Aerobic exercise alleviates diabetic cardiomyopathy via attenuation of P2X4-mediated NLRP3 inflammasome activation and cardiomyocyte pyroptosis

Aerobic exercise alleviates diabetic cardiomyopathy via attenuation of P2X4-mediated NLRP3 inflammasome activation and cardiomyocyte pyroptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Aerobic exercise alleviates diabetic cardiomyopathy via attenuation of P2X4-mediated NLRP3 inflammasome activation and cardiomyocyte pyroptosis Zonghan Liu, Yangjun Yang, Luchen Song, Xinyu Ruan, Yuan He, Yong Zou, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3965620/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Diabetic cardiomyopathy (DCM) is one of the most prevalent diabetic complications associated with chronic low-grade inflammation. P2X purinergic receptors and NLRP3 inflammasome have been reported to be enriched in DCM hearts. They are regarded as partners in the crime of inflammation and inflammatory type of cell death, pyroptosis. Exercise is an effective nonpharmacological therapy for DCM though the involving mechanisms are ill-defined. The cardioprotective role of exercise may rely heavily on its anti-inflammatory effect. However, whether exercise modulates P2X and NLRP3 inflammasome activation and thus ameliorates DCM pathologies and pyroptosis needs to be clarified entirely. In this study, we found that P2X4/P2X7-NLRP3 is involved in the pathogenesis of DCM. Exercise serves a cardioprotective effect through the inhibition of the P2X4/ROS/NLRP3 signalling pathway. AICAR exerts an inhibitory effect on NLRP3 inflammasome and pyroptosis by simultaneously targeting P2X4 and P2X7, showing an exercise mimic effect. Overall, we proposed novel insights into the therapeutic and preventive effects of early exercise intervention on DCM progress. Diabetic cardiomyopathy Aerobic exercise P2X receptors NLRP3 inflammasome Pyroptosis AICAR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Highlights P2X4/P2X7-NLRP3 is involved in the pathogenesis of cardiomyopathy caused by diabetes or obesity. However, exercise intervention only inhibited P2X4. Exercise intervention, chronic AICAR treatment, or knockdown of P2X4 and P2X7 resulted in reduced activation of NLRP3 inflammasome and pyroptosis. P2X7 and P2X4 receptors exhibit a complementary relationship and contribute to the activation of NLRP3 inflammasome. The inhibitory effect of AICAR on NLRP3 inflammasome relies on both P2X7 and P2X4. The expression of PANX1 monomer increased in the hearts of diabetic mice but was insusceptible to HFD, or high glucose and high PA treatment. 1. Introduction Diabetes mellitus (DM) is a chronic metabolic disease caused by absolute or relative insulin secretion deficiency, characterized by hyperglycemia and hyperlipidemia 1 . The long-term development and progression of DM can affect multiple organs, leading to diabetic complications 2 . Diabetic cardiomyopathy (DCM) is one of the most common severe DM complications, significantly contributing to heart failure, arrhythmia, and mortality 3 . The pathogenesis of DCM is complicated, including abnormal fatty acid metabolism, hyperglycemia, oxidative stress, inflammation, and cardiomyocyte death 4 . Due to the complex etiology and limited treatment options, DCM has evolved into an intractable clinical issue with catastrophic repercussions 5 . Pyroptosis is a newly identified type of necrotic and inflammasome-mediated programmed cell death, characterized by cell swelling, rupture, and release of cytoplasmic content, including pro-inflammatory cytokines IL 1β and IL 18 6 . Emerging evidence has highlighted the involvement of pyroptosis in the pathogenesis of DCM 7 . It is a well-recognized issue that NLRP3 inflammasome is the crucial component that mediates pyroptosis and contributes to the pathogenesis of DCM; targeting suppression of NLRP3 inflammasome activity had remarkable therapeutic effects 8–10 . The NLRP3 inflammasome is a complex composed of the damage-associated molecular pattern (DAMP)/pathogen-associated molecular pattern (PAMP) sensor (NLRP3), an adaptor (ASC), and an effector (Caspase 1). Even though it is well-known that NLRP3 inflammasome activation depends on recognizing DAMPs and PAMPs, the exact mechanisms that regulate NLRP3 inflammasome activation are still ambiguous. It is thought to include multiple upstream signals, most of which are not mutually exclusive, including the efflux of potassium ions (K + ), the influx of calcium ions (Ca 2+ ), oxidative stress, metabolic changes, etc. 11 . Extracellular ATP (eATP) is a common DAMP that activates the NLRP3 inflammasome. The high amount of eATP under pathological conditions is mainly released from the pannexin 1 (PANX1) channel 12,13 . P2X receptors are ligand-gated ion channels that could be activated by eATP. eATP causes channel opening of P2X receptors, the influx of Ca 2+ /Sodium ions (Na + ), or efflux of K + , promoting the accumulation of intracellular ROS through activation of NADPH oxidase 14 . Among these receptors, P2X7 is the most structurally and functionally distinct P2X subtype, strongly associated with immunity and inflammation. Different from any other P2X receptors, P2X7 exhibits a complete absence of desensitisation 15,16 . Furthermore, it has been experimentally demonstrated that P2X7 is the sole mediator of K + efflux upon binding with ATP 17 . Indeed, P2X7 is activated in various models of cardiomyopathy, and pharmacologically and genetically inhibiting P2X7 can attenuate cardiomyopathy pathology 18–20 . Nevertheless, the function of other P2X subtypes, which are expressed at varying levels in different tissues of humans and mice, remains inadequately comprehended. Noteworthy, P2X are all ion channels that exhibit cation-selective and facilitate the entry of Ca 2+ /Na + upon ATP bindings. Since Ca 2+ influx can activate NLRP3 inflammasome, it is possible that other P2X possess the ability to trigger activation of NLRP3 inflammasome. Initial research findings indicated that P2X4 activation elicits enhanced cardiac inotropy and decelerates the heart rate 21 . The mechanism may involve the interaction of P2X4 with eNOS to generate NO or an increase in intracellular Ca2 + that increases myocardial contractility 22 . However, an overabundance of NO and Ca2 + can also lead to excessive oxidative stress and inflammation, which might sabotage cardiac function. Indeed, a correlation was observed between elevated cardiac P2X4 and heart failure and coronary artery disease 23,24 . Furthermore, activation of P2X4 was proved to lead to the assembly of NLRP3 inflammasome in diabetic nephropathy 25 . Thus, we speculate that NLRP3 inflammasome activation in DCM might also be partially caused by P2X4. Regular exercise training is a typical non-pharmacologic method to prevent and treat DM and diabetic complications. Aerobic exercise intervention has been shown to inhibit P2X7 elevation, NLRP3 inflammasome activation, and cardiomyocyte death in the heart of high-fat diet (HFD) and DM animal models 26,27 . However, it remains unclear whether the effect of exercise on P2X7 in the hearts of diabetic or obese mice is mediated by the regulation of PANX1. Furthermore, there is still a lack of clarity regarding whether other P2X, which is more sensitive to ATP, contributes to the development of inflammation and cardiac cell death in DCM. Additionally, whether and how exercise might ameliorate DCM in a manner dependent on P2X and NLRP3 inflammasome remains further investigated. In this study, we showed that regular exercise intervention mitigated the development of DCM by suppressing NLRP3 inflammasome activation and pyroptosis. The pathogenesis of DCM is associated with the participation of P2X4 and P2X7, which exhibit a synergistic impact. Nevertheless, it is more plausible that regular exercise training dampens the NLRP3 inflammation activation via the reduction of P2X4 protein levels, thereby leading to a decrease in pyroptosis. Our results provide novel insight into the mechanism of exercise intervention in regulating DCM pathological progression. 2. Materials and Methods 2.1 Establishment of animal models 5-week-old male C57BL/6J mice were purchased from the animal experiment center of East China Normal University (Shanghai, China). The mice were housed appropriately (12 h light/dark cycle, 22 ± 2°C temperature, 40–70% relative humidity) with access to food and water ad libitum . Mice were subjected to adaptive feeding for one week and were used for the following experiments. 