SLC8A1 as a novel susceptibility gene in facilitating tendinopathy: Insights into Its Mechanisms from Mendelian Randomization and Experimental Validation

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background Patients with tendinopathy (TD) have expressed dissatisfaction with the efficacy of the first-line treatment, indomethacin. This research aims to identify key biomarkers in TD and investigate their underlying mechanisms. Methods Tendon samples were harvested from 5 SD rats exhibiting TD and 5 healthy normal controls (NCs), destined for transcriptome sequencing. After thorough preprocessing of the RNA sequencing data, a differential expression analysis was performed to identify genes that significantly differentiated the TD group from the NCs. To identify candidate genes, an intersection analysis was performed between the differentially expressed genes (DEGs) and the key module genes obtained through weighted gene co-expression network analysis. The candidate genes underwent Mendelian randomization (MR) analysis and least absolute shrinkage and selection operator analysis to identify key genes. We conducted experimental validation and sensitivity analyses, such as pleiotropy, heterogeneity, and leave-one-out evaluations, to ensure the robustness of our findings. Results The findings present new evidence indicating that SLC8A1 facilitates the progression of TD. MR analysis established a causal link between SLC8A1 and TD progression (p < 0.05). The study indicated that SLC8A1 might inhibit TD progression by negatively regulating gamma-glutamylisoleucine levels. In SD rats, TD led to a disordered arrangement of collagen structures, increased infiltration of inflammatory cells, increased cell density, and thicker inflammatory hyperplasia in tendon. These results confirm the effective creation of a TD model. Analysis showed significant upregulation of SLC8A1 expression in the TD group (p < 0.05). Conclusion This research highlights SLC8A1 as a potential biomarker in TD development, providing novel perspectives for clinical diagnosis and treatment strategies.
Full text 91,894 characters · extracted from preprint-html · click to expand
SLC8A1 as a novel susceptibility gene in facilitating tendinopathy: Insights into Its Mechanisms from Mendelian Randomization and Experimental Validation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article SLC8A1 as a novel susceptibility gene in facilitating tendinopathy: Insights into Its Mechanisms from Mendelian Randomization and Experimental Validation Junjie Tang, Ziqi Zhou, Weijie Wu, Peng Shen, Xinyuan Wu, Jianye Liu, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7266504/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Nov, 2025 Read the published version in Molecular Cytogenetics → Version 1 posted 9 You are reading this latest preprint version Abstract Background Patients with tendinopathy (TD) have expressed dissatisfaction with the efficacy of the first-line treatment, indomethacin. This research aims to identify key biomarkers in TD and investigate their underlying mechanisms. Methods Tendon samples were harvested from 5 SD rats exhibiting TD and 5 healthy normal controls (NCs), destined for transcriptome sequencing. After thorough preprocessing of the RNA sequencing data, a differential expression analysis was performed to identify genes that significantly differentiated the TD group from the NCs. To identify candidate genes, an intersection analysis was performed between the differentially expressed genes (DEGs) and the key module genes obtained through weighted gene co-expression network analysis. The candidate genes underwent Mendelian randomization (MR) analysis and least absolute shrinkage and selection operator analysis to identify key genes. We conducted experimental validation and sensitivity analyses, such as pleiotropy, heterogeneity, and leave-one-out evaluations, to ensure the robustness of our findings. Results The findings present new evidence indicating that SLC8A1 facilitates the progression of TD. MR analysis established a causal link between SLC8A1 and TD progression (p < 0.05). The study indicated that SLC8A1 might inhibit TD progression by negatively regulating gamma-glutamylisoleucine levels. In SD rats, TD led to a disordered arrangement of collagen structures, increased infiltration of inflammatory cells, increased cell density, and thicker inflammatory hyperplasia in tendon. These results confirm the effective creation of a TD model. Analysis showed significant upregulation of SLC8A1 expression in the TD group (p < 0.05). Conclusion This research highlights SLC8A1 as a potential biomarker in TD development, providing novel perspectives for clinical diagnosis and treatment strategies. Tendinopathy mendelian randomization SLC8A1 gamma − glutamylisoleucine achilles tendon injury Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Tendinopathy (TD) refers to a range of alterations that take place in injured and pathological tendons, resulting in pain and impaired function.( 1 ) Since the early 2000s, the global incidence of TD has increased, causing long-lasting or irreversible functional impairments affecting people of all age groups, whether they are athletes or not.( 2 ) TD frequently occurs in the limbs and constitutes 30%-50% of musculoskeletal and locomotor system diseases.( 3 ) Research has demonstrated that the effectiveness and evidence base for most treatment plans, such as NSAIDs and corticosteroids, targeting TD remain inadequate.( 4 , 5 ) As a result, early diagnosis and intervention are crucial for achieving full recovery from the condition.( 6 ) A significant gap remains in understanding the crucial genes and pathways involved in the early stages of TD.( 7 ) Identifying essential pathways that regulate extracellular matrix homeostasis in the early phase is imperative for designing targeted TD treatments. Consequently, there is an urgent need for more in-depth studies to clarify these hub genes. In recent years, transcriptome analysis via RNA sequencing has been widely applied to pinpoint target genes pertinent to the diagnosis and therapy of a spectrum of diseases, such as sports medicine-related diseases and conditions.( 8 – 10 ) This extensive utilization has consequently led to the amassing of substantial quantities of biological data.( 11 ) For this reason, we applied the RNA sequencing and public gene database to understand TD pathogenesis. Mendelian randomization (MR) uses genetic variants as instrumental variables to evaluate the causal link between an exposure and disease outcomes.( 12 ) If a causal link exists between the exposure and the outcome, genetic variants that are robustly linked to the exposure should also exhibit an association with the outcome. This method relies on the random distribution of genetic variants during meiosis, which more effectively minimizes residual confounding compared to traditional observational studies.( 13 ) Additionally, MR is less prone to reverse causality, as genetic variants are established at birth and typically remain stable regardless of subsequent occurrences. 2. Materials and methods Research design The research was divided into two primary sections. The initial section concentrated on Discovery and Validation, targeting the identification of intersecting genes within the IEU dataset, which encompasses Open genome-wide association studies (GWAS) and expression quantitative trait loci (eQTL). This effort successfully highlighted the SLC8A1 gene. The second section involved Potential Mechanisms, where statistical methods consisted of three stages. In the first stage, SLC8A1 was investigated as the exposure variable, with Achilles tendon injury serving as the outcome. During the second stage, 1400 metabolites were scrutinized as exposure variables, again with Achilles tendon injury as the outcome, which led to the detection of 59 significant metabolites. In the third and final stage, SLC8A1 was once more assessed as the exposure variable, while the 59 previously identified metabolites were examined as potential outcomes, revealing notable associations with gamma-glutamylisoleucine levels. Figure 1 presents the research design implemented in this research. Data sources The genetic data related to Achilles tendon injury and SLC8A1 eQTLs were sourced from the IEU Open GWAS project (available at https://gwas.mrcieu.ac.uk/ ). The specific datasets utilized were identified by the eQTL IDs ebi-a-GCST90018787 and eqtl-a-ENSG00000183023. Additionally, genetic data for 1,400 metabolites were retrieved from the GWAS Catalog online platform (accessible via https://www.ebi.ac.uk/gwas/ ), with the dataset ID GCST90199621 to GCST90201020. Instrumental variables (IVs) selection To broaden the range of potential SNPs, IVs were selected using a less stringent threshold (p < 1×10 − 5 ). The clumping process used a linkage disequilibrium (LD) threshold with a distance of 10,000 kb and an r² value of 0.001. To reduce the potential bias arising from weak IVs, SNPs with an F statistic less than 10 were omitted following individual calculations. The F statistic is determined by squaring the ratio of beta to its standard error (SE).( 14 ) MR analysis and sensitivity analysis A two-sample MR analysis was performed to explore potential causal relationships between various exposures and outcomes, employing five methods: inverse variance weighted (IVW), MR Egger regression, simple mode, weighted median, and weighted mode.( 15 ) The primary analysis utilized the IVW method, maintaining a significance threshold of p < 0.05. The study conducted sensitivity analyses, such as heterogeneity assessments, pleiotropy evaluations, and leave-one-out analysis, to ensure result robustness.( 16 ) These sensitivity analyses helped to validate the exclusivity assumption of the MR analysis. Transcriptome Sequencing (RNA sequence) The workflow for a reference-based transcriptome experiment includes enriching mRNA using mRNA Capture Beads. After purification with the beads, the mRNA is fragmented by exposure to high temperature. Subsequently, the fragmented mRNA acts as a template for the synthesis of the first cDNA strand within a reverse transcription reaction mixture. During the synthesis of the second cDNA strand, end repair and the addition of an A-tail are performed simultaneously. Following this, adapters are ligated to the cDNA, and the target fragments are purified using Hieff NGS®DNA Selection Beads. The purified fragments are then amplified by qRT-PCR to construct the sequencing library. Establishment of Tendinopathy Model Male Sprague-Dawley (SD) rats, aged 6 weeks, were obtained from the Experimental Animal Center of Nantong University. The rats were housed in a pathogen-free environment for two weeks. SD rats were stochastically assigned to either the Control or Tendinopathy group, with each group consisting of six rats. The animal experiment was conducted without blinding. The rats were acclimated for one week before receiving 60 µL injections of collagenase I (5 mg/mL) at the midpoint of the right Achilles tendon every 2 days. After 14 days, successful model establishment was confirmed through histological and clinical assessments.