhea and associated factors in Uganda: a multilevel proportional hazards analysis. BMC pediatrics , 24 (1), p.403. https://doi.org/10.1186/s12887-024-04879-9 Zelelie TZ, Eguale T, Yitayew B, Abeje D, Alemu A, Seman A, et al. (2023) Molecular epidemiology and antimicrobial susceptibility of diarrheagenic Escherichia coli isolated from children under age five with and without diarrhea in Central Ethiopia. PLoS ONE 18(7): e0288517. https://doi.org/10.1371/journal.pone.0288517 Kong YS, Horner P, Unemo M, Hocking JS. (2019).Pharmacokinetic considerations regarding the treatment of bacterial sexually transmitted infections with azithromycin: a review. J Antimicrob Chemother 2019; 74:1157–66. https://doi.org/10.1093/jac/dky548 Peirano V, Bianco MN, NavarroA, Schelotto F, Varela G.(2018) . Diarrheagenic Escherichia coli Associated with Acute Gastroenteritis in Children from Soriano, Uruguay, Canadian Journal of Infectious Diseases and Medical Microbiology , 2018, 8387218, https://doi.org/10.1155/2018/8387218 Additional Declarations No competing interests reported. Supplementary Files PhionahSupplementarydoc1.pdf Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 05 Jan, 2026 Reviews received at journal 02 Jan, 2026 Reviewers agreed at journal 30 Dec, 2025 Reviews received at journal 24 Dec, 2025 Reviewers agreed at journal 23 Dec, 2025 Reviewers agreed at journal 23 Dec, 2025 Reviewers agreed at journal 08 Dec, 2025 Reviewers agreed at journal 08 Dec, 2025 Reviewers invited by journal 04 Dec, 2025 Editor assigned by journal 04 Dec, 2025 Editor invited by journal 02 Dec, 2025 Submission checks completed at journal 02 Dec, 2025 First submitted to journal 02 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7842018","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":556144197,"identity":"c548afc3-107e-49da-af53-d248438ea799","order_by":0,"name":"Phionah K. Akankunda","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6UlEQVRIiWNgGAWjYDACCcYGIHmAgYGHAYRtGBiYmRtI0pIG1MJISAuYhGs5DCQJaDGXbm58XFBzR96c54zZgzc156P524FaflRsw6nFcs7BZuMZx54Z7uztMTecc+x27ozDjA2MPWdu49RicCOxTZqH7TDjhvM8ZkDG7dwGoBZmxjZCWv4dtodo+Xcudz5RWnjbDiduONtjBmQcyN1ASIvljMRmY96+w8kbzhwrk5zbl5y7EajlID6/mEukP3zM8+2w7YYzydsk3nyzy513/vDBBz8q8DgMq+gBnOpxahkFo2AUjIJRgAwAblheziVgrp0AAAAASUVORK5CYII=","orcid":"","institution":"of Mbarara University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Phionah","middleName":"K.","lastName":"Akankunda","suffix":""},{"id":556144198,"identity":"4bf0a400-a111-4763-b0c7-83b798dd31f1","order_by":1,"name":"Jemimah Natuhwera","email":"","orcid":"","institution":"Kampala International University-Ishaka","correspondingAuthor":false,"prefix":"","firstName":"Jemimah","middleName":"","lastName":"Natuhwera","suffix":""},{"id":556144202,"identity":"f27924ba-01d6-46ca-8dbb-465f721e1ee6","order_by":2,"name":"Halidi Kirunda","email":"","orcid":"","institution":"National Agricultural Research Organisation","correspondingAuthor":false,"prefix":"","firstName":"Halidi","middleName":"","lastName":"Kirunda","suffix":""},{"id":556144203,"identity":"f0f9f1ac-2fc4-44ba-bf81-64bd2c42089f","order_by":3,"name":"Charles Nkubi Bagenda","email":"","orcid":"","institution":"Mbarara University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Charles","middleName":"Nkubi","lastName":"Bagenda","suffix":""},{"id":556144204,"identity":"c44a8722-1423-4760-8434-d09d4f3186a2","order_by":4,"name":"Umar Mohammed San","email":"","orcid":"","institution":"Kampala International University-Ishaka","correspondingAuthor":false,"prefix":"","firstName":"Umar","middleName":"Mohammed","lastName":"San","suffix":""},{"id":556144206,"identity":"caf50179-d19c-47ae-8b2a-ceafc8c0ca73","order_by":5,"name":"Joel Bazira","email":"","orcid":"","institution":"of Mbarara University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Joel","middleName":"","lastName":"Bazira","suffix":""}],"badges":[],"createdAt":"2025-10-12 16:38:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7842018/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7842018/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97894873,"identity":"b2af6f39-cf07-4b68-bee0-16dd7cff79a3","added_by":"auto","created_at":"2025-12-10 15:33:10","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6702997,"visible":true,"origin":"","legend":"","description":"","filename":"ORIGINALMANUSCRIPT...REVISED.docx","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/b48f2ac0840cbf4c843b41ef.docx"},{"id":97701987,"identity":"b388d314-5570-4968-bb84-cddb33df808b","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7772,"visible":true,"origin":"","legend":"","description":"","filename":"b3b37de20e1145c6ad6276a3ce1169ef.json","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/40e78a59c2efb431ff8b6990.json"},{"id":97701993,"identity":"a82180a6-2a0a-43cc-b934-094f4ccc60d1","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":685151,"visible":true,"origin":"","legend":"","description":"","filename":"PhionahSupplementarydoc1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/051dec511932164503b9434d.pdf"},{"id":97702000,"identity":"0902c3dd-768d-4757-b376-7a2cca1a6f40","added_by":"auto","created_at":"2025-12-08 12:29:38","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":94913,"visible":true,"origin":"","legend":"","description":"","filename":"b3b37de20e1145c6ad6276a3ce1169ef1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/f402d1591b1e808c75c5e191.xml"},{"id":97701991,"identity":"e1741276-c91e-45a8-830f-f9d95608c502","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"emf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19152,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.emf","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/c91a384f469002b1b4f038f9.emf"},{"id":97894456,"identity":"09fde591-99e5-4418-933b-f19147bfac68","added_by":"auto","created_at":"2025-12-10 15:32:32","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":224589,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/619e989c709a6ed717d14e3b.jpeg"},{"id":97894605,"identity":"199cfcfe-b555-451c-ae69-3ae503957b6e","added_by":"auto","created_at":"2025-12-10 15:32:48","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/ec0517dd0b0df26258e7ba7a.jpeg"},{"id":97893375,"identity":"1eb32e59-58bd-4d0c-a2a7-2052a0cce565","added_by":"auto","created_at":"2025-12-10 15:30:14","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":209890,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/b64471c8a58038fe1846882f.jpeg"},{"id":97701990,"identity":"ff587e56-6e27-4e22-9e62-7ca2c78f5262","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/3faf94771fe219a6326c337e.jpeg"},{"id":97894794,"identity":"fd5d2b9d-bd3c-437b-aeac-5fd53d6d3783","added_by":"auto","created_at":"2025-12-10 15:33:02","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":76504,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/bd9d7716be5cc9a573ba6977.png"},{"id":97894519,"identity":"b669770b-df71-4108-8037-8ce76768029e","added_by":"auto","created_at":"2025-12-10 