Sex Hormone-Binding Globulin (SHBG) Modulates Inflammatory and Oxidative Stress Responses in Equine Immune Cells: Implications for Equine Metabolic Syndrome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sex Hormone-Binding Globulin (SHBG) Modulates Inflammatory and Oxidative Stress Responses in Equine Immune Cells: Implications for Equine Metabolic Syndrome Nabila Bourebaba, Justyna Domagała, Marta Pander, Lynda Bourebaba This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7698110/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : Sex hormone-binding globulin (SHBG) is a plasma glycoprotein mainly recognized for its role in regulating sex steroid bioavailability. However, recent studies indicate SHBG's involvement in a variety of biological processes, including those related to the immune system. In this study, the immunomodulatory effects of SHBG on lipopolysaccharide (LPS)-stimulated equine peripheral blood mononuclear cells (PBMCs) and macrophages were examined. Methods : Equine peripheral blood mononuclear cells (PBMCs) and macrophages were stimulated with LPS to induce an acute inflammatory response and subsequently treated with 50 nM SHBG. The anti-inflammatory activity of SHBG was assessed by analyzing the secretion of inflammatory mediators, the activation of regulatory T cells (Tregs), the proportion of M2 macrophages, and markers of oxidative and nitrosative stress. In addition, the therapeutic potential of SHBG was evaluated ex vivo using equine subcutaneous adipose tissue explants. Results : SHBG markedly reduced the secretion of pro-inflammatory cytokines and chemokines (IL-1β, IL-6, TNF-α, MCP-1), while enhancing the release of anti-inflammatory mediators including IL-10. It also promoted regulatory T cell (Treg) activation within the total PBMCs population, thereby contributing to an immunosuppressive environment. In macrophages, SHBG shifted the phenotype from pro-inflammatory M1 toward anti-inflammatory M2 subtype, facilitating the resolution of inflammation. Furthermore, SHBG mitigated oxidative and nitrosative stress by lowering reactive oxygen species (ROS) and nitric oxide (NO) levels and enhancing antioxidant enzymes activity, thus restoring redox balance. Importantly, conditioned media from SHBG-treated PBMCs reduced the pro-inflammatory impact of PBMC-derived mediators on subcutaneous adipose tissue (SAT) explants, as shown by the decreased IL-6 and IL-1β tissue expression compared with media from LPS-stimulated PBMCs. Conclusion : Collectively, these findings identify SHBG as a novel regulator of immune homeostasis, capable of attenuating inflammation and oxidative stress at multiple levels. Immunology Cell Communication and Signaling General Cell Biology & Physiology SHBG Inflammation Macrophages Tregs EMS Oxidative stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Equine metabolic syndrome (EMS) is an endocrine disorder that has recently reached alarming proportions worldwide, posing a significant burden on both veterinary practice and the equestrian industry. The condition, formally introduced to the veterinary field in 2002 is defined as an array of interconnected clinical and pathophysiological abnormalities that include insulin dysregulation, excess adiposity or obesity, systemic low-grade inflammation and in advanced cases, laminitis [ 1 ]. While the exact etiology of EMS remains complex, previous reports have highlighted the involvement of both genetic and environmental factors, as well as prolonged overfeeding with high-energy index feed and current breeding methods, which result in pathological obesity, adiposity, dysregulation of glucose metabolism and endocrine dysfunctions [ 2 ]. EMS pathophysiology is complex and encompasses various molecular and cellular changes not all fully understood. Insulin dysregulation (ID) and the resulting hyperinsulinemia are considered among the key metabolic disturbances contributing to EMS onset, particularly in association with excessive non-structural carbohydrates intake combined with reduced physical activity. ID leads to abnormal fluctuations in insulin secretion and impaired glucose homeostasis, which drive increased fat deposition, altered energy partitioning, and mitochondrial stress. These disturbances favor the development of oxidative stress and low-grade systemic inflammation, accompanied by the permanent activation of pro-inflammatory signaling pathways [ 3 , 4 ]. Adipose tissue (AT) plays a pivotal role in the pathophysiology of EMS, acting not only as an energy reservoir but also as an active endocrine and immunological organ. In the context of ID, excessive nutrient intake drives adipocyte hypertrophy and hyperplasia, leading to AT expansion and dysfunction. Hypertrophic adipocytes exhibit altered insulin signaling, reduced glucose uptake, and increased lipolysis, resulting in elevated free fatty acids (FFAs) release and ectopic fat deposition, which exacerbate systemic metabolic stress [ 5 ]. Dysfunctional AT also contributes to a chronic pro-inflammatory state. Enlarged adipocytes secrete increased levels of pro-inflammatory adipokines and cytokines such as TNF-α, IL-6, and leptin, while the secretion of anti-inflammatory mediators such as adiponectin is suppressed. These changes further impair insulin sensitivity, sustain low-grade inflammation, and promote oxidative stress. In parallel, infiltration of immune cells, particularly macrophages and eosinophils, amplifies the release of reactive oxygen species (ROS) and fibrogenic mediators, including TGF-β and connective tissue growth factor (CTGF) [ 6 , 7 ]. Macrophages play a central role in the pathophysiology of EMS, with implications both systemically and within the AT itself. In adipose depots, chronic nutrient overload and ID induce adipocyte stress, leading to the release of chemotactic signals such as monocyte chemoattractant protein-1 (MCP-1) and leptin adipokine. This recruits circulating monocytes, which differentiate into macrophages; that infiltrate AT and cluster around necrotic adipocytes. Once activated, these macrophages shift toward a pro-inflammatory M1-like phenotype, secreting cytokines such as TNF-α, IL-1β, and IL-6, which amplify local inflammation and exacerbate AT dysfunction. At the same time, their production of ROS and pro-fibrotic mediators contributes to extracellular matrix remodelling and fibrosis. The loss of balance with alternatively activated M2-like macrophages, which normally support tissue repair and maintain insulin sensitivity, further accelerates pathological remodelling [ 8 – 10 ]. Systemically, macrophages act as amplifiers of immune dysregulation in EMS. Circulating monocyte-derived macrophages infiltrate multiple tissues, releasing inflammatory mediators that sustain low-grade systemic inflammation, endothelial dysfunction, and organ fibrosis. Their crosstalk with eosinophils and T cells creates a chronic pro-inflammatory microenvironment, linking metabolic imbalance to immune activation and tissue damage. Thus, macrophages serve as a pivotal cellular mediator connecting AT dysfunction with systemic EMS manifestations [ 11 – 13 ]. Given the central role of chronic inflammation in EMS pathophysiology, regulatory mechanisms that can counteract immune activation and metabolic stress are of particular interest. One such factor is sex hormone–binding globulin (SHBG), a glycoprotein primarily synthesized in the liver but also expressed in AT, where it can exert local and systemic effects. Beyond its well-established role in regulating sex hormones bioavailability, SHBG possesses direct anti-inflammatory properties that may mitigate EMS-related inflammation [ 14 ]. SHBG is a serum glycoprotein exhibiting high affinity and specificity to sex steroids. Its circulating levels are governed not only by androgens and estrogens, but also by thyroid hormones and various other metabolic influences [ 15 ]. Indeed, changes in circulating SHBG levels have been previously observed in various metabolic disorders. Low SHBG has been associated with polycystic ovary syndrome [ 16 ], metabolic syndrome and type 2 diabetes [ 17 ], insulin dysregulation [ 18 ], and metabolic dysfunction-associated steatotic liver disease [ 19 ]. In these conditions, reduced SHBG contributes to increased free sex hormones, altered insulin signaling, and low-grade inflammation, highlighting its role as both a marker and mediator of metabolic and inflammatory disturbances relevant to EMS. While reduced SHBG has been linked to adverse metabolic and inflammatory states, emerging evidence indicates that SHBG itself may actively modulate immune and metabolic pathways involved in EMS pathophysiology. SHBG has been shown to modulate macrophage activity, suppressing pro-inflammatory cytokines release while promoting a shift toward a more anti-inflammatory profile [ 20 ]. In AT, SHBG exerts anti-inflammatory effects by inhibiting the PDIA3/ERK axis. This results in a marked reduction of pro-inflammatory cytokines such as IL-6 and TNF-α, with additional, decreases in MCP-1 and PGE2, thereby contributing to the attenuation of inflammation in EMS [ 21 ]. By dampening systemic inflammation, modulating immune-metabolic interactions, and improving AT homeostasis, SHBG may represent a protective factor against the progression of EMS. We therefore hypothesize that SHBG exerts these effects by modulating macrophage activation and attenuating local inflammation in subcutaneous adipose tissue (SAT), highlighting its potential as a therapeutic target to restore immune and metabolic balance. 2. Materials and Methods 2.1. Isolation of equine peripheral blood mononuclear cells (EqPBMCs) Fresh blood was drawn from healthy adult horses through jugular venipuncture using sterile CPDA-1 anticoagulant blood bags. Peripheral blood mononuclear cells (PBMCs) were then isolated following the method outlined by Patrone et al. [ 22 ]. Specifically, the blood cells were layered onto a Ficoll Histopaque®-1083 (Sigma-Aldrich, Poznań, Poland) density gradient and centrifuged at 400 × g for 30 minutes at 25°C. The cells located in the buffy coat layer were carefully collected and washed three times with HBSS (Sigma-Aldrich, Poznań, Poland) and further used for subsequent monocytes purification or experimental settings. 2.2. Equine monocyte adhesion and macrophage differentiation Isolated PBMCs were plated in 6-well culture plates and incubated to allow monocytes to adhere to the surface of the wells. The adherence-based isolation was carried out by culturing the cells in RPMI 1640 medium (Sigma-Aldrich, Poznań, Poland) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich, Poznań, Poland) and 1% penicillin/streptomycin (P/S) at 37°C in a humidified atmosphere with 5% CO₂. Non-adherent cells were gently removed after 2 hours by washing with warm HBSS, leaving behind the adherent monocyte population. Flow cytometry analysis confirmed the monocyte population by positive staining for the lineage marker CD14 (Supplementary Figure S1). Pure monocytes were subsequently cultured for an additional 5 days in the same complete medium supplemented with 1 µg/mL of recombinant human GM-CSF (Thermo Fisher Scientific, Warsaw, Poland) to induce their differentiation into macrophages. The medium was replaced every 2 days during this period to maintain optimal culture conditions. Once differentiated, macrophages were ready for further experimental treatments and analyses. 2.3. Experimental design The study was conducted to assess the inflammatory response induced by lipopolysaccharide (LPS) and the potential modulatory effect of SHBG on equine peripheral blood mononuclear cells (EqPBMCs) and macrophages (EqMƟ). Cells were first exposed to 8 µg/mL of lipopolysaccharides (LPS; Escherichia coli O111:B4, Cat No. L4130, Sigma-Aldrich, Poznań, Poland) for 24 hours under standard culture conditions (37°C, 5% CO 2 ), and subsequently treated with 50 nM SHBG (Biosynth Ltd, Chemat, Gdańsk, Poland) for additional 24 hours. Control cells were cultured under identical conditions in the absence of any treatment. For both cell types, the following experimental groups were established: EqMƟ_CTRL: Untreated control macrophages EqMƟ_ LPS: Macrophages stimulated with LPS to induce inflammation EqMƟ_LPS + SHBG: Macrophages stimulated with LPS and treated with 50 nM SHBG Correspondingly, the same groups were prepared for PBMCs with the following designations: EqPBMC_CTRL: Untreated control PBMCs EqPBMC_LPS: PBMCs stimulated with LPS EqPBMC_LPS + SHBG: PBMCs co-treated with LPS and SHBG Following treatment, cells and conditioned culture media were collected and processed according to the procedures described below for further analyses. 2.4. Multiplex immunoassay for cytokine quantification The concentrations of multiple cytokines and growth factors, including IFNγ, IL-1α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8/CXCL8, IL-10, IL-12 (p70), IL-13, IL-17a, IL-18, IP-10, TNFα, MCP-1, RANTES/CCL5, Eotaxin/CCL11, FGF-2, Fractalkine/CS3CL1, G-CSF, GM-CSF and GRO were measured using the Milliplex MAP Magnetic Bead Multiplex Assay Kit (EQCYTMAG-93K, Sigma Aldrich, Poznań, Poland). Briefly, 25 µL of standards, controls, or undiluted samples were added to designated wells, followed by 25 µL of assay buffer and 25 µL of the appropriate matrix solution. Next, 25 µL of premixed magnetic beads conjugated with analyte-specific antibodies were dispensed into each well. Plates were sealed, wrapped in foil, and incubated with agitation overnight at 4°C. After three washes using a magnetic separation device, 25 µL of detection antibodies were added and incubated for 1 h at room temperature, followed by a 30-minutes incubation with 25 µL of Streptavidin-Phycoerythrin. Wells were subsequently washed three times, and beads were resuspended in 150 µL of sheath fluid. Fluorescence was measured using a Bio-Plex 200 System (Bio-Rad, Hercules, CA, USA). Analyte concentrations were calculated from standard curves and final cytokine concentrations were expressed in pg/mL. 2.5. Evaluation of oxidative and nitrosative stress in treated cells Oxidative stress has been evaluated by measuring the accumulation of ROS within experimental cells using the Muse® Oxidative Stress assay Kit (Merck Millipore, Poznań, Poland), following the manufacturer’s instructions. Equine PBMCs and macrophages were collected following each treatment, washed with PBS and resuspended in assay buffer. Afterwards, cells were labelled with the fluorescent ROS detection reagent working solution at a final ratio of 1:19 v/v in the dark during 30 minutes at 37°C in a controlled standard cell culture incubator. The levels of intracellular nitric oxide (NO) were measured via the Muse® Nitric Oxide Assay Kit. (Merck Millipore, Poznań, Poland) according to the manufacturer’s recommendations. Following the established treatment protocol, PBMCs and macrophages were harvested, washed with PBS and incubated in the presence of the detection probe working solution at a final ratio of 1:10 v/v, at 37°C for 30 minutes. Subsequently, the Muse® 7-AAD viability dye was added and the incubation extended to 5 minutes at room temperature in the dark for the discrimination between live and dead cells. ROS/NO-negative and ROS/NO-positive cells were quantified using the MUSE® Merck Millipore Cell Analyzer (Merck Millipore, Poznań, Poland). 2.6. Quantification of nitric oxide secretion Equine macrophages and PBMCs were seeded in 24-well plates and exposed to the different treatment conditions as described above. After incubation, culture supernatants were collected and centrifuged at 300 × g for 5 minutes to remove cellular debris. NO production was determined by measuring nitrite accumulation using the Griess Reagent Kit (Thermo Fisher Scientific, Warsaw, Poland), according the manufacturer’s instructions. Briefly, equal volumes of each cell-free supernatant and Griess solution were mixed and incubated for 15 minutes at room temperature in the dark. Absorbance was afterwards measured at 540 nm using a microplate reader (Synergy H1, BioTek® Instruments, Inc., Warsaw, Poland). Nitrite concentrations were calculated based on a standard curve generated with sodium nitrite and expressed as µM NO. 2.7. Profiling of antioxidant enzymes activity in treated cells The effect of SHBG protein treatment on antioxidant enzymes activity was assessed using the Superoxide Dismutase (SOD) Assay Kit-WST (ScienCell Research Laboratories, San Diego, USA) and the Catalase (CAT) Colorimetric Assay Kit (MyBioSource, San Diego, USA). Briefly, equine PBMCs and macrophages were exposed to LPS and SHBG protein for 24 hours each, washed with cold HBSS (Sigma-Aldrich, Poznań, Poland) and lysed using cold lysis buffer provided in the assay kits. Supernatants containing cellular proteins were afterwards collected for enzyme activity assays and total protein concentrations were estimated using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Warsaw, Poland) following manufacturer’s protocol. For SOD activity determination, samples were incubated with WST working solution in microtiter plates following the manufacturer’s instructions, and absorbance was measured at 438 nm using a microplate reader (Synergy H1, BioTek® Instruments, Inc., Warsaw, Poland). Catalase activity was measured by monitoring the decomposition of H 2 O 2 with absorbance read at 240 nm. Enzyme activities were expressed as percentage of SOD activity reflecting the levels of superoxide radicals inhibition and nanomoles of decomposed H 2 O 2 per minute per milligram of protein for CAT. 2.8. Regulatory T cell activation assay Activation of regulatory T cells (Tregs) was evaluated by flow cytometry using CD4, CD25, and Foxp3 markers. PBMCs from the three experimental conditions: EqPBMC_CTRL, EqPBMC_LPS, and EqPBMC_LPS + SHBG were collected following the defined treatments and washed twice with PBS. For surface staining, cells were resuspended in PBS and incubated with mouse anti-horse CD4 (MCA1078GA, 1:200; Abd Serotec, Hercules, CA, USA) and mouse anti-human/horse CD25-FITC (MA1-35144, 1:200; Thermo Fisher Scientific, Warsaw, Poland) for 30 minutes at 4°C in the dark. After two washes with PBS, cells were fixed and permeabilized using the eBioscience Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific, Warsaw, Poland) according to the manufacturer’s instructions. Intracellular staining was performed by incubating cells with anti-human / horse Foxp3-PE (61-5773-82, eBioscience, Thermo Fisher Scientific, Warsaw, Poland) for 30 minutes at 4°C in the dark. Stained cells were washed, resuspended in PBS, and analyzed on a BD LSR Fortessa flow cytometer using FACSDiva version 9.0 software (Becton Dickinson, San Jose, USA). The proportion of activated regulatory T cells (CD4+/CD25+/Foxp3+) was determined following appropriate gating strategies using the FlowJo software (TreeStar Inc., Ashland, OR, USA). 2.9. Macrophage polarization analysis Macrophage polarization was assessed by flow cytometry using M1/M2 surface markers (CD80, CD86, HLA-DR, CD163, CD206) and the intracellular marker Arginase I (Arg1). The analysis included untreated control macrophages, LPS-stimulated macrophages, and macrophages co-treated with LPS and SHBG. Cells were harvested following each treatment, washed with PBS, centrifuged at 400 × g, 10 minutes, room temperature, and resuspended in PBS for surface staining or in permeabilization buffer for intracellular staining. For intracellular Arg1 detection, cells were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich, Poznań, Poland) for 15 min at room temperature, permeabilized with 0.1% saponin in PBS for 15 minutes, washed in PBS containing 5% FBS, and incubated with APC-conjugated anti-human Arginase I antibody (clone ARG1; BioLegend, Cat. No. 369706) for 30 minutes at room temperature in the dark. Following washes, samples were incubated with appropriate secondary antibody for 30 minutes at room temperature in the dark and finally resuspended in PBS. Surface markers were stained by directly incubating cells with fluorochrome-conjugated antibodies for 30 minutes at room temperature in the dark in PBS supplemented with 5% FBS to reduce non-specific binding. The antibodies used were: PE-conjugated anti-human CD80 (B7-1) (BD Pharmingen, Cat. No. 566992), APC-conjugated anti-human CD86 (BD Pharmingen, Cat. No. 555660), PE-conjugated anti-human HLA-DR [L243] (Elabscience, Cat. No. E-AB-F1111D), PE-conjugated anti-human CD163 (Invitrogen, Cat. No. 12-1639-42) and PE-conjugated anti-human CD206 (BioLegend, Cat. No. 321106). Flow cytometry was performed using a BD LSR Fortessa with FACSDiva version 9.0 flow cytometer equipped with an FCS Express 7.0 software (Becton Dickinson, San Jose, USA). Unstained controls were included for gating and compensation. The M1/M2 ratio was calculated by comparing mean fluorescence intensities of M1-associated markers to M2-associated markers. 2.10. Characterization of macrophage morphological changes Macrophages were grown onto glass coverslips in a 24-well plate and exposed to different treatment conditions as described above. Cells were afterwards rinsed twice with PBS and incubated with a MitoRed working solution (1:1000, Sigma-Aldrich, Poznań, Poland) during 30 minutes at 37°C, 5% CO 2 for mitochondria staining. Next, excess MitoRed staining solution was removed, cells were washed three times with PBS and fixed for 30 minutes in a 4% paraformaldehyde solution (PFA, Sigma-Aldrich, Poznań, Poland) at room temperature. Cell membranes were then permeabilized using 0.1% Triton X- 100 (Sigma-Aldrich, Poznań, Poland) for 15 minutes at room temperature to facilitate intracellular staining. Following three PBS washes, F-actin filaments were labelled using the atto-488-conjugated phalloidin (1:800, Sigma Aldrich, Poznan, Poland) for 40 minutes in the dark. Nuclei were counterstained with DAPI using the Fluoroshield™ mounting medium (Sigma-Aldrich, Poznań, Poland). Stained cells were observed using a laser scanning confocal microscope (Observer Z1 Confocal Spinning Disc V.2 Zeiss with live imaging chamber, Leica Microsystems, KAWA.SKA Sp. z o.o., Poland) and obtained photomicrographs were processed with the Fiji ImageJ Software (version 1.52n, Wayne Rasband, National Institutes of Health, USA). 2.11. Ex vivo co-culture of equine subcutaneous adipose tissue (SAT) with treated PBMCs Subcutaneous adipose tissue (SAT) samples were freshly collected from healthy adult mares and transported in Dulbecco’s Phosphate Buffered Saline (DPBS, Sigma-Aldrich, Poznań, Poland) containing 1% penicillin-streptomycin (PS, Gibco, Thermo Fisher Scientific, Warsaw, Poland) to minimize the risk of bacterial contamination. Tissue specimens were cut into smaller fragments of approximately 50 mg each and washed twice with DPBS / 1% PS. The fragments were then placed into culture plates containing Dulbecco’s Modified Eagle’s Medium low glucose (1000 mg/L), L-glutamine, and sodium bicarbonate (DMEM-LG, Gibco, Thermo Fisher Scientific, Warsaw, Poland) medium, supplemented with 0.2% bovine serum albumin (BSA, Sigma Aldrich, Poznań, Poland) and 1% PS and incubated for 2 hours to allow tissue stabilization before co-culture. PBMCs were treated under three conditions as described above: untreated control, LPS exposure, LPS followed by 50 nM native SHBG (Biosynth Ltd, Chemat, Gdańsk, Poland) for 24 hours. Following their respective treatments, PBMCs were co-cultured with SAT fragments in basal culture medium for 24 hours at 37°C with 5% CO 2 under sterile conditions. The SAT groups were named to reflect the PBMCs treatment conditions used to mimic systemic inflammation: EqSAT_CTRL: SAT co-cultured with untreated PBMCs EqSAT_LPS: SAT co-cultured with LPS-stimulated PBMCs EqSAT_LPS + SHBG: SAT co-cultured with PBMCs treated with LPS and SHBG After incubation, tissue pieces from each group were pooled, preserved in suitable reagents, and prepared for subsequent analyses as detailed below. 