( 17 ) All surgical procedures and postoperative care for the animals complied with the National Research Council's Guide for the Care and Use of Laboratory Animals and received approval from the Nantong University Animal Research Ethics Committee. (S20220211-003). Histochemical Analysis Tendon samples, which were obtained from the Achilles tendons of SD rats, were immersed in 4% paraformaldehyde for 24 hours, followed by dehydration and embedding in paraffin. Paraffin sections of 5 µm thickness were prepared and stained using H&E and Masson's trichrome solutions (G1005/G1006, Servicebio, Wuhan, China). For immunohistochemistry, sections were blocked in solution for 2 hours at room temperature and subsequently incubated overnight at 4°C with anti-SLC8A1 antibodies (1:1000, 28447-1-AP, Proteintech, Wuhan, China). Staining was visualized with diaminobenzidine (P0203, Beyotime Biotechnology, Shanghai, China). Imaging was performed with a Leica DMi1 inverted phase-contrast microscope. Immunofluorescent staining The sections were permeabilized with 0.1% Triton X-100 in PBS for 15 minutes. After permeabilization, the sections were blocked using a 5% bovine serum albumin solution at ambient temperature for 1 hour. The sections were incubated overnight with primary antibodies targeting SLC8A1 (1:1000, 28447-1-AP, Proteintech, Wuhan, China). The following day, sections were incubated with goat anti-rabbit IgG H&L secondary antibodies for 2 hours at room temperature in a dark environment. Finally, the stained sections were observed using an Olympus fluorescence microscope. Western blotting Proteins were isolated from TD and NCs tissues with RIPA lysis buffer. Subsequently, proteins were separated using SDS-PAGE and transferred to a PVDF membrane. The membranes were blocked for 10 minutes at room temperature using NcmBlot blocking buffer (P30500, New Cell & Molecular Biotech, Suzhou, China). The membranes were incubated overnight at 4°C with primary antibodies against SLC8A1 and GAPDH, both at a 1:2000 dilution (Proteintech, Wuhan, China; catalog numbers 12359-1-AP and 60004-1-Ig, respectively). Immunoreactive bands were visualized using ECL reagents (P10300, New Cell & Molecular Biotech, Suzhou, China) following incubation with a secondary antibody. Each band's gray value was measured and quantified. Finally, the data were normalized and presented as a ratio relative to GAPDH. Real-time quantitative polymerase chain reaction (qRT-PCR) Total mRNA was isolated from TD and normal tendon tissues using the MiniBEST universal RNA extraction kit. The RNA was then reverse transcribed into cDNA utilizing the HiScript III RT SuperMix for qPCR (R323, Vazyme Biotech, Nanjing, China). For qRT-PCR analysis, the QuantStudio5 instrument was employed in combination with SYBR (G3326, Servicebio Biotech, Wuhan, China). The mRNA levels of target genes were normalized relative to GAPDH gene expression. Relative gene expression was quantified as the fold change over the control, calculated as 2 −ΔΔct .The primer sequences utilized for qRT-PCR are detailed below. GAPDH-F (from 5′ to 3′): GACATGCCGCCTGGAGAAAC GAPDH-R (from 5′ to 3′): AGCCCAGGATGCCCTTTAGT SLC8A1-F (from 5′ to 3′): CACCCAACACTGCCACCATAAC SLC8A1-R (from 5′ to 3′): GATGCCAATGCTCTCGCTCAC Statistical analysis Data analyses were performed using R 4.3.2 ( http://www.Rproject.org ) and GraphPad Prism 8.0, utilizing the 'Two Sample MR' package version 0.5.8. A p-value less than 0.05 indicated statistical significance. 3. Results MR analysis revealed that SLC8A1 facilitate progression of TD SLC8A1 was identified as the only gene with a causal association with TD across independent datasets from the IEU Open GWAS eQTLs. An MR analysis was conducted using the IEU Open GWAS eQTLs dataset, where the SLC8A1 eQTL was designated as the exposure and Achilles tendon injury was the outcome. Six SNPs were chosen as instrumental variables for the SLC8A1 eQTL, and the IVW estimates showing a positive association with TD progression. (OR = 1.084, p = 0.048, 95% CI = 1.001 to 1.175) (Fig. 2 ). The MR-Egger method showed no heterogeneity (p = 0.687) and no pleiotropy (p = 0.482). Figure S1 provides a detailed presentation of the forest plot, scatter plot, and leave-one-out analysis. Transcriptome sequencing data analysis confirmed that SLC8A1 promote TD progression Through transcriptome sequencing, we performed differential analysis on the sequencing results and generated volcano and heatmaps plots for the differential gene analysis (Fig. 3 A-B). (P.Value 0.585) The findings indicated a substantial rise in the expression of SLC8A1 in the TD group relative to the control group. (Fig. 3 C). Assessment of SLC8A1 expression in SD rat models This research effectively developed TD models using 6-week-old SD rats, confirmed by fundamental experiments. Gross observations revealed significant inflammation and tissue hyperplasia in the TD group. (Fig. 4 A) H&E staining and Masson’s trichrome staining further confirmed the inferior histological structure of tendon in TD group, as evidenced by increased infiltration of inflammatory cells, disordered arrangement of collagen structures and thicker inflammatory hyperplasia in tendon or peritendineum. (Fig. 4 B) The immunofluorescent staining revealed an increase in the number of SLC8A1 positive cells in TD group. (Fig. 4 C) Western blotting showed upward trend in SLC8A1 expression in the tendon tissues of TD rats. And SLC8A1 expression was evaluated via qRT-PCR, revealing a significant increase in the TD group compared to NCs (p < 0.05), as illustrated in Figs. 4 D and 4 E. SLC8A1 inhibited expression of the metabolite gamma − glutamylisoleucine Steps 2 and 3 were conducted to explore the potential mechanism of SLC8A1 in TD. Gamma-glutamylisoleucine was identified as a key metabolite candidate. Gamma-glutamylisoleucine is a dipeptide composed of γ-glutamate and isoleucine, which is a proteolytic product of larger proteins and belongs to the family of N-acyl-α-amino acids and their derivatives. Nine SNPs were chosen as instrumental variables, with SLC8A1 eQTL serving as the exposure and gamma-glutamylisoleucine levels as the outcome. The IVW-MR analysis revealed a causal association between the SLC8A1 eQTL from the IEU Open GWAS dataset and the metabolite levels of gamma-glutamylisoleucine. (OR = 0.929, p = 0.047, 95% CI = 0.864 to 0.999) (Fig. 5 ). Figure S2 provides a detailed presentation of the forest plot, scatter plot, and leave-one-out analysis. The metabolite gamma − glutamylisoleucine inhibited TD progression Employing 16 SNPs as instrumental variables for gamma-glutamylisoleucine levels, the IVW analysis identified a causal link between decreased gamma-glutamylisoleucine levels and TD (OR = 0.870, p = 0.016, 95%CI = 0.777 to 0.975) (Fig. 6 ). Further MR-Egger analysis validated the lack of heterogeneity (p = 0.564) and pleiotropy (p = 0.800). Detailed analyses, including the forest plot, scatter plot, and leave-one-out analysis, are presented in Figure S3 . Sensitivity analyses, including pleiotropy, heterogeneity, and leave-one-out assessments, confirmed the robustness of the findings. The findings suggest that the SLC8A1 eQTL influences TD progression by modulating gamma-glutamylisoleucine levels. (Fig. 7 ) 4. Discussion Currently, TD remains a significant challenge in the field of musculoskeletal disorders, characterized by its extensive prevalence, low cure rate, and substantial medical costs. Although some conservative treatments, such as rest, nonsteroidal anti-inflammatory medication, and physical therapy, can significantly alleviate symptoms of TD, there remains a shortage of therapies that can modify the underlying pathology of the condition.( 18 ) Meanwhile, MR, as a potent technique, has been extensively utilized across numerous diseases to identify new therapeutic targets and uncover underlying disease mechanisms.( 19 , 20 ) Nevertheless, to date, no MR studies that integrate GWAS and eQTL data specifically for TD have been published. Therefore, this article represents the inaugural effort to combine GWAS and eQTL data via the MR approach, aiming to pinpoint novel therapeutic targets and elucidate their potential metabolic mechanisms in TD. The findings indicate that genetic susceptibility to SLC8A1 may expedite TD progression, with MR analysis establishing a causal relationship between SLC8A1 and TD development. Further analysis showed that SLC8A1 reduces gamma-glutamylisoleucine levels, which are inversely related to the risk of TD. According to the above-mentioned relationships, we finally confirmed that a metabolic mechanism by which SLC8A1 may facilitate TD progression through the modulation of gamma-glutamylisoleucine levels. TD is a debilitating and painful disorder marked by degenerative alterations in the mechanical properties and cellular architecture of tendons, which can lead to tendon injury.( 21 ) The Achilles tendon injury is among the most frequently impacted tendons.( 22 , 23 ) It is a type of overuse injury that is diagnosed through clinical examination and can involve either the distal attachment or the middle section of the tendon.( 24 ) Histological characteristics of Achilles tendon injury involve disordered tendon structure, elevated and altered cellularity and vascularity, and are frequently associated with persistent inflammation. In TD, abnormal tissue remodeling disrupts collagen fiber orientation, mechanically weakening the tendon.( 25 ) To date, for patients who do not respond to non-invasive therapy, surgery becomes the ultimate option, yet it still cannot ensure clinical improvement.( 26 ) The suboptimal outcomes of TD treatment, whether through conservative or surgical approaches, may be partly due to the low number of tendon-forming cells and the scarcity of blood vessels.