15:32:41","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":133736,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/11cd08fcd9b14adff14ed877.png"},{"id":97894772,"identity":"64e3cb9f-f783-43bc-954c-e2b688c55680","added_by":"auto","created_at":"2025-12-10 15:33:00","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/b6ca6b779c76c8e2b9ebf98e.png"},{"id":97701997,"identity":"7f9518a0-5952-449e-83c6-66ea56cfd906","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":84733,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/613651068b5171244b615098.png"},{"id":97701995,"identity":"69d59fa8-069f-40cb-b4d4-21413e408062","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/4ec4fa38264559683949698c.png"},{"id":97702003,"identity":"41a6e083-26b9-4254-8d49-e3fe88edbdf9","added_by":"auto","created_at":"2025-12-08 12:29:38","extension":"xml","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92414,"visible":true,"origin":"","legend":"","description":"","filename":"b3b37de20e1145c6ad6276a3ce1169ef1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/676443c28760b4a2bccb179b.xml"},{"id":97892992,"identity":"c8983d23-c7b6-4506-b772-44a11e4945d9","added_by":"auto","created_at":"2025-12-10 15:25:16","extension":"html","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102683,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/335b08187f230ae4e05e5a6a.html"},{"id":97894677,"identity":"e84d7b4a-a083-4962-bb54-9361d175d758","added_by":"auto","created_at":"2025-12-10 15:32:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":34717,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProportion of different pathogenic E. \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ecoli \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePathotypes identified\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/8706ec40da6edf8f334dec90.png"},{"id":97701983,"identity":"919dc900-f97e-4b38-bd78-ee9cfb163697","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":68720,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of PCR products showing amplification of a 775 bp of EAE. Lane 1 represents the DNA ladder (1000bp). Lanes 2, 3, and 4 correspond to the tested samples, all showing bands at approximately 775 bp, indicating successful amplification of EAE. Lane 5 is the negative control, showing no detectable band. Lane 6 is the positive control, validating the PCR reaction.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/de2117315517f5155789db1e.png"},{"id":97701986,"identity":"7145e6d2-aca8-4120-97f2-863e08c8dc3d","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":68909,"visible":true,"origin":"","legend":"\u003cp\u003ePCR amplification showing a 630 bp of EAEC product in samples (lanes 2–3) and positive control (lane 5); no band observed in the negative control (lane 4).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/f011c96c3574076afa9b3666.png"},{"id":98774534,"identity":"f08a0a90-60d2-483d-baf2-dbc71099f03b","added_by":"auto","created_at":"2025-12-22 11:51:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":941814,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/9283d47d-8a65-4e41-9f69-52c7b438cd21.pdf"},{"id":97701988,"identity":"4e0f4988-a835-4bd5-8165-0ccdb08351e2","added_by":"auto","created_at":"2025-12-08 12:29:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":685151,"visible":true,"origin":"","legend":"","description":"","filename":"PhionahSupplementarydoc1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7842018/v1/780c246c347c2bb33b6beb54.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eMolecular Detection of Diarrheagenic Escherichia Coli Pathotypes Isolated From Children With Diarrhea in Mbarara City, South Western Uganda\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDiarrheal diseases remain a global public health concern affecting children, with a high prevalence in resource-limited settings (Omona et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Diarrhea is characterized by stools of decreased consistency and increased volume due to imbalance of secretion and absorption of water and salts in the intestine (Saka et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). It is a major source of malnutrition in Low-Middle Income Countries (LMICs) (Saka et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Diarrhea have been listed as 1 of the top 10 causes of mortality and disability-adjusted life-years for persons in all age groups, and 1 of the 5 leading causes of mortality and disability-adjusted life-years among children aged\u0026thinsp;\u0026lt;\u0026thinsp;5 years (Troeger et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Fenta, Alemu and Angaw, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eGlobally, an estimated 1.6\u0026nbsp;million child mortality is recorded yearly due to chronic diarrhea, accounting for 1:5 child deaths (Manetu et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Although global diarrhea mortality has decreased significantly over the last 25 years, diarrhea morbidity has not because of risk factors, including poor water supply, sanitation, and hygiene (WASH) in Sub-Saharan Africa (Thiam et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Diarrhea represents a major cause of childhood mortality across Africa, With Substantial geographic variation and particularly high burden in East and Uganda. Geographic analysis reveals Eastern Africa has the highest disease incidence (114,389 cases per 100,000 children\u0026thinsp;\u0026lt;\u0026thinsp;5), while Western Africa shows highest mortality rates (Thystrup et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In Uganda specifically, diarrhea accounts for 22% of deaths in children under 5 (Omona \u003cem\u003eet al.\u003c/em\u003e, 2019) with overall child mortality reaching 2 in 10 children (Tumusiime et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cem\u003eRotavirus\u003c/em\u003e, \u003cem\u003eCryptosporidium\u003c/em\u003e, \u003cem\u003eEscherichia coli (E. coli)\u003c/em\u003e, enterotoxigenic \u003cem\u003eE. coli\u003c/em\u003e (\u003cem\u003eETEC\u003c/em\u003e), and \u003cem\u003eShigella\u003c/em\u003e are utmost the main etiological agents of diarrhea (Mokomane et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Other causes include various genera of bacterial pathogens such as \u003cem\u003eSalmonella\u003c/em\u003e, \u003cem\u003eShigella\u003c/em\u003e, \u003cem\u003eYersinia\u003c/em\u003e, \u003cem\u003eVibrio\u003c/em\u003e, \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003eEnterobacter\u003c/em\u003e, \u003cem\u003ePlesiomonas\u003c/em\u003e, \u003cem\u003eKlebsiella\u003c/em\u003e, \u003cem\u003eProteus\u003c/em\u003e, \u003cem\u003eSerratia\u003c/em\u003e, \u003cem\u003eAeromonas\u003c/em\u003e (Onohuean and Igere, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Diarrheagenic \u003cem\u003eE. coli\u003c/em\u003e is classified into six major pathotypes (pathogenic variants), including enteroaggregative \u003cem\u003eE. coli\u003c/em\u003e (EAEC), enteropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e (EPEC), enterotoxigenic \u003cem\u003eE. coli\u003c/em\u003e (ETEC), enter-invasive \u003cem\u003eEscherichia coli\u003c/em\u003e (EIEC), enterohaemorrhagic \u003cem\u003eE. coli\u003c/em\u003e (EHEC also known as Shiga-toxin producing \u003cem\u003eE. coli\u003c/em\u003e), and diffusely adherent \u003cem\u003eEscherichia coli\u003c/em\u003e (DAEC) (Peirano et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). EAEC and EPEC are the foremost causes of acute diarrhea outbreaks or leading potentially fatal infant and children in underdeveloped nations, while ETEC is the prominent cause of travelers\u0026rsquo; diarrhea.