2.12. Immunohistochemical detection of IL-1β and IL-6 in treated SAT specimens SAT samples subjected to treatment described above were carefully washed with PBS and fixed in 10% neutral buffered formalin (NBF, Sigma Aldrich, Poznań, Poland) for 24 hours at room temperature. After fixation, tissues were rinsed, dehydrated through graded alcohols, and embedded in paraffin blocks. Using a Microm HM 340E rotary microtome (Zeiss, Oberkochen, Germany), paraffin-embedded samples were cut into 5 µm sections. The sections were then deparaffinized, rehydrated via graded descending ethanol series, and underwent antigen retrieval by incubation in Tris-buffer at 96°C for 20 minutes. To inhibit endogenous peroxidase and phosphatase activities, sections were treated with Dako REAL Peroxidase-Blocking Solution (Dako Cytomation Poland, Gdynia, Poland) for 10 minutes. The slides were incubated for 1 hour at room temperature with primary antibodies targeting IL-1β (Abcam, Cat. No. ab9722) and IL-6 (Affinity Biosciences, Cat. No. DF6087), prepared in the recommended antibody diluent. Visualization of the antigen-antibody complexes was achieved using the Dako Real EnVision + System HRP Labelled Polymer Anti-Rabbit, coupled with the Liquid DAB + Substrate Chromogen System (Dako Cytomation Poland, Gdynia, Poland), as per the manufacturer’s guidelines. Cell nuclei were counterstained using Hematoxylin solution, Gill’s formulation No. III (Merck Millipore, Darmstadt, Germany). The stained sections were mounted using the Dako Faramount Aqueous Mounting Medium (Dako Cytomation Poland, Gdynia, Poland) and covered with glass coverslips. Microscopic examination was performed using an Axio Imager A1 light microscope (Zeiss, Oberkochen, Germany) at 10× and 40× objective magnifications, and images were recorded with a Canon PowerShot camera. For each section, 10 representative fields were randomly selected across the tissue, including both adipocyte-rich regions and stromal-vascular areas. Staining intensity and subcellular localization, including cytoplasmic and perivascular patterns characteristic of adipocytes and stromal cells, were visually assessed on a 0–4 scale according to the manufacturer’s recommendations: 0, no staining; 1+, delicate staining; 2+, average staining; 3+, intense staining; and 4+, bright staining. Negative controls were included to confirm staining specificity. The scoring approach was informed by methodologies described in previous studies and used for reference and comparison [ 24 – 26 ]. 2.13. Gene expression analysis of inflammatory and antioxidant markers Gene expression of key transcripts involved in inflammatory responses and antioxidant defenses (Table 1 ) was assessed by real-time quantitative reverse transcription PCR (RT-qPCR). Total RNA was extracted from PBMCs, macrophages, and SAT explants of each experimental group using TRIzol reagent (Thermo Fisher Scientific, Warsaw, Poland), followed by chloroform phase separation and isopropanol/ethanol precipitation [ 23 ], and RNA purity as well as concentration were measured using a nanospectrophotometer (Synergy H1, BioTek® Instruments, Inc., Warsaw, Poland). Genomic DNA (gDNA) digestion and cDNA synthesis were performed using a Tetro™ cDNA synthesis kit (Bioline, London, UK) in a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Detection of target mRNA expression was performed using the SensiFAST SYBR Green Kit (Bioline, London, UK) on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). A total of 150 ng of cDNA was amplified in a total volume of 10 µl containing SYBR-Green Master Mix, forward and reverse primers and tested samples. Thermal cycling conditions were as follows: 95°C for 2 min, followed by 40 cycles at 95°C for 15 sec, annealing for 15 s, and elongation at 72°C for 15 s. All data were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression, and relative transcript levels were calculated using the RQ MAX log₂ algorithm. Table 1 Sequences of primers used in qPCR. Gene Primer Sequence 5'–3' Amplicon length (bp) Accession No. IL1B F: R: TATGTGTGTGATGCAGCTGTG ACTCAAATTCCACGTTGCCC 352 NM_001082526.1 IL6 F: R: CGTCACTCCAGTTGCCTTCT GCCAGTACCTCCTTGCTGTT 225 NM_001082496.2 TNF F: R: TCCTACCCGTCCAAGGTCAA CTCATACCAGGGCTTGGCTT 93 NM_001081819.2 IL4 F: R: GCTGAACAACCTCACAGATGG CAGCCCTGCAGATTTCCTTT 110 NM_001082519.1 IL10 F: R: GCTATGTTACCTGGTCTTCCTGG ACTCATGGCTTTGTAGACACC 461 NM_001082490.1 IL13 F: R: AGCAGTCATTGCTCTCGCTT CTCCACACCATGCTGCCATT 144 XM_023616897.1 IL1RA F: R: AGACCTCACGAGACTTCGGA GCTTTAAGTAGGGCCGTGGT 829 XM_070234754.1 IL18 F: R: CGCACCCCAGACCGTATTTA CGCTAGACCTCTAGTGAGGC 61 NM_001082512.1 MCP1 F: R: GCATTCCCTAAATGCCCCCT GGGGTTCACAGAGGAAAGCA 194 NM_001081931.2 TGF F: R: ATTCCTGGCGCTACCTCAGT GCTGGAACTGAACCCGTTGAT 197 NM_001081849.1 SOD1 F: R: CATTCCATCATTGGCCGCAC GAGCGATCCCAATCACACCA 130 NW_001867397.1 SOD2 F: R: GGACAAACCTGAGCCCCAAT TTGGACACCAGCCGATACAG 125 NW_001867408.1 CAT F: R: ACCAAGGTTTGGCCTCACAA TTGGGTCAAAGGCCAACTGT 112 XM_014729341.2 GPx F: R: TCGAGCCCAACTTCACACTC AAGTTCCAGGCGACATCGTT 178 NM_001166479.1 GAPDH F: R: GATGCCCCAATGTTTGTGA AAGCAGGGATGATGTTCTGG 250 NM_001163856.1 IL1B : Interleukin 1 beta; IL6 : Interleukin 6; TNF : Tumor Necrosis Factor; IL4 : Interleukin 4; IL10 : Interleukin 10; IL13 : Interleukin 13; IL1RA : Interleukin 1 Receptor Antagonist, IL18 : Interleukin 18 ; MCP1 : Chemokine (C-C Motif) Ligand 2 (CCL2); TGF : Transforming Growth Factor; SOD1 : Superoxide Dismutase 1; SOD2 : Superoxide Dismutase 2; CAT : Catalase; GPx : Glutathione Peroxidase; GAPDH : Glyceraldehyde 3-Phosphate Dehydrogenase. 2.14. Statistical analysis Data were analyzed by one-way analysis of variance (ANOVA) using GraphPad Prism software (version 10.5.0, San Diego, CA, USA). Multiple group comparisons were performed using Tukey’s post-hoc test. Normality of the data was assessed with the Shapiro-Wilk test, and when assumptions of normality were not met, the nonparametric Kruskal-Wallis test was applied. Statistically significant differences are indicated as follows: *p < 0.05 , **p < 0.01 , ***p < 0.001 and ****p < 0.0001 . Results are presented as mean ± standard deviation. 3. Results 3.1. SHBG modulates the expression of inflammatory cytokines and chemokines in LPS-stimulated equine PBMCs and macrophages To investigate the anti-inflammatory and immunomodulatory effects of SHBG glycoprotein, the expression of key inflammatory mediators has been analysed. A bead-based multiplex immunoassay of secreted cytokines and chemokines demonstrated that LPS stimulation markedly increased the levels of pro-inflammatory mediators in both immune cell populations. In PBMCs (Fig. 1 A), LPS exposure enhanced the protein levels of several immune-activating molecules including IL-2, IFN-γ, IL-10, and RANTES/CCL5, while SHBG treatment partially reversed these increases, significantly reducing pro-inflammatory mediators’ levels and augmenting IL-10 and IL-13 protein expression. Similarly, in macrophages (Fig. 1 B), LPS induced significant elevation of IL-6, TNF-α, IL-18, IL-12p70, with IL-1β exhibiting the highest increase compared to control cells ( p < 0.01 ). Additionally, key chemoattractant proteins MCP-1/CCL2, GRO and RANTES/CCL5 were found to be critically elevated in the LPS stimulated cells. The subsequent treatment of LPS-stimulated macrophages with SHBG (50 nM) caused a substantial reduction in pro-inflammatory cytokine release as well as chemokines expression, indicating its anti-inflammatory potential. Additionally, SHBG treatment increased the levels of the immunomodulatory cytokine IL-10 compared to LPS alone. These findings suggest that SHBG modulates the inflammatory response by downregulating pro-inflammatory cytokines and chemokines and promoting anti-inflammatory mediators in both macrophages and PBMCs. To complement the protein-level findings, expression of key inflammatory genes affected by LPS stimulation and SHBG treatment was further analysed. As shown in Fig. 2 .A and 2.B, LPS-treated PBMCs and macrophages exhibited a significant increase in the gene expression of pro-inflammatory markers, including IL1B , IL1RA , IL18 , IL6 , TNF , and MCP ( p < 0.01 , p < 0.001 ), as compared to untreated respective control cells. Notably, the treatment of inflamed cells with SHBG protein (50 nM) resulted in a marked downregulation of these same transcripts in both PBMCs and macrophages relative to untreated LPS-stimulated groups of cells ( p < 0.01 , p < 0.001 ). To additionally substantiate the immunoregulatory potential of SHBG, the expression of genes involved in anti-inflammatory responses was examined. The exposure of both PBMCs (Fig. 3 A.) and macrophages (Fig. 3 B.) triggered the suppression of IL4, IL10, IL13, and TGF transcript levels when compared to unstimulated cells ( p < 0.001 ), as a consequence of an acute inflammatory reaction onset. Interestingly, the application of SHBG to activated cells reversed the observed anti-inflammatory genes expression depletion, as evidenced by the visible higher IL4, IL10, IL13, and TGF mRNAs levels, by opposition to untreated inflamed cells ( p < 0.05, p < 0.01, p < 0.001, p < 0.0001 ). 3.2. SHBG regulates immune cell responses in LPS-stimulated PBMCs and macrophages To determine how SHBG influences immunomodulatory responses, the activation of regulatory T cells (Tregs) in equine PBMCs was analysed. Under LPS stimulation alone, the frequency of Tregs (CD4 + CD25 + FoxP3 + ) was relatively low, reflecting the pro-inflammatory environment (Fig. 4 A and 4 B). In contrast, treatment with SHBG markedly increased the proportion of CD4 + CD25 + FoxP3 + cells, suggesting that SHBG promotes the expansion or maintenance of Tregs even in the context of inflammatory stimulation. These results are consistent with the previously observed upregulation of the immunoregulatory cytokines IL-10 and TGF-β, indicating that SHBG supports a regulatory immune phenotype in PBMCs. Macrophage polarization was further evaluated by flow cytometry using classical M1 markers (CD80, CD86, HLA-DR) and M2 markers (CD163, CD206, Arg1). In native, unstimulated macrophages, baseline expression of M1 and M2 markers was low and relatively balanced, reflecting a homeostatic state (Fig. 5 .A). LPS stimulation strongly induced M1 polarization, with a marked increase in CD80, CD86, and HLA-DR expression, while M2 marker expression remained minimal. In contrast, SHBG treatment significantly promoted M2 polarization, as evidenced by increased CD163, CD206, and Arg1 levels, accompanied by a concomitant reduction in M1 marker expression. Analysis of the M1/M2 ratio confirmed these observations: LPS induced a pronounced shift toward M1 dominance, whereas SHBG treatment shifted the balance toward M2 subtype ( p < 0.0001 ), supporting a more anti-inflammatory phenotype compared to LPS alone. To further characterize macrophage polarization, cytoskeletal organization and mitochondrial activity were assessed using fluorescence confocal microscopy. In the control group, macrophages exhibited a small, rounded morphology characteristic of a homeostatic, non-activated state. Cells displayed compact cytoskeletal organization with sparse, short actin filaments and limited cytoplasmic extensions. Mitochondria appeared concentrated in the perinuclear region, consistent with basal metabolic activity (Fig. 6 ). Upon LPS stimulation, macrophages underwent substantial morphological changes typical of classical M1 polarization. Cells became broadly spread with elongated and thickened F-actin filaments, forming prominent filopodia and lamellipodia indicating enhanced cytoskeletal remodelling and motility. The mitochondrial network was more abundant and dispersed throughout the cytoplasm, reflecting increased energy demands and bioenergetic reprogramming linked to pro-inflammatory activation. In contrast, macrophages treated with SHBG following LPS stimulation exhibited an intermediate phenotype (Fig. 6 ). They retained some cytoskeletal extension but showed reduced spreading and fewer actin-rich protrusions compared to LPS alone. Mitochondrial staining was less widespread, indicating partial restoration toward a metabolically less active state, consistent with a shift toward an anti-inflammatory, reparative macrophage phenotype. Together, these complementary approaches demonstrate that SHBG not only modulates macrophage surface marker expression but also influences their cytoskeletal architecture and mitochondrial organization, features integral to functional polarization states. 3.3. SHBG attenuates oxidative and nitrosative stress in inflamed PBMCs and macrophages Given the close relationship between inflammation and oxidative stress, intracellular ROS accumulation was evaluated. Obtained data demonstrated that LPS-induced inflammation was accompanied by a marked increased proportion of ROS-positive cells in both PBMCs (Fig. 7 A, and 7 C) and macrophages (Fig. 7 E, and 7 G) compared to controls ( p < 0.0001 ), while SHBG significantly reduced the overall ROS production in both cell types. Furthermore, the generated oxidative stress was associated with significant alterations in antioxidant enzymes expression in both PBMCs and macrophages following LPS treatment. In PBMCs, LPS stimulation significantly increased the expression of key anti-oxidant genes namely, CAT, GPx, SOD1 and SOD2 ( p < 0.01 to p < 0.0001 ) in contrast to resting cells, suggesting the establishment of a stress-mediated compensatory mechanism. Interestingly, SHBG treatment further augmented the transcript levels of CAT, GPx, SOD1 and SOD2 when compared to both control and LPS groups ( p < 0.05 to p < 0.0001 ) (Fig. 7 I). Macrophages exhibited a similar pattern, where LPS elicitation mediated the increase in anti-oxidant enzymes expression, while SHBG application triggered a potentiation of their transcriptional induction (Fig. 7 J). A similar trend was observed in enzymatic activity, with LPS-treated PBMCs and macrophages showing increased CAT and SOD activities, which were further markedly elevated upon SHBG treatment (Fig. 7 K and 7 L). Total nitric oxide (NO) production followed a similar pattern: LPS stimulation induced a marked increase in NO levels in both PBMCs and macrophages, which was significantly attenuated by SHBG treatment (Fig. 7 D and 7 H). Secreted NO levels were elevated by LPS and reduced upon SHBG treatment ( p < 0.05 to p < 0.0001 ). Collectively, these results indicate that SHBG mitigates LPS-induced oxidative and nitrosative stress by modulating antioxidant enzyme expression and activity and by reducing both ROS and NO production in PBMCs and macrophages. 3.4. Impact of SHBG-treated PBMC-derived secretum on cytokine expression in equine SAT To evaluate the impact of PBMC-derived factors on adipose tissue inflammation, equine SAT explants were exposed to conditioned media from differently treated PBMCs. SAT treated with the secretum of LPS-stimulated PBMCs, characterized by elevated pro-inflammatory cytokines, exhibited a pronounced upregulation of pro-inflammatory genes including IL1B, IL6, IL18, TNF and MCP1 (Fig. 8 A), mimicking the inflammatory state observed during systemic inflammation. In contrast, exposure of SAT to the secretum from SHBG-treated, LPS-stimulated PBMCs reversed this response, resulting in reduced expression of the same pro-inflammatory genes and partial restoration of anti-inflammatory cytokine transcripts (IL10, IL4, IL13, TGF) (Fig. 8 B), which were strongly downregulated following exposure to LPS-PBMC secretum ( p < 0.0001 ). Building upon the transcriptional findings, immunohistochemical analysis revealed distinct differences in cytokine expression across experimental conditions within equine SAT (Fig. 8 A and 8 B). In control samples exposed to conditioned media derived from unstimulated PBMCs, both IL-1β and IL-6 exhibited moderate basal immunoreactivity, scored approximately as 2+. This staining was predominantly localized along the plasma membranes of mature adipocytes and within the stromal vascular fraction. The membranous staining pattern suggests a basal level of cytokine presence associated with cell surface signalling domains, while cytoplasmic immunoreactivity within stromal compartments indicates low-grade paracrine activity. Upon exposure to LPS-stimulated PBMCs-derived secreted factors, there was a marked and robust upregulation of both IL-1β and IL-6, with staining intensities reaching strong levels, approximately 4+. This enhanced immunoreactivity was diffusely distributed throughout the adipose tissue, with intense staining observed in adipocyte membranes and pronounced cytoplasmic accumulation, reflecting tissue inflammatory activation. Treatment with conditioned medium from LPS-stimulated PBMCs supplemented with SHBG resulted in a noticeable attenuation of cytokine immunoreactivity, with staining intensities reduced to nearly 2 + to 3+. This moderate expression level was characterized by focal and discontinuous staining along adipocyte membranes. The decreased intensity and more localized distribution suggest a partial reversal of LPS-induced inflammatory activation by SHBG. These findings indicate that SHBG modulates the immunoregulatory profile of PBMCs, which can in turn mitigate systemic inflammation-like responses in adipose tissue. 4. Discussion EMS is characterized by pathological obesity with abnormal accumulation of fat deposits and chronic inflammation, where adipose tissue dysfunction results in systemic inflammation and insulin resistance through the dysregulated production of inflammatory adipocytokines [ 27 , 28 ]. Pro-inflammatory cytokines including interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) are significantly elevated in both adipose tissue and serum of EMS-affected horses, creating a state of chronic low-grade inflammation. This inflammatory environment directly impairs insulin sensitivity in key metabolic tissues, establishing a self-perpetuating cycle where inflammation drives insulin resistance and metabolic dysfunction [ 29 , 30 ]. Additionally, elevated FFAs released from dysfunctional adipose tissue activate Toll-like receptor 4 (TLR-4)-mediated inflammatory pathways in skeletal muscle and visceral tissues, exacerbating systemic inflammation [ 31 ]. SHBG is traditionally recognized for its role in regulating sex steroid bioavailability; however, emerging evidence highlights its importance in modulating inflammatory processes and cellular metabolism beyond hormonal transport [ 14 ]. SHBG has been shown to influence inflammatory responses and metabolic functions across various cell types and species by interacting with immune signaling pathways, reducing oxidative and endoplasmic reticulum stress, and modulating cytokine production [ 32 – 35 ]. Therefore, the present study investigated how SHBG influences the inflammatory activation of equine immune cells in response to LPS, a potent pro-inflammatory stimulus. PBMCs and macrophages are integral to both innate and adaptive immunity and are directly implicated in the chronic inflammation characteristic of EMS. In adipose tissue, macrophages accumulate and adopt a pro-inflammatory phenotype, amplifying cytokine and chemokine secretion that sustains tissue inflammation and promotes systemic insulin resistance. Similarly, circulating PBMCs contribute to the inflammatory milieu through rapid secretion of cytokines such as IL-1β, TNF-α, IL-6, and IL-18 upon activation by damage-associated signals [ 30 , 36 ]. Loss or decreased levels of SHBG have been increasingly correlated with elevated inflammatory states and metabolic disturbances. Clinical and epidemiological studies report an inverse association between circulating SHBG concentrations and systemic inflammatory markers such as IL-6 and C-reactive protein (CRP). For instance, lower SHBG levels have been linked to increased risk and severity of metabolic syndrome, insulin resistance, and chronic inflammatory diseases, suggesting that SHBG may play a protective role in inflammatory homeostasis [ 37 – 40 ]. Mechanistically, inflammation itself can downregulate SHBG production, creating a vicious cycle exacerbating systemic inflammation [ 41 , 42 ]. Our findings reveal that SHBG exerts potent anti-inflammatory effects on LPS-stimulated equine PBMCs and macrophages. In both cell types, SHBG markedly reduced the secretion of major pro-inflammatory cytokines, including IL-1β, TNF-α, IL-6, and IL-18, while at the same time promoting an anti-inflammatory shift through increased IL-10 and modest enhancement of IL-4 and IL-13. Notably, multiplex profiling also showed a dampening of several chemokines (MCP-1/CCL2, RANTES/CCL5, GRO/CXCL1, and IL-8/CXCL8), suggesting that SHBG not only limits cytokine production but may also restrain the recruitment of additional immune cells into the inflammatory microenvironment. Together, these protein-level changes closely paralleled the gene expression data, reinforcing the translational relevance of SHBG’s immunomodulatory action and supporting its role as a regulator of inflammatory responses. Previous studies in various models provide mechanistic insight into the anti-inflammatory capacity of SHBG. Yamazaki et al. [ 35 ] found that SHBG inhibited LPS- and TNF-α-induced inflammatory cytokine accumulation in macrophages and adipocytes, possibly through suppression of NF-κB and MAPK signaling pathways, key regulators of cytokine gene transcription. Moreover, FitzGerald and colleagues [ 43 ] demonstrated that exercise-mediated increase of SHBG production correlate with lowered IL-1β and IL-6 circulating levels in athletic males. This aligns with our findings where SHBG treatment reduced both pro-inflammatory mRNA and protein levels, suggesting an attenuation of these inflammatory pathways in equine immune cells. Moreover, IL-10 elevation observed at protein and mRNA levels post-SHBG treatment likely enhances immune resolution. IL-10 is a well-characterized anti-inflammatory cytokine capable of suppressing NF-κB activation and downregulating TNF-α and IL-6 production, thereby mitigating the cytokine storm. TGF-β, another anti-inflammatory mediator induced by SHBG, limits immune responses and supports tissue repair. The upregulation of these cytokines may represent an SHBG-driven feedback mechanism counteracting inflammatory damage [ 44 , 45 ]. The crosstalk between SHBG and anti-inflammatory responses has already been evoked in a previous study, showing that the treatment of PCOS mice with Glucagon-like peptide-1 receptor agonist (GLP-1Ras) improves SHBG levels, and subsequently restores the levels of IL-10 and TGF-β anti-inflammatory mediators through the inhibition of the TLR4-NF-κB axis [ 46 ]. The regulation of chemokines MCP-1, RANTES, IL-8, and GRO was also attenuated by SHBG in LPS-stimulated cells. These chemokines contribute critically to immune cell trafficking and leukocyte infiltration into inflamed tissues, perpetuating chronic inflammation. SHBG's suppression of their expression could decrease inflammatory cell recruitment, an effect beneficial in chronic inflammatory states such as EMS [ 30 ]. Supporting these findings, another study reported that SHBG reduced MCP-1 expression in LPS-stimulated macrophages and adipocytes [ 35 ]. Additionally, SHBG was shown to attenuate MCP-1 expression in subcutaneous adipose tissue from EMS-affected horses, further highlighting its potential anti-inflammatory role in metabolic dysfunction [ 34 ]. Taken together, our results extend these clinical observations by demonstrating that SHBG can directly modulate the expression of key pro-inflammatory chemokines, including MCP-1, RANTES, IL-8, and GRO, in LPS-stimulated cells. This mechanistic evidence complements human and animal studies showing that low SHBG levels are associated with increased inflammatory mediators in metabolic disturbances, supporting the idea that SHBG functions not only as a biomarker but also as an active regulator of inflammatory pathways [ 47 ]. Notably, our previous study in EMS SAT demonstrated that SHBG treatment downregulated both protein disulfide-isomerase A3 (PDIA3) and extracellular signal-regulated kinase 1/2 (ERK1/2), key regulators of cellular stress and pro-inflammatory signaling [ 34 ]. PDIA3, initially defined as a chaperone protein involved in the unfolded protein response, has been shown to also promote immune activation and oxidative damage [ 48 ], while chronic activation of ERK1/2 modulates the transcription of pro-inflammatory cytokines via JNK/NF-κB pathways [ 49 ]. Considering that both PDIA3 and ERK1/2 are expressed in PBMCs and macrophages and are central to cytokines regulation [ 50 ], it is plausible that SHBG may mediate its anti-inflammatory effects in these cell populations through a similar PDIA3–ERK1/2-dependent mechanism. By reducing PDIA3 expression, SHBG could attenuate ERK1/2 activation, thereby suppressing downstream pro-inflammatory signaling and cytokine production. This mechanistic model provides a potential molecular explanation for the observed reductions in IL-1β, TNF-α, IL-6, and IL-18, and suggests that SHBG’s immunomodulatory role extends beyond adipose tissue to circulating immune cells. To investigate whether SHBG-mediated modulation of immune cells could influence adipose tissue inflammation, healthy SAT was cultured in conditioned media from control PBMCs, LPS-stimulated PBMCs, and LPS-stimulated PBMCs treated with SHBG. Exposure to media from LPS-activated PBMCs induced a marked inflammatory response in the SAT, as shown by