( 27 ) Consequently, it is imperative to explore and develop novel approaches to improve tendon repair and regeneration. In this study, we utilized MR analysis to pinpoint the novel susceptibility gene SLC8A1 in TD, thereby offering therapeutic targets for patients. The SLC8A1 gene encodes an NCX1 antiporter family protein, which facilitates calcium extrusion and is activated by protein phosphatase 2A.( 28 ) This protein facilitates the exchange of calcium and sodium ions, ensuring calcium homeostasis.( 29 ) Knowledge regarding the connection between the SLC8A1 gene and TD development is still restricted. However, recent studies have increasingly highlighted the significance of genes in diseases’ development. Li et al. demonstrated that circRNA_SLC8A1 promotes Mycobacterium tuberculosis survival in macrophages through the NFκB signaling pathway.( 30 ) Chu et al. found that SLC8A1 is suggested as a potential prognostic biomarker for immunotherapy in recurrent spontaneous abortion and uterine corpus endometrial carcinoma.( 31 ) Lin et al. revealed that Circ-SLC8A1 counteracts miR-516b-5p's suppression, thereby facilitating osteoporosis.( 32 ) To investigate the link between SLC8A1 expression and TD, we performed an extensive analysis across various disease categories using the TCGA database. Our study reveals significant SLC8A1 expression in TD patients, confirmed by MR analysis. The study indicates that gamma-glutamylisoleucine levels might inhibit TD progression. While metabolites such as creatinine, D-chiro-inositol, and high-density lipoprotein have shown significant associations with TD in some studies, research on metabolic gene expression and the role of metabolites in TD remains limited.( 33 , 34 ) Today, we have validated the possibility that gamma-glutamylisoleucine can inhibit the TD process through RNA sequencing, MR, and related experiments. Gamma-glutamylisoleucine is a dipeptide composed of γ-glutamate and isoleucine. It is a proteolytic product of larger proteins and belongs to the family of N-acyl-α-amino acids and their derivatives. Studies suggest that gamma-glutamylisoleucine may serve as a biomarker for a number of diseases. Thacker et al. demonstrated that gamma-glutamylisoleucine was reported as a potential biomarker for prostate cancer in HeLa cells.( 35 ) Shi et al. proposed that gamma-glutamylisoleucine was directly related to salt-sensitive hypertension by influencing the sodium content in the human body.( 36 ) Agarwal et al. revealed that type 2 diabetes in adolescents and DNA methylation are interconnected through the serum metabolite gamma-glutamylisoleucine.( 37 ) At the current stage, scholar’s research on gamma-glutamylisoleucine has further confirmed its promising prospects as an important metabolite in the body for influencing the progression of certain diseases. SLC8A1 potentially affects amino acid metabolism by altering collagen stability in vivo, notably by reducing gamma-glutamylisoleucine levels, which may facilitate TD progression. Disruptions in amino acid metabolism lead to reduction of intracellular oxidative stress, including cell viability, types of cell death, and intracellular ROS production.( 38 , 39 ) These alterations compromise the remodeling of the extracellular matrix in tendon tissue, increase oxidative stress, and thereby impair TD progression. However, this research is subject to certain limitations. Further in vivo and in vitro experiments, including cell-based validation of a specific gene in TD, require additional samples. Details will be provided in our forthcoming article. Conducting clinical trials in real-world settings is crucial to validate the involvement of SLC8A1 in TD. The analysis ultimately did not differentiate results based on etiology, such as repetitive strain or acute injury. Future studies should build on these findings through extensive experiments to further investigate SLC8A1's involvement in TD and explore potential therapeutic approaches. 5. Conclusion The research offers preliminary evidence indicating that SLC8A1 facilitates the progression of TD. Further MR analysis and basic experiments validate a causal relationship between SLC8A1 and TD evolution. Research indicates that SLC8A1 may downregulate gamma-glutamylisoleucine levels, both of which significantly contribute to TD progression. These findings introduce a new therapeutic target and lay the groundwork for future SLC8A1-related research in TD. Declarations Data Availability Data from the study is available upon request from the corresponding author, pending approval. Declaration of Interest The authors declare no conflicts of interest concerning this publication. They also confirm that the funding sources do not present any conflicts of interest. Authors’ Contributions Junjie Tang, Ziqi Zhou, and Weijie Wu had unrestricted access to the study data and ensured its integrity and accurate analysis. Peng Shen contributed to the study's conceptualization and design. Xinyuan Wu, and Jianye Liu provided literature support. Junjie Tang and Ziqi Zhou provided supervision and critically reviewed the manuscript. Junjie Tang and Weijie Wu participated in the drafting of the manuscript. All authors contributed to the review, revision, and final approval of the manuscript. Clinical trial number Not applicable. Ethics and Consent to Participate declarations: All surgical procedures and postoperative care for the animals complied with the National Research Council's Guide for the Care and Use of Laboratory Animals and received approval from the Nantong University Animal Research Ethics Committee. (S20220211-003). Funding This study was funded by Natural Science Foundation of Nantong (JC2023098). China Postdoctoral Science Foundation (2022M711718). Scientific Research Project of Nantong Commission of Health (MS2023022). Jiangsu Provincial Research Hospital (YJXYY202204). The authors and the funding source have no conflict of interest. References Millar NL, Silbernagel KG, Thorborg K, Kirwan PD, Galatz LM, Abrams GD et al. Tendinopathy Nat Reviews Disease Primers. 2021;7(1). Hopkins C, Fu S-C, Chua E, Hu X, Rolf C, Mattila VM, et al. Critical review on the socio-economic impact of tendinopathy. Asia-Pacific J Sports Med Arthrosc Rehabilitation Technol. 2016;4:9–20. Lui PPY, Maffulli N, Rolf C, Smith RKW. What are the validated animal models for tendinopathy? Scand J Med Sci Sports. 2011;21(1):3–17. Malliaras P. Physiotherapy management of Achilles tendinopathy. J Physiotherapy. 2022;68(4):221–37. Tang C, Wang Z, Xie Y, Fei Y, Luo J, Wang C et al. Classification of distinct tendinopathy subtypes for precision therapeutics. Nat Commun. 2024;15(1). Shim J, Pavlova AV, Moss RA, MacLean C, Brandie D, Mitchell L, et al. Patient ratings in exercise therapy for the management of tendinopathy: a systematic review with meta-analysis. Physiotherapy. 2023;120:78–94. Kang X, Tian B, Zhang L, Ge Z, Zhao Y, Zhang Y. Relationship of common variants in MPP7, TIMP2 and CASP8 genes with the risk of chronic achilles tendinopathy. Sci Rep. 2019;9(1). Cho N, Lee S-G, Kim JO, Kim Y-A, Kim E-M, Park C, et al. Identification of Differentially Expressed Genes Associated with Extracellular Matrix Degradation and Inflammatory Regulation in Calcific Tendinopathy Using RNA Sequencing. Calcif Tissue Int. 2020;107(5):489–98. Zhao Y, Lv J, Zhang H, Xie J, Dai H, Zhang X. Gene Expression Profiles Analyzed Using Integrating RNA Sequencing, and Microarray Reveals Increased Inflammatory Response, Proliferation, and Osteoclastogenesis in Pigmented Villonodular Synovitis. Front Immunol. 2021;12. Casamassimi A, Federico A, Rienzo M, Esposito S, Ciccodicola A. Transcriptome Profiling in Human Diseases: New Advances and Perspectives. Int J Mol Sci. 2017;18(8). Fu W, Yang R, Li J. Single-cell and spatial transcriptomics reveal changes in cell heterogeneity during progression of human tendinopathy. BMC Biol. 2023;21(1). Bowden J, Holmes MV. Meta-analysis andMendelianrandomization: A review. Res Synthesis Methods. 2019;10(4):486–96. Kuan V, Warwick A, Hingorani A, Tufail A, Cipriani V, Burgess S et al. Association of Smoking, Alcohol Consumption, Blood Pressure, Body Mass Index, and Glycemic Risk Factors With Age-Related Macular Degeneration. JAMA Ophthalmol. 2021;139(12). Zhang Y, Peng R, Chen Z, Zhang W, Liu Z, Xu S, et al. Evidence for a causal effect of major depressive disorder, anxiety on prostatitis risk: A univariate and multivariate Mendelian randomization study. Prostate. 2023;83(14):1387–92. He L, Yu T, Zhang W, Wang B, Ma Y, Li S. Causal Associations of Obesity With Achilles Tendinopathy: A Two-Sample Mendelian Randomization Study. Front Endocrinol. 2022;13. Burgess S, Bowden J, Fall T, Ingelsson E, Thompson SG. Sensitivity Analyses for Robust Causal Inference from Mendelian Randomization Analyses with Multiple Genetic Variants. Epidemiology. 2017;28(1):30–42. Chen M, Zou F, Wang P, Hu W, Shen P, Wu X, et al. Dual-Barb Microneedle with JAK/STAT Inhibitor‐Loaded Nanovesicles Encapsulation for Tendinopathy. Adv Healthc Mater. 2024;13:28. Vicenzino B, Tendinopathy. Evidence-Informed Physical Therapy Clinical Reasoning. J Orthop Sports Phys Therapy. 2015;45(11):816–8. Lin Y-L, Yao T, Wang Y-W, Zhou Z-X, Hong Z-C, Shen Y, et al. Potential drug targets for gastroesophageal reflux disease and Barrett’s esophagus identified through Mendelian randomization analysis. J Hum Genet. 2024;69(6):245–53. Zheng G, Chattopadhyay S, Sundquist J, Sundquist K, Ji J. Antihypertensive drug targets and breast cancer risk: a two-sample Mendelian randomization study. Eur J Epidemiol. 2024;39(5):535–48. Ilaltdinov AW, Gong Y, Leong DJ, Gruson KI, Zheng D, Fung DT, et al. Advances in the development of gene therapy, noncoding RNA, and exosome-based treatments for tendinopathy. Ann N Y Acad Sci. 2020;1490(1):3–12. Linsell L, Dawson J, Zondervan K, Rose P, Randall T, Fitzpatrick R, Carr A. Prevalence and incidence of adults consulting for shoulder conditions in UK primary care; patterns of diagnosis and referral. Rheumatology. 2006;45(2):215–21. Riel H, Lindstrøm CF, Rathleff MS, Jensen MB, Olesen JL. Prevalence and incidence rate of lower-extremity tendinopathies in a Danish general practice: a registry-based study. BMC Musculoskelet Disord. 2019;20(1). Cook JL, Purdam CR. Is tendon pathology a continuum? A pathology model to explain the clinical presentation of load-induced tendinopathy. Br J Sports Med. 2009;43(6):409–16. Achilles tendinopathy. Nat Reviews Disease Primers. 