\u003c/p\u003e\u003cp\u003eA large number of verotoxigenic \u003cem\u003eE. coli\u003c/em\u003e serotypes are associated with human intestinal infections, and some of these serotypes are recognized as important foodborne pathogens that may cause mild to severe bloody diarrhea and hemolytic uremic syndrome (citation). Cattle and their environment are among the most important sources of pathogenic \u003cem\u003eE. coli\u003c/em\u003e, and they may be the origin of contamination of meat and meat products (Elder et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Midgley and Desmarchelier, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). In Uganda, \u003cem\u003eE. coli\u003c/em\u003e is frequently linked to acute infantile diarrhea.\u003c/p\u003e\u003cp\u003eIn western Uganda, \u003cem\u003eE. coli\u003c/em\u003e is commonly isolated from children who have diarrhea; however, the genetic background is not regularly assessed, thus it is unclear what percentage of diarrhea is caused by DEC. As a result, there is a dearth of research on the significance of DEC and particular DEC pathotypes as diarrheal disease causes in Mbarara Municipality and southwest Uganda. In order to provide baseline information on the circulating DEC pathotypes in the study locality and their clinical significance, this study examined the incidence and frequency of DEC as a cause of infectious diarrhea in children under the age of 12 in Mbarara City, as well as their pattern of antibiotic susceptibility.\u003c/p\u003e"},{"header":"Methodology","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStudy Design\u003c/h2\u003e\u003cp\u003eThis study was a cross-sectional hospital-based study. Sample collection was carried out at health centers of Mbarara City including Mbarara Municipal Council Health Centre IV and Holy Innocents Children\u0026rsquo;s hospital. The study involved children of 6 months to 12 years old with diarrhea during the study time.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eSample Collection\u003c/h3\u003e\n\u003cp\u003eOut of the 391 children aged 6 months to 12 years old with diarrhea at the study centers. Diarrhea was well-defined, according to World Health Organization guidelines as the occurrence of 3 or more, loose, liquid or watery stools within 24 hours, as this was done on triage of the children at different Health Centre\u0026rsquo;s. (Citation). The study included only those children who had no antibiotics exposure for the last two weeks. There is variability in the validity of antibiotics to remain in the body, some antibiotic\u0026rsquo;s have shorter half-life when compared to others (Kong \u003cem\u003eet al.\u003c/em\u003e,2019). The study excluded those who never had diarrhea but visited the health units at the time of the study was done by (Zelelie et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eSample handling and transportation.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSterile stool sample containers were given to Children\u0026rsquo;s parents / guardians and were instructed on stool sample collection into a dry, clean stool container and for children below 3 years a sterile rectal swab was used to collect the specimen to avoid contamination of the sample with urine. To ensure optimum recovery of \u003cem\u003eE. coli\u003c/em\u003e all specimens obtained were transported immediately to the Mbarara University Microbiology Laboratory. The samples were handled by the researcher and a research assistant following standard Operating Procedures on sample handling. The bacterial isolation and identification, DNA extraction and antimicrobial susceptibility test was carried out.\u003c/p\u003e\n\u003ch3\u003eBacterial Isolation and Identification stool samples\u003c/h3\u003e\n\u003cp\u003eThe stool samples collected were inoculated on MacConkey medium and Levin eosin methylene blue media. All stool samples were processed in less than 6 hours from the time of specimen collection. The Plates were incubated for 18\u0026ndash;24 hours at 37 \u003csup\u003eo\u003c/sup\u003e C in an aerobic environment. The isolates of \u003cem\u003eE. coli\u003c/em\u003e were identified by Gram-stain for morphology; the biochemical tests (indole, Simmons citrate, urea, triple sugar iron agar) was carried out to identify \u003cem\u003eE. coli\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDNA extraction and pathotype identification.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDNA was extracted at DC Molecular Laboratories in Mbarara city from the isolates using the boiling method by boiling at 100\u0026deg;C for 10 minutes in a preheated heating block as described by (Onohuean and Igere, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e); and following the established standard operating procedure for DNA extraction. The different DEC pathotypes were speciated by Polymerase Chain reaction (PCR) techniques using the primers as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The Fresh overnight cultures were placed in a sterile 1.5 ml Eppendorf tube and centrifuged for 10 minutes at 13,000 rpm. The cell pellets were then rinsed twice with phosphate-buffered saline pH 7.4 and suspended in 500 ml sterile and distilled water before lysed for DNA release. After centrifuging the suspension for 5 minutes at 15,000 rpm, the supernatant was cautiously pipetted into sterile cryogenic tubes and kept at 20\u0026deg;C for use as probable genomic DNA \u003cem\u003eE. coli spp\u003c/em\u003e. for PCR tests.\u003c/p\u003e\n\u003ch3\u003eAntimicrobial Susceptibility test\u003c/h3\u003e\n\u003cp\u003eFor all DEC pathotypes were assessed using the disc diffusion method (kirby-bauer method) according to clinical and laboratory standard institute guidelines (CLSI). Antibiotics for the study were selected based CLSI guidelines for enterobacterales. The bacterias tested were chloramphenicol (30NgC30), Ceftriaxone(30NgCR30), Tetracycline (30NgTE30), Imipenum (10mcgIPM10), Ciprofloxacin (30NgCIP30), Amoxicillin (20NgAMC30). The results were interpreted using CLSI guidelines. \u003cem\u003eE. coli\u003c/em\u003e ATCC (American type culture collection) 25922 was used as quality control strained for Antimicrobial Susceptibility strain testing.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePathotype identification.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAbout 2.5 ml of crude template DNA in a 25-L reaction volume, 10 mM Tris-HCl, 2 mM MgCl2, 1.5 U Taq polymerase (HybriPol Bioline, UK), 0.2 mM dNTPs, 0.2 mM primers (SBS Genetech Co, Ltd), and a Gene Amp 2700 thermocycler were used for the amplifications (Periano et al 2018). 