increased mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, IL-18, TNF-α, IFNγ; MCP-1) and enhanced tissue staining of IL-1β and IL-6. These results suggest that SHBG’s anti-inflammatory effects on PBMCs can be transmitted to adipose tissue, reducing immune-mediated inflammation and promoting an anti-inflammatory environment. The observed protective effect in healthy SAT exposed to conditioned media from SHBG-treated PBMCs might be due, at least in part, to SHBG’s promotion of regulatory T cell (Treg) activation in PBMCs. Tregs, defined phenotypically as CD4 + CD25 + FOXP3 + positive cells, are main regulators of immune tolerance and mediate potent anti-inflammatory effects, primarily via secretion of IL-10 and TGF-β, along with suppression of effector T cells and macrophages [ 51 ]. In our study, SHBG treatment was associated with Tregs activation, which appears to be linked to the release of immunoregulatory cytokines from PBMCs. Specifically, we observed increased production of IL-4 and IL-13, predominantly secreted by CD4 + T helper 2 (Th2) cells, as well as IL-10, which can be produced by monocytes, macrophages, and Tregs themselves. This cytokine milieu provides a favorable environment for Tregs proliferation and functional activation, contributing to enhanced IL-10 secretion and the reinforcement of regulatory immune responses [ 52 ]. The molecular mechanisms underlying these immunoregulatory effects likely involve SHBG-mediated activation of PI3K/AKT signaling pathways in lymphocytes, as demonstrated by Balogh et al. [ 53 ], who reported that SHBG can bind to and be internalized by human T and B lymphocytes, modifying intracellular signaling pathways, such as Erk1/2 phosphorylation and AKT, independent of sex hormones, suggesting that SHBG can directly influence immune cell function. AKT signaling is crucial for Treg development, survival, and functional maintenance. Indeed, AKT activation promotes Foxp3 stability and enhances IL-10 production in regulatory T cells, while also supporting the differentiation of naive CD4 + T cells toward Th2 and Treg phenotypes, rather than pro-inflammatory Th1 or Th17 lineages [ 54 ]. This AKT-mediated mechanism could explain how SHBG protein promotes anti-inflammatory cytokine production (IL-4, IL-13, IL-10) while creating a regulatory immune environment, that favors Tregs expansion and function. Further support for SHBG's role in immune regulation comes from studies of conditions characterized by suppressed SHBG levels. In PCOS patients, where insulin resistance leads to decreased SHBG synthesis, a corresponding decrease in Treg cell populations and reduced levels of anti-inflammatory cytokines have been reported. This inverse relationship between SHBG levels and regulatory immune dysfunction provides additional evidence that SHBG may play a crucial role in maintaining immune homeostasis through Treg-mediated mechanisms [ 55 ]. In line with these observations, SHBG similarly modulated macrophage responses. In our study, the exposure of LPS-stimulated equine macrophages to SHBG promoted a shift from the pro-inflammatory M1 phenotype toward the anti-inflammatory M2 phenotype. This was evidenced by decreased expression of classical M1 markers CD80, CD86 and HLA-DR, and increased expression of M2-associated markers, including CD163, CD206 and Arginase-1, alongside corresponding changes in cytokine profiles, i.e. downregulation of IL-1β, TNF-α, and IL-6, and upregulation of IL-10 and TGF-β. Macrophage polarization is a dynamic process regulated by the surrounding microenvironment, where M1 macrophages are classically activated, producing high levels of pro-inflammatory cytokines, and M2 macrophages contribute to the resolution of inflammation and tissue repair through the release of anti-inflammatory mediators [ 56 ]. A major pathway involved in this phenotypic switch is signaling through the tumor-associated macrophages (TAM) family of receptor tyrosine kinases Tyro3, Axl, and MerTK. TAM receptor activation by the vitamin K-dependent ligands growth arrest-specific gene 6 (Gas6) and Protein S promotes efferocytosis of apoptotic cells and triggers anti-inflammatory signaling cascades, that drive macrophage reprogramming toward an M2 state, characterized by increased secretion of immunosuppressive cytokines such as IL-10 and TGF-β [ 57 ]. Studies have reported that Gas6 and Protein S contain an SHBG-like domain, consisting of two laminin G-like subdomains, which is essential for their binding to and activation of TAM receptors. The C-terminal SHBG-like regions of Gas6 and Protein S share sequence homology and structural similarity with SHBG itself [ 58 – 60 ]. Consequently, the existing structural homology between SHBG and the SHBG-like domains of Gas6 and Protein S suggests potential functional cross-reactivity with TAM receptors. The presence of these conserved laminin G-like subdomains in SHBG raises the possibility that the glycoprotein could directly engage these receptors on macrophages. Such interaction would enable SHBG to suppress NF-κB-mediated pro-inflammatory pathways, while activating downstream signals that promote M2 polarization and immune resolution [ 61 ]. This mechanism provides a plausible explanation for the observed macrophage reprogramming from M1 to M2 phenotype and suggests that SHBG's anti-inflammatory effects may be mediated through direct TAM receptor activation, although further mechanistic studies are required to validate this pathway. Oxidative stress, characterized by the excessive production of ROS and NO, is a hallmark of inflammatory activation in immune cells. Upon exposure to inflammatory stimuli such as LPS, both macrophages and PBMCs undergo metabolic reprogramming that leads to increased generation of these reactive molecules. ROS production occurs primarily through NADPH oxidase activation and mitochondrial dysfunction, while NO is generated via inducible nitric oxide synthase (iNOS) upregulation. Although these molecules serve important antimicrobial and signaling functions, their excessive accumulation contributes to cellular damage, perpetuates inflammatory responses, and disrupts immune homeostasis [ 62 ]. In the present research, the potential modulatory effects of SHBG on LPS-induced oxidative and nitrosative stress in equine macrophages and PBMCs were examined. SHBG treatment significantly attenuated intracellular ROS accumulation in both cell types, thereby mitigating the oxidative burst induced by LPS. Furthermore, SHBG enhanced the expression and enzymatic activity of key antioxidant defenses, including superoxide dismutase (SOD1/2) and catalase (CAT), collectively restoring the redox balance. In parallel, SHBG markedly reduced both intracellular and secreted NO levels, thereby attenuating LPS-induced nitrosative stress in equine macrophages and PBMCs. Reduced SHBG expression levels have previously been correlated with increased systemic oxidative stress in various metabolic and inflammatory conditions, underscoring a critical role for SHBG in mitigating oxidative damage. For instance, clinical studies have reported that patients with insulin resistance, obesity, or metabolic syndrome characterized by low SHBG levels exhibit elevated oxidative stress markers such as malondialdehyde (MDA) and oxidized low-density lipoprotein (ox-LDL), along with impaired antioxidant defenses. Similarly, experimental data show that oxidative stress itself suppresses SHBG expression, creating a pathological feedback loop that exacerbates redox imbalance [ 63 – 65 ]. Moreover, these findings align with emerging evidence from in vitro and clinical studies highlighting SHBG's direct antioxidant properties. For example, in human adipocytes and macrophages exposed to LPS, SHBG supplementation reduced ROS production, upregulated SOD, CAT, and Nrf2-mediated antioxidant defenses, and lowered lipid peroxidation markers including MDA [ 35 ]. Similarly, in PPARγ-depleted equine adipose stromal cells, SHBG application restored proper expression levels of CAT, SOD1/2, GPx, and Nrf2, that was attributed to an improvement of mitochondrial function and dynamics [ 66 ]. Additionally, Bourebaba et al. [ 67 ], showed that SHBG treatment of equine adipose-derived stromal cells affected by metabolic syndrome decreased both oxidative and nitrosative stress, through the upregulation of key antioxidant enzymes and the attenuation of ROS and NO production, thereby reestablishing redox homeostasis and mitigating oxidative damage. Collectively, these observations reinforce SHBG's protective role against ROS/NO-driven inflammation, and position it as a therapeutic candidate for redox-related disorders in veterinary and human medicine. 5. Conclusion This study provides evidence that SHBG exerts strong anti-inflammatory and antioxidant effects on equine immune cells exposed to LPS. SHBG limited the secretion of pro-inflammatory cytokines and chemokines, promoted regulatory cytokine production, and enhanced Tregs activation, thereby reinforcing anti-inflammatory feedback loops. In parallel, SHBG induced a phenotypic switch in macrophages from the pro-inflammatory M1 to the anti-inflammatory M2 state, while mitigating oxidative and nitrosative stress through the restoration of antioxidant defenses. Together, these findings position SHBG as a key regulator of immune homeostasis, capable of attenuating inflammation at multiple levels. As a perspective, future studies should explore whether these effects are mediated by direct receptor interactions such as a potential SHBG-TAM receptor complex, or by alternative intracellular signaling cascades, which may provide novel mechanistic insight and therapeutic opportunities in EMS and related inflammatory disorders. Declarations Ethics approval and consent to participate The collection of blood and adipose tissue samples from adult mares was approved by the Local Ethics Committee for Animal Experiments in Wrocław, PAN Ludwik Hirszfeld Institute of Immunology and Experimental Therapy in Wrocław (Instytut Immunologii i Terapii Doświadczalnej im. Ludwika Hirszfelda PAN we Wrocławiu), approval no. [058/2021/P1, on 23 September 2021], with informed consent obtained from the horse owners. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Funding The work was supported by a grant from the National Science Centre in Poland during the realization of the project: “Exploring the role and therapeutic potential of sex hormone binding globulin (SHBG) in the course of insulin resistance, inflammation, lipotoxicity in adipose stem progenitor cells and adipocytes in equine metabolic syndrome (EMS) mares.” (2019/35/B/NZ7/03651). Authors' contributions N.B. and L.B. conceived and designed the study. N.B. performed the experiments, conducted data analysis and statistical evaluation. J.D. collected and provided equine samples. N.B., J.D., M.P. and L.B. drafted the manuscript. L.B. critically reviewed the manuscript. All authors read and approved the final manuscript. Acknowledgments Not Applicable Availability of data and material The data that support the presented findings are available from the corresponding author, upon reasonable request. References Johnson PJ, Wiedmeyer CE, LaCarrubba A, (Seshu), Ganjam VK, Messer NT (eds) (2010) Laminitis and the Equine Metabolic Syndrome. Veterinary Clinics of North America: Equine Practice , 26 (2), 239–255. https://doi.org/10.1016/j.cveq.2010.04.004 Kronfeld DS, Treiber KH, Hess TM, Splan RK, Byrd BM, Staniar WB, White NW (2006) Metabolic Syndrome in Healthy Ponies Facilitates Nutritional Countermeasures against Pasture Laminitis. J Nutr 136(7). https://doi.org/10.1093/jn/136.7.2090S . 2090S-2093S Stefaniuk-Szmukier M, Piórkowska K, Ropka-Molik K (2023) Equine Metabolic Syndrome: A Complex Disease Influenced by Multifactorial Genetic Factors. Genes 14(8):1544. https://doi.org/10.3390/genes14081544 Frank N, Tadros EM (2014) Insulin dysregulation. Equine Vet J 46(1):103–112. https://doi.org/10.1111/evj.12169 Reynolds A, Keen JA, Fordham T, Morgan RA (2019) Adipose tissue dysfunction in obese horses with equine metabolic syndrome. Equine Vet J 51(6):760–766. https://doi.org/10.1111/evj.13097 Zak A, Siwinska N, Elzinga S, Barker VD, Stefaniak T, Schanbacher BJ, Adams AA (2020) Effects of equine metabolic syndrome on inflammation and acute-phase markers in horses. Domest Anim Endocrinol 72:106448. https://doi.org/10.1016/j.domaniend.2020.106448 McCullagh S, Keen J, Dosi M, Morgan R (2024) Bringing equine adipose tissue into focus. Equine Veterinary Educ 36(3):145–151. https://doi.org/10.1111/eve.13894 Ertelt A, Barton A-K, Schmitz RR, Gehlen H (2014) Metabolic syndrome: is equine disease comparable to what we know in humans? Endocr Connections 3(3):R81–R93. https://doi.org/10.1530/EC-14-0038 Basinska K, Marycz K, Śmieszek A, Nicpoń J (2015) The production and distribution of IL-6 and TNF-α in subcutaneous adipose tissue and their correlation with serum concentrations in Welsh ponies with equine metabolic syndrome. J Vet Sci 16(1):113. https://doi.org/10.4142/jvs.2015.16.1.113 Yao J, Wu D, Qiu Y (2022) Adipose tissue macrophage in obesity-associated metabolic diseases. Front Immunol 13:977485. https://doi.org/10.3389/fimmu.2022.977485 Zak A, Siwinska N, Elzinga S, Barker VD, Stefaniak T, Schanbacher BJ, Adams AA (2020) Effects of equine metabolic syndrome on inflammation and acute-phase markers in horses. Domest Anim Endocrinol 72:106448. https://doi.org/10.1016/j.domaniend.2020.106448 Frank N (2011) Equine Metabolic Syndrome. Veterinary Clin North America: Equine Pract 27(1):73–92. https://doi.org/10.1016/j.cveq.2010.12.004 Elzinga S, Wood P, Adams AA (2016) Plasma Lipidomic and Inflammatory Cytokine Profiles of Horses With Equine Metabolic Syndrome. J Equine Veterinary Sci 40:49–55. https://doi.org/10.1016/j.jevs.2016.01.013 Bourebaba N, Ngo T, Śmieszek A, Bourebaba L, Marycz K (2022) Sex hormone binding globulin as a potential drug candidate for liver-related metabolic disorders treatment. Biomed Pharmacother 153:113261. https://doi.org/10.1016/j.biopha.2022.113261 Thaler MA, Seifert-Klauss V, Luppa PB (2015) The biomarker sex hormone-binding globulin – From established applications to emerging trends in clinical medicine. Best Pract Res Clin Endocrinol Metab 29(5):749–760. https://doi.org/10.1016/j.beem.2015.06.005 Qu X, Donnelly R (2020) Sex Hormone-Binding Globulin (SHBG) as an Early Biomarker and Therapeutic Target in Polycystic Ovary Syndrome. Int J Mol Sci 21(21):8191. https://doi.org/10.3390/ijms21218191 Le TN, Nestler JE, Strauss JF, Wickham EP (2012) Sex hormone-binding globulin and type 2 diabetes mellitus. Trends Endocrinol Metabolism 23(1):32–40. https://doi.org/10.1016/j.tem.2011.09.005 Dinakaran A, Srinivasan A, Rajagambeeram R, Nanda SK, Daniel M (2024) SHBG and Insulin Resistance - Nexus revisited. Bioinformation 20(8):816–821. https://doi.org/10.6026/973206300200816 Abdel-latif A, Al-Jarhi UM, Hesham D, Khozam M, Fathy SA (2023) Sex hormone binding globulin (SHBG) as a predictor of liver fibrosis in subjects with nonalcoholic fatty liver disease (NAFLD). Egypt J Intern Med 35(1):38. https://doi.org/10.1186/s43162-023-00220-5 Yamazaki, H., Kushiyama, A., Sakoda, H., Fujishiro, M., Yamamotoya, T., Nakatsu,Y., … Asano, T. (2018). Protective Effect of Sex Hormone-Binding Globulin against Metabolic Syndrome: In Vitro Evidence Showing Anti-Inflammatory and Lipolytic Effects on Adipocytes and Macrophages. Mediators of Inflammation , 2018 , 1–12. https://doi.org/10.1155/2018/3062319 Bourebaba, L., Kępska, M., Qasem, B., Zyzak, M., Łyczko, J., Klemens, M., … Marycz,K. (2023). Sex hormone-binding globulin improves lipid metabolism and reduces inflammation in subcutaneous adipose tissue of metabolic syndrome-affected horses. Frontiers in Molecular Biosciences , 10 , 1214961. https://doi.org/10.3389/fmolb.2023.1214961 Patrone D, Alessio N, Antonucci N, Brigida AL, Peluso G, Galderisi U, Siniscalco D (2022) Optimization of Peripheral Blood Mononuclear Cell Extraction from Small Volume of Blood Samples: Potential Implications for Children-Related Diseases. Methods Protocols 5(2):20. https://doi.org/10.3390/mps5020020 Rio DC, Ares M, Hannon GJ, Nilsen TW (2010) Purification of RNA Using TRIzol (TRI Reagent). Cold Spring Harbor Protoc 2010(6):5439. pdb.prot https://doi.org/10.1101/pdb.prot5439 Fedchenko N, Reifenrath J (2014) Different approaches for interpretation and reporting of immunohistochemistry analysis results in the bone tissue – a review. Diagn Pathol 9(1):221. https://doi.org/10.1186/s13000-014-0221-9 Blondy, S., Durand, S., Lacroix, A., Christou, N., Bouchaud, C., Peyny, M., … Mathonnet,M. (2022). Detection of Glycosylated Markers From Cancer Stem Cells With ColoSTEM Dx Kit for Earlier Prediction of Colon Cancer Aggressiveness. Frontiers in Oncology , 12 , 918702. https://doi.org/10.3389/fonc.2022.918702 Meyerholz DK, Beck AP (2018) Principles and approaches for reproducible scoring of tissue stains in research. Lab Invest 98(7):844–855. https://doi.org/10.1038/s41374-018-0057-0 Basinska K, Marycz K, Śmieszek A, Nicpoń J (2015) The production and distribution of IL-6 and TNF-α in subcutaneous adipose tissue and their correlation with serum concentrations in Welsh ponies with equine metabolic syndrome. J Vet Sci 16(1):113. https://doi.org/10.4142/jvs.2015.16.1.113 Johnson PJ (2024) Equine metabolic syndrome: part 2. UK-Vet Equine 8(4):170–175. https://doi.org/10.12968/ukve.2024.8.4.170 Tadros EM, Frank N, Donnell RL (2013) Effects of equine metabolic syndrome on inflammatory responses of horses to intravenous lipopolysaccharide infusion. Am J Vet Res 74(7):1010–1019. https://doi.org/10.2460/ajvr.74.7.1010 Zak, A., Siwinska, N., Elzinga, S., Barker, V. D., Stefaniak, T., Schanbacher, B.J., … Adams, A. A. (2020). Effects of equine metabolic syndrome on inflammation and acute-phase markers in horses. Domestic Animal Endocrinology , 72 , 106448. https://doi.org/10.1016/j.domaniend.2020.106448 Ertelt A, Barton A-K, Schmitz RR, Gehlen H (2014) Metabolic syndrome: is equine disease comparable to what we know in humans? Endocr Connections 3(3):R81–R93. https://doi.org/10.1530/EC-14-0038 Bourebaba N, Sikora M, Qasem B, Bourebaba L, Marycz K (2023) Sex hormone-binding globulin (SHBG) mitigates ER stress and improves viability and insulin sensitivity in adipose-derived mesenchymal stem cells (ASC) of equine metabolic syndrome (EMS)-affected horses. Cell Communication Signal 21(1):230. https://doi.org/10.1186/s12964-023-01254-6 Kornicka-Garbowska K, Bourebaba L, Röcken M, Marycz K (2021) Sex Hormone Binding Globulin (SHBG) Mitigates ER Stress in Hepatocytes In Vitro and Ex Vivo. Cells 10(4):755. https://doi.org/10.3390/cells10040755 Bourebaba, L., Kępska, M., Qasem, B., Zyzak, M., Łyczko, J., Klemens, M., … Marycz,K. (2023). Sex hormone-binding globulin improves lipid metabolism and reduces inflammation in subcutaneous adipose tissue of metabolic syndrome-affected horses. Frontiers in Molecular Biosciences , 10 , 1214961. https://doi.org/10.3389/fmolb.2023.1214961 Yamazaki, H., Kushiyama, A., Sakoda, H., Fujishiro, M., Yamamotoya, T., Nakatsu,Y., … Asano, T. (2018). Protective Effect of Sex Hormone-Binding Globulin against Metabolic Syndrome: In Vitro Evidence Showing Anti-Inflammatory and Lipolytic Effects on Adipocytes and Macrophages. Mediators of Inflammation , 2018 , 1–12. https://doi.org/10.1155/2018/3062319 Reynolds A, Keen JA, Fordham T, Morgan RA (2019) Adipose tissue dysfunction in obese horses with equine metabolic syndrome. Equine Vet J 51(6):760–766. https://doi.org/10.1111/evj.13097 Osmancevic A, Daka B, Michos ED, Trimpou P, Allison M (2023) The Association between Inflammation, Testosterone and SHBG in men: A cross-sectional Multi‐Ethnic Study of Atherosclerosis. Clin Endocrinol 99(2):190–197. https://doi.org/10.1111/cen.14930 Gao Z, Liu K (2024) Association between systemic immunity-inflammation index and sex hormones in children and adolescents aged 6–19. Front Endocrinol 15:1355738. https://doi.org/10.3389/fendo.2024.1355738 Liao C-H, Li H-Y, Yu H-J, Chiang H-S, Lin M-S, Hua C-H, Ma W-Y (2012) Low serum sex hormone-binding globulin: Marker of inflammation? Clin Chim Acta 413(7–8):803–807. https://doi.org/10.1016/j.cca.2012.01.021 Milin-Lazović, J., Polovina, S., Šumarac-Dumanović, M., Stamenković-Pejković, D.,Jeremić, D., Cvijović, G., … Micić, D. (2013). SHBG and testosterone are associated with inflammation in obese men. Endocrine Abstracts . https://doi.org/10.1530/endoabs.32.P761 Simó R, Barbosa-Desongles A, Hernandez C, Selva DM (2012) IL1β Down-regulation of Sex Hormone-Binding Globulin Production by Decreasing HNF-4α Via MEK-1/2 and JNK MAPK Pathways. Mol Endocrinol 26(11):1917–1927. https://doi.org/10.1210/me.2012-1152 Liu N, Feng Y, Luo X, Ma X, Ma F (2022) Association Between Dietary Inflammatory Index and Sex Hormone Binding Globulin and Sex Hormone in U.S. Adult Females. Front Public Health 10:802945. https://doi.org/10.3389/fpubh.2022.802945 FitzGerald LZ, Robbins WA, Kesner JS, Xun L (2012) Reproductive hormones and interleukin-6 in serious leisure male athletes. Eur J Appl Physiol 112(11):3765–3773. https://doi.org/10.1007/s00421-012-2356-2 Acuner-Ozbabacan, E. S., Engin, B. H., Guven-Maiorov, E., Kuzu, G., Muratcioglu,S., Baspinar, A., … Nussinov, R. (2014). The structural network of Interleukin-10 and its implications in inflammation and cancer. BMC Genomics , 15 (S4), S2. https://doi.org/10.1186/1471-2164-15-S4-S2 Chen CC, Manning AM (1996) TGF-β1, IL-10 and IL-4 differentially modulate the cytokine-induced expression of IL-6 and IL-8 in human endothelial cells. Cytokine 8(1):58–65. https://doi.org/10.1006/cyto.1995.0008 Zhang, Y., Lin, Y., Li, G., Yuan, Y., Wang, X., Li, N., … Ding, X. (2023). Glucagon-like peptide-1 receptor agonists decrease hyperinsulinemia and hyperandrogenemia in dehydroepiandrosterone-induced polycystic ovary syndrome mice and are associated with mitigating inflammation and inducing browning of white adipose tissue. Biology of Reproduction , 108 (6), 945–959. https://doi.org/10.1093/biolre/ioad032 Elkholi DGEY, Hammoudah SF (2012) Subclinical inflammation in obese women with polycystic ovary syndrome. Middle East Fertility Soc J 17(3):195–202. https://doi.org/10.1016/j.mefs.2012.02.004 Wang W-T, Sun L, Sun C-H (2019) PDIA3-regulted inflammation and oxidative stress contribute to the traumatic brain injury (TBI) in mice. Biochem Biophys Res Commun 518(4):657–663. https://doi.org/10.1016/j.bbrc.2019.08.100 Lucas RM, Luo L, Stow JL (2022) ERK1/2 in immune signalling. Biochem Soc Trans 50(5):1341–1352. https://doi.org/10.1042/BST20220271 Meng F, Lowell CA (1997) Lipopolysaccharide (LPS)-induced Macrophage Activation and Signal Transduction in the Absence of Src-Family Kinases Hck, Fgr, and Lyn. J Exp Med 185(9):1661–1670. https://doi.org/10.1084/jem.185.9.1661 Singer M, Elsayed AM, Husseiny MI (2024) Regulatory T-cells: The Face-off of the Immune Balance. Front Bioscience-Landmark 29(11):377. https://doi.org/10.31083/j.fbl2911377 Zong Y, Deng K, Chong WP (2024) Regulation of Treg cells by cytokine signaling and co-stimulatory molecules. Front Immunol 15:1387975. https://doi.org/10.3389/fimmu.2024.1387975 Balogh, A., Karpati, E., Schneider, A. E., Hetey, S., Szilagyi, A., Juhasz, K., …Than, N. G. (2019). Sex hormone-binding globulin provides a novel entry pathway for estradiol and influences subsequent signaling in lymphocytes via membrane receptor. Scientific Reports , 9 (1), 4. https://doi.org/10.1038/s41598-018-36882-3 Pompura SL, Dominguez-Villar M (2018) The PI3K/AKT signaling pathway in regulatory T-cell development, stability, and function. J Leukoc Biol 103(6):1065–1076. https://doi.org/10.1002/JLB.2MIR0817-349R Yang Y, Xia J, Yang Z, Wu G, Yang J (2021), May 28 The Abnormal Expression of HSP70 Is Related to Treg / Th17 Imbalance in PCOS Patients. In Review. https://doi.org/10.21203/rs.3.rs-502127/v1 Chen, S., Saeed, A. F. U. H., Liu, Q., Jiang, Q., Xu, H., Xiao, G. G., … Duo, Y.