2025;11(1). Maffulli N, Longo UG, Kadakia A, Spiezia F. Achilles tendinopathy. Foot Ankle Surg. 2020;26(3):240–9. Watanabe G, Yamamoto M, Taniguchi S, Sugiyama Y, Hirouchi H, Ishizuka S et al. Chronological Changes in the Expression and Localization of Sox9 between Achilles Tendon Injury and Functional Recovery in Mice. Int J Mol Sci. 2023;24(14). Proteau S, Krossa I, Husser C, Guéguinou M, Sella F, Bille K et al. LKB1-SIK2 loss drives uveal melanoma proliferation and hypersensitivity to SLC8A1 and ROS inhibition. EMBO Mol Med. 2023;15(12). Laurino S, Russi S, Sabato C, Luongo M, Laurenziello P, Vagliasindi A et al. The inhibition of SLC8A1 promotes Ca2+-dependent cell death in Gastric Cancer. Biomed Pharmacother. 2025;182. Li Z, Gao Y, Zhang B, Dong W, Xi Y, Li Y, Cui J. circRNA_SLC8A1 promotes the survival of mycobacterium tuberculosis in macrophages by upregulating expression of autophagy-related protein SQSTM1/p62 to activate the NF-κB pathway. Sci Rep. 2024;14(1). Chu J-j, Qin X-j, Chen W, Xu Z, Xu X-j. SLC8A1, a novel prognostic biomarker and immunotherapy target in RSA and UCEC based on scRNA-seq and pan-cancer analysis. Heliyon. 2024;10(17). Lin C, Zhong W, Yan W, Yang J, Zheng W, Wu Q. Circ-SLC8A1 regulates osteoporosis through blocking the inhibitory effect of miR‐516b‐5p on AKAP2 expression. J Gene Med. 2020;22(11). Tilley BJ, Cook JL, Docking SI, Gaida JE. Is higher serum cholesterol associated with altered tendon structure or tendon pain? A systematic review. Br J Sports Med. 2015;49(23):1504–9. Sikes KJ, McConnell A, Serkova N, Cole B, Frisbie D. Untargeted metabolomics analysis identifies creatine, myo-inositol, and lipid pathway modulation in a murine model of tendinopathy. J Orthop Res. 2021;40(4):965–76. Thacker JB, He C, Pennathur S. Quantitative analysis of γ-glutamylisoleucine, γ‐glutamylthreonine, and γ‐glutamylvaline in HeLa cells using UHPLC‐MS/MS. J Sep Sci. 2021;44(15):2898–907. Shi M, He J, Li C, Lu X, He WJ, Cao J, et al. Metabolomics study of blood pressure salt-sensitivity and hypertension. Nutr Metabolism Cardiovasc Dis. 2022;32(7):1681–92. Agarwal P, Wicklow BA, Dart AB, Hizon NA, Sellers EAC, McGavock JM et al. Integrative analysis reveals novel associations between DNA methylation and the serum metabolome of adolescents with type 2 diabetes: A cross-sectional study. Front Endocrinol. 2022;13. Kim RJ, Hah Y-S, Gwark J-Y, Park HB. N-acetylcysteine reduces glutamate-induced cytotoxicity to fibroblasts of rat supraspinatus tendons. Connect Tissue Res. 2019;60(5):431–43. Furuta H, Yamada M, Nagashima T, Matsuda S, Nagayasu K, Shirakawa H, Kaneko S. Increased expression of glutathione peroxidase 3 prevents tendinopathy by suppressing oxidative stress. Front Pharmacol. 2023;14. Additional Declarations No competing interests reported. Supplementary Files FigureS1.tif FigureS2.tif FigureS3.tif SupplementMaterial.docx Cite Share Download PDF Status: Published Journal Publication published 19 Nov, 2025 Read the published version in Molecular Cytogenetics → Version 1 posted Editorial decision: Revision requested 21 Sep, 2025 Reviews received at journal 20 Sep, 2025 Reviews received at journal 12 Sep, 2025 Reviewers agreed at journal 09 Sep, 2025 Reviewers agreed at journal 11 Aug, 2025 Reviewers invited by journal 11 Aug, 2025 Editor assigned by journal 06 Aug, 2025 Submission checks completed at journal 06 Aug, 2025 First submitted to journal 31 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7266504","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":501852637,"identity":"9a184bb4-b0d1-4021-83f2-dde7f33c4e79","order_by":0,"name":"Junjie Tang","email":"","orcid":"","institution":"Affiliated Hospital of Nantong University, Medical School of Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Junjie","middleName":"","lastName":"Tang","suffix":""},{"id":501852638,"identity":"e13a004d-9d4e-48b5-8858-2fe48f2f9081","order_by":1,"name":"Ziqi Zhou","email":"","orcid":"","institution":"Affiliated Hospital of Nantong University, Medical School of Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Ziqi","middleName":"","lastName":"Zhou","suffix":""},{"id":501852639,"identity":"ea7cf887-4208-4e77-b5c5-684e06d1c473","order_by":2,"name":"Weijie Wu","email":"","orcid":"","institution":"Affiliated Hospital of Nantong University, Medical School of Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Weijie","middleName":"","lastName":"Wu","suffix":""},{"id":501852640,"identity":"076927cd-cf20-4994-b8b0-2ea9bf4639b6","order_by":3,"name":"Peng Shen","email":"","orcid":"","institution":"Affiliated Hospital of Nantong University, Medical School of Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Shen","suffix":""},{"id":501852641,"identity":"ae56ed30-7a3c-4d49-a931-70b1fa95ee2d","order_by":4,"name":"Xinyuan Wu","email":"","orcid":"","institution":"Affiliated Hospital of Nantong University, Medical School of Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Xinyuan","middleName":"","lastName":"Wu","suffix":""},{"id":501852642,"identity":"38988fd9-84dd-4066-851e-03cac808d25c","order_by":5,"name":"Jianye Liu","email":"","orcid":"","institution":"Affiliated Hospital of Nantong University, Medical School of Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Jianye","middleName":"","lastName":"Liu","suffix":""},{"id":501852646,"identity":"d461f212-1dd9-4b8b-88e2-1e9f713e7bce","order_by":6,"name":"Minhao Chen","email":"","orcid":"","institution":"Affiliated Hospital of Nantong University, Medical School of Nantong University","correspondingAuthor":false,"prefix":"","firstName":"Minhao","middleName":"","lastName":"Chen","suffix":""},{"id":501852647,"identity":"d454b5fa-a7be-438d-a63e-e633200d72cd","order_by":7,"name":"Hua Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYFACHgjFD8TMpGgxYJBsgGrhIVqLwQFitRjcyD0m8XPHn8TNN5IPfi5guCNnT0iL5Iy8NMneMwaJ226kJUvPYHhmTNAWfokcMwneNpCWHANpHobDiT2EtLABtUj+BWrZPCP/82+glnqCWkC2SINs2SCRwwayJYGgwyR73hhby7YZG88488zMmsfgsGHPAQJaDI7nGN582yYn29+e/Pg2T8VhefYGQtbAgUACyASilYMAPyEHjYJRMApGwYgFAAx1OpsxSn0LAAAAAElFTkSuQmCC","orcid":"","institution":"Affiliated Hospital of Nantong University, Medical School of Nantong University","correspondingAuthor":true,"prefix":"","firstName":"Hua","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2025-08-01 02:08:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7266504/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7266504/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13039-025-00738-z","type":"published","date":"2025-11-19T15:58:27+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":89385362,"identity":"39c9ff9f-e8e1-4a3a-8191-572bbb80f8aa","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2092752,"visible":true,"origin":"","legend":"\u003cp\u003eThe detailed study design of this study.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/ec5c854c1824017257748c29.png"},{"id":89387472,"identity":"c9d86de9-a6c5-4e8c-af29-8f2566d8ce17","added_by":"auto","created_at":"2025-08-19 12:38:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":584444,"visible":true,"origin":"","legend":"\u003cp\u003eMR analysis demonstrated that genetic susceptibility to SLC8A1 eQTL may accelerate TD progression.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/fd8397876781a8167a3fd4cc.png"},{"id":89385371,"identity":"73d306a7-6208-4cc4-87e1-b14d1db0fb6d","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":676893,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptome sequencing data analysis confirmed that genetic susceptibility to SLC8A1 eQTL contributed to TD progression.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/5d4912c34a1c81a681db9746.png"},{"id":89385382,"identity":"73efbda2-166f-4ae9-9928-84ba034fbccb","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":7636268,"visible":true,"origin":"","legend":"\u003cp\u003eThe experiments verified that SLC8A1 promoted progression of TD. A) Photos of the Achilles tendon in control and tendinopathy groups. B) H\u0026amp;E and Masson’s staining for control and TD tendon. Scale bar: 200 μm. C) Immunofluorescence staining for SLC8A1 in control and TD tissues. Scale bar: 100 μm. D) Western blotting was used to detect SLC8A1 protein levels in tendon tissues of the normal group and TD group. E) qRT-PCR analysis of the mRNA expression of SLC8A1 in TD groups. *P \u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/077bf3910a218b022c8020d3.png"},{"id":89385392,"identity":"54031b07-3539-4406-aaf6-db7a9eeacc5c","added_by":"auto","created_at":"2025-08-19 12:30:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":642309,"visible":true,"origin":"","legend":"\u003cp\u003eMR analysis showed that genetic susceptibility to SLC8A1 eQTL was associated with reduced levels of gamma−glutamylisoleucine.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/5da786740cf5f55c2255ad8d.png"},{"id":89385373,"identity":"81f3a5c6-b379-42ee-bf5c-7fcb82c8552e","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":637410,"visible":true,"origin":"","legend":"\u003cp\u003eMR analysis revealed that genetic susceptibility to levels of gamma−glutamylisoleucine metabolite may mitigate the progression of TD\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/f52c9f1f6541ce3f7780a148.png"},{"id":89385368,"identity":"6d464cf9-069b-45d2-875b-c885723452e8","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":315176,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the potential mechanism.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/c7e8663135c1d0c6dda1a6bf.png"},{"id":96651327,"identity":"241188f9-5f01-4792-99df-489ab59676f7","added_by":"auto","created_at":"2025-11-24 16:14:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16804380,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/966d99dc-60e8-4ca3-9f5c-a67db07f87a7.pdf"},{"id":89385367,"identity":"e99e7d51-a03e-4a64-af9d-57d8694cbc39","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":8011314,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/945372127ae2a835a5a2bf29.tif"},{"id":89385375,"identity":"03951975-c8f3-4f69-b823-263e452237c8","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":8011314,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/206acaabcfbe1743b8784539.tif"},{"id":89385376,"identity":"ac7d3da1-7706-4301-8211-d20c740895f1","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":8011314,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/f262b633c0fe1c60dfd9b7da.tif"},{"id":89385363,"identity":"d70a3f56-3cef-4bee-a857-f2b4bb06b08d","added_by":"auto","created_at":"2025-08-19 12:30:34","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":16369,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-7266504/v1/447e9e960c972c7fff7d3426.