30 cycles of 1 minute at 94\u0026deg;C, 1 minute at different annealing temperatures, and 1 minute at 72\u0026deg;C were conducted under similar conditions for all reactions, which included a 5-minute denaturation at 94\u0026deg;C. A 10 minutes at 72\u0026deg;C was the final extension period. To see the PCR bands, the resulting PCR products were subsequently electrophoresed with 0.5X T ethidium bromide stain on 2 percent agarose gels (Periano et al., 2018). The first PCR screens employed stx1/stx2 and eae primers to see if STEC or EPEC DEC were present. To distinguish between tEPEC and aEPEC, DNA with positive eae and negative stx1/stx2 PCR was examined using bfp primers. Negative eae and stx1/stx2 extracts were tested using pCVD432 primers for plasmidic EAEC sequences, ipaH primers for detecting genes coding the invasion plasmid antigen of EIEC (and Shigella), and PCR assays for ETEC labile and stable enterotoxins (Periano et al 2018). Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows the summary of the primers and the Sequence employed.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eGenes for PCR amplification, Primers and Their characteristics.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGENE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePRIMER\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence 5\u003csup\u003e1\u003c/sup\u003e-3\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAmplicon size (bp).\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAnnealing\u003c/p\u003e\u003cp\u003etemp (\u0026deg;C).\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eeae\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eEAE 1\u003c/p\u003e\u003cp\u003eEAE 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAGAATGAAATAGAAGTCGT\u003c/p\u003e\u003cp\u003eGCGGTATCTTTCGCGTAATCGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e775\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e55\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ebfp\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eEP1\u003c/p\u003e\u003cp\u003eEP2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAATGGTGCTTGCGCTTGCTGC\u003c/p\u003e\u003cp\u003eGCCGCTTTATCCAACCTGGTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e324\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e55\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStx1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eVT1-A\u003c/p\u003e\u003cp\u003eVT2-B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAAGAGTCCGTGGATTACG\u003c/p\u003e\u003cp\u003eAGCGATGCAGCTATTAATAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e131\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e55\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStx2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eVT2-a\u003c/p\u003e\u003cp\u003eVT2-b\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTAACCACACCCCACCGGGCAGT\u003c/p\u003e\u003cp\u003eGCTCTGGATGCATCTCTGGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e348\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e55\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003epCDV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eEAEC1\u003c/p\u003e\u003cp\u003eEAEC2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGGCGAAAGACTGTATCAT\u003c/p\u003e\u003cp\u003eCAATGTATAGAAATCCGCTGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e630\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eipaH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eEI1\u003c/p\u003e\u003cp\u003eEI2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTTCCTTGACCGCCTTTCCGATACCGTC\u003c/p\u003e\u003cp\u003eGCCGGTCAGCCCTCTGAGAGTAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e620\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e55\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eeltA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLT-A-1\u003c/p\u003e\u003cp\u003eLT-A-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCGACAGATTATACCGTGC\u003c/p\u003e\u003cp\u003eCCGAATTCTGTTATATATGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e332\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e55\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eestA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSTA-1\u003c/p\u003e\u003cp\u003eSTA-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATTTTTATTTCTGTATTGTCTTT\u003c/p\u003e\u003cp\u003eGGATTACAACACAGTTCACAGCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e147\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e55\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003eData Analysis\u003c/h2\u003e\u003cp\u003eThe complete data was then verified for completeness, uniformity and accuracy to remove outliers. The data was coded and exported to MS Excel spreadsheets and STATA version 2.0). The analysis was done based on the study objectives and results were presented in tables and charts using frequency, proportion, percentages and bar charts. CLSI guidelines was used to classify the isolates based on the susceptible patterns (S, I, R) to determine variations in susceptibility of the isolates of E.coli from different patients.\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003eA total of 391 stool samples were collected from children aged 6 months to 12 years of presenting with diarrhea. About 78 tested positive for \u003cem\u003eE\u003c/em\u003e. \u003cem\u003ecoli\u003c/em\u003e with an overall prevalence of 19.95% (CI\u0026thinsp;=\u0026thinsp;95%, 16.27\u0026ndash;24.22). Of the 78 (19.95%) positives, the highest prevalence of \u003cem\u003eE\u003c/em\u003e. \u003cem\u003ecoli\u003c/em\u003e by sex was found in females representing 55.56%. The overall proportion of Pathogenic E. \u003cem\u003ecoli\u003c/em\u003e isolated based on pathotypes was 55.13% (43.84\u0026ndash;65.91, 95% CI) as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrevalence of \u003cem\u003eE. coli\u003c/em\u003e based on sex and status.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eE. \u003cem\u003ecoli\u003c/em\u003e Status\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFrequency (n)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePercentage\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNegative\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e313\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e80.05 (75.78\u0026ndash;83.73)*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePositive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e19.95 (16.20 -24.22)*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSex\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePathogenic\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNon-pathogenic\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e18 (54.55%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e15 (45.45%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33 (100%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e25 (55.56%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e20 (44.44%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e45 (100%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e43 (55.13%)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e35 (44.87%)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e78 (100%)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e* (95% Confidence Interval)\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThe Proportion of different pathogenic E. \u003cem\u003ecoli\u003c/em\u003e Pathotypes was identified. About 43 (55.13%) pathogenic E. \u003cem\u003ecoli\u003c/em\u003e belonged to the three common pathotypes as shown Table Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The different pathotypes isolated were Enteropathogenic E. \u003cem\u003ecoli\u003c/em\u003e ( EPEC) as the most prevalent pathotype representing 86.05%, followed by Entero-haemorrhagic E. \u003cem\u003ecoli\u003c/em\u003e (EHEP) with 9.30%.