(2023). Macrophages in immunoregulation and therapeutics. Signal Transduction and Targeted Therapy , 8 (1), 207. https://doi.org/10.1038/s41392-023-01452-1 Myers KV, Amend SR, Pienta KJ (2019) Targeting Tyro3, Axl and MerTK (TAM receptors): implications for macrophages in the tumor microenvironment. Mol Cancer 18(1):94. https://doi.org/10.1186/s12943-019-1022-2 Manfioletti G, Brancolini C, Avanzi G, Schneider C (1993) The protein encoded by a growth arrest-specific gene (gas6) is a new member of the vitamin K-dependent proteins related to protein S, a negative coregulator in the blood coagulation cascade. Mol Cell Biol 13(8):4976–4985. https://doi.org/10.1128/MCB.13.8.4976 Lemke G (2013) Biology of the TAM Receptors. Cold Spring Harb Perspect Biol 5(11):a009076–a009076. https://doi.org/10.1101/cshperspect.a009076 Li F, Xu L, Li C, Hu F, Su Y (2024) Immunological role of Gas6/TAM signaling in hemostasis and thrombosis. Thromb Res 238:161–171. https://doi.org/10.1016/j.thromres.2024.05.002 Pastore M, Grimaudo S, Pipitone RM, Lori G, Raggi C, Petta S, Marra F (2019) Role of Myeloid-Epithelial-Reproductive Tyrosine Kinase and Macrophage Polarization in the Progression of Atherosclerotic Lesions Associated With Nonalcoholic Fatty Liver Disease. Front Pharmacol 10:604. https://doi.org/10.3389/fphar.2019.00604 Morris G, Gevezova M, Sarafian V, Maes M (2022) Redox regulation of the immune response. Cell Mol Immunol 19(10):1079–1101. https://doi.org/10.1038/s41423-022-00902-0 Sun, Y., Li, S., Liu, H., Bai, H., Hu, K., Zhang, R., … Fan, P. (2021). Oxidative stress promotes hyperandrogenism by reducing sex hormone-binding globulin in polycystic ovary syndrome. Fertility and Sterility , 116 (6), 1641–1650. https://doi.org/10.1016/j.fertnstert.2021.07.1203 Rahmatnezhad L, Moghaddam-Banaem L, Lak B, Shiva T, A., Rasuli J (2023) Free androgen index (FAI)’s relations with oxidative stress and insulin resistance in polycystic ovary syndrome. Sci Rep 13(1):5118. https://doi.org/10.1038/s41598-023-31406-0 Szybiak-Skora W, Cyna W, Lacka K (2025) New Insights in the Diagnostic Potential of Sex Hormone-Binding Globulin (SHBG)—Clinical Approach. Biomedicines 13(5):1207. https://doi.org/10.3390/biomedicines13051207 Marycz K, Wiatrak B, Irwin-Houston JM, Marcinkowska K, Mularczyk M, Bourebaba L (2024) Sex hormone binding globulin (SHBG) modulates mitochondrial dynamics in PPARγ-depleted equine adipose derived stromal cells. J Mol Med 102(8):1015–1036. https://doi.org/10.1007/s00109-024-02459-z Bourebaba N, Sikora M, Qasem B, Bourebaba L, Marycz K (2023) Sex hormone-binding globulin (SHBG) mitigates ER stress and improves viability and insulin sensitivity in adipose-derived mesenchymal stem cells (ASC) of equine metabolic syndrome (EMS)-affected horses. Cell Communication Signal 21(1):230. https://doi.org/10.1186/s12964-023-01254-6 Additional Declarations The authors declare no competing interests. Supplementary Files SupplementarymaterialS1.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7698110","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":519655464,"identity":"f926cdc8-861c-4e3b-8105-2407a80c89b6","order_by":0,"name":"Nabila Bourebaba","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJUlEQVRIiWNgGAWjYFACHoYDDxgYEkBMZgaGAwz8UHHGBiA+gEtLArIWyQaEFgZcWhhQtBgcIKDFnP3swQMJNQx5/BK5Dx8X1NyRN76Re0y6gsFGdsMB3gPYtFj25CUcSDjGUCw5I93YeMaxZ4bbbuSlSZ5hSDPecIAvAZsWgwM5BgcS2BgSN9xIY5PmYTvMuO1GjtnNBobDiRsO8Bhg1XL+DVDLP7AW9t88/w7bb54B1vIft5YbQFsS2yC2MPO2AQ2XAGs5gEfLu4QDiX0SxZI9z5ilZ/Y9S55x5l36zwaDZOOZh3H45Xzu4Q8fvtnk8bOnMX4u+HbHtr8997BhQ4WdbN/x3oMPsGiBAglkDg/IKCBm5sGtAQ3wYDBGwSgYBaNgZAMAbx91lxb3YMMAAAAASUVORK5CYII=","orcid":"","institution":"Wrocław University of Environmental and Life Sciences","correspondingAuthor":true,"prefix":"","firstName":"Nabila","middleName":"","lastName":"Bourebaba","suffix":""},{"id":519655465,"identity":"2cdcbc1d-2965-44aa-8d1e-fb45ad7441df","order_by":1,"name":"Justyna Domagała","email":"","orcid":"","institution":"Wrocław University of Environmental and Life Sciences","correspondingAuthor":false,"prefix":"","firstName":"Justyna","middleName":"","lastName":"Domagała","suffix":""},{"id":519655466,"identity":"ae280709-9508-4f2b-8d54-103f9217cef4","order_by":2,"name":"Marta Pander","email":"","orcid":"","institution":"Wrocław University of Environmental and Life Sciences","correspondingAuthor":false,"prefix":"","firstName":"Marta","middleName":"","lastName":"Pander","suffix":""},{"id":519655467,"identity":"4af39389-9a74-4443-92a3-ebb90d451fc5","order_by":3,"name":"Lynda Bourebaba","email":"","orcid":"","institution":"Wrocław University of Environmental and Life Sciences","correspondingAuthor":false,"prefix":"","firstName":"Lynda","middleName":"","lastName":"Bourebaba","suffix":""}],"badges":[],"createdAt":"2025-09-24 00:33:33","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-7698110/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7698110/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92135098,"identity":"e8158619-deb2-4ad8-9527-0636fca4d594","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14916146,"visible":true,"origin":"","legend":"","description":"","filename":"BourebabaN.etalManuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/1227450f72a674eebb0261b9.docx"},{"id":92135055,"identity":"4d24c765-786c-4a54-95c7-6ac07b35a695","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":342,"visible":true,"origin":"","legend":"","description":"","filename":"rs7698110.json","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/bb634ee1a4dd151b387495ce.json"},{"id":92135066,"identity":"3695d92d-a7af-4d48-8d36-fa8384f6c56c","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":195339,"visible":true,"origin":"","legend":"","description":"","filename":"rs76981100enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/f8b1a97f19d21ca134d43cbd.xml"},{"id":92135057,"identity":"d1311802-cc54-4d86-8055-4c54e70cb398","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65917,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/c50624a965fd541f03c04449.png"},{"id":92135657,"identity":"19510d07-9354-49da-b3cc-5e1edee4a6aa","added_by":"auto","created_at":"2025-09-25 04:36:49","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":294839,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/b8699c565e72c60e41b141d7.png"},{"id":92135547,"identity":"77ae1883-9ee4-481e-886d-0a1cd9334b76","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/c461f25e9a55f76e642a99e7.jpeg"},{"id":92135063,"identity":"851bb08b-3801-4bee-a306-a56fdbd97933","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3054,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage12.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/5095ae6ed2e9c6bcba177490.jpeg"},{"id":92135067,"identity":"72349e7f-d1ba-4594-a09c-2cc572d2674d","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":438510,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/6c6595f34abc8ab0e30ce342.jpeg"},{"id":92135060,"identity":"96dc2746-0021-4c71-af4f-ec45abc95e10","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/098bdc72770b2fe58698420b.jpeg"},{"id":92136264,"identity":"67b84b6d-f3d1-42d5-8873-e20e61affbd5","added_by":"auto","created_at":"2025-09-25 04:44:49","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/02673201a6cfce55a91ca38d.jpeg"},{"id":92135550,"identity":"52c3b1b4-b4e2-475f-a187-204911de871f","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":350412,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/bce71179b663e90ba71349b8.png"},{"id":92135556,"identity":"306b0485-da2e-4a0a-96cc-352609409b72","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":156460,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/193ad5c7813fa88173e85815.png"},{"id":92135087,"identity":"ff0ee6f5-1063-445b-8c5b-4425bac69425","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/e40db5a1c235cef61946491a.jpeg"},{"id":92135552,"identity":"e979db46-3da5-44c6-b3f3-42bba3073195","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":382162,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/bc57655d4133f5556918363c.png"},{"id":92135660,"identity":"00607707-53bd-4445-b8a3-69169e15fb85","added_by":"auto","created_at":"2025-09-25 04:36:49","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":426494,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/d37f84741e0ec5692782d3c7.png"},{"id":92135074,"identity":"97baec78-2c4f-4f32-b1f1-36909dda8fd9","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97807,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/8274b99df7f04a8f0c361dd7.jpeg"},{"id":92136576,"identity":"77ebeab2-11bf-490b-b1e7-a3b0d9012a25","added_by":"auto","created_at":"2025-09-25 04:52:49","extension":"jpeg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":77426,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/150864f04146f20d2acd93ad.jpeg"},{"id":92135555,"identity":"80fcae55-e76a-4dd8-9e51-d9b434e84d54","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"jpeg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107337,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/60a675e5992820cc100d5fee.jpeg"},{"id":92135560,"identity":"10b60635-bac2-475a-80cf-d0989a0a9fcb","added_by":"auto","created_at":"2025-09-25 04:28:50","extension":"jpeg","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":154124,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/fb6874d7f1a9d045ae0137ab.jpeg"},{"id":92135077,"identity":"9374c6b7-dc30-495a-887a-ebd034bca483","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"jpeg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79036,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/5afe8224697e1b52c66e49f6.jpeg"},{"id":92135557,"identity":"2e0f8735-d313-4145-9d16-33a4507c3ea8","added_by":"auto","created_at":"2025-09-25 04:28:50","extension":"jpeg","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":75949,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/9da2781ae4bdaa1251b7350a.jpeg"},{"id":92135554,"identity":"edfaea33-611f-4dda-9792-aea50731724a","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"jpeg","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":129362,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/d3660c9089eafc8aaa5bc2e4.jpeg"},{"id":92135069,"identity":"4ae5e3f5-9f78-4fc5-9f4b-1df335ec87b2","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19274,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/e7497af849577792e1cedead.png"},{"id":92135073,"identity":"17eea80f-c1d5-45c6-a0bd-9eb102353ac9","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":58110,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/2d8d12244a24dff482eedf5a.png"},{"id":92135096,"identity":"ba6cddd5-4e41-494a-91fc-b371cbad970d","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/ea3e91323ba0f6397bda96f9.png"},{"id":92135078,"identity":"264432aa-3220-4723-be17-2430016d7ae6","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1064,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage12.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/4a767759c556727cf6760982.png"},{"id":92135088,"identity":"f622a91a-fab1-4850-b65b-8d6274391af9","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":54647,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/b8ef6b52e52c635ebac3b061.png"},{"id":92135092,"identity":"d54a28d2-6743-4c83-83a6-cf10194d0aa0","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/914fb03595ce589dc8843735.png"},{"id":92135080,"identity":"1cd84503-36e4-4e08-b584-4ed88f56622f","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/b4f78172c5091a1c9148879c.png"},{"id":92135558,"identity":"6ec83446-d088-4265-97e9-80e0c1c8e078","added_by":"auto","created_at":"2025-09-25 04:28:50","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79782,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/69892d2f264ba9566e024871.png"},{"id":92135090,"identity":"f242dd7f-69d7-4934-8cbe-65251f7fb9cb","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51150,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/c3760b13816fb3bc2800e397.png"},{"id":92135091,"identity":"9a9adbdd-5336-4c11-98ad-a158eb6ad9bc","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/62c1abcc07c22ff3fa9ce617.png"},{"id":92135094,"identity":"e2ffc88a-98fd-4485-b678-b796f5d243dc","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":63118,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/7812f5b1b8014e612d42a407.png"},{"id":92135661,"identity":"88d2d3fe-2ab5-4f72-80c5-3ec2664fe472","added_by":"auto","created_at":"2025-09-25 04:36:50","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":69082,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/4feffbc389c304d3ef8500aa.png"},{"id":92135100,"identity":"4b0e2867-3bfa-44c8-bf18-0777535f9f15","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":31754,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/e2458f6638fa0cba143b60f4.png"},{"id":92135562,"identity":"1b41f14d-7102-4b86-bb44-55a8a03571f6","added_by":"auto","created_at":"2025-09-25 04:28:50","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":24134,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/3cdb1feb2c7ebc5ed698e8a4.png"},{"id":92135559,"identity":"f716985c-d1ee-43b8-a3cb-7659eea8c19f","added_by":"auto","created_at":"2025-09-25 04:28:50","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":39850,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/47bc6a101422da4f6fefb18a.png"},{"id":92135561,"identity":"80c27127-c6c5-465e-a40d-4d97042a9a8a","added_by":"auto","created_at":"2025-09-25 04:28:50","extension":"png","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":55007,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/e3557094d554eae7a9bee1cb.png"},{"id":92135082,"identity":"5d565dab-9b3b-4232-a0b7-25f898bc1105","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":25632,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/4b69c01152c4212e8ac24f30.png"},{"id":92135083,"identity":"61dd74e1-668c-44e4-9119-b698f496a619","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26000,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/7fc380a8c6e3b90b95c2011a.png"},{"id":92135103,"identity":"48fdc85c-efe8-4993-970a-1c94aa2dbe7f","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"png","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":74330,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/6f2e9a24d618bae18605a30d.png"},{"id":92135102,"identity":"123b824f-eac8-420e-be5f-26542e953a34","added_by":"auto","created_at":"2025-09-25 04:20:50","extension":"xml","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":194673,"visible":true,"origin":"","legend":"","description":"","filename":"rs76981100structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/cdf29adc1ee1f8df0eb05803.xml"},{"id":92135564,"identity":"c7b78ec2-077a-49a1-b817-705b28cd6add","added_by":"auto","created_at":"2025-09-25 04:28:50","extension":"html","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":206606,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/bbc2ec7ea2e90a830e12c5d9.html"},{"id":92135053,"identity":"eeafeb03-5698-43ce-89a8-1940b4825c79","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":178165,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SHBG on LPS-induced cytokines and chemokines secretion in PBMCs and macrophages. Representative Bar Charts of multiplex cytokine and chemokine levels in equine PBMCs (A) and macrophages (B). Representative data from four independent experiments are shown ± SD (n = 4) are shown. Asterisks (*) indicate statistically significant differences between groups as specified. * \u003cem\u003ep\u0026lt;0.05\u003c/em\u003e, **\u003cem\u003ep\u0026lt; 0.01\u003c/em\u003e, ***\u003cem\u003ep\u0026lt;0.001\u003c/em\u003e, ****\u003cem\u003ep\u0026lt;0.0001\u003c/em\u003e. EqPBMCs_CTRL: control equine PBMCs; EqPBMCs_LPS: equine PBMCs stimulated with 8 µg/mL LPS; EqPBMCs_LPS + SHBG: equine PBMCs stimulated with 8 µg/mL LPS and treated with 50 nM SHBG. EqMφ_CTRL: control equine macrophages; EqMφ _LPS: equine macrophages stimulated with 8 µg/mL LPS; Eq EqMφ _LPS + SHBG: equine macrophages stimulated with 8 µg/mL LPS and treated with 50 nM SHBG.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/44e9666c7ea999f3ad269564.png"},{"id":92135054,"identity":"6e5bfe75-9cc2-433a-81c7-02b708d91fd9","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":734527,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SHBG on LPS-induced pro-inflammatory cytokine and chemokine gene expression in equine PBMCs and macrophages. Representative Bar-Charts of the relative gene expression of pro-inflammatory markers in PBMCs (A) and macrophages (B). Representative data from four independent experiments are shown ± SD (n = 4) are shown. Asterisks (*) indicate statistically significant differences between groups as specified. * \u003cem\u003ep\u0026lt;0.05\u003c/em\u003e, **\u003cem\u003ep\u0026lt; 0.01\u003c/em\u003e, ***\u003cem\u003ep\u0026lt;0.001\u003c/em\u003e, ****\u003cem\u003ep\u0026lt;0.0001\u003c/em\u003e. EqPBMCs_CTRL: control equine PBMCs; EqPBMCs_LPS: equine PBMCs stimulated with 8 µg/mL LPS; EqPBMCs_LPS + SHBG: equine PBMCs stimulated with 8 µg/mL LPS and treated with 50 ηM SHBG. EqMφ_CTRL: control equine macrophages; EqMφ _LPS: equine macrophages stimulated with 8 µg/mL LPS; Eq EqMφ _LPS + SHBG: equine macrophages stimulated with 8 µg/mL LPS and treated with 50 nM SHBG.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/d720069458b6a3a03b20eef1.png"},{"id":92135544,"identity":"1f15ca4c-1f2a-49af-b955-72cadae90f86","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":472660,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SHBG on LPS-induced anti-inflammatory factors expression in equine PBMCs and macrophages. Representative Bar-Charts of the relative gene expression of selected anti-inflammatory genes in PBMCs (A) and macrophages (B). Asterisks (*) indicate statistically significant differences between groups as specified. * \u003cem\u003ep\u0026lt;0.05\u003c/em\u003e, **\u003cem\u003ep\u0026lt; 0.01\u003c/em\u003e, ***\u003cem\u003ep\u0026lt;0.001\u003c/em\u003e, ****\u003cem\u003ep\u0026lt;0.0001\u003c/em\u003e. EqPBMCs_CTRL: control equine PBMCs; EqPBMCs_LPS: equine PBMCs stimulated with 8 µg/mL LPS; EqPBMCs_LPS + SHBG: equine PBMCs stimulated with 8 µg/mL LPS and treated with 50 ηM SHBG. EqMφ_CTRL: control equine macrophages; EqMφ _LPS: equine macrophages stimulated with 8 µg/mL LPS; Eq EqMφ _LPS + SHBG: equine macrophages stimulated with 8 µg/mL LPS and treated with 50 nM SHBG.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/89510426142138f7bb9d77ef.png"},{"id":92135543,"identity":"5ebc6c12-d603-45c2-a5b4-9fea565769e2","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":341334,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of SHBG on T regulatory cells activation within the PBMCs population. Representative Bar-Charts of the relative percentage of Tregs positive cells (A). Representative flow cytometry overlay histograms depicting fluorescence intensity distributions of stained cell populations (B). Asterisks (*) indicate statistically significant differences between groups as specified. \u003cem\u003e* p\u0026lt;0.05\u003c/em\u003e, \u003cem\u003e**p\u0026lt; 0.01\u003c/em\u003e, \u003cem\u003e***p\u0026lt;0.001\u003c/em\u003e, \u003cem\u003e****p\u0026lt;0.0001\u003c/em\u003e. EqPBMCs_CTRL: control equine PBMCs; EqPBMCs_LPS: equine PBMCs stimulated with 8 µg/mL LPS; EqPBMCs_LPS + SHBG: equine PBMCs stimulated with 8 µg/mL LPS and treated with 50 nM SHBG.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/05ece099dc6d995b9fbc6b6b.png"},{"id":92135546,"identity":"76096908-96e9-4f28-a673-ce5eb2b87ab8","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":571804,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SHBG on macrophages polarization. Bar-Charts depicting the relative percentages of M1 and M2 positive cells (A). Representative flow cytometry overlay histograms depicting fluorescence intensity distributions of stained cell populations (B). Asterisks (*) indicate statistically significant differences between groups as specified. \u003cem\u003e* p\u0026lt;0.05, **p\u0026lt; 0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001\u003c/em\u003e. EqMφ_CTRL: control equine macrophages; EqMφ _LPS: equine macrophages stimulated with 8 µg/mL LPS; Eq EqMφ _LPS + SHBG: equine macrophages stimulated with 8 µg/mL LPS and treated with 50 nM SHBG.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/db3aadf45728a912b2f0f138.png"},{"id":92135545,"identity":"e641415c-0cd0-4e20-bbf0-6cc12e3b3927","added_by":"auto","created_at":"2025-09-25 04:28:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":454622,"visible":true,"origin":"","legend":"\u003cp\u003eInfluence of SHBG on macrophages morphology under pro-inflammatory milieu. Representative photomicrographs of stained macrophages for nuceli (DAPI), F-actin (Phalloidin) and mitochondria (MitoRed); scale bar size 18 μm; magnification set at 60-folds. EqMφ_CTRL: control equine macrophages; EqMφ _LPS: equine macrophages stimulated with 8 µg/mL LPS; Eq EqMφ _LPS + SHBG: equine macrophages stimulated with 8 µg/mL LPS and treated with 50 nM SHBG.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/b6ebc6a8086ab20b209c9b25.png"},{"id":92135081,"identity":"e508c375-d849-4f02-b031-6d3d0f70ae96","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":656530,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SHBG on oxidative and nitrosative stress in inflamed PBMCs and Macrophages. Dot-Plots for intracellular ROS production in PBMCs (A). Dot-Plots for intracellular nitric oxide production in PBMCs (B). Average percentages of total ROS\u003csup\u003e+\u003c/sup\u003e and ROS\u003csup\u003e− \u003c/sup\u003ein PBMCs (C). Average percentages of total nitric oxide production in PBMCs (D). Dot-Plots for intracellular ROS production in macrophages (E). Dot-Plots for intracellular nitric oxide production in macrophages (F). Average percentages of total ROS\u003csup\u003e+\u003c/sup\u003e and ROS\u003csup\u003e−\u003c/sup\u003e in macrophages (G). Average percentages of total nitric oxide production in macrophages (H). Representative Bar-Charts of the relative gene expression of selected antioxidant markers in PBMCs (I). Representative Bar-Charts of the relative gene expression of selected antioxidant enzymes markers in macrophages (J). Representative Bar-Charts of antioxidant enzymes activity in PBMCs (K) and macrophages (L). Asterisks (*) indicate statistically significant differences between groups as specified. \u003cem\u003e* p\u0026lt;0.05, **p\u0026lt; 0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001\u003c/em\u003e. EqPBMCs_CTRL: control equine PBMCs; EqPBMCs_LPS: equine PBMCs stimulated with 8 µg/mL LPS; EqPBMCs_LPS + SHBG: equine PBMCs stimulated with 8 µg/mL LPS and treated with 50 ηM SHBG. EqMφ_CTRL: control equine macrophages; EqMφ_LPS: equine macrophages stimulated with 8 µg/mL LPS; Eq EqMφ _LPS + SHBG: equine macrophages stimulated with 8 µg/mL LPS and treated with 50 nM SHBG.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/b8f90d2fc9a84c842ffd1fa9.png"},{"id":92135065,"identity":"ba988d04-8465-457a-8dee-819b216aa595","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":915956,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of SHBG-treated PBMC-derived secretum on adipose tissue inflammation. Representative Bar-Charts of the relative gene expression of selected Pro-inflammatory (A) and anti-inflammatory genes (B). Representative photomicrographs of the immunohistochemical staining of tissue IL-1β (C). Representative photomicrographs of the immunohistochemical staining of tissue IL-6 (D). Asterisks (*) indicate statistically significant differences between groups as specified. \u003cem\u003e*p\u0026lt;0.05, **p\u0026lt; 0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001\u003c/em\u003e. EqSAT_CTRL: control equine subcutaneous adipose tissue co-cultured with control equine PBMCs; EqSAT_LPS: subcutaneous adipose tissue co-cultured with equine PBMCs stimulated with 8 µg/mL LPS; EqSAT_LPS + SHBG: subcutaneous adipose tissue co-cultured equine PBMCs stimulated with 8 µg/mL LPS and treated with 50 nM SHBG.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/6d223de693a114c8d397abe2.png"},{"id":92188860,"identity":"d58d78ba-0273-44de-84a3-38f6e5716e65","added_by":"auto","created_at":"2025-09-25 14:54:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5636815,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/28b5d4f1-b36b-48ac-bb74-9769e2ae5f33.pdf"},{"id":92135059,"identity":"ca65b60d-9a75-490e-82a5-3917897965f8","added_by":"auto","created_at":"2025-09-25 04:20:49","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":229986,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarymaterialS1.