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"SLC8A1 as a novel susceptibility gene in facilitating tendinopathy: Insights into Its Mechanisms from Mendelian Randomization and Experimental Validation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eTendinopathy (TD) refers to a range of alterations that take place in injured and pathological tendons, resulting in pain and impaired function.(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) Since the early 2000s, the global incidence of TD has increased, causing long-lasting or irreversible functional impairments affecting people of all age groups, whether they are athletes or not.(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) TD frequently occurs in the limbs and constitutes 30%-50% of musculoskeletal and locomotor system diseases.(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) Research has demonstrated that the effectiveness and evidence base for most treatment plans, such as NSAIDs and corticosteroids, targeting TD remain inadequate.(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e) As a result, early diagnosis and intervention are crucial for achieving full recovery from the condition.(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) A significant gap remains in understanding the crucial genes and pathways involved in the early stages of TD.(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e) Identifying essential pathways that regulate extracellular matrix homeostasis in the early phase is imperative for designing targeted TD treatments. Consequently, there is an urgent need for more in-depth studies to clarify these hub genes.\u003c/p\u003e\u003cp\u003eIn recent years, transcriptome analysis via RNA sequencing has been widely applied to pinpoint target genes pertinent to the diagnosis and therapy of a spectrum of diseases, such as sports medicine-related diseases and conditions.(\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e) This extensive utilization has consequently led to the amassing of substantial quantities of biological data.(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e) For this reason, we applied the RNA sequencing and public gene database to understand TD pathogenesis.\u003c/p\u003e\u003cp\u003eMendelian randomization (MR) uses genetic variants as instrumental variables to evaluate the causal link between an exposure and disease outcomes.(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e) If a causal link exists between the exposure and the outcome, genetic variants that are robustly linked to the exposure should also exhibit an association with the outcome. This method relies on the random distribution of genetic variants during meiosis, which more effectively minimizes residual confounding compared to traditional observational studies.(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e) Additionally, MR is less prone to reverse causality, as genetic variants are established at birth and typically remain stable regardless of subsequent occurrences.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cp\u003e\u003cb\u003eResearch design\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe research was divided into two primary sections. The initial section concentrated on Discovery and Validation, targeting the identification of intersecting genes within the IEU dataset, which encompasses Open genome-wide association studies (GWAS) and expression quantitative trait loci (eQTL). This effort successfully highlighted the SLC8A1 gene. The second section involved Potential Mechanisms, where statistical methods consisted of three stages. In the first stage, SLC8A1 was investigated as the exposure variable, with Achilles tendon injury serving as the outcome. During the second stage, 1400 metabolites were scrutinized as exposure variables, again with Achilles tendon injury as the outcome, which led to the detection of 59 significant metabolites. In the third and final stage, SLC8A1 was once more assessed as the exposure variable, while the 59 previously identified metabolites were examined as potential outcomes, revealing notable associations with gamma-glutamylisoleucine levels. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e presents the research design implemented in this research.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eData sources\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe genetic data related to Achilles tendon injury and SLC8A1 eQTLs were sourced from the IEU Open GWAS project (available at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://gwas.mrcieu.ac.uk/\u003c/span\u003e\u003cspan address=\"https://gwas.mrcieu.ac.uk/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The specific datasets utilized were identified by the eQTL IDs ebi-a-GCST90018787 and eqtl-a-ENSG00000183023. Additionally, genetic data for 1,400 metabolites were retrieved from the GWAS Catalog online platform (accessible via \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/gwas/\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/gwas/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), with the dataset ID GCST90199621 to GCST90201020.\u003c/p\u003e\u003cp\u003e\u003cb\u003eInstrumental variables (IVs) selection\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo broaden the range of potential SNPs, IVs were selected using a less stringent threshold (p\u0026thinsp;\u0026lt;\u0026thinsp;1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e). The clumping process used a linkage disequilibrium (LD) threshold with a distance of 10,000 kb and an r\u0026sup2; value of 0.001. To reduce the potential bias arising from weak IVs, SNPs with an F statistic less than 10 were omitted following individual calculations. The F statistic is determined by squaring the ratio of beta to its standard error (SE).(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e)\u003c/p\u003e\u003cp\u003e\u003cb\u003eMR analysis and sensitivity analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA two-sample MR analysis was performed to explore potential causal relationships between various exposures and outcomes, employing five methods: inverse variance weighted (IVW), MR Egger regression, simple mode, weighted median, and weighted mode.(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e) The primary analysis utilized the IVW method, maintaining a significance threshold of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The study conducted sensitivity analyses, such as heterogeneity assessments, pleiotropy evaluations, and leave-one-out analysis, to ensure result robustness.(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) These sensitivity analyses helped to validate the exclusivity assumption of the MR analysis.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTranscriptome Sequencing (RNA sequence)\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe workflow for a reference-based transcriptome experiment includes enriching mRNA using mRNA Capture Beads. After purification with the beads, the mRNA is fragmented by exposure to high temperature. Subsequently, the fragmented mRNA acts as a template for the synthesis of the first cDNA strand within a reverse transcription reaction mixture. During the synthesis of the second cDNA strand, end repair and the addition of an A-tail are performed simultaneously. Following this, adapters are ligated to the cDNA, and the target fragments are purified using Hieff NGS\u0026reg;DNA Selection Beads. The purified fragments are then amplified by qRT-PCR to construct the sequencing library.\u003c/p\u003e\u003cp\u003e\u003cb\u003eEstablishment of Tendinopathy Model\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMale Sprague-Dawley (SD) rats, aged 6 weeks, were obtained from the Experimental Animal Center of Nantong University. The rats were housed in a pathogen-free environment for two weeks. SD rats were stochastically assigned to either the Control or Tendinopathy group, with each group consisting of six rats. The animal experiment was conducted without blinding. The rats were acclimated for one week before receiving 60 \u0026micro;L injections of collagenase I (5 mg/mL) at the midpoint of the right Achilles tendon every 2 days. After 14 days, successful model establishment was confirmed through histological and clinical assessments.(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e) All surgical procedures and postoperative care for the animals complied with the National Research Council's Guide for the Care and Use of Laboratory Animals and received approval from the Nantong University Animal Research Ethics Committee. (S20220211-003).\u003c/p\u003e\u003cp\u003e\u003cb\u003eHistochemical Analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTendon samples, which were obtained from the Achilles tendons of SD rats, were immersed in 4% paraformaldehyde for 24 hours, followed by dehydration and embedding in paraffin. Paraffin sections of 5 \u0026micro;m thickness were prepared and stained using H\u0026amp;E and Masson's trichrome solutions (G1005/G1006, Servicebio, Wuhan, China). For immunohistochemistry, sections were blocked in solution for 2 hours at room temperature and subsequently incubated overnight at 4\u0026deg;C with anti-SLC8A1 antibodies (1:1000, 28447-1-AP, Proteintech, Wuhan, China). Staining was visualized with diaminobenzidine (P0203, Beyotime Biotechnology, Shanghai, China). Imaging was performed with a Leica DMi1 inverted phase-contrast microscope.\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunofluorescent staining\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe sections were permeabilized with 0.1% Triton X-100 in PBS for 15 minutes. After permeabilization, the sections were blocked using a 5% bovine serum albumin solution at ambient temperature for 1 hour. The sections were incubated overnight with primary antibodies targeting SLC8A1 (1:1000, 28447-1-AP, Proteintech, Wuhan, China). The following day, sections were incubated with goat anti-rabbit IgG H\u0026amp;L secondary antibodies for 2 hours at room temperature in a dark environment. Finally, the stained sections were observed using an Olympus fluorescence microscope.