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe Antimicrobial Profile on DEC Pathotypes as shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Drug susceptibility patterns were done on the pathogenic \u003cem\u003eE. coli\u003c/em\u003e using the Kirby-Bauer disc diffusion method as described by the Clinical Laboratory Standards Institute (CLSI, 2022) to determine sensitivity, intermediate and resistance to different drugs that are commonly used to treat E.\u003cem\u003ecoli\u003c/em\u003e infections. The drug sensitivity indicate that the most sensitive drug was Imipenum with 79% (EPEC; 29/43,), followed by Chloramphenicol representing (EPEC; 27/43) The most resistant drug was amoxicillin with 70% (EPEC;25/43), followed by ciprofloxacin with 60% (EPEC; 25/43) as shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAntimicrobial Profile on DEC Pathotypes.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDrug\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCategory\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003cp\u003en\u0026thinsp;=\u0026thinsp;43\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEHEC n\u0026thinsp;=\u0026thinsp;4\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eEPEC\u003c/p\u003e\u003cp\u003en\u0026thinsp;=\u0026thinsp;37\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eEIEC\u003c/p\u003e\u003cp\u003en\u0026thinsp;=\u0026thinsp;2\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eChlorophenical30NgC-30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSensitive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e33 (72%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2 (50%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e27 (73%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2 (100%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eResistant\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e12 (28%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2 (50%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e10 (27%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0 (0%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eCeftriaxone30Ng\u003c/p\u003e\u003cp\u003eCR-30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSensitive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e23 (53%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1 (25%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e19 (51%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2 (100%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eResistant\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2 0 (47%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2 (50%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e18 (49%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0 (0%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTetracycline30Ng\u003c/p\u003e\u003cp\u003eTE-30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSensitive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1 8 (42%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1(25%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e15 (41%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2 (100%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eResistant\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e25 (58%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3(75%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e22 (59%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0 (0%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eImepenum10mcg\u003c/p\u003e\u003cp\u003eIPM-10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSensitive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e34 (79%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3 (75%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e29 (78%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2 (100%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eResistant\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9 (21%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1(25%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e8 (22%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0 (0%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eCiprofloxacin30Ng\u003c/p\u003e\u003cp\u003eCIP-30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSensitive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e17 (40%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3(75%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12 (32%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2 (100%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eResistant\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e26 (60%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1(25%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e25 (68%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0 (0%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eAmoxacillin20Ng\u003c/p\u003e\u003cp\u003eAMC-30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSensitive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e13 (30%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1(25%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12 (32%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0 (0%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eResistant\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e30 (70%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3 (75%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e25 (68%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2 (100%)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eDiarrheagenic E. coli infections are indistinguishable from gastroenteritis due to other bacterial or viral infection, and therefore isolation and identification of the specific DEC associated with a clinical case could allow caregivers to provide appropriate treatment (Saka \u003cem\u003eet al\u003c/em\u003e.,2019). This study examined the incidence and frequency of DEC as a cause of infectious diarrhea in children under the age of 12 in Mbarara City, as well as their pattern of antibiotic susceptibility.