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7698110/v1/1b50d9f1e86fe9a08a6f41ec.pptx"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eSex Hormone-Binding Globulin (SHBG) Modulates Inflammatory and Oxidative Stress Responses in Equine Immune Cells: Implications for Equine Metabolic Syndrome\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eEquine metabolic syndrome (EMS) is an endocrine disorder that has recently reached alarming proportions worldwide, posing a significant burden on both veterinary practice and the equestrian industry. The condition, formally introduced to the veterinary field in 2002 is defined as an array of interconnected clinical and pathophysiological abnormalities that include insulin dysregulation, excess adiposity or obesity, systemic low-grade inflammation and in advanced cases, laminitis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. While the exact etiology of EMS remains complex, previous reports have highlighted the involvement of both genetic and environmental factors, as well as prolonged overfeeding with high-energy index feed and current breeding methods, which result in pathological obesity, adiposity, dysregulation of glucose metabolism and endocrine dysfunctions [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eEMS pathophysiology is complex and encompasses various molecular and cellular changes not all fully understood. Insulin dysregulation (ID) and the resulting hyperinsulinemia are considered among the key metabolic disturbances contributing to EMS onset, particularly in association with excessive non-structural carbohydrates intake combined with reduced physical activity. ID leads to abnormal fluctuations in insulin secretion and impaired glucose homeostasis, which drive increased fat deposition, altered energy partitioning, and mitochondrial stress. These disturbances favor the development of oxidative stress and low-grade systemic inflammation, accompanied by the permanent activation of pro-inflammatory signaling pathways [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAdipose tissue (AT) plays a pivotal role in the pathophysiology of EMS, acting not only as an energy reservoir but also as an active endocrine and immunological organ. In the context of ID, excessive nutrient intake drives adipocyte hypertrophy and hyperplasia, leading to AT expansion and dysfunction. Hypertrophic adipocytes exhibit altered insulin signaling, reduced glucose uptake, and increased lipolysis, resulting in elevated free fatty acids (FFAs) release and ectopic fat deposition, which exacerbate systemic metabolic stress [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Dysfunctional AT also contributes to a chronic pro-inflammatory state. Enlarged adipocytes secrete increased levels of pro-inflammatory adipokines and cytokines such as TNF-α, IL-6, and leptin, while the secretion of anti-inflammatory mediators such as adiponectin is suppressed. These changes further impair insulin sensitivity, sustain low-grade inflammation, and promote oxidative stress. In parallel, infiltration of immune cells, particularly macrophages and eosinophils, amplifies the release of reactive oxygen species (ROS) and fibrogenic mediators, including TGF-β and connective tissue growth factor (CTGF) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eMacrophages play a central role in the pathophysiology of EMS, with implications both systemically and within the AT itself. In adipose depots, chronic nutrient overload and ID induce adipocyte stress, leading to the release of chemotactic signals such as monocyte chemoattractant protein-1 (MCP-1) and leptin adipokine. This recruits circulating monocytes, which differentiate into macrophages; that infiltrate AT and cluster around necrotic adipocytes. Once activated, these macrophages shift toward a pro-inflammatory M1-like phenotype, secreting cytokines such as TNF-α, IL-1β, and IL-6, which amplify local inflammation and exacerbate AT dysfunction. At the same time, their production of ROS and pro-fibrotic mediators contributes to extracellular matrix remodelling and fibrosis. The loss of balance with alternatively activated M2-like macrophages, which normally support tissue repair and maintain insulin sensitivity, further accelerates pathological remodelling [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSystemically, macrophages act as amplifiers of immune dysregulation in EMS. Circulating monocyte-derived macrophages infiltrate multiple tissues, releasing inflammatory mediators that sustain low-grade systemic inflammation, endothelial dysfunction, and organ fibrosis. Their crosstalk with eosinophils and T cells creates a chronic pro-inflammatory microenvironment, linking metabolic imbalance to immune activation and tissue damage. Thus, macrophages serve as a pivotal cellular mediator connecting AT dysfunction with systemic EMS manifestations [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eGiven the central role of chronic inflammation in EMS pathophysiology, regulatory mechanisms that can counteract immune activation and metabolic stress are of particular interest. One such factor is sex hormone\u0026ndash;binding globulin (SHBG), a glycoprotein primarily synthesized in the liver but also expressed in AT, where it can exert local and systemic effects. Beyond its well-established role in regulating sex hormones bioavailability, SHBG possesses direct anti-inflammatory properties that may mitigate EMS-related inflammation [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSHBG is a serum glycoprotein exhibiting high affinity and specificity to sex steroids. Its circulating levels are governed not only by androgens and estrogens, but also by thyroid hormones and various other metabolic influences [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Indeed, changes in circulating SHBG levels have been previously observed in various metabolic disorders. Low SHBG has been associated with polycystic ovary syndrome [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], metabolic syndrome and type 2 diabetes [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], insulin dysregulation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], and metabolic dysfunction-associated steatotic liver disease [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In these conditions, reduced SHBG contributes to increased free sex hormones, altered insulin signaling, and low-grade inflammation, highlighting its role as both a marker and mediator of metabolic and inflammatory disturbances relevant to EMS.\u003c/p\u003e\u003cp\u003eWhile reduced SHBG has been linked to adverse metabolic and inflammatory states, emerging evidence indicates that SHBG itself may actively modulate immune and metabolic pathways involved in EMS pathophysiology. SHBG has been shown to modulate macrophage activity, suppressing pro-inflammatory cytokines release while promoting a shift toward a more anti-inflammatory profile [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In AT, SHBG exerts anti-inflammatory effects by inhibiting the PDIA3/ERK axis. This results in a marked reduction of pro-inflammatory cytokines such as IL-6 and TNF-α, with additional, decreases in MCP-1 and PGE2, thereby contributing to the attenuation of inflammation in EMS [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBy dampening systemic inflammation, modulating immune-metabolic interactions, and improving AT homeostasis, SHBG may represent a protective factor against the progression of EMS. We therefore hypothesize that SHBG exerts these effects by modulating macrophage activation and attenuating local inflammation in subcutaneous adipose tissue (SAT), highlighting its potential as a therapeutic target to restore immune and metabolic balance.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Isolation of equine peripheral blood mononuclear cells (EqPBMCs)\u003c/h2\u003e\u003cp\u003eFresh blood was drawn from healthy adult horses through jugular venipuncture using sterile CPDA-1 anticoagulant blood bags. Peripheral blood mononuclear cells (PBMCs) were then isolated following the method outlined by Patrone et al. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Specifically, the blood cells were layered onto a Ficoll Histopaque\u0026reg;-1083 (Sigma-Aldrich, Poznań, Poland) density gradient and centrifuged at 400 \u0026times; g for 30 minutes at 25\u0026deg;C. The cells located in the buffy coat layer were carefully collected and washed three times with HBSS (Sigma-Aldrich, Poznań, Poland) and further used for subsequent monocytes purification or experimental settings.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Equine monocyte adhesion and macrophage differentiation\u003c/h2\u003e\u003cp\u003eIsolated PBMCs were plated in 6-well culture plates and incubated to allow monocytes to adhere to the surface of the wells. The adherence-based isolation was carried out by culturing the cells in RPMI 1640 medium (Sigma-Aldrich, Poznań, Poland) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich, Poznań, Poland) and 1% penicillin/streptomycin (P/S) at 37\u0026deg;C in a humidified atmosphere with 5% CO₂. Non-adherent cells were gently removed after 2 hours by washing with warm HBSS, leaving behind the adherent monocyte population. Flow cytometry analysis confirmed the monocyte population by positive staining for the lineage marker CD14 (Supplementary Figure S1). Pure monocytes were subsequently cultured for an additional 5 days in the same complete medium supplemented with 1 \u0026micro;g/mL of recombinant human GM-CSF (Thermo Fisher Scientific, Warsaw, Poland) to induce their differentiation into macrophages. The medium was replaced every 2 days during this period to maintain optimal culture conditions. Once differentiated, macrophages were ready for further experimental treatments and analyses.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Experimental design\u003c/h2\u003e\u003cp\u003eThe study was conducted to assess the inflammatory response induced by lipopolysaccharide (LPS) and the potential modulatory effect of SHBG on equine peripheral blood mononuclear cells (EqPBMCs) and macrophages (EqMƟ).\u003c/p\u003e\u003cp\u003eCells were first exposed to 8 \u0026micro;g/mL of lipopolysaccharides (LPS; \u003cem\u003eEscherichia coli\u003c/em\u003e O111:B4, Cat No. L4130, Sigma-Aldrich, Poznań, Poland) for 24 hours under standard culture conditions (37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e), and subsequently treated with 50 nM SHBG (Biosynth Ltd, Chemat, Gdańsk, Poland) for additional 24 hours. Control cells were cultured under identical conditions in the absence of any treatment.\u003c/p\u003e\u003cp\u003eFor both cell types, the following experimental groups were established:\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eEqMƟ_CTRL: Untreated control macrophages\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003eEqMƟ_ LPS: Macrophages stimulated with LPS to induce inflammation\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003eEqMƟ_LPS\u0026thinsp;+\u0026thinsp;SHBG: Macrophages stimulated with LPS and treated with 50 nM SHBG\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eCorrespondingly, the same groups were prepared for PBMCs with the following designations:\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eEqPBMC_CTRL: Untreated control PBMCs\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003eEqPBMC_LPS: PBMCs stimulated with LPS\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003eEqPBMC_LPS\u0026thinsp;+\u0026thinsp;SHBG: PBMCs co-treated with LPS and SHBG\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eFollowing treatment, cells and conditioned culture media were collected and processed according to the procedures described below for further analyses.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Multiplex immunoassay for cytokine quantification\u003c/h2\u003e\u003cp\u003eThe concentrations of multiple cytokines and growth factors, including IFNγ, IL-1α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-8/CXCL8, IL-10, IL-12 (p70), IL-13, IL-17a, IL-18, IP-10, TNFα, MCP-1, RANTES/CCL5, Eotaxin/CCL11, FGF-2, Fractalkine/CS3CL1, G-CSF, GM-CSF and GRO were measured using the Milliplex MAP Magnetic Bead Multiplex Assay Kit (EQCYTMAG-93K, Sigma Aldrich, Poznań, Poland). Briefly, 25 \u0026micro;L of standards, controls, or undiluted samples were added to designated wells, followed by 25 \u0026micro;L of assay buffer and 25 \u0026micro;L of the appropriate matrix solution. Next, 25 \u0026micro;L of premixed magnetic beads conjugated with analyte-specific antibodies were dispensed into each well. Plates were sealed, wrapped in foil, and incubated with agitation overnight at 4\u0026deg;C. After three washes using a magnetic separation device, 25 \u0026micro;L of detection antibodies were added and incubated for 1 h at room temperature, followed by a 30-minutes incubation with 25 \u0026micro;L of Streptavidin-Phycoerythrin. Wells were subsequently washed three times, and beads were resuspended in 150 \u0026micro;L of sheath fluid. Fluorescence was measured using a Bio-Plex 200 System (Bio-Rad, Hercules, CA, USA). Analyte concentrations were calculated from standard curves and final cytokine concentrations were expressed in pg/mL.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Evaluation of oxidative and nitrosative stress in treated cells\u003c/h2\u003e\u003cp\u003eOxidative stress has been evaluated by measuring the accumulation of ROS within experimental cells using the Muse\u0026reg; Oxidative Stress assay Kit (Merck Millipore, Poznań, Poland), following the manufacturer\u0026rsquo;s instructions. Equine PBMCs and macrophages were collected following each treatment, washed with PBS and resuspended in assay buffer. Afterwards, cells were labelled with the fluorescent ROS detection reagent working solution at a final ratio of 1:19 v/v in the dark during 30 minutes at 37\u0026deg;C in a controlled standard cell culture incubator.\u003c/p\u003e\u003cp\u003eThe levels of intracellular nitric oxide (NO) were measured via the Muse\u0026reg; Nitric Oxide Assay Kit. (Merck Millipore, Poznań, Poland) according to the manufacturer\u0026rsquo;s recommendations. Following the established treatment protocol, PBMCs and macrophages were harvested, washed with PBS and incubated in the presence of the detection probe working solution at a final ratio of 1:10 v/v, at 37\u0026deg;C for 30 minutes. Subsequently, the Muse\u0026reg; 7-AAD viability dye was added and the incubation extended to 5 minutes at room temperature in the dark for the discrimination between live and dead cells.\u003c/p\u003e\u003cp\u003eROS/NO-negative and ROS/NO-positive cells were quantified using the MUSE\u0026reg; Merck Millipore Cell Analyzer (Merck Millipore, Poznań, Poland).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Quantification of nitric oxide secretion\u003c/h2\u003e\u003cp\u003eEquine macrophages and PBMCs were seeded in 24-well plates and exposed to the different treatment conditions as described above. After incubation, culture supernatants were collected and centrifuged at 300 \u0026times; g for 5 minutes to remove cellular debris. NO production was determined by measuring nitrite accumulation using the Griess Reagent Kit (Thermo Fisher Scientific, Warsaw, Poland), according the manufacturer\u0026rsquo;s instructions. Briefly, equal volumes of each cell-free supernatant and Griess solution were mixed and incubated for 15 minutes at room temperature in the dark. Absorbance was afterwards measured at 540 nm using a microplate reader (Synergy H1, BioTek\u0026reg; Instruments, Inc., Warsaw, Poland). Nitrite concentrations were calculated based on a standard curve generated with sodium nitrite and expressed as \u0026micro;M NO.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Profiling of antioxidant enzymes activity in treated cells\u003c/h2\u003e\u003cp\u003eThe effect of SHBG protein treatment on antioxidant enzymes activity was assessed using the Superoxide Dismutase (SOD) Assay Kit-WST (ScienCell Research Laboratories, San Diego, USA) and the Catalase (CAT) Colorimetric Assay Kit (MyBioSource, San Diego, USA). Briefly, equine PBMCs and macrophages were exposed to LPS and SHBG protein for 24 hours each, washed with cold HBSS (Sigma-Aldrich, Poznań, Poland) and lysed using cold lysis buffer provided in the assay kits. Supernatants containing cellular proteins were afterwards collected for enzyme activity assays and total protein concentrations were estimated using the Pierce\u0026trade; BCA Protein Assay Kit (Thermo Fisher Scientific, Warsaw, Poland) following manufacturer\u0026rsquo;s protocol. For SOD activity determination, samples were incubated with WST working solution in microtiter plates following the manufacturer\u0026rsquo;s instructions, and absorbance was measured at 438 nm using a microplate reader (Synergy H1, BioTek\u0026reg; Instruments, Inc., Warsaw, Poland). Catalase activity was measured by monitoring the decomposition of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e with absorbance read at 240 nm. Enzyme activities were expressed as percentage of SOD activity reflecting the levels of superoxide radicals inhibition and nanomoles of decomposed H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e per minute per milligram of protein for CAT.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Regulatory T cell activation assay\u003c/h2\u003e\u003cp\u003eActivation of regulatory T cells (Tregs) was evaluated by flow cytometry using CD4, CD25, and Foxp3 markers. PBMCs from the three experimental conditions: EqPBMC_CTRL, EqPBMC_LPS, and EqPBMC_LPS\u0026thinsp;+\u0026thinsp;SHBG were collected following the defined treatments and washed twice with PBS. For surface staining, cells were resuspended in PBS and incubated with mouse anti-horse CD4 (MCA1078GA, 1:200; Abd Serotec, Hercules, CA, USA) and mouse anti-human/horse CD25-FITC (MA1-35144, 1:200; Thermo Fisher Scientific, Warsaw, Poland) for 30 minutes at 4\u0026deg;C in the dark. After two washes with PBS, cells were fixed and permeabilized using the eBioscience Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific, Warsaw, Poland) according to the manufacturer\u0026rsquo;s instructions. Intracellular staining was performed by incubating cells with anti-human / horse Foxp3-PE (61-5773-82, eBioscience, Thermo Fisher Scientific, Warsaw, Poland) for 30 minutes at 4\u0026deg;C in the dark.\u003c/p\u003e\u003cp\u003eStained cells were washed, resuspended in PBS, and analyzed on a BD LSR Fortessa flow cytometer using FACSDiva version 9.0 software (Becton Dickinson, San Jose, USA). The proportion of activated regulatory T cells (CD4+/CD25+/Foxp3+) was determined following appropriate gating strategies using the FlowJo software (TreeStar Inc., Ashland, OR, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Macrophage polarization analysis\u003c/h2\u003e\u003cp\u003eMacrophage polarization was assessed by flow cytometry using M1/M2 surface markers (CD80, CD86, HLA-DR, CD163, CD206) and the intracellular marker Arginase I (Arg1). The analysis included untreated control macrophages, LPS-stimulated macrophages, and macrophages co-treated with LPS and SHBG. Cells were harvested following each treatment, washed with PBS, centrifuged at 400 \u0026times; g, 10 minutes, room temperature, and resuspended in PBS for surface staining or in permeabilization buffer for intracellular staining.\u003c/p\u003e\u003cp\u003eFor intracellular Arg1 detection, cells were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich, Poznań, Poland) for 15 min at room temperature, permeabilized with 0.1% saponin in PBS for 15 minutes, washed in PBS containing 5% FBS, and incubated with APC-conjugated anti-human Arginase I antibody (clone ARG1; BioLegend, Cat. No. 369706) for 30 minutes at room temperature in the dark. Following washes, samples were incubated with appropriate secondary antibody for 30 minutes at room temperature in the dark and finally resuspended in PBS. Surface markers were stained by directly incubating cells with fluorochrome-conjugated antibodies for 30 minutes at room temperature in the dark in PBS supplemented with 5% FBS to reduce non-specific binding. The antibodies used were: PE-conjugated anti-human CD80 (B7-1) (BD Pharmingen, Cat. No. 566992), APC-conjugated anti-human CD86 (BD Pharmingen, Cat. No. 555660), PE-conjugated anti-human HLA-DR [L243] (Elabscience, Cat. No. E-AB-F1111D), PE-conjugated anti-human CD163 (Invitrogen, Cat. No. 12-1639-42) and PE-conjugated anti-human CD206 (BioLegend, Cat. No. 321106).\u003c/p\u003e\u003cp\u003eFlow cytometry was performed using a BD LSR Fortessa with FACSDiva version 9.0 flow cytometer equipped with an FCS Express 7.0 software (Becton Dickinson, San Jose, USA). Unstained controls were included for gating and compensation. The M1/M2 ratio was calculated by comparing mean fluorescence intensities of M1-associated markers to M2-associated markers.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10. Characterization of macrophage morphological changes\u003c/h2\u003e\u003cp\u003eMacrophages were grown onto glass coverslips in a 24-well plate and exposed to different treatment conditions as described above. Cells were afterwards rinsed twice with PBS and incubated with a MitoRed working solution (1:1000, Sigma-Aldrich, Poznań, Poland) during 30 minutes at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e for mitochondria staining. Next, excess MitoRed staining solution was removed, cells were washed three times with PBS and fixed for 30 minutes in a 4% paraformaldehyde solution (PFA, Sigma-Aldrich, Poznań, Poland) at room temperature. Cell membranes were then permeabilized using 0.1% Triton X- 100 (Sigma-Aldrich, Poznań, Poland) for 15 minutes at room temperature to facilitate intracellular staining. Following three PBS washes, F-actin filaments were labelled using the atto-488-conjugated phalloidin (1:800, Sigma Aldrich, Poznan, Poland) for 40 minutes in the dark. Nuclei were counterstained with DAPI using the Fluoroshield\u0026trade; mounting medium (Sigma-Aldrich, Poznań, Poland). Stained cells were observed using a laser scanning confocal microscope (Observer Z1 Confocal Spinning Disc V.2 Zeiss with live imaging chamber, Leica Microsystems, KAWA.SKA Sp. z o.o., Poland) and obtained photomicrographs were processed with the Fiji ImageJ Software (version 1.52n, Wayne Rasband, National Institutes of Health, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11. \u003cem\u003eEx vivo\u003c/em\u003e co-culture of equine subcutaneous adipose tissue (SAT) with treated PBMCs\u003c/h2\u003e\u003cp\u003eSubcutaneous adipose tissue (SAT) samples were freshly collected from healthy adult mares and transported in Dulbecco\u0026rsquo;s Phosphate Buffered Saline (DPBS, Sigma-Aldrich, Poznań, Poland) containing 1% penicillin-streptomycin (PS, Gibco, Thermo Fisher Scientific, Warsaw, Poland) to minimize the risk of bacterial contamination. Tissue specimens were cut into smaller fragments of approximately 50 mg each and washed twice with DPBS / 1% PS. The fragments were then placed into culture plates containing Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium low glucose (1000 mg/L), L-glutamine, and sodium bicarbonate (DMEM-LG, Gibco, Thermo Fisher Scientific, Warsaw, Poland) medium, supplemented with 0.2% bovine serum albumin (BSA, Sigma Aldrich, Poznań, Poland) and 1% PS and incubated for 2 hours to allow tissue stabilization before co-culture.\u003c/p\u003e\u003cp\u003ePBMCs were treated under three conditions as described above: untreated control, LPS exposure, LPS followed by 50 nM native SHBG (Biosynth Ltd, Chemat, Gdańsk, Poland) for 24 hours. Following their respective treatments, PBMCs were co-cultured with SAT fragments in basal culture medium for 24 hours at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e under sterile conditions.\u003c/p\u003e\u003cp\u003eThe SAT groups were named to reflect the PBMCs treatment conditions used to mimic systemic inflammation:\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eEqSAT_CTRL: SAT co-cultured with untreated PBMCs\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003eEqSAT_LPS: SAT co-cultured with LPS-stimulated PBMCs\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003eEqSAT_LPS\u0026thinsp;+\u0026thinsp;SHBG: SAT co-cultured with PBMCs treated with LPS and SHBG\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eAfter incubation, tissue pieces from each group were pooled, preserved in suitable reagents, and prepared for subsequent analyses as detailed below.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12. Immunohistochemical detection of IL-1β and IL-6 in treated SAT specimens\u003c/h2\u003e\u003cp\u003eSAT samples subjected to treatment described above were carefully washed with PBS and fixed in 10% neutral buffered formalin (NBF, Sigma Aldrich, Poznań, Poland) for 24 hours at room temperature. After fixation, tissues were rinsed, dehydrated through graded alcohols, and embedded in paraffin blocks. Using a Microm HM 340E rotary microtome (Zeiss, Oberkochen, Germany), paraffin-embedded samples were cut into 5 \u0026micro;m sections. The sections were then deparaffinized, rehydrated via graded descending ethanol series, and underwent antigen retrieval by incubation in Tris-buffer at 96\u0026deg;C for 20 minutes.