\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern blotting\u003c/b\u003e\u003c/p\u003e\u003cp\u003eProteins were isolated from TD and NCs tissues with RIPA lysis buffer. Subsequently, proteins were separated using SDS-PAGE and transferred to a PVDF membrane. The membranes were blocked for 10 minutes at room temperature using NcmBlot blocking buffer (P30500, New Cell \u0026amp; Molecular Biotech, Suzhou, China). The membranes were incubated overnight at 4\u0026deg;C with primary antibodies against SLC8A1 and GAPDH, both at a 1:2000 dilution (Proteintech, Wuhan, China; catalog numbers 12359-1-AP and 60004-1-Ig, respectively). Immunoreactive bands were visualized using ECL reagents (P10300, New Cell \u0026amp; Molecular Biotech, Suzhou, China) following incubation with a secondary antibody. Each band's gray value was measured and quantified. Finally, the data were normalized and presented as a ratio relative to GAPDH.\u003c/p\u003e\u003cp\u003e\u003cb\u003eReal-time quantitative polymerase chain reaction (qRT-PCR)\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal mRNA was isolated from TD and normal tendon tissues using the MiniBEST universal RNA extraction kit. The RNA was then reverse transcribed into cDNA utilizing the HiScript III RT SuperMix for qPCR (R323, Vazyme Biotech, Nanjing, China). For qRT-PCR analysis, the QuantStudio5 instrument was employed in combination with SYBR (G3326, Servicebio Biotech, Wuhan, China). The mRNA levels of target genes were normalized relative to GAPDH gene expression. Relative gene expression was quantified as the fold change over the control, calculated as 2\u003csup\u003e\u0026minus;ΔΔct\u003c/sup\u003e.The primer sequences utilized for qRT-PCR are detailed below.\u003c/p\u003e\u003cp\u003eGAPDH-F (from 5\u0026prime; to 3\u0026prime;): GACATGCCGCCTGGAGAAAC\u003c/p\u003e\u003cp\u003eGAPDH-R (from 5\u0026prime; to 3\u0026prime;): AGCCCAGGATGCCCTTTAGT\u003c/p\u003e\u003cp\u003eSLC8A1-F (from 5\u0026prime; to 3\u0026prime;): CACCCAACACTGCCACCATAAC\u003c/p\u003e\u003cp\u003eSLC8A1-R (from 5\u0026prime; to 3\u0026prime;): GATGCCAATGCTCTCGCTCAC\u003c/p\u003e\u003cp\u003e\u003cb\u003eStatistical analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eData analyses were performed using R 4.3.2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.Rproject.org\u003c/span\u003e\u003cspan address=\"http://www.Rproject.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and GraphPad Prism 8.0, utilizing the 'Two Sample MR' package version 0.5.8. A p-value less than 0.05 indicated statistical significance.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cb\u003eMR analysis revealed that SLC8A1 facilitate progression of TD\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSLC8A1 was identified as the only gene with a causal association with TD across independent datasets from the IEU Open GWAS eQTLs. An MR analysis was conducted using the IEU Open GWAS eQTLs dataset, where the SLC8A1 eQTL was designated as the exposure and Achilles tendon injury was the outcome. Six SNPs were chosen as instrumental variables for the SLC8A1 eQTL, and the IVW estimates showing a positive association with TD progression. (OR\u0026thinsp;=\u0026thinsp;1.084, p\u0026thinsp;=\u0026thinsp;0.048, 95% CI\u0026thinsp;=\u0026thinsp;1.001 to 1.175) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The MR-Egger method showed no heterogeneity (p\u0026thinsp;=\u0026thinsp;0.687) and no pleiotropy (p\u0026thinsp;=\u0026thinsp;0.482). \u003cb\u003eFigure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e provides a detailed presentation of the forest plot, scatter plot, and leave-one-out analysis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTranscriptome sequencing data analysis confirmed that SLC8A1 promote TD progression\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThrough transcriptome sequencing, we performed differential analysis on the sequencing results and generated volcano and heatmaps plots for the differential gene analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). (P.Value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |logFC)| \u0026gt;0.585) The findings indicated a substantial rise in the expression of SLC8A1 in the TD group relative to the control group. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAssessment of SLC8A1 expression in SD rat models\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThis research effectively developed TD models using 6-week-old SD rats, confirmed by fundamental experiments. Gross observations revealed significant inflammation and tissue hyperplasia in the TD group. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) H\u0026amp;E staining and Masson\u0026rsquo;s trichrome staining further confirmed the inferior histological structure of tendon in TD group, as evidenced by increased infiltration of inflammatory cells, disordered arrangement of collagen structures and thicker inflammatory hyperplasia in tendon or peritendineum. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) The immunofluorescent staining revealed an increase in the number of SLC8A1 positive cells in TD group. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) Western blotting showed upward trend in SLC8A1 expression in the tendon tissues of TD rats. And SLC8A1 expression was evaluated via qRT-PCR, revealing a significant increase in the TD group compared to NCs (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), as illustrated in Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eSLC8A1 inhibited expression of the metabolite gamma\u0026thinsp;\u0026minus;\u0026thinsp;glutamylisoleucine\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSteps 2 and 3 were conducted to explore the potential mechanism of SLC8A1 in TD. Gamma-glutamylisoleucine was identified as a key metabolite candidate. Gamma-glutamylisoleucine is a dipeptide composed of γ-glutamate and isoleucine, which is a proteolytic product of larger proteins and belongs to the family of N-acyl-α-amino acids and their derivatives. Nine SNPs were chosen as instrumental variables, with SLC8A1 eQTL serving as the exposure and gamma-glutamylisoleucine levels as the outcome. The IVW-MR analysis revealed a causal association between the SLC8A1 eQTL from the IEU Open GWAS dataset and the metabolite levels of gamma-glutamylisoleucine. (OR\u0026thinsp;=\u0026thinsp;0.929, p\u0026thinsp;=\u0026thinsp;0.047, 95% CI\u0026thinsp;=\u0026thinsp;0.864 to 0.999) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). \u003cb\u003eFigure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e\u003c/b\u003e provides a detailed presentation of the forest plot, scatter plot, and leave-one-out analysis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe metabolite gamma\u0026thinsp;\u0026minus;\u0026thinsp;glutamylisoleucine inhibited TD progression\u003c/b\u003e\u003c/p\u003e\u003cp\u003eEmploying 16 SNPs as instrumental variables for gamma-glutamylisoleucine levels, the IVW analysis identified a causal link between decreased gamma-glutamylisoleucine levels and TD (OR\u0026thinsp;=\u0026thinsp;0.870, p\u0026thinsp;=\u0026thinsp;0.016, 95%CI\u0026thinsp;=\u0026thinsp;0.777 to 0.975) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Further MR-Egger analysis validated the lack of heterogeneity (p\u0026thinsp;=\u0026thinsp;0.564) and pleiotropy (p\u0026thinsp;=\u0026thinsp;0.800). Detailed analyses, including the forest plot, scatter plot, and leave-one-out analysis, are presented in \u003cb\u003eFigure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e\u003c/b\u003e. Sensitivity analyses, including pleiotropy, heterogeneity, and leave-one-out assessments, confirmed the robustness of the findings.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe findings suggest that the SLC8A1 eQTL influences TD progression by modulating gamma-glutamylisoleucine levels. (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e)\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eCurrently, TD remains a significant challenge in the field of musculoskeletal disorders, characterized by its extensive prevalence, low cure rate, and substantial medical costs. Although some conservative treatments, such as rest, nonsteroidal anti-inflammatory medication, and physical therapy, can significantly alleviate symptoms of TD, there remains a shortage of therapies that can modify the underlying pathology of the condition.(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) Meanwhile, MR, as a potent technique, has been extensively utilized across numerous diseases to identify new therapeutic targets and uncover underlying disease mechanisms.(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e) Nevertheless, to date, no MR studies that integrate GWAS and eQTL data specifically for TD have been published. Therefore, this article represents the inaugural effort to combine GWAS and eQTL data via the MR approach, aiming to pinpoint novel therapeutic targets and elucidate their potential metabolic mechanisms in TD.\u003c/p\u003e\u003cp\u003eThe findings indicate that genetic susceptibility to SLC8A1 may expedite TD progression, with MR analysis establishing a causal relationship between SLC8A1 and TD development. Further analysis showed that SLC8A1 reduces gamma-glutamylisoleucine levels, which are inversely related to the risk of TD. According to the above-mentioned relationships, we finally confirmed that a metabolic mechanism by which SLC8A1 may facilitate TD progression through the modulation of gamma-glutamylisoleucine levels.\u003c/p\u003e\u003cp\u003eTD is a debilitating and painful disorder marked by degenerative alterations in the mechanical properties and cellular architecture of tendons, which can lead to tendon injury.(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e) The Achilles tendon injury is among the most frequently impacted tendons.(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e) It is a type of overuse injury that is diagnosed through clinical examination and can involve either the distal attachment or the middle section of the tendon.(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e) Histological characteristics of Achilles tendon injury involve disordered tendon structure, elevated and altered cellularity and vascularity, and are frequently associated with persistent inflammation. In TD, abnormal tissue remodeling disrupts collagen fiber orientation, mechanically weakening the tendon.(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e) To date, for patients who do not respond to non-invasive therapy, surgery becomes the ultimate option, yet it still cannot ensure clinical improvement.