\u003c/p\u003e\u003cp\u003eOf the 391 stool samples collected from children with diarrhea aged 6 months to 12 years at two health facilities in Mbarara, 78 tested positive for E. \u003cem\u003ecoli\u003c/em\u003e given an overall prevalence of \u003cb\u003e19.95%\u003c/b\u003e with a 95% confidence interval of 16.27% to 24.22%. This is a low prevalence compared to the studies done Central Ethiopia (Zelelie \u003cem\u003eet al\u003c/em\u003e.,2023) and Northwest Ethiopia, where 194 samples consisting of 144 stool samples from children and 50 fecal samples from calves were studied, presumptive E. \u003cem\u003ecoli\u003c/em\u003e isolates were identified from 74 (38.3%) of the samples (Belete, Demlie et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and in Mozambique (35.7%) by (Manhique-Coutinho, Chiani et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and in Branzil (Robins-browne et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), The variability in the prevalence could be due to climate variability, study population, water supply that will influence DEC incidence (Zelelie et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOf the 391 samples, \u003cb\u003e187\u003c/b\u003e (47.83%) were males and \u003cb\u003e204\u003c/b\u003e (52.17%) were females. Of the 78 (19.95%) E. \u003cem\u003ecoli\u003c/em\u003e positives, prevalence of E. \u003cem\u003ecoli\u003c/em\u003e by gender, males were 18 (54.55%) and females were 25 (55.56%). The \u003cem\u003eP\u003c/em\u003e- value for chi - square test was above 0.05 therefore, there was no significant difference in the prevalence of E.\u003cem\u003ecoli\u003c/em\u003e by gender i.e. the prevalence of E. \u003cem\u003ecoli\u003c/em\u003e in males did not significantly differ from the prevalence of E.\u003cem\u003ecoli\u003c/em\u003e in females, this is in line with the study done in North East Ethiopia (Belete, Demlie et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThough \u003cem\u003eE. coli\u003c/em\u003e is a microbe that can be found in both humans, animals and animal gut, normally, it is not harmful. However, some \u003cem\u003eE. coli\u003c/em\u003e variants can acquire virulence genes and cause gastroenteritis, which can be deadly if left untreated. These strains are classified as diarrheagenic \u003cem\u003eE. coli\u003c/em\u003e (DEC), and of six subtypes (Rodrigues \u003cem\u003eet a\u003c/em\u003el., 2016).In this study, the 78 (19.95%) E.\u003cem\u003ecoli\u003c/em\u003e positives isolates were subjected to multiplex PCR to identify the DEC.\u003c/p\u003e\u003cp\u003eOf the 78 \u003cem\u003eE.coli\u003c/em\u003e isolates, 43 were pathogenic giving prevalence percentage of pathogenic\u003c/p\u003e\u003cp\u003e\u003cem\u003eE.coli\u003c/em\u003e as 55.13% with a 95% CI of 43.84% to 65.91%. This was higher compared to the studies done in Rakai hospital, Southern Uganda ( 38.2%) by (Masiga, Kigozi et al. 2022) higher than that done in informal settlements in Nairobi Kenya where the prevalence was 27%, and in Mozambique (48.6%) by (Manhique-Coutinho, Chiani et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) but lower compared to studies done in Amatole District Municipality of Eastern Cape, South Africa (Omolajaiye, Afolabi \u003cem\u003eet al.\u003c/em\u003e 2020), this could be due to distribution of DEC pathotypes which varies geographically due to seasonal variations, animal interactions and poor sanitation and hygiene.\u003c/p\u003e\u003cp\u003eThe 43 (55.13%) pathogenic E.\u003cem\u003ecoli\u003c/em\u003e belonged to the three common pathotypes i.e.\u003c/p\u003e\u003cp\u003eEnteropathogenic E. \u003cem\u003ecoli\u003c/em\u003e (EPEC) was the most prevalent pathotype with 86.05%, followed by Enterohaemorrhagic \u003cem\u003eE.coli\u003c/em\u003e (EHEP) with 9.30% and enter-invasive E.\u003cem\u003ecoli\u003c/em\u003e (EIEC) was the least with a prevalence percentage of 4.65%. The other pathotypes like Enterotoxigenic\u003c/p\u003e\u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e (ETEC), Enteroaggregative E. \u003cem\u003ecoli\u003c/em\u003e (EAEC), Adherent-Invasive \u003cem\u003eE. coli\u003c/em\u003e (AIEC) and diffusely adhesion E. \u003cem\u003ecoli\u003c/em\u003e (DAEC) were not found. EPEC being the most prevalent is in agreement with other studies done in developing countries where it\u0026rsquo;s classified as the leading cause of diarrhea and death in children, particularly in developing nations (Robins-browne et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Also in agreement with results reported in West Africa where higher recovery rates for EPEC and EHEP have been found significantly associated with childhood diarrhea (Okeke I, \u003cem\u003eet al\u003c/em\u003e, 2017). Though majority of the previous studies carried out also implicate enteroaggregative \u003cem\u003eE. coli\u003c/em\u003e (EAEC) as the most prevalent like in Nigeria (Saka, Dabo et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and in Eastern Cape town in South Africa (Omolajaiye, Afolabi \u003cem\u003eet al\u003c/em\u003e. 2020).\u003c/p\u003e\u003cp\u003eAntibiotic resistance is quickly becoming one of the most concerning public health issues today (Mobarki, Almerabi and Hattan, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), The rise of multi-drug resistance is due to the over-prescription, antimicrobial misuse in medicine, and their rampant use for agricultural purposes (Ayukekbong, Ntemgwa and Atabe, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In this study, the highly sensitive drug Imepenum with 79%, followed by Chlorophenical with 72%, This is not in agreement with a study done in Bahir Dar city, Northwest Ethiopia (where antibiotics results indicated that norfloxacin was found the most effective drug with 85.1% sensitivity (norfloxacin is quinolone like ciprofloxacin which was the least sensitive) followed by chloramphenicol 83.8% which is in line with this study where chloramphenicol was the most sensitive (100%) (Belete, Demlie et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThis study has several limitations; first was inability to determine prior use of antibiotics using laboratory techniques and only relied on information given by the parents or guardians. Secondly, the study did not consider the socio-economic variables of the participants. DEC is prevalent in children with diarrhea in Mbarara City western Uganda and its identification in children should be considered among strategies for combatting childhood diarrhea in Uganda.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe findings indicate that diarrheagenic \u003cem\u003eE. coli\u003c/em\u003e (DEC), particularly \u003cem\u003eEPEC\u003c/em\u003e, could contribute to childhood acute diarrheal disease. These observations highlight the need for further research to clarify the epidemiologic significance of DEC pathotypes in Uganda\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author declared that there was not conflicting interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledges\u0026nbsp;Mwesigye\u0026nbsp;Fred, James Mwesigye, \u0026nbsp;the \u0026nbsp;Microbiology laboratory technician, Mbarara Municipal Health Centre IV OPD team, Holly Innocents Children\u0026rsquo;s Hospital OPD team, DC laboratory staff, Mbarara ZARDI \u0026nbsp;for their positive contributions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Author Contributions Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStudy Conceptualization:\u0026nbsp;Phionah KA, Jemimah N., Halid K.,\u0026nbsp;Joel B., Charles NB.