\u003c/p\u003e\u003cp\u003eTo inhibit endogenous peroxidase and phosphatase activities, sections were treated with Dako REAL Peroxidase-Blocking Solution (Dako Cytomation Poland, Gdynia, Poland) for 10 minutes. The slides were incubated for 1 hour at room temperature with primary antibodies targeting IL-1β (Abcam, Cat. No. ab9722) and IL-6 (Affinity Biosciences, Cat. No. DF6087), prepared in the recommended antibody diluent.\u003c/p\u003e\u003cp\u003eVisualization of the antigen-antibody complexes was achieved using the Dako Real EnVision\u0026thinsp;+\u0026thinsp;System HRP Labelled Polymer Anti-Rabbit, coupled with the Liquid DAB\u0026thinsp;+\u0026thinsp;Substrate Chromogen System (Dako Cytomation Poland, Gdynia, Poland), as per the manufacturer\u0026rsquo;s guidelines. Cell nuclei were counterstained using Hematoxylin solution, Gill\u0026rsquo;s formulation No. III (Merck Millipore, Darmstadt, Germany). The stained sections were mounted using the Dako Faramount Aqueous Mounting Medium (Dako Cytomation Poland, Gdynia, Poland) and covered with glass coverslips.\u003c/p\u003e\u003cp\u003eMicroscopic examination was performed using an Axio Imager A1 light microscope (Zeiss, Oberkochen, Germany) at 10\u0026times; and 40\u0026times; objective magnifications, and images were recorded with a Canon PowerShot camera.\u003c/p\u003e\u003cp\u003eFor each section, 10 representative fields were randomly selected across the tissue, including both adipocyte-rich regions and stromal-vascular areas. Staining intensity and subcellular localization, including cytoplasmic and perivascular patterns characteristic of adipocytes and stromal cells, were visually assessed on a 0\u0026ndash;4 scale according to the manufacturer\u0026rsquo;s recommendations: 0, no staining; 1+, delicate staining; 2+, average staining; 3+, intense staining; and 4+, bright staining. Negative controls were included to confirm staining specificity. The scoring approach was informed by methodologies described in previous studies and used for reference and comparison [\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13. Gene expression analysis of inflammatory and antioxidant markers\u003c/h2\u003e\u003cp\u003eGene expression of key transcripts involved in inflammatory responses and antioxidant defenses (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) was assessed by real-time quantitative reverse transcription PCR (RT-qPCR). Total RNA was extracted from PBMCs, macrophages, and SAT explants of each experimental group using TRIzol reagent (Thermo Fisher Scientific, Warsaw, Poland), followed by chloroform phase separation and isopropanol/ethanol precipitation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and RNA purity as well as concentration were measured using a nanospectrophotometer (Synergy H1, BioTek\u0026reg; Instruments, Inc., Warsaw, Poland). Genomic DNA (gDNA) digestion and cDNA synthesis were performed using a Tetro\u0026trade; cDNA synthesis kit (Bioline, London, UK) in a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA) according to the manufacturer\u0026rsquo;s instructions. Detection of target mRNA expression was performed using the SensiFAST SYBR Green Kit (Bioline, London, UK) on a CFX Connect\u0026trade; Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). A total of 150 ng of cDNA was amplified in a total volume of 10 \u0026micro;l containing SYBR-Green Master Mix, forward and reverse primers and tested samples. Thermal cycling conditions were as follows: 95\u0026deg;C for 2 min, followed by 40 cycles at 95\u0026deg;C for 15 sec, annealing for 15 s, and elongation at 72\u0026deg;C for 15 s. All data were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression, and relative transcript levels were calculated using the RQ\u003csub\u003eMAX\u003c/sub\u003e log₂ algorithm.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSequences of primers used in qPCR.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence 5'\u0026ndash;3'\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003eAmplicon length (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAccession No.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL1B\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTATGTGTGTGATGCAGCTGTG ACTCAAATTCCACGTTGCCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e352\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001082526.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL6\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTCACTCCAGTTGCCTTCT GCCAGTACCTCCTTGCTGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e225\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001082496.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTNF\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCTACCCGTCCAAGGTCAA CTCATACCAGGGCTTGGCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e93\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001081819.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTGAACAACCTCACAGATGG CAGCCCTGCAGATTTCCTTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e110\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001082519.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL10\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTATGTTACCTGGTCTTCCTGG ACTCATGGCTTTGTAGACACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e461\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001082490.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL13\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGCAGTCATTGCTCTCGCTT CTCCACACCATGCTGCCATT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e144\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eXM_023616897.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL1RA\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGACCTCACGAGACTTCGGA\u003c/p\u003e\u003cp\u003eGCTTTAAGTAGGGCCGTGGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e829\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eXM_070234754.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL18\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGCACCCCAGACCGTATTTA\u003c/p\u003e\u003cp\u003eCGCTAGACCTCTAGTGAGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001082512.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eMCP1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCATTCCCTAAATGCCCCCT\u003c/p\u003e\u003cp\u003eGGGGTTCACAGAGGAAAGCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e194\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001081931.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTGF\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATTCCTGGCGCTACCTCAGT\u003c/p\u003e\u003cp\u003eGCTGGAACTGAACCCGTTGAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e197\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001081849.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSOD1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCATTCCATCATTGGCCGCAC\u003c/p\u003e\u003cp\u003eGAGCGATCCCAATCACACCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e130\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNW_001867397.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSOD2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGACAAACCTGAGCCCCAAT\u003c/p\u003e\u003cp\u003eTTGGACACCAGCCGATACAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e125\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNW_001867408.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCAT\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACCAAGGTTTGGCCTCACAA\u003c/p\u003e\u003cp\u003eTTGGGTCAAAGGCCAACTGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e112\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eXM_014729341.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGPx\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCGAGCCCAACTTCACACTC\u003c/p\u003e\u003cp\u003eAAGTTCCAGGCGACATCGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e178\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001166479.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF:\u003c/p\u003e\u003cp\u003eR:\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGATGCCCCAATGTTTGTGA AAGCAGGGATGATGTTCTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e250\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003eNM_001163856.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eIL1B\u003c/b\u003e: Interleukin 1 beta; \u003cb\u003eIL6\u003c/b\u003e: Interleukin 6; \u003cb\u003eTNF\u003c/b\u003e: Tumor Necrosis Factor; \u003cb\u003eIL4\u003c/b\u003e: Interleukin 4; \u003cb\u003eIL10\u003c/b\u003e: Interleukin 10; \u003cb\u003eIL13\u003c/b\u003e: Interleukin 13; \u003cb\u003eIL1RA\u003c/b\u003e: Interleukin 1 Receptor Antagonist, \u003cb\u003eIL18\u003c/b\u003e : Interleukin 18 ; \u003cb\u003eMCP1\u003c/b\u003e: Chemokine (C-C Motif) Ligand 2 (CCL2); \u003cb\u003eTGF\u003c/b\u003e: Transforming Growth Factor; \u003cb\u003eSOD1\u003c/b\u003e: Superoxide Dismutase 1; \u003cb\u003eSOD2\u003c/b\u003e: Superoxide Dismutase 2; \u003cb\u003eCAT\u003c/b\u003e: Catalase; \u003cb\u003eGPx\u003c/b\u003e: Glutathione Peroxidase; \u003cb\u003eGAPDH\u003c/b\u003e: Glyceraldehyde 3-Phosphate Dehydrogenase.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.14. Statistical analysis\u003c/h2\u003e\u003cp\u003eData were analyzed by one-way analysis of variance (ANOVA) using GraphPad Prism software (version 10.5.0, San Diego, CA, USA). Multiple group comparisons were performed using Tukey\u0026rsquo;s post-hoc test. Normality of the data was assessed with the Shapiro-Wilk test, and when assumptions of normality were not met, the nonparametric Kruskal-Wallis test was applied. Statistically significant differences are indicated as follows: \u003cem\u003e*p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e, \u003cem\u003e**p\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e, \u003cem\u003e***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e and \u003cem\u003e****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e. Results are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.1. SHBG modulates the expression of inflammatory cytokines and chemokines in LPS-stimulated equine PBMCs and macrophages\u003c/h2\u003e\u003cp\u003eTo investigate the anti-inflammatory and immunomodulatory effects of SHBG glycoprotein, the expression of key inflammatory mediators has been analysed. A bead-based multiplex immunoassay of secreted cytokines and chemokines demonstrated that LPS stimulation markedly increased the levels of pro-inflammatory mediators in both immune cell populations. In PBMCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), LPS exposure enhanced the protein levels of several immune-activating molecules including IL-2, IFN-γ, IL-10, and RANTES/CCL5, while SHBG treatment partially reversed these increases, significantly reducing pro-inflammatory mediators\u0026rsquo; levels and augmenting IL-10 and IL-13 protein expression. Similarly, in macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), LPS induced significant elevation of IL-6, TNF-α, IL-18, IL-12p70, with IL-1β exhibiting the highest increase compared to control cells (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e). Additionally, key chemoattractant proteins MCP-1/CCL2, GRO and RANTES/CCL5 were found to be critically elevated in the LPS stimulated cells. The subsequent treatment of LPS-stimulated macrophages with SHBG (50 nM) caused a substantial reduction in pro-inflammatory cytokine release as well as chemokines expression, indicating its anti-inflammatory potential. Additionally, SHBG treatment increased the levels of the immunomodulatory cytokine IL-10 compared to LPS alone. These findings suggest that SHBG modulates the inflammatory response by downregulating pro-inflammatory cytokines and chemokines and promoting anti-inflammatory mediators in both macrophages and PBMCs.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo complement the protein-level findings, expression of key inflammatory genes affected by LPS stimulation and SHBG treatment was further analysed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.A and 2.B, LPS-treated PBMCs and macrophages exhibited a significant increase in the gene expression of pro-inflammatory markers, including \u003cem\u003eIL1B\u003c/em\u003e, \u003cem\u003eIL1RA\u003c/em\u003e, \u003cem\u003eIL18\u003c/em\u003e, \u003cem\u003eIL6\u003c/em\u003e, \u003cem\u003eTNF\u003c/em\u003e, and MCP (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e, \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), as compared to untreated respective control cells. Notably, the treatment of inflamed cells with SHBG protein (50 nM) resulted in a marked downregulation of these same transcripts in both PBMCs and macrophages relative to untreated LPS-stimulated groups of cells (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e, \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo additionally substantiate the immunoregulatory potential of SHBG, the expression of genes involved in anti-inflammatory responses was examined. The exposure of both PBMCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA.) and macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB.) triggered the suppression of IL4, IL10, IL13, and TGF transcript levels when compared to unstimulated cells (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e), as a consequence of an acute inflammatory reaction onset. Interestingly, the application of SHBG to activated cells reversed the observed anti-inflammatory genes expression depletion, as evidenced by the visible higher IL4, IL10, IL13, and TGF mRNAs levels, by opposition to untreated inflamed cells (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.2. SHBG regulates immune cell responses in LPS-stimulated PBMCs and macrophages\u003c/b\u003e\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003c/ol\u003e\u003c/p\u003e\u003cp\u003eTo determine how SHBG influences immunomodulatory responses, the activation of regulatory T cells (Tregs) in equine PBMCs was analysed. Under LPS stimulation alone, the frequency of Tregs (CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e+\u003c/sup\u003e) was relatively low, reflecting the pro-inflammatory environment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In contrast, treatment with SHBG markedly increased the proportion of CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e+\u003c/sup\u003e cells, suggesting that SHBG promotes the expansion or maintenance of Tregs even in the context of inflammatory stimulation. These results are consistent with the previously observed upregulation of the immunoregulatory cytokines IL-10 and TGF-β, indicating that SHBG supports a regulatory immune phenotype in PBMCs.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eMacrophage polarization was further evaluated by flow cytometry using classical M1 markers (CD80, CD86, HLA-DR) and M2 markers (CD163, CD206, Arg1). In native, unstimulated macrophages, baseline expression of M1 and M2 markers was low and relatively balanced, reflecting a homeostatic state (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.A). LPS stimulation strongly induced M1 polarization, with a marked increase in CD80, CD86, and HLA-DR expression, while M2 marker expression remained minimal. In contrast, SHBG treatment significantly promoted M2 polarization, as evidenced by increased CD163, CD206, and Arg1 levels, accompanied by a concomitant reduction in M1 marker expression. Analysis of the M1/M2 ratio confirmed these observations: LPS induced a pronounced shift toward M1 dominance, whereas SHBG treatment shifted the balance toward M2 subtype (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e), supporting a more anti-inflammatory phenotype compared to LPS alone.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo further characterize macrophage polarization, cytoskeletal organization and mitochondrial activity were assessed using fluorescence confocal microscopy. In the control group, macrophages exhibited a small, rounded morphology characteristic of a homeostatic, non-activated state. Cells displayed compact cytoskeletal organization with sparse, short actin filaments and limited cytoplasmic extensions. Mitochondria appeared concentrated in the perinuclear region, consistent with basal metabolic activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Upon LPS stimulation, macrophages underwent substantial morphological changes typical of classical M1 polarization. Cells became broadly spread with elongated and thickened F-actin filaments, forming prominent filopodia and lamellipodia indicating enhanced cytoskeletal remodelling and motility. The mitochondrial network was more abundant and dispersed throughout the cytoplasm, reflecting increased energy demands and bioenergetic reprogramming linked to pro-inflammatory activation. In contrast, macrophages treated with SHBG following LPS stimulation exhibited an intermediate phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). They retained some cytoskeletal extension but showed reduced spreading and fewer actin-rich protrusions compared to LPS alone. Mitochondrial staining was less widespread, indicating partial restoration toward a metabolically less active state, consistent with a shift toward an anti-inflammatory, reparative macrophage phenotype. Together, these complementary approaches demonstrate that SHBG not only modulates macrophage surface marker expression but also influences their cytoskeletal architecture and mitochondrial organization, features integral to functional polarization states.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.3. SHBG attenuates oxidative and nitrosative stress in inflamed PBMCs and macrophages\u003c/h2\u003e\u003cp\u003eGiven the close relationship between inflammation and oxidative stress, intracellular ROS accumulation was evaluated. Obtained data demonstrated that LPS-induced inflammation was accompanied by a marked increased proportion of ROS-positive cells in both PBMCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC) and macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE, and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG) compared to controls (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e), while SHBG significantly reduced the overall ROS production in both cell types. Furthermore, the generated oxidative stress was associated with significant alterations in antioxidant enzymes expression in both PBMCs and macrophages following LPS treatment. In PBMCs, LPS stimulation significantly increased the expression of key anti-oxidant genes namely, CAT, GPx, SOD1 and SOD2 (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e to \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e) in contrast to resting cells, suggesting the establishment of a stress-mediated compensatory mechanism. Interestingly, SHBG treatment further augmented the transcript levels of CAT, GPx, SOD1 and SOD2 when compared to both control and LPS groups (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e to \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eI). Macrophages exhibited a similar pattern, where LPS elicitation mediated the increase in anti-oxidant enzymes expression, while SHBG application triggered a potentiation of their transcriptional induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eJ). A similar trend was observed in enzymatic activity, with LPS-treated PBMCs and macrophages showing increased CAT and SOD activities, which were further markedly elevated upon SHBG treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eK and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eL). Total nitric oxide (NO) production followed a similar pattern: LPS stimulation induced a marked increase in NO levels in both PBMCs and macrophages, which was significantly attenuated by SHBG treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eH). Secreted NO levels were elevated by LPS and reduced upon SHBG treatment (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e to \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e). Collectively, these results indicate that SHBG mitigates LPS-induced oxidative and nitrosative stress by modulating antioxidant enzyme expression and activity and by reducing both ROS and NO production in PBMCs and macrophages.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.4. Impact of SHBG-treated PBMC-derived secretum on cytokine expression in equine SAT\u003c/h2\u003e\u003cp\u003eTo evaluate the impact of PBMC-derived factors on adipose tissue inflammation, equine SAT explants were exposed to conditioned media from differently treated PBMCs. SAT treated with the secretum of LPS-stimulated PBMCs, characterized by elevated pro-inflammatory cytokines, exhibited a pronounced upregulation of pro-inflammatory genes including IL1B, IL6, IL18, TNF and MCP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), mimicking the inflammatory state observed during systemic inflammation. In contrast, exposure of SAT to the secretum from SHBG-treated, LPS-stimulated PBMCs reversed this response, resulting in reduced expression of the same pro-inflammatory genes and partial restoration of anti-inflammatory cytokine transcripts (IL10, IL4, IL13, TGF) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB), which were strongly downregulated following exposure to LPS-PBMC secretum (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e).\u003c/p\u003e\u003cp\u003eBuilding upon the transcriptional findings, immunohistochemical analysis revealed distinct differences in cytokine expression across experimental conditions within equine SAT (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA and \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). In control samples exposed to conditioned media derived from unstimulated PBMCs, both IL-1β and IL-6 exhibited moderate basal immunoreactivity, scored approximately as 2+. This staining was predominantly localized along the plasma membranes of mature adipocytes and within the stromal vascular fraction. The membranous staining pattern suggests a basal level of cytokine presence associated with cell surface signalling domains, while cytoplasmic immunoreactivity within stromal compartments indicates low-grade paracrine activity. Upon exposure to LPS-stimulated PBMCs-derived secreted factors, there was a marked and robust upregulation of both IL-1β and IL-6, with staining intensities reaching strong levels, approximately 4+. This enhanced immunoreactivity was diffusely distributed throughout the adipose tissue, with intense staining observed in adipocyte membranes and pronounced cytoplasmic accumulation, reflecting tissue inflammatory activation. Treatment with conditioned medium from LPS-stimulated PBMCs supplemented with SHBG resulted in a noticeable attenuation of cytokine immunoreactivity, with staining intensities reduced to nearly 2\u0026thinsp;+\u0026thinsp;to 3+. This moderate expression level was characterized by focal and discontinuous staining along adipocyte membranes. The decreased intensity and more localized distribution suggest a partial reversal of LPS-induced inflammatory activation by SHBG. These findings indicate that SHBG modulates the immunoregulatory profile of PBMCs, which can in turn mitigate systemic inflammation-like responses in adipose tissue.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eEMS is characterized by pathological obesity with abnormal accumulation of fat deposits and chronic inflammation, where adipose tissue dysfunction results in systemic inflammation and insulin resistance through the dysregulated production of inflammatory adipocytokines [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Pro-inflammatory cytokines including interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) are significantly elevated in both adipose tissue and serum of EMS-affected horses, creating a state of chronic low-grade inflammation. This inflammatory environment directly impairs insulin sensitivity in key metabolic tissues, establishing a self-perpetuating cycle where inflammation drives insulin resistance and metabolic dysfunction [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Additionally, elevated FFAs released from dysfunctional adipose tissue activate Toll-like receptor 4 (TLR-4)-mediated inflammatory pathways in skeletal muscle and visceral tissues, exacerbating systemic inflammation [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSHBG is traditionally recognized for its role in regulating sex steroid bioavailability; however, emerging evidence highlights its importance in modulating inflammatory processes and cellular metabolism beyond hormonal transport [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. SHBG has been shown to influence inflammatory responses and metabolic functions across various cell types and species by interacting with immune signaling pathways, reducing oxidative and endoplasmic reticulum stress, and modulating cytokine production [\u003cspan additionalcitationids=\"CR33 CR34\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Therefore, the present study investigated how SHBG influences the inflammatory activation of equine immune cells in response to LPS, a potent pro-inflammatory stimulus.