(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e) The suboptimal outcomes of TD treatment, whether through conservative or surgical approaches, may be partly due to the low number of tendon-forming cells and the scarcity of blood vessels.(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e) Consequently, it is imperative to explore and develop novel approaches to improve tendon repair and regeneration. In this study, we utilized MR analysis to pinpoint the novel susceptibility gene SLC8A1 in TD, thereby offering therapeutic targets for patients.\u003c/p\u003e\u003cp\u003eThe SLC8A1 gene encodes an NCX1 antiporter family protein, which facilitates calcium extrusion and is activated by protein phosphatase 2A.(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e) This protein facilitates the exchange of calcium and sodium ions, ensuring calcium homeostasis.(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e) Knowledge regarding the connection between the SLC8A1 gene and TD development is still restricted. However, recent studies have increasingly highlighted the significance of genes in diseases\u0026rsquo; development. Li et al. demonstrated that circRNA_SLC8A1 promotes Mycobacterium tuberculosis survival in macrophages through the NFκB signaling pathway.(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e) Chu et al. found that SLC8A1 is suggested as a potential prognostic biomarker for immunotherapy in recurrent spontaneous abortion and uterine corpus endometrial carcinoma.(\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e) Lin et al. revealed that Circ-SLC8A1 counteracts miR-516b-5p's suppression, thereby facilitating osteoporosis.(\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e) To investigate the link between SLC8A1 expression and TD, we performed an extensive analysis across various disease categories using the TCGA database. Our study reveals significant SLC8A1 expression in TD patients, confirmed by MR analysis.\u003c/p\u003e\u003cp\u003eThe study indicates that gamma-glutamylisoleucine levels might inhibit TD progression. While metabolites such as creatinine, D-chiro-inositol, and high-density lipoprotein have shown significant associations with TD in some studies, research on metabolic gene expression and the role of metabolites in TD remains limited.(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e) Today, we have validated the possibility that gamma-glutamylisoleucine can inhibit the TD process through RNA sequencing, MR, and related experiments. Gamma-glutamylisoleucine is a dipeptide composed of γ-glutamate and isoleucine. It is a proteolytic product of larger proteins and belongs to the family of N-acyl-α-amino acids and their derivatives. Studies suggest that gamma-glutamylisoleucine may serve as a biomarker for a number of diseases. Thacker et al. demonstrated that gamma-glutamylisoleucine was reported as a potential biomarker for prostate cancer in HeLa cells.(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e) Shi et al. proposed that gamma-glutamylisoleucine was directly related to salt-sensitive hypertension by influencing the sodium content in the human body.(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e) Agarwal et al. revealed that type 2 diabetes in adolescents and DNA methylation are interconnected through the serum metabolite gamma-glutamylisoleucine.(\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e) At the current stage, scholar\u0026rsquo;s research on gamma-glutamylisoleucine has further confirmed its promising prospects as an important metabolite in the body for influencing the progression of certain diseases.\u003c/p\u003e\u003cp\u003eSLC8A1 potentially affects amino acid metabolism by altering collagen stability in vivo, notably by reducing gamma-glutamylisoleucine levels, which may facilitate TD progression. Disruptions in amino acid metabolism lead to reduction of intracellular oxidative stress, including cell viability, types of cell death, and intracellular ROS production.(\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e) These alterations compromise the remodeling of the extracellular matrix in tendon tissue, increase oxidative stress, and thereby impair TD progression.\u003c/p\u003e\u003cp\u003eHowever, this research is subject to certain limitations. Further in vivo and in vitro experiments, including cell-based validation of a specific gene in TD, require additional samples. Details will be provided in our forthcoming article. Conducting clinical trials in real-world settings is crucial to validate the involvement of SLC8A1 in TD. The analysis ultimately did not differentiate results based on etiology, such as repetitive strain or acute injury. Future studies should build on these findings through extensive experiments to further investigate SLC8A1's involvement in TD and explore potential therapeutic approaches.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe research offers preliminary evidence indicating that SLC8A1 facilitates the progression of TD. Further MR analysis and basic experiments validate a causal relationship between SLC8A1 and TD evolution. Research indicates that SLC8A1 may downregulate gamma-glutamylisoleucine levels, both of which significantly contribute to TD progression. These findings introduce a new therapeutic target and lay the groundwork for future SLC8A1-related research in TD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData from the study is available upon request from the corresponding author, pending approval.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest concerning this publication. They also confirm that the funding sources do not present any conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJunjie Tang, Ziqi Zhou, and Weijie Wu had unrestricted access to the study data and ensured its integrity and accurate analysis. Peng Shen contributed to the study's conceptualization and design. Xinyuan Wu, and Jianye Liu provided literature support. Junjie Tang and Ziqi Zhou provided supervision and critically reviewed the manuscript. Junjie Tang and Weijie Wu participated in the drafting of the manuscript. All authors contributed to the review, revision, and final approval of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics and Consent to Participate declarations:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll surgical procedures and postoperative care for the animals complied with the National Research Council's Guide for the Care and Use of Laboratory Animals and received approval from the Nantong University Animal Research Ethics Committee. (S20220211-003).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by Natural Science Foundation of Nantong (JC2023098). China Postdoctoral Science Foundation (2022M711718). Scientific Research Project of Nantong Commission of Health (MS2023022). Jiangsu Provincial Research Hospital (YJXYY202204). The authors and the funding source have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMillar NL, Silbernagel KG, Thorborg K, Kirwan PD, Galatz LM, Abrams GD et al. Tendinopathy Nat Reviews Disease Primers. 2021;7(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHopkins C, Fu S-C, Chua E, Hu X, Rolf C, Mattila VM, et al. Critical review on the socio-economic impact of tendinopathy. Asia-Pacific J Sports Med Arthrosc Rehabilitation Technol. 2016;4:9\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLui PPY, Maffulli N, Rolf C, Smith RKW. What are the validated animal models for tendinopathy? Scand J Med Sci Sports. 2011;21(1):3\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMalliaras P. Physiotherapy management of Achilles tendinopathy. J Physiotherapy. 2022;68(4):221\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang C, Wang Z, Xie Y, Fei Y, Luo J, Wang C et al. Classification of distinct tendinopathy subtypes for precision therapeutics. Nat Commun. 2024;15(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShim J, Pavlova AV, Moss RA, MacLean C, Brandie D, Mitchell L, et al. Patient ratings in exercise therapy for the management of tendinopathy: a systematic review with meta-analysis. Physiotherapy. 2023;120:78\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKang X, Tian B, Zhang L, Ge Z, Zhao Y, Zhang Y. Relationship of common variants in MPP7, TIMP2 and CASP8 genes with the risk of chronic achilles tendinopathy. Sci Rep. 2019;9(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCho N, Lee S-G, Kim JO, Kim Y-A, Kim E-M, Park C, et al. Identification of Differentially Expressed Genes Associated with Extracellular Matrix Degradation and Inflammatory Regulation in Calcific Tendinopathy Using RNA Sequencing. Calcif Tissue Int. 2020;107(5):489\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao Y, Lv J, Zhang H, Xie J, Dai H, Zhang X. Gene Expression Profiles Analyzed Using Integrating RNA Sequencing, and Microarray Reveals Increased Inflammatory Response, Proliferation, and Osteoclastogenesis in Pigmented Villonodular Synovitis. Front Immunol. 2021;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCasamassimi A, Federico A, Rienzo M, Esposito S, Ciccodicola A. Transcriptome Profiling in Human Diseases: New Advances and Perspectives. Int J Mol Sci. 2017;18(8).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu W, Yang R, Li J. Single-cell and spatial transcriptomics reveal changes in cell heterogeneity during progression of human tendinopathy. BMC Biol. 2023;21(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBowden J, Holmes MV. Meta-analysis andMendelianrandomization: A review. Res Synthesis Methods. 2019;10(4):486\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKuan V, Warwick A, Hingorani A, Tufail A, Cipriani V, Burgess S et al. Association of Smoking, Alcohol Consumption, Blood Pressure, Body Mass Index, and Glycemic Risk Factors With Age-Related Macular Degeneration. JAMA Ophthalmol. 2021;139(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Peng R, Chen Z, Zhang W, Liu Z, Xu S, et al. Evidence for a causal effect of major depressive disorder, anxiety on prostatitis risk: A univariate and multivariate Mendelian randomization study. Prostate. 2023;83(14):1387\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe L, Yu T, Zhang W, Wang B, Ma Y, Li S. Causal Associations of Obesity With Achilles Tendinopathy: A Two-Sample Mendelian Randomization Study. Front Endocrinol. 2022;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBurgess S, Bowden J, Fall T, Ingelsson E, Thompson SG. Sensitivity Analyses for Robust Causal Inference from Mendelian Randomization Analyses with Multiple Genetic Variants. Epidemiology. 