\u003c/p\u003e\n\u003cp\u003eData Analysis and presentation:\u0026nbsp;Phionah KA, Jemimah N., Halid K.,\u0026nbsp;Joel B., Charles NB.\u003c/p\u003e\n\u003cp\u003eResults and discussion:\u0026nbsp;Phionah KA, Jemimah N., Halid K.,\u0026nbsp;Joel B., Charles NB and UMS\u003c/p\u003e\n\u003cp\u003eManuscript draft and final revision: \u0026nbsp;Phionah KA, Jemimah N., Halid K.,\u0026nbsp;Joel B., Charles NB and UMS\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors did not receive funding from any source.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData used in the study were captured in the main text and also supplementary materials was provided.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAn institutional review Board (IRB) approval (MUST-2023-799) was obtained from the Research Ethics Committee (REC) of Mbarara University Science and Technology. In line with Helsinki declaration all human participants were treated with utmost confidentiality. Informed consent was obtained from the parent or guardian of each participant prior to participation in the study and sample collection. \u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAyukekbong, J.A., Ntemgwa, M. and Atabe, A.N., (2017). The threat of antimicrobial resistance in developing countries: causes and control strategies. \u003cem\u003eAntimicrobial Resistance \u0026amp; Infection Control\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(1), p.47. https://doi.org/10.1186/s13756-017-0208-x \u003c/li\u003e\n \u003cli\u003eBelete, M.A., Demlie, T.B., Chekole, W.S. and Sisay Tessema, T., (2022). Molecular identification of diarrheagenic Escherichia coli pathotypes and their antibiotic resistance patterns among diarrheic children and in contact calves in Bahir Dar city, Northwest Ethiopia. \u003cem\u003ePlos one\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(9), p.e0275229. https://doi.org/10.1371/journal.pone.0275229 \u003c/li\u003e\n \u003cli\u003eFenta, A., Alemu, K. and Angaw, D.A., (2020). Prevalence and associated factors of acute diarrhea among under-five children in Kamashi district, western Ethiopia: community-based study. \u003cem\u003eBMC pediatrics\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(1), p.236. https://doi.org/10.1186/s12887-020-02138-1 \u003c/li\u003e\n \u003cli\u003eMokomane, M., Kasvosve, I., Melo, E.D., Pernica, J.M. and Goldfarb, D.M., (2018). The global problem of childhood diarrhoeal diseases: emerging strategies in prevention and management. \u003cem\u003eTherapeutic advances in infectious disease\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(1), pp.29-43.https://doi.org/10.1177/2049936117744429\u003c/li\u003e\n \u003cli\u003eManetu, W. , M’masi, S. and Recha, C. (2021) Diarrhea Disease among Children under 5 Years of Age: A Global Systematic Review. \u003cem\u003eOpen Journal of Epidemiology\u003c/em\u003e, \u003cstrong\u003e11\u003c/strong\u003e, 207-221. doi: 10.4236/ojepi.2021.113018.\u003c/li\u003e\n \u003cli\u003eManhique-Coutinho, L., Chiani, P., Michelacci, V., Taviani, E., Bauhofer, A. F. L., Chissaque, A., ... \u0026amp; De Deus, N. (2022). Molecular characterization of diarrheagenic Escherichia coli isolates from children with diarrhea: A cross-sectional study in four provinces of Mozambique: Diarrheagenic Escherichia coli in Mozambique. \u003cem\u003eInternational Journal of Infectious Diseases\u003c/em\u003e, \u003cem\u003e121\u003c/em\u003e, 190-194.https://doi.org/10.1016/j.ijid.2022.04.054 \u003c/li\u003e\n \u003cli\u003eMobarki, N., Almerabi, B., \u0026amp; Hattan, A. (2019). Antibiotic resistance crisis. \u003cem\u003eInt. J. Med. Dev. Ctries\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(4), 561-564. https://doi.org/10.24911/IJMDC.2.1.7 \u003c/li\u003e\n \u003cli\u003eOmona, S., Malinga, G.M., Opoke, R., Openy, G. and Opiro, R., (2020). Prevalence of diarrhoea and associated risk factors among children under five years old in Pader District, northern Uganda. \u003cem\u003eBMC infectious diseases\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(1), p.37. https://doi.org/10.1186/s12879-020-4770-0 \u003c/li\u003e\n \u003cli\u003eOnohuean, H. and Igere, B.E., (2022). Occurrence, antibiotic susceptibility and genes encoding antibacterial resistance of Salmonella spp. and Escherichia coli from milk and meat sold in markets of Bushenyi District, Uganda. \u003cem\u003eMicrobiology insights\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e, p.11786361221088992. https://doi.org/10.1177/11786361221088992 \u003c/li\u003e\n \u003cli\u003eTroeger, C., Blacker, B.F., Khalil, I.A., Rao, P.C., Cao, S., Zimsen, S.R., Albertson, S.B., Stanaway, J.D., Deshpande, A., Abebe, Z. and Alvis-Guzman, N., 2018. Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for the Global Burden of Disease Study 2016. \u003cem\u003eThe Lancet Infectious Diseases\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(11), pp.1211-1228. https://doi.org/10.1016/S1473-3099(18)30362-1 \u003c/li\u003e\n \u003cli\u003eThiam, S., Diène, A.N., Fuhrimann, S., Winkler, M.S., Sy, I., Ndione, J.A., Schindler, C., Vounatsou, P., Utzinger, J., Faye, O. and Cissé, G., 2017. Prevalence of diarrhoea and risk factors among children under five years old in Mbour, Senegal: a cross-sectional study. \u003cem\u003eInfectious diseases of poverty\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(04), pp.43-54.\u003c/li\u003e\n \u003cli\u003eRobins-Browne, R.M., Holt, K.E., Ingle, D.J., Hocking, D.M., Yang, J. and Tauschek, M., 2016. Are Escherichia coli pathotypes still relevant in the era of whole-genome sequencing?. \u003cem\u003eFrontiers in cellular and infection microbiology\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e, p.141. https://doi.org/10.3389/fcimb.2016.00141 \u003c/li\u003e\n \u003cli\u003eAslam, M., Nattress, F., Greer, G., Yost, C., Gill, C. and McMullen, L., 2003. Origin of contamination and genetic diversity of Escherichia coli in beef cattle. \u003cem\u003eApplied and environmental microbiology\u003c/em\u003e, \u003cem\u003e69\u003c/em\u003e(5), pp.2794-2799. https://doi.org/10.1128/AEM.69.5.2794-2799.2003 \u003c/li\u003e\n \u003cli\u003eElder, R.O., Keen, J.E., Siragusa, G.R., Barkocy-Gallagher, G.A., Koohmaraie, M. and Laegreid, W.W., 2000. Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e, \u003cem\u003e97\u003c/em\u003e(7), pp.2999-3003. https://doi.org/10.1073/pnas.97.7.2999 \u003c/li\u003e\n \u003cli\u003eMidgley and Desmarchelier, 2001. Pre‐slaughter handling of cattle and Shiga toxin‐producing Escherichia coli (STEC). \u003cem\u003eLetters in Applied Microbiology\u003c/em\u003e, \u003cem\u003e32\u003c/em\u003e(5), pp.307-311. https://doi.org/10.1046/j.1472-765X.2001.00912.x \u003c/li\u003e\n \u003cli\u003eRice, D.H., Hancock, D.D., Vetter, R.L. and Besser, T.E., 1996. Escherichia coli O157 infection in a human linked to exposure to infected livestock.