\u003c/p\u003e\u003cp\u003ePBMCs and macrophages are integral to both innate and adaptive immunity and are directly implicated in the chronic inflammation characteristic of EMS. In adipose tissue, macrophages accumulate and adopt a pro-inflammatory phenotype, amplifying cytokine and chemokine secretion that sustains tissue inflammation and promotes systemic insulin resistance. Similarly, circulating PBMCs contribute to the inflammatory milieu through rapid secretion of cytokines such as IL-1β, TNF-α, IL-6, and IL-18 upon activation by damage-associated signals [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eLoss or decreased levels of SHBG have been increasingly correlated with elevated inflammatory states and metabolic disturbances. Clinical and epidemiological studies report an inverse association between circulating SHBG concentrations and systemic inflammatory markers such as IL-6 and C-reactive protein (CRP). For instance, lower SHBG levels have been linked to increased risk and severity of metabolic syndrome, insulin resistance, and chronic inflammatory diseases, suggesting that SHBG may play a protective role in inflammatory homeostasis [\u003cspan additionalcitationids=\"CR38 CR39\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Mechanistically, inflammation itself can downregulate SHBG production, creating a vicious cycle exacerbating systemic inflammation [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOur findings reveal that SHBG exerts potent anti-inflammatory effects on LPS-stimulated equine PBMCs and macrophages. In both cell types, SHBG markedly reduced the secretion of major pro-inflammatory cytokines, including IL-1β, TNF-α, IL-6, and IL-18, while at the same time promoting an anti-inflammatory shift through increased IL-10 and modest enhancement of IL-4 and IL-13. Notably, multiplex profiling also showed a dampening of several chemokines (MCP-1/CCL2, RANTES/CCL5, GRO/CXCL1, and IL-8/CXCL8), suggesting that SHBG not only limits cytokine production but may also restrain the recruitment of additional immune cells into the inflammatory microenvironment. Together, these protein-level changes closely paralleled the gene expression data, reinforcing the translational relevance of SHBG\u0026rsquo;s immunomodulatory action and supporting its role as a regulator of inflammatory responses. Previous studies in various models provide mechanistic insight into the anti-inflammatory capacity of SHBG. Yamazaki et al. [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] found that SHBG inhibited LPS- and TNF-α-induced inflammatory cytokine accumulation in macrophages and adipocytes, possibly through suppression of NF-κB and MAPK signaling pathways, key regulators of cytokine gene transcription. Moreover, FitzGerald and colleagues [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] demonstrated that exercise-mediated increase of SHBG production correlate with lowered IL-1β and IL-6 circulating levels in athletic males. This aligns with our findings where SHBG treatment reduced both pro-inflammatory mRNA and protein levels, suggesting an attenuation of these inflammatory pathways in equine immune cells.\u003c/p\u003e\u003cp\u003eMoreover, IL-10 elevation observed at protein and mRNA levels post-SHBG treatment likely enhances immune resolution. IL-10 is a well-characterized anti-inflammatory cytokine capable of suppressing NF-κB activation and downregulating TNF-α and IL-6 production, thereby mitigating the cytokine storm. TGF-β, another anti-inflammatory mediator induced by SHBG, limits immune responses and supports tissue repair. The upregulation of these cytokines may represent an SHBG-driven feedback mechanism counteracting inflammatory damage [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The crosstalk between SHBG and anti-inflammatory responses has already been evoked in a previous study, showing that the treatment of PCOS mice with Glucagon-like peptide-1 receptor agonist (GLP-1Ras) improves SHBG levels, and subsequently restores the levels of IL-10 and TGF-β anti-inflammatory mediators through the inhibition of the TLR4-NF-κB axis [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe regulation of chemokines MCP-1, RANTES, IL-8, and GRO was also attenuated by SHBG in LPS-stimulated cells. These chemokines contribute critically to immune cell trafficking and leukocyte infiltration into inflamed tissues, perpetuating chronic inflammation. SHBG's suppression of their expression could decrease inflammatory cell recruitment, an effect beneficial in chronic inflammatory states such as EMS [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Supporting these findings, another study reported that SHBG reduced MCP-1 expression in LPS-stimulated macrophages and adipocytes [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Additionally, SHBG was shown to attenuate MCP-1 expression in subcutaneous adipose tissue from EMS-affected horses, further highlighting its potential anti-inflammatory role in metabolic dysfunction [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Taken together, our results extend these clinical observations by demonstrating that SHBG can directly modulate the expression of key pro-inflammatory chemokines, including MCP-1, RANTES, IL-8, and GRO, in LPS-stimulated cells. This mechanistic evidence complements human and animal studies showing that low SHBG levels are associated with increased inflammatory mediators in metabolic disturbances, supporting the idea that SHBG functions not only as a biomarker but also as an active regulator of inflammatory pathways [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eNotably, our previous study in EMS SAT demonstrated that SHBG treatment downregulated both protein disulfide-isomerase A3 (PDIA3) and extracellular signal-regulated kinase 1/2 (ERK1/2), key regulators of cellular stress and pro-inflammatory signaling [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. PDIA3, initially defined as a chaperone protein involved in the unfolded protein response, has been shown to also promote immune activation and oxidative damage [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], while chronic activation of ERK1/2 modulates the transcription of pro-inflammatory cytokines via JNK/NF-κB pathways [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Considering that both PDIA3 and ERK1/2 are expressed in PBMCs and macrophages and are central to cytokines regulation [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], it is plausible that SHBG may mediate its anti-inflammatory effects in these cell populations through a similar PDIA3\u0026ndash;ERK1/2-dependent mechanism. By reducing PDIA3 expression, SHBG could attenuate ERK1/2 activation, thereby suppressing downstream pro-inflammatory signaling and cytokine production. This mechanistic model provides a potential molecular explanation for the observed reductions in IL-1β, TNF-α, IL-6, and IL-18, and suggests that SHBG\u0026rsquo;s immunomodulatory role extends beyond adipose tissue to circulating immune cells.\u003c/p\u003e\u003cp\u003eTo investigate whether SHBG-mediated modulation of immune cells could influence adipose tissue inflammation, healthy SAT was cultured in conditioned media from control PBMCs, LPS-stimulated PBMCs, and LPS-stimulated PBMCs treated with SHBG. Exposure to media from LPS-activated PBMCs induced a marked inflammatory response in the SAT, as shown by increased mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, IL-18, TNF-α, IFNγ; MCP-1) and enhanced tissue staining of IL-1β and IL-6. These results suggest that SHBG\u0026rsquo;s anti-inflammatory effects on PBMCs can be transmitted to adipose tissue, reducing immune-mediated inflammation and promoting an anti-inflammatory environment.\u003c/p\u003e\u003cp\u003eThe observed protective effect in healthy SAT exposed to conditioned media from SHBG-treated PBMCs might be due, at least in part, to SHBG\u0026rsquo;s promotion of regulatory T cell (Treg) activation in PBMCs. Tregs, defined phenotypically as CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003eFOXP3\u003csup\u003e+\u003c/sup\u003e positive cells, are main regulators of immune tolerance and mediate potent anti-inflammatory effects, primarily via secretion of IL-10 and TGF-β, along with suppression of effector T cells and macrophages [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. In our study, SHBG treatment was associated with Tregs activation, which appears to be linked to the release of immunoregulatory cytokines from PBMCs. Specifically, we observed increased production of IL-4 and IL-13, predominantly secreted by CD4\u003csup\u003e+\u003c/sup\u003e T helper 2 (Th2) cells, as well as IL-10, which can be produced by monocytes, macrophages, and Tregs themselves. This cytokine milieu provides a favorable environment for Tregs proliferation and functional activation, contributing to enhanced IL-10 secretion and the reinforcement of regulatory immune responses [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. The molecular mechanisms underlying these immunoregulatory effects likely involve SHBG-mediated activation of PI3K/AKT signaling pathways in lymphocytes, as demonstrated by Balogh et al. [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], who reported that SHBG can bind to and be internalized by human T and B lymphocytes, modifying intracellular signaling pathways, such as Erk1/2 phosphorylation and AKT, independent of sex hormones, suggesting that SHBG can directly influence immune cell function. AKT signaling is crucial for Treg development, survival, and functional maintenance. Indeed, AKT activation promotes Foxp3 stability and enhances IL-10 production in regulatory T cells, while also supporting the differentiation of naive CD4\u003csup\u003e+\u003c/sup\u003e T cells toward Th2 and Treg phenotypes, rather than pro-inflammatory Th1 or Th17 lineages [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. This AKT-mediated mechanism could explain how SHBG protein promotes anti-inflammatory cytokine production (IL-4, IL-13, IL-10) while creating a regulatory immune environment, that favors Tregs expansion and function. Further support for SHBG's role in immune regulation comes from studies of conditions characterized by suppressed SHBG levels. In PCOS patients, where insulin resistance leads to decreased SHBG synthesis, a corresponding decrease in Treg cell populations and reduced levels of anti-inflammatory cytokines have been reported. This inverse relationship between SHBG levels and regulatory immune dysfunction provides additional evidence that SHBG may play a crucial role in maintaining immune homeostasis through Treg-mediated mechanisms [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn line with these observations, SHBG similarly modulated macrophage responses. In our study, the exposure of LPS-stimulated equine macrophages to SHBG promoted a shift from the pro-inflammatory M1 phenotype toward the anti-inflammatory M2 phenotype. This was evidenced by decreased expression of classical M1 markers CD80, CD86 and HLA-DR, and increased expression of M2-associated markers, including CD163, CD206 and Arginase-1, alongside corresponding changes in cytokine profiles, i.e. downregulation of IL-1β, TNF-α, and IL-6, and upregulation of IL-10 and TGF-β.\u003c/p\u003e\u003cp\u003eMacrophage polarization is a dynamic process regulated by the surrounding microenvironment, where M1 macrophages are classically activated, producing high levels of pro-inflammatory cytokines, and M2 macrophages contribute to the resolution of inflammation and tissue repair through the release of anti-inflammatory mediators [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. A major pathway involved in this phenotypic switch is signaling through the tumor-associated macrophages (TAM) family of receptor tyrosine kinases Tyro3, Axl, and MerTK. TAM receptor activation by the vitamin K-dependent ligands growth arrest-specific gene 6 (Gas6) and Protein S promotes efferocytosis of apoptotic cells and triggers anti-inflammatory signaling cascades, that drive macrophage reprogramming toward an M2 state, characterized by increased secretion of immunosuppressive cytokines such as IL-10 and TGF-β [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Studies have reported that Gas6 and Protein S contain an SHBG-like domain, consisting of two laminin G-like subdomains, which is essential for their binding to and activation of TAM receptors. The C-terminal SHBG-like regions of Gas6 and Protein S share sequence homology and structural similarity with SHBG itself [\u003cspan additionalcitationids=\"CR59\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Consequently, the existing structural homology between SHBG and the SHBG-like domains of Gas6 and Protein S suggests potential functional cross-reactivity with TAM receptors. The presence of these conserved laminin G-like subdomains in SHBG raises the possibility that the glycoprotein could directly engage these receptors on macrophages. Such interaction would enable SHBG to suppress NF-κB-mediated pro-inflammatory pathways, while activating downstream signals that promote M2 polarization and immune resolution [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. This mechanism provides a plausible explanation for the observed macrophage reprogramming from M1 to M2 phenotype and suggests that SHBG's anti-inflammatory effects may be mediated through direct TAM receptor activation, although further mechanistic studies are required to validate this pathway.\u003c/p\u003e\u003cp\u003eOxidative stress, characterized by the excessive production of ROS and NO, is a hallmark of inflammatory activation in immune cells. Upon exposure to inflammatory stimuli such as LPS, both macrophages and PBMCs undergo metabolic reprogramming that leads to increased generation of these reactive molecules. ROS production occurs primarily through NADPH oxidase activation and mitochondrial dysfunction, while NO is generated via inducible nitric oxide synthase (iNOS) upregulation. Although these molecules serve important antimicrobial and signaling functions, their excessive accumulation contributes to cellular damage, perpetuates inflammatory responses, and disrupts immune homeostasis [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. In the present research, the potential modulatory effects of SHBG on LPS-induced oxidative and nitrosative stress in equine macrophages and PBMCs were examined. SHBG treatment significantly attenuated intracellular ROS accumulation in both cell types, thereby mitigating the oxidative burst induced by LPS. Furthermore, SHBG enhanced the expression and enzymatic activity of key antioxidant defenses, including superoxide dismutase (SOD1/2) and catalase (CAT), collectively restoring the redox balance. In parallel, SHBG markedly reduced both intracellular and secreted NO levels, thereby attenuating LPS-induced nitrosative stress in equine macrophages and PBMCs.\u003c/p\u003e\u003cp\u003eReduced SHBG expression levels have previously been correlated with increased systemic oxidative stress in various metabolic and inflammatory conditions, underscoring a critical role for SHBG in mitigating oxidative damage. For instance, clinical studies have reported that patients with insulin resistance, obesity, or metabolic syndrome characterized by low SHBG levels exhibit elevated oxidative stress markers such as malondialdehyde (MDA) and oxidized low-density lipoprotein (ox-LDL), along with impaired antioxidant defenses. Similarly, experimental data show that oxidative stress itself suppresses SHBG expression, creating a pathological feedback loop that exacerbates redox imbalance [\u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Moreover, these findings align with emerging evidence from \u003cem\u003ein vitro\u003c/em\u003e and clinical studies highlighting SHBG's direct antioxidant properties. For example, in human adipocytes and macrophages exposed to LPS, SHBG supplementation reduced ROS production, upregulated SOD, CAT, and Nrf2-mediated antioxidant defenses, and lowered lipid peroxidation markers including MDA [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Similarly, in PPARγ-depleted equine adipose stromal cells, SHBG application restored proper expression levels of CAT, SOD1/2, GPx, and Nrf2, that was attributed to an improvement of mitochondrial function and dynamics [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. Additionally, Bourebaba et al. [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e], showed that SHBG treatment of equine adipose-derived stromal cells affected by metabolic syndrome decreased both oxidative and nitrosative stress, through the upregulation of key antioxidant enzymes and the attenuation of ROS and NO production, thereby reestablishing redox homeostasis and mitigating oxidative damage. Collectively, these observations reinforce SHBG's protective role against ROS/NO-driven inflammation, and position it as a therapeutic candidate for redox-related disorders in veterinary and human medicine.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study provides evidence that SHBG exerts strong anti-inflammatory and antioxidant effects on equine immune cells exposed to LPS. SHBG limited the secretion of pro-inflammatory cytokines and chemokines, promoted regulatory cytokine production, and enhanced Tregs activation, thereby reinforcing anti-inflammatory feedback loops. In parallel, SHBG induced a phenotypic switch in macrophages from the pro-inflammatory M1 to the anti-inflammatory M2 state, while mitigating oxidative and nitrosative stress through the restoration of antioxidant defenses. Together, these findings position SHBG as a key regulator of immune homeostasis, capable of attenuating inflammation at multiple levels.\u003c/p\u003e\u003cp\u003eAs a perspective, future studies should explore whether these effects are mediated by direct receptor interactions such as a potential SHBG-TAM receptor complex, or by alternative intracellular signaling cascades, which may provide novel mechanistic insight and therapeutic opportunities in EMS and related inflammatory disorders.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003cp\u003eThe collection of blood and adipose tissue samples from adult mares was approved by the Local Ethics Committee for Animal Experiments in Wrocław, PAN Ludwik Hirszfeld Institute of Immunology and Experimental Therapy in Wrocław (Instytut Immunologii i Terapii Doświadczalnej im. Ludwika Hirszfelda PAN we Wrocławiu), approval no. [058/2021/P1, on 23 September 2021], with informed consent obtained from the horse owners.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eCompeting interests\u003c/h2\u003e\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThe work was supported by a grant from the National Science Centre in Poland during the realization of the project: \u0026ldquo;Exploring the role and therapeutic potential of sex hormone binding globulin (SHBG) in the course of insulin resistance, inflammation, lipotoxicity in adipose stem progenitor cells and adipocytes in equine metabolic syndrome (EMS) mares.\u0026rdquo; (2019/35/B/NZ7/03651).\u003c/p\u003e\u003ch2\u003eAuthors' contributions\u003c/h2\u003e\u003cp\u003eN.B. and L.B. conceived and designed the study. N.B. performed the experiments, conducted data analysis and statistical evaluation. J.D. collected and provided equine samples. N.B., J.D., M.P. and L.B. drafted the manuscript. L.B. critically reviewed the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eNot Applicable\u003c/p\u003e\u003ch2\u003eAvailability of data and material\u003c/h2\u003e\u003cp\u003eThe data that support the presented findings are available from the corresponding author, upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eJohnson PJ, Wiedmeyer CE, LaCarrubba A, (Seshu), Ganjam VK, Messer NT (eds) (2010) Laminitis and the Equine Metabolic Syndrome. \u003cem\u003eVeterinary Clinics of North America: Equine Practice\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(2), 239\u0026ndash;255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cveq.2010.04.004\u003c/span\u003e\u003cspan address=\"10.1016/j.cveq.2010.04.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKronfeld DS, Treiber KH, Hess TM, Splan RK, Byrd BM, Staniar WB, White NW (2006) Metabolic Syndrome in Healthy Ponies Facilitates Nutritional Countermeasures against Pasture Laminitis. J Nutr 136(7). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jn/136.7.2090S\u003c/span\u003e\u003cspan address=\"10.1093/jn/136.7.2090S\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 2090S-2093S\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStefaniuk-Szmukier M, Pi\u0026oacute;rkowska K, Ropka-Molik K (2023) Equine Metabolic Syndrome: A Complex Disease Influenced by Multifactorial Genetic Factors. Genes 14(8):1544. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/genes14081544\u003c/span\u003e\u003cspan address=\"10.3390/genes14081544\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFrank N, Tadros EM (2014) Insulin dysregulation. Equine Vet J 46(1):103\u0026ndash;112. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/evj.12169\u003c/span\u003e\u003cspan address=\"10.1111/evj.12169\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReynolds A, Keen JA, Fordham T, Morgan RA (2019) Adipose tissue dysfunction in obese horses with equine metabolic syndrome. Equine Vet J 51(6):760\u0026ndash;766. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/evj.13097\u003c/span\u003e\u003cspan address=\"10.1111/evj.13097\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZak A, Siwinska N, Elzinga S, Barker VD, Stefaniak T, Schanbacher BJ, Adams AA (2020) Effects of equine metabolic syndrome on inflammation and acute-phase markers in horses. Domest Anim Endocrinol 72:106448. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.domaniend.2020.106448\u003c/span\u003e\u003cspan address=\"10.1016/j.domaniend.2020.106448\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcCullagh S, Keen J, Dosi M, Morgan R (2024) Bringing equine adipose tissue into focus. Equine Veterinary Educ 36(3):145\u0026ndash;151. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/eve.13894\u003c/span\u003e\u003cspan address=\"10.1111/eve.13894\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eErtelt A, Barton A-K, Schmitz RR, Gehlen H (2014) Metabolic syndrome: is equine disease comparable to what we know in humans? Endocr Connections 3(3):R81\u0026ndash;R93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1530/EC-14-0038\u003c/span\u003e\u003cspan address=\"10.1530/EC-14-0038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBasinska K, Marycz K, Śmieszek A, Nicpoń J (2015) The production and distribution of IL-6 and TNF-α in subcutaneous adipose tissue and their correlation with serum concentrations in Welsh ponies with equine metabolic syndrome. J Vet Sci 16(1):113. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4142/jvs.2015.16.1.113\u003c/span\u003e\u003cspan address=\"10.4142/jvs.2015.16.1.113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYao J, Wu D, Qiu Y (2022) Adipose tissue macrophage in obesity-associated metabolic diseases. Front Immunol 13:977485. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2022.977485\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.977485\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZak A, Siwinska N, Elzinga S, Barker VD, Stefaniak T, Schanbacher BJ, Adams AA (2020) Effects of equine metabolic syndrome on inflammation and acute-phase markers in horses. Domest Anim Endocrinol 72:106448. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.domaniend.2020.106448\u003c/span\u003e\u003cspan address=\"10.1016/j.domaniend.2020.106448\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFrank N (2011) Equine Metabolic Syndrome. Veterinary Clin North America: Equine Pract 27(1):73\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cveq.2010.12.004\u003c/span\u003e\u003cspan address=\"10.1016/j.cveq.2010.12.