2017;28(1):30\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen M, Zou F, Wang P, Hu W, Shen P, Wu X, et al. Dual-Barb Microneedle with JAK/STAT Inhibitor‐Loaded Nanovesicles Encapsulation for Tendinopathy. Adv Healthc Mater. 2024;13:28.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVicenzino B, Tendinopathy. Evidence-Informed Physical Therapy Clinical Reasoning. J Orthop Sports Phys Therapy. 2015;45(11):816\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin Y-L, Yao T, Wang Y-W, Zhou Z-X, Hong Z-C, Shen Y, et al. Potential drug targets for gastroesophageal reflux disease and Barrett\u0026rsquo;s esophagus identified through Mendelian randomization analysis. J Hum Genet. 2024;69(6):245\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng G, Chattopadhyay S, Sundquist J, Sundquist K, Ji J. Antihypertensive drug targets and breast cancer risk: a two-sample Mendelian randomization study. Eur J Epidemiol. 2024;39(5):535\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIlaltdinov AW, Gong Y, Leong DJ, Gruson KI, Zheng D, Fung DT, et al. Advances in the development of gene therapy, noncoding RNA, and exosome-based treatments for tendinopathy. Ann N Y Acad Sci. 2020;1490(1):3\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLinsell L, Dawson J, Zondervan K, Rose P, Randall T, Fitzpatrick R, Carr A. Prevalence and incidence of adults consulting for shoulder conditions in UK primary care; patterns of diagnosis and referral. Rheumatology. 2006;45(2):215\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRiel H, Lindstr\u0026oslash;m CF, Rathleff MS, Jensen MB, Olesen JL. Prevalence and incidence rate of lower-extremity tendinopathies in a Danish general practice: a registry-based study. BMC Musculoskelet Disord. 2019;20(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCook JL, Purdam CR. Is tendon pathology a continuum? A pathology model to explain the clinical presentation of load-induced tendinopathy. Br J Sports Med. 2009;43(6):409\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAchilles tendinopathy. Nat Reviews Disease Primers. 2025;11(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaffulli N, Longo UG, Kadakia A, Spiezia F. Achilles tendinopathy. Foot Ankle Surg. 2020;26(3):240\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWatanabe G, Yamamoto M, Taniguchi S, Sugiyama Y, Hirouchi H, Ishizuka S et al. Chronological Changes in the Expression and Localization of Sox9 between Achilles Tendon Injury and Functional Recovery in Mice. Int J Mol Sci. 2023;24(14).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eProteau S, Krossa I, Husser C, Gu\u0026eacute;guinou M, Sella F, Bille K et al. LKB1-SIK2 loss drives uveal melanoma proliferation and hypersensitivity to SLC8A1 and ROS inhibition. EMBO Mol Med. 2023;15(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLaurino S, Russi S, Sabato C, Luongo M, Laurenziello P, Vagliasindi A et al. The inhibition of SLC8A1 promotes Ca2+-dependent cell death in Gastric Cancer. Biomed Pharmacother. 2025;182.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Z, Gao Y, Zhang B, Dong W, Xi Y, Li Y, Cui J. circRNA_SLC8A1 promotes the survival of mycobacterium tuberculosis in macrophages by upregulating expression of autophagy-related protein SQSTM1/p62 to activate the NF-κB pathway. Sci Rep. 2024;14(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChu J-j, Qin X-j, Chen W, Xu Z, Xu X-j. SLC8A1, a novel prognostic biomarker and immunotherapy target in RSA and UCEC based on scRNA-seq and pan-cancer analysis. Heliyon. 2024;10(17).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin C, Zhong W, Yan W, Yang J, Zheng W, Wu Q. Circ-SLC8A1 regulates osteoporosis through blocking the inhibitory effect of miR‐516b‐5p on AKAP2 expression. J Gene Med. 2020;22(11).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTilley BJ, Cook JL, Docking SI, Gaida JE. Is higher serum cholesterol associated with altered tendon structure or tendon pain? A systematic review. Br J Sports Med. 2015;49(23):1504\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSikes KJ, McConnell A, Serkova N, Cole B, Frisbie D. Untargeted metabolomics analysis identifies creatine, myo-inositol, and lipid pathway modulation in a murine model of tendinopathy. J Orthop Res. 2021;40(4):965\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThacker JB, He C, Pennathur S. Quantitative analysis of γ-glutamylisoleucine, γ‐glutamylthreonine, and γ‐glutamylvaline in HeLa cells using UHPLC‐MS/MS. J Sep Sci. 2021;44(15):2898\u0026ndash;907.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi M, He J, Li C, Lu X, He WJ, Cao J, et al. Metabolomics study of blood pressure salt-sensitivity and hypertension. Nutr Metabolism Cardiovasc Dis. 2022;32(7):1681\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAgarwal P, Wicklow BA, Dart AB, Hizon NA, Sellers EAC, McGavock JM et al. Integrative analysis reveals novel associations between DNA methylation and the serum metabolome of adolescents with type 2 diabetes: A cross-sectional study. Front Endocrinol. 2022;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim RJ, Hah Y-S, Gwark J-Y, Park HB. N-acetylcysteine reduces glutamate-induced cytotoxicity to fibroblasts of rat supraspinatus tendons. Connect Tissue Res. 2019;60(5):431\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFuruta H, Yamada M, Nagashima T, Matsuda S, Nagayasu K, Shirakawa H, Kaneko S. Increased expression of glutathione peroxidase 3 prevents tendinopathy by suppressing oxidative stress. Front Pharmacol. 2023;14.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-cytogenetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mocy","sideBox":"Learn more about [Molecular Cytogenetics](http://molecularcytogenetics.biomedcentral.com/)","snPcode":"13039","submissionUrl":"https://submission.nature.com/new-submission/13039/3","title":"Molecular Cytogenetics","twitterHandle":"@OAgenetics","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Tendinopathy, mendelian randomization, SLC8A1, gamma − glutamylisoleucine, achilles tendon injury","lastPublishedDoi":"10.21203/rs.3.rs-7266504/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7266504/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003ePatients with tendinopathy (TD) have expressed dissatisfaction with the efficacy of the first-line treatment, indomethacin. This research aims to identify key biomarkers in TD and investigate their underlying mechanisms.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eTendon samples were harvested from 5 SD rats exhibiting TD and 5 healthy normal controls (NCs), destined for transcriptome sequencing. After thorough preprocessing of the RNA sequencing data, a differential expression analysis was performed to identify genes that significantly differentiated the TD group from the NCs. To identify candidate genes, an intersection analysis was performed between the differentially expressed genes (DEGs) and the key module genes obtained through weighted gene co-expression network analysis. The candidate genes underwent Mendelian randomization (MR) analysis and least absolute shrinkage and selection operator analysis to identify key genes. We conducted experimental validation and sensitivity analyses, such as pleiotropy, heterogeneity, and leave-one-out evaluations, to ensure the robustness of our findings.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eThe findings present new evidence indicating that SLC8A1 facilitates the progression of TD. MR analysis established a causal link between SLC8A1 and TD progression (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The study indicated that SLC8A1 might inhibit TD progression by negatively regulating gamma-glutamylisoleucine levels. In SD rats, TD led to a disordered arrangement of collagen structures, increased infiltration of inflammatory cells, increased cell density, and thicker inflammatory hyperplasia in tendon. These results confirm the effective creation of a TD model. Analysis showed significant upregulation of SLC8A1 expression in the TD group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThis research highlights SLC8A1 as a potential biomarker in TD development, providing novel perspectives for clinical diagnosis and treatment strategies.\u003c/p\u003e","manuscriptTitle":"SLC8A1 as a novel susceptibility gene in facilitating tendinopathy: Insights into Its Mechanisms from Mendelian Randomization and Experimental Validation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-19 12:30:29","doi":"10.21203/rs.3.rs-7266504/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-21T17:08:05+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-20T17:55:01+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-12T12:42:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"13844716402535736389100392017667583871","date":"2025-09-09T20:36:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"303184987174855534059205368958062430969","date":"2025-08-11T14:29:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-11T14:23:15+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-06T07:59:31+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-06T07:59:11+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Cytogenetics","date":"2025-08-01T02:04:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-cytogenetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mocy","sideBox":"Learn more about [Molecular Cytogenetics](http://molecularcytogenetics.biomedcentral.com/)","snPcode":"13039","submissionUrl":"https://submission.nature.com/new-submission/13039/3","title":"Molecular Cytogenetics","twitterHandle":"@OAgenetics","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e2b31b7e-2ebc-455e-84c1-5ebb89883452","owner":[],"postedDate":"August 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-24T16:12:58+00:00","versionOfRecord":{"articleIdentity":"rs-7266504","link":"https://doi.org/10.1186/s13039-025-00738-z","journal":{"identity":"molecular-cytogenetics","isVorOnly":false,"title":"Molecular Cytogenetics"},"publishedOn":"2025-11-19 15:58:27","publishedOnDateReadable":"November 19th, 2025"},"versionCreatedAt":"2025-08-19 12:30:29","video":"","vorDoi":"10.1186/s13039-025-00738-z","vorDoiUrl":"https://doi.org/10.1186/s13039-025-00738-z","workflowStages":[]},"version":"v1","identity":"rs-7266504","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7266504","identity":"rs-7266504","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00