\u003c/li\u003e\n \u003cli\u003eShere, J.A., Bartlett, K.J. and Kaspar, C.W., 1998. Longitudinal study of Escherichia coli O157: H7 dissemination on four dairy farms in Wisconsin. \u003cem\u003eApplied and Environmental Microbiology\u003c/em\u003e, \u003cem\u003e64\u003c/em\u003e(4), pp.1390-1399. https://doi.org/10.1128/AEM.64.4.1390-1399.1998 \u003c/li\u003e\n \u003cli\u003eSaka HK, Dabo NT, Muhammad B, García-Soto S, Ugarte-Ruiz M and Alvarez J (2019) Diarrheagenic Escherichia coli Pathotypes From Children Younger Than 5 Years in Kano State, Nigeria. Front. Public Health 7:348. https://doi.org/10.3389/fpubh.2019.00348 \u003c/li\u003e\n \u003cli\u003eThystrup, C., Majowicz, S. E., Kitila, D. B., Desta, B. N., Fayemi, O. E., Ayolabi, C. I., ... \u0026amp; Pires, S. M. (2024). Etiology-specific incidence and mortality of diarrheal diseases in the African region: a systematic review and meta-analysis. \u003cem\u003eBMC Public Health\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e(1), 1864. https://mednexus.org/doi/epdf/10.1186/s40249-017-0323-1 \u003c/li\u003e\n \u003cli\u003eThystrup, C., Majowicz, S.E., Kitila, D.B., Desta, B.N., Fayemi, O.E., Ayolabi, C.I., Hugho, E., Buys, E.M., Akanni, G.B., Machava, N.E. and Monjane, C., 2024. Etiology-specific incidence and mortality of diarrheal diseases in the African region: a systematic review and meta-analysis. \u003cem\u003eBMC Public Health\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e(1), p.1864. https://doi.org/10.1186/s12889-024-19334-8 \u003c/li\u003e\n \u003cli\u003eTumusiime, S., Asimwe, J.B., Atuhaire, L., Wasswa, R., Nsimbe, D. and Kayera, B., 2024. Time to treatment-seeking by caretakers of children under-five with diarrhea and associated factors in Uganda: a multilevel proportional hazards analysis. \u003cem\u003eBMC pediatrics\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e(1), p.403. https://doi.org/10.1186/s12887-024-04879-9 \u003c/li\u003e\n \u003cli\u003eZelelie TZ, Eguale T, Yitayew B, Abeje D, Alemu A, Seman A, et al. (2023) Molecular epidemiology and antimicrobial susceptibility of diarrheagenic Escherichia coli isolated from children under age five with and without diarrhea in Central Ethiopia. PLoS ONE 18(7): e0288517. https://doi.org/10.1371/journal.pone.0288517 \u003c/li\u003e\n \u003cli\u003eKong YS, Horner P, Unemo M, Hocking JS. (2019).Pharmacokinetic considerations regarding the treatment of bacterial sexually transmitted infections with azithromycin: a review. J Antimicrob Chemother 2019; 74:1157–66. https://doi.org/10.1093/jac/dky548 \u003c/li\u003e\n \u003cli\u003ePeirano V, Bianco MN, NavarroA, Schelotto F, Varela G.(2018) . Diarrheagenic \u003cem\u003eEscherichia coli\u003c/em\u003e Associated with Acute Gastroenteritis in Children from Soriano, Uruguay, \u003cem\u003eCanadian Journal of Infectious Diseases and Medical Microbiology\u003c/em\u003e, 2018, 8387218, \u003cstrong\u003ehttps://doi.org/10.1155/2018/8387218\u003c/strong\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Escherichia coli, diarrheagenic, pathotype","lastPublishedDoi":"10.21203/rs.3.rs-7842018/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7842018/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: \u0026nbsp;Diarrheal diseases remain a global public health concern affecting children, with a high prevalence in resource-limited settings. In many poor nations, diarrheal diseases have been listed as 1 of the top 10 causes of mortality.\u003c/p\u003e\n\u003cp\u003eObjective: This study aimed to determine the prevalence and antibiotic susceptibility profiles of diarrheagenic \u003cem\u003eEscherichia coli\u003c/em\u003e (\u003cem\u003eE. coli\u003c/em\u003e) pathotypes with diarrhea using Polymerase Chain Reaction in Mbarara City.\u003c/p\u003e\n\u003cp\u003eMethodology: It was a cross section hospital-based study where 391 stool samples were collected from children aged six months and 12 years presenting with diarrhea and not taking any antibiotic treatment for diarrhea at the time of the investigation.\u003c/p\u003e\n\u003cp\u003eResults: Out of 391 stool samples collected, 78 were positive for \u003cem\u003eE. coli\u003c/em\u003egiving an overall prevalence of \u003cstrong\u003e19.95 %. \u003c/strong\u003eOf the 78 (19.95 %) positive samples, males were 18 (54.55%) and females were 25 (55.56%). \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eAmong the 78 \u003cem\u003eE. coli\u003c/em\u003e isolates still, 43 (55.13 %) were pathogenic and belonged to the three common pathotypes including Enteropathogenic E. \u003cem\u003ecoli\u003c/em\u003e (EPEC), which was the most prevalent pathotype (\u003cstrong\u003e86.05\u003c/strong\u003e%), followed by Enterohaemorrhagic \u003cem\u003eE\u003c/em\u003e.\u003cem\u003ecoli \u003c/em\u003e(EHEP) (9.30 %), while enter-invasive was the least (4.65\u003cstrong\u003e%).\u003c/strong\u003e The \u003cem\u003eE. coli\u003c/em\u003e isolates were most sensitive to chloramphenicol, followed by imipenem (70%), tetracycline (30%), ceftriaxone (28%) and amoxicillin (26%) was the most resistant\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Diarrheagenic \u003cem\u003eE. coli\u003c/em\u003e(DEC) is prevalent in Mbarara City and is an important agent that should be considered in routine studies and surveillance for childhood acute diarrheal disease.\u003c/p\u003e","manuscriptTitle":"Molecular Detection of Diarrheagenic Escherichia Coli Pathotypes Isolated From Children With Diarrhea in Mbarara City, South Western Uganda","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-08 12:29:32","doi":"10.21203/rs.3.rs-7842018/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-05T05:22:39+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-02T07:51:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"236592967274383725112987671573832825028","date":"2025-12-31T03:26:29+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-25T04:56:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"308177865250944381162198439487899749382","date":"2025-12-23T17:18:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"177963962892980872727859174752502368759","date":"2025-12-23T15:52:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"22039897091840153486182660897183761965","date":"2025-12-08T08:15:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"132438703877953111499780181801491995875","date":"2025-12-08T05:39:20+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-05T02:37:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-05T01:55:52+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-12-02T14:58:12+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-02T13:25:04+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2025-12-02T13:15:30+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c286c88c-2456-4107-aa80-342d779af3e7","owner":[],"postedDate":"December 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-02-03T17:39:26+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-08 12:29:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7842018","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7842018","identity":"rs-7842018","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.