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eElzinga S, Wood P, Adams AA (2016) Plasma Lipidomic and Inflammatory Cytokine Profiles of Horses With Equine Metabolic Syndrome. J Equine Veterinary Sci 40:49\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jevs.2016.01.013\u003c/span\u003e\u003cspan address=\"10.1016/j.jevs.2016.01.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBourebaba N, Ngo T, Śmieszek A, Bourebaba L, Marycz K (2022) Sex hormone binding globulin as a potential drug candidate for liver-related metabolic disorders treatment. Biomed Pharmacother 153:113261. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2022.113261\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2022.113261\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThaler MA, Seifert-Klauss V, Luppa PB (2015) The biomarker sex hormone-binding globulin \u0026ndash; From established applications to emerging trends in clinical medicine. Best Pract Res Clin Endocrinol Metab 29(5):749\u0026ndash;760. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.beem.2015.06.005\u003c/span\u003e\u003cspan address=\"10.1016/j.beem.2015.06.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQu X, Donnelly R (2020) Sex Hormone-Binding Globulin (SHBG) as an Early Biomarker and Therapeutic Target in Polycystic Ovary Syndrome. Int J Mol Sci 21(21):8191. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms21218191\u003c/span\u003e\u003cspan address=\"10.3390/ijms21218191\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLe TN, Nestler JE, Strauss JF, Wickham EP (2012) Sex hormone-binding globulin and type 2 diabetes mellitus. Trends Endocrinol Metabolism 23(1):32\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tem.2011.09.005\u003c/span\u003e\u003cspan address=\"10.1016/j.tem.2011.09.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDinakaran A, Srinivasan A, Rajagambeeram R, Nanda SK, Daniel M (2024) SHBG and Insulin Resistance - Nexus revisited. Bioinformation 20(8):816\u0026ndash;821. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.6026/973206300200816\u003c/span\u003e\u003cspan address=\"10.6026/973206300200816\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbdel-latif A, Al-Jarhi UM, Hesham D, Khozam M, Fathy SA (2023) Sex hormone binding globulin (SHBG) as a predictor of liver fibrosis in subjects with nonalcoholic fatty liver disease (NAFLD). Egypt J Intern Med 35(1):38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s43162-023-00220-5\u003c/span\u003e\u003cspan address=\"10.1186/s43162-023-00220-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYamazaki, H., Kushiyama, A., Sakoda, H., Fujishiro, M., Yamamotoya, T., Nakatsu,Y., \u0026hellip; Asano, T. (2018). Protective Effect of Sex Hormone-Binding Globulin against Metabolic Syndrome: \u003cem\u003eIn Vitro\u003c/em\u003e Evidence Showing Anti-Inflammatory and Lipolytic Effects on Adipocytes and Macrophages.\u003cem\u003eMediators of Inflammation\u003c/em\u003e, \u003cem\u003e2018\u003c/em\u003e, 1\u0026ndash;12. https://doi.org/10.1155/2018/3062319\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBourebaba, L., Kępska, M., Qasem, B., Zyzak, M., Łyczko, J., Klemens, M., \u0026hellip; Marycz,K. (2023). Sex hormone-binding globulin improves lipid metabolism and reduces inflammation in subcutaneous adipose tissue of metabolic syndrome-affected horses. \u003cem\u003eFrontiers in Molecular Biosciences\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 1214961. https://doi.org/10.3389/fmolb.2023.1214961\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePatrone D, Alessio N, Antonucci N, Brigida AL, Peluso G, Galderisi U, Siniscalco D (2022) Optimization of Peripheral Blood Mononuclear Cell Extraction from Small Volume of Blood Samples: Potential Implications for Children-Related Diseases. Methods Protocols 5(2):20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/mps5020020\u003c/span\u003e\u003cspan address=\"10.3390/mps5020020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRio DC, Ares M, Hannon GJ, Nilsen TW (2010) Purification of RNA Using TRIzol (TRI Reagent). Cold Spring Harbor Protoc 2010(6):5439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003epdb.prot\u003c/span\u003e\u003cspan address=\"http://pdb.prot\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/pdb.prot5439\u003c/span\u003e\u003cspan address=\"10.1101/pdb.prot5439\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFedchenko N, Reifenrath J (2014) Different approaches for interpretation and reporting of immunohistochemistry analysis results in the bone tissue \u0026ndash; a review. Diagn Pathol 9(1):221. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13000-014-0221-9\u003c/span\u003e\u003cspan address=\"10.1186/s13000-014-0221-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBlondy, S., Durand, S., Lacroix, A., Christou, N., Bouchaud, C., Peyny, M., \u0026hellip; Mathonnet,M. (2022). Detection of Glycosylated Markers From Cancer Stem Cells With ColoSTEM Dx Kit for Earlier Prediction of Colon Cancer Aggressiveness. \u003cem\u003eFrontiers in Oncology\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e, 918702. https://doi.org/10.3389/fonc.2022.918702\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeyerholz DK, Beck AP (2018) Principles and approaches for reproducible scoring of tissue stains in research. Lab Invest 98(7):844\u0026ndash;855. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41374-018-0057-0\u003c/span\u003e\u003cspan address=\"10.1038/s41374-018-0057-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBasinska K, Marycz K, Śmieszek A, Nicpoń J (2015) The production and distribution of IL-6 and TNF-α in subcutaneous adipose tissue and their correlation with serum concentrations in Welsh ponies with equine metabolic syndrome. J Vet Sci 16(1):113. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4142/jvs.2015.16.1.113\u003c/span\u003e\u003cspan address=\"10.4142/jvs.2015.16.1.113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJohnson PJ (2024) Equine metabolic syndrome: part 2. UK-Vet Equine 8(4):170\u0026ndash;175. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12968/ukve.2024.8.4.170\u003c/span\u003e\u003cspan address=\"10.12968/ukve.2024.8.4.170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTadros EM, Frank N, Donnell RL (2013) Effects of equine metabolic syndrome on inflammatory responses of horses to intravenous lipopolysaccharide infusion. Am J Vet Res 74(7):1010\u0026ndash;1019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2460/ajvr.74.7.1010\u003c/span\u003e\u003cspan address=\"10.2460/ajvr.74.7.1010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZak, A., Siwinska, N., Elzinga, S., Barker, V. D., Stefaniak, T., Schanbacher, B.J., \u0026hellip; Adams, A. A. (2020). Effects of equine metabolic syndrome on inflammation and acute-phase markers in horses. \u003cem\u003eDomestic Animal Endocrinology\u003c/em\u003e, \u003cem\u003e72\u003c/em\u003e, 106448. https://doi.org/10.1016/j.domaniend.2020.106448\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eErtelt A, Barton A-K, Schmitz RR, Gehlen H (2014) Metabolic syndrome: is equine disease comparable to what we know in humans? Endocr Connections 3(3):R81\u0026ndash;R93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1530/EC-14-0038\u003c/span\u003e\u003cspan address=\"10.1530/EC-14-0038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBourebaba N, Sikora M, Qasem B, Bourebaba L, Marycz K (2023) Sex hormone-binding globulin (SHBG) mitigates ER stress and improves viability and insulin sensitivity in adipose-derived mesenchymal stem cells (ASC) of equine metabolic syndrome (EMS)-affected horses. Cell Communication Signal 21(1):230. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12964-023-01254-6\u003c/span\u003e\u003cspan address=\"10.1186/s12964-023-01254-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKornicka-Garbowska K, Bourebaba L, R\u0026ouml;cken M, Marycz K (2021) Sex Hormone Binding Globulin (SHBG) Mitigates ER Stress in Hepatocytes In Vitro and Ex Vivo. Cells 10(4):755. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells10040755\u003c/span\u003e\u003cspan address=\"10.3390/cells10040755\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBourebaba, L., Kępska, M., Qasem, B., Zyzak, M., Łyczko, J., Klemens, M., \u0026hellip; Marycz,K. (2023). Sex hormone-binding globulin improves lipid metabolism and reduces inflammation in subcutaneous adipose tissue of metabolic syndrome-affected horses. \u003cem\u003eFrontiers in Molecular Biosciences\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 1214961. https://doi.org/10.3389/fmolb.2023.1214961\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYamazaki, H., Kushiyama, A., Sakoda, H., Fujishiro, M., Yamamotoya, T., Nakatsu,Y., \u0026hellip; Asano, T. (2018). Protective Effect of Sex Hormone-Binding Globulin against Metabolic Syndrome: \u003cem\u003eIn Vitro\u003c/em\u003e Evidence Showing Anti-Inflammatory and Lipolytic Effects on Adipocytes and Macrophages.\u003cem\u003eMediators of Inflammation\u003c/em\u003e, \u003cem\u003e2018\u003c/em\u003e, 1\u0026ndash;12. https://doi.org/10.1155/2018/3062319\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReynolds A, Keen JA, Fordham T, Morgan RA (2019) Adipose tissue dysfunction in obese horses with equine metabolic syndrome. Equine Vet J 51(6):760\u0026ndash;766. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/evj.13097\u003c/span\u003e\u003cspan address=\"10.1111/evj.13097\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOsmancevic A, Daka B, Michos ED, Trimpou P, Allison M (2023) The Association between Inflammation, Testosterone and SHBG in men: A cross-sectional Multi‐Ethnic Study of Atherosclerosis. Clin Endocrinol 99(2):190\u0026ndash;197. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/cen.14930\u003c/span\u003e\u003cspan address=\"10.1111/cen.14930\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao Z, Liu K (2024) Association between systemic immunity-inflammation index and sex hormones in children and adolescents aged 6\u0026ndash;19. Front Endocrinol 15:1355738. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fendo.2024.1355738\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2024.1355738\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiao C-H, Li H-Y, Yu H-J, Chiang H-S, Lin M-S, Hua C-H, Ma W-Y (2012) Low serum sex hormone-binding globulin: Marker of inflammation? Clin Chim Acta 413(7\u0026ndash;8):803\u0026ndash;807. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cca.2012.01.021\u003c/span\u003e\u003cspan address=\"10.1016/j.cca.2012.01.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMilin-Lazović, J., Polovina, S., Šumarac-Dumanović, M., Stamenković-Pejković, D.,Jeremić, D., Cvijović, G., \u0026hellip; Micić, D. (2013). SHBG and testosterone are associated with inflammation in obese men. \u003cem\u003eEndocrine Abstracts\u003c/em\u003e. https://doi.org/10.1530/endoabs.32.P761\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSim\u0026oacute; R, Barbosa-Desongles A, Hernandez C, Selva DM (2012) IL1β Down-regulation of Sex Hormone-Binding Globulin Production by Decreasing HNF-4α Via MEK-1/2 and JNK MAPK Pathways. Mol Endocrinol 26(11):1917\u0026ndash;1927. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/me.2012-1152\u003c/span\u003e\u003cspan address=\"10.1210/me.2012-1152\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu N, Feng Y, Luo X, Ma X, Ma F (2022) Association Between Dietary Inflammatory Index and Sex Hormone Binding Globulin and Sex Hormone in U.S. Adult Females. Front Public Health 10:802945. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpubh.2022.802945\u003c/span\u003e\u003cspan address=\"10.3389/fpubh.2022.802945\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFitzGerald LZ, Robbins WA, Kesner JS, Xun L (2012) Reproductive hormones and interleukin-6 in serious leisure male athletes. Eur J Appl Physiol 112(11):3765\u0026ndash;3773. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00421-012-2356-2\u003c/span\u003e\u003cspan address=\"10.1007/s00421-012-2356-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAcuner-Ozbabacan, E. S., Engin, B. H., Guven-Maiorov, E., Kuzu, G., Muratcioglu,S., Baspinar, A., \u0026hellip; Nussinov, R. (2014). The structural network of Interleukin-10 and its implications in inflammation and cancer. \u003cem\u003eBMC Genomics\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(S4), S2. https://doi.org/10.1186/1471-2164-15-S4-S2\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen CC, Manning AM (1996) TGF-β1, IL-10 and IL-4 differentially modulate the cytokine-induced expression of IL-6 and IL-8 in human endothelial cells. Cytokine 8(1):58\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/cyto.1995.0008\u003c/span\u003e\u003cspan address=\"10.1006/cyto.1995.0008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, Y., Lin, Y., Li, G., Yuan, Y., Wang, X., Li, N., \u0026hellip; Ding, X. (2023). Glucagon-like peptide-1 receptor agonists decrease hyperinsulinemia and hyperandrogenemia in dehydroepiandrosterone-induced polycystic ovary syndrome mice and are associated with mitigating inflammation and inducing browning of white adipose tissue. \u003cem\u003eBiology of Reproduction\u003c/em\u003e, \u003cem\u003e108\u003c/em\u003e(6), 945\u0026ndash;959. https://doi.org/10.1093/biolre/ioad032\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eElkholi DGEY, Hammoudah SF (2012) Subclinical inflammation in obese women with polycystic ovary syndrome. Middle East Fertility Soc J 17(3):195\u0026ndash;202. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mefs.2012.02.004\u003c/span\u003e\u003cspan address=\"10.1016/j.mefs.2012.02.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang W-T, Sun L, Sun C-H (2019) PDIA3-regulted inflammation and oxidative stress contribute to the traumatic brain injury (TBI) in mice. Biochem Biophys Res Commun 518(4):657\u0026ndash;663. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2019.08.100\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2019.08.100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLucas RM, Luo L, Stow JL (2022) ERK1/2 in immune signalling. Biochem Soc Trans 50(5):1341\u0026ndash;1352. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/BST20220271\u003c/span\u003e\u003cspan address=\"10.1042/BST20220271\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeng F, Lowell CA (1997) Lipopolysaccharide (LPS)-induced Macrophage Activation and Signal Transduction in the Absence of Src-Family Kinases Hck, Fgr, and Lyn. J Exp Med 185(9):1661\u0026ndash;1670. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1084/jem.185.9.1661\u003c/span\u003e\u003cspan address=\"10.1084/jem.185.9.1661\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSinger M, Elsayed AM, Husseiny MI (2024) Regulatory T-cells: The Face-off of the Immune Balance. Front Bioscience-Landmark 29(11):377. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.31083/j.fbl2911377\u003c/span\u003e\u003cspan address=\"10.31083/j.fbl2911377\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZong Y, Deng K, Chong WP (2024) Regulation of Treg cells by cytokine signaling and co-stimulatory molecules. Front Immunol 15:1387975. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2024.1387975\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2024.1387975\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBalogh, A., Karpati, E., Schneider, A. E., Hetey, S., Szilagyi, A., Juhasz, K., \u0026hellip;Than, N. G. (2019). Sex hormone-binding globulin provides a novel entry pathway for estradiol and influences subsequent signaling in lymphocytes via membrane receptor.\u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(1), 4. https://doi.org/10.1038/s41598-018-36882-3\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePompura SL, Dominguez-Villar M (2018) The PI3K/AKT signaling pathway in regulatory T-cell development, stability, and function. J Leukoc Biol 103(6):1065\u0026ndash;1076. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/JLB.2MIR0817-349R\u003c/span\u003e\u003cspan address=\"10.1002/JLB.2MIR0817-349R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang Y, Xia J, Yang Z, Wu G, Yang J (2021), May 28 The Abnormal Expression of HSP70 Is Related to Treg / Th17 Imbalance in PCOS Patients. In Review. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21203/rs.3.rs-502127/v1\u003c/span\u003e\u003cspan address=\"10.21203/rs.3.rs-502127/v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, S., Saeed, A. F. U. H., Liu, Q., Jiang, Q., Xu, H., Xiao, G. G., \u0026hellip; Duo, Y.(2023). Macrophages in immunoregulation and therapeutics. \u003cem\u003eSignal Transduction and Targeted Therapy\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(1), 207. https://doi.org/10.1038/s41392-023-01452-1\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMyers KV, Amend SR, Pienta KJ (2019) Targeting Tyro3, Axl and MerTK (TAM receptors): implications for macrophages in the tumor microenvironment. Mol Cancer 18(1):94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12943-019-1022-2\u003c/span\u003e\u003cspan address=\"10.1186/s12943-019-1022-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eManfioletti G, Brancolini C, Avanzi G, Schneider C (1993) The protein encoded by a growth arrest-specific gene (gas6) is a new member of the vitamin K-dependent proteins related to protein S, a negative coregulator in the blood coagulation cascade. Mol Cell Biol 13(8):4976\u0026ndash;4985. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/MCB.13.8.4976\u003c/span\u003e\u003cspan address=\"10.1128/MCB.13.8.4976\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLemke G (2013) Biology of the TAM Receptors. Cold Spring Harb Perspect Biol 5(11):a009076\u0026ndash;a009076. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/cshperspect.a009076\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a009076\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi F, Xu L, Li C, Hu F, Su Y (2024) Immunological role of Gas6/TAM signaling in hemostasis and thrombosis. Thromb Res 238:161\u0026ndash;171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.thromres.2024.05.002\u003c/span\u003e\u003cspan address=\"10.1016/j.thromres.2024.05.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePastore M, Grimaudo S, Pipitone RM, Lori G, Raggi C, Petta S, Marra F (2019) Role of Myeloid-Epithelial-Reproductive Tyrosine Kinase and Macrophage Polarization in the Progression of Atherosclerotic Lesions Associated With Nonalcoholic Fatty Liver Disease. Front Pharmacol 10:604. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2019.00604\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2019.00604\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorris G, Gevezova M, Sarafian V, Maes M (2022) Redox regulation of the immune response. Cell Mol Immunol 19(10):1079\u0026ndash;1101. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41423-022-00902-0\u003c/span\u003e\u003cspan address=\"10.1038/s41423-022-00902-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun, Y., Li, S., Liu, H., Bai, H., Hu, K., Zhang, R., \u0026hellip; Fan, P. (2021). Oxidative stress promotes hyperandrogenism by reducing sex hormone-binding globulin in polycystic ovary syndrome. \u003cem\u003eFertility and Sterility\u003c/em\u003e, \u003cem\u003e116\u003c/em\u003e(6), 1641\u0026ndash;1650. https://doi.org/10.1016/j.fertnstert.2021.07.1203\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRahmatnezhad L, Moghaddam-Banaem L, Lak B, Shiva T, A., Rasuli J (2023) Free androgen index (FAI)\u0026rsquo;s relations with oxidative stress and insulin resistance in polycystic ovary syndrome. Sci Rep 13(1):5118. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-023-31406-0\u003c/span\u003e\u003cspan address=\"10.1038/s41598-023-31406-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSzybiak-Skora W, Cyna W, Lacka K (2025) New Insights in the Diagnostic Potential of Sex Hormone-Binding Globulin (SHBG)\u0026mdash;Clinical Approach. Biomedicines 13(5):1207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biomedicines13051207\u003c/span\u003e\u003cspan address=\"10.3390/biomedicines13051207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarycz K, Wiatrak B, Irwin-Houston JM, Marcinkowska K, Mularczyk M, Bourebaba L (2024) Sex hormone binding globulin (SHBG) modulates mitochondrial dynamics in PPARγ-depleted equine adipose derived stromal cells. J Mol Med 102(8):1015\u0026ndash;1036. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00109-024-02459-z\u003c/span\u003e\u003cspan address=\"10.1007/s00109-024-02459-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBourebaba N, Sikora M, Qasem B, Bourebaba L, Marycz K (2023) Sex hormone-binding globulin (SHBG) mitigates ER stress and improves viability and insulin sensitivity in adipose-derived mesenchymal stem cells (ASC) of equine metabolic syndrome (EMS)-affected horses. Cell Communication Signal 21(1):230. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12964-023-01254-6\u003c/span\u003e\u003cspan address=\"10.1186/s12964-023-01254-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"Wroclaw University of Environmental and Life Sciences","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SHBG, Inflammation, Macrophages, Tregs, EMS, Oxidative stress","lastPublishedDoi":"10.21203/rs.3.rs-7698110/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7698110/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Sex hormone-binding globulin (SHBG) is a plasma glycoprotein mainly recognized for its role in regulating sex steroid bioavailability. However, recent studies indicate SHBG's involvement in a variety of biological processes, including those related to the immune system. In this study, the immunomodulatory effects of SHBG on lipopolysaccharide (LPS)-stimulated equine peripheral blood mononuclear cells (PBMCs) and macrophages were examined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: Equine peripheral blood mononuclear cells (PBMCs) and macrophages were stimulated with LPS to induce an acute inflammatory response and subsequently treated with 50 nM SHBG. The anti-inflammatory activity of SHBG was assessed by analyzing the secretion of inflammatory mediators, the activation of regulatory T cells (Tregs), the proportion of M2 macrophages, and markers of oxidative and nitrosative stress. In addition, the therapeutic potential of SHBG was evaluated \u003cem\u003eex vivo\u003c/em\u003e using equine subcutaneous adipose tissue explants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: SHBG markedly reduced the secretion of pro-inflammatory cytokines and chemokines (IL-1β, IL-6, TNF-α, MCP-1), while enhancing the release of anti-inflammatory mediators including IL-10. It also promoted regulatory T cell (Treg) activation within the total PBMCs population, thereby contributing to an immunosuppressive environment. In macrophages, SHBG shifted the phenotype from pro-inflammatory M1 toward anti-inflammatory M2 subtype, facilitating the resolution of inflammation. Furthermore, SHBG mitigated oxidative and nitrosative stress by lowering reactive oxygen species (ROS) and nitric oxide (NO) levels and enhancing antioxidant enzymes activity, thus restoring redox balance. Importantly, conditioned media from SHBG-treated PBMCs reduced the pro-inflammatory impact of PBMC-derived mediators on subcutaneous adipose tissue (SAT) explants, as shown by the decreased IL-6 and IL-1β tissue expression compared with media from LPS-stimulated PBMCs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Collectively, these findings identify SHBG as a novel regulator of immune homeostasis, capable of attenuating inflammation and oxidative stress at multiple levels.\u003c/p\u003e","manuscriptTitle":"Sex Hormone-Binding Globulin (SHBG) Modulates Inflammatory and Oxidative Stress Responses in Equine Immune Cells: Implications for Equine Metabolic Syndrome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-25 04:20:44","doi":"10.21203/rs.3.rs-7698110/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4c74400f-8766-4c43-bd40-4545d9d7a24c","owner":[],"postedDate":"September 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":55230159,"name":"Immunology"},{"id":55230160,"name":"Cell Communication and Signaling"},{"id":55230161,"name":"General Cell Biology \u0026 Physiology"}],"tags":[],"updatedAt":"2025-09-25T04:20:44+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-25 04:20:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7698110","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7698110","identity":"rs-7698110","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.