2.1.1 Diabetes model The mice were randomly divided into four groups: ( 1 ) normal chow diet (CON); ( 2 ) normal chow diet + exercise (EX); ( 3 ) 45%HFD + STZ (STZ, S0130, Sigma-Aldrich) (DM); and ( 4 ) 45%HFD + STZ + exercise (DM + EX). The DM group mice were fed 45%HFD for 4 weeks. After 4-week HFD feeding, the DM group mice were subjected to a single intraperitoneal injection of 100 mg/kg of streptozotocin, which was freshly dissolved in a 0.1 mol/L sodium citrate buffer with a pH of 4.5. Mice with fasting blood glucose (FBG) levels exceeding 11.1 mmol/L were identified as diabetic mice and were continuously fed with 45% HFD for 9 weeks. As a control of DM, mice were fed a normal chow diet for four weeks, then injected with an equal volume of sodium citrate buffer, similar to the DM group, and maintained on the normal chow diet for 9 weeks. Treadmill exercise was conducted one week after intraperitoneal injection of STZ or sodium citrate buffer. The exercise adaption protocol was performed at 5 min for warming up (6 m/min), 30 min for formal training (8 m/min), 5 min for relaxing (6 m/min), and 3 days/week. After 1 week of exercise adaption, mice were subjected to formal exercise training. The training protocol was performed at 5 min for warming up (8 m/min), 50 min for formal training (12 m/min), and 5 min for relaxing (8 m/min), 5 days/week for 8 weeks. 2.1.2 HFD-induced obesity Model The mice were randomly divided into three groups: ( 1 ) normal chow diet (CON); ( 2 ) 60%HFD (HFD); and ( 3 ) 60%HFD + exercise (HE). The HFD group mice were fed 60% HFD for either 10 or 15 weeks. Simultaneously, the CON group mice were fed a normal chow diet for either 10 or 15 weeks. The exercise adaption protocol was that speed increased from 7 m/min to 13 m/min, and the running duration increased from 15 min/day to 60 min/day for 1 week. The exercise training protocol was 5 min for warming up (7 m/min), 60 min for formal training (13 m/min), and 5 min for relaxing (7 m/min) for 10 or 15 weeks. 2.1.3 Body compositions One day after the last exercise training session, the body compositions of live mice were measured using the AccuFat MRI system (AccuFat-1050, MAG-MED, China). 2.1.4 Glucose tolerance test (GTT) and insulin tolerance test (ITT) GTT and ITT experiments were carried out during the last two weeks of the experiment. The mice in each group were assigned to receive GTT and ITT experiments in a random manner. The assay was performed according to the previous study 28 . Specifically, to test insulin tolerance, mice were given an intraperitoneal injection of insulin (0.75U/kg body weight) after 4 h of fasting. To test glucose tolerance, mice were given an intraperitoneal injection of glucose (1.25 g/kg body weight) after 6 h of fasting. Blood glucose levels were measured from tail venous blood before (0min) and after insulin or glucose injection at 15, 30, 45, 60, 90, and 120 min. 2.1.5 Echocardiography Echocardiograms were performed in M mode using the Vevo 3100 echocardiography system (VisualSonics Inc., Canada). In brief, mice were lightly anaesthetized with isoflurane (2.5% for induction and 1.5% for maintenance). M-mode echocardiogram was performed on the parasternal long-axis section of the left ventricle (LV) to record the end-systolic and the corresponding end-diastolic LV anterior wall thickness (LVAWs and LVAWd) as well as LV inner diastolic and systolic dimensions (LVIDd and LVIDs). The measurements were obtained from at least three beats at a similar stabilized heart rate and were averaged. All echocardiograms were performed by an experienced investigator blind to the animal treatments. 2.2 Cell culture and experimental treatments Rat myocardial cell line H9C2 was purchased from the Stem Cell Bank, Chinese Academy of Sciences. H9C2 cells were cultured at 37°C, 5% CO2 in high glucose Dulbecco’s modified eagle medium (DMEM)(Gibico, 11995065, USA) supplemented with 10% (vol/vol) fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 µg/mL). When H9C2 cells had reached 80% confluency, they were seeded and cultured in 6-well or 96-well plates with low glucose DMEM (Gibico, 11885084, USA) for the subsequent experiments. 2.2.1 Drug treatments H9C2 cells were treated with the indicated concentrations of glucose (Sigma, G7021) and PA (Sigma, P0500) for 24h at a confluency of 80%. The PA was conjugated with 15% BSA solution to prepare a 10 mM stock solution. At the same time, the PA-free 15% BSA was used as control reagents added to cells to ensure that each well received an equal volume of BSA. Mannitol was used to balance the osmolarity of the solution, depending on the glucose concentration. For the AICAR (Selleckchem, S1802, USA) treatment, cells were treated with various concentrations of AICAR (0.1-2mM dissolved in Ultrapure water) for 24 h concurrently with glucose and PA treatment. For the MCC950 (Selleckchem, S7809, USA) treatment, cells were treated with the inhibitors MCC950 (5nM dissolved in DMSO according to the manufacturer’s instruction) 10–20 min prior to glucose and PA treatment. KCl (25 mM) and CaCl 2 (0.9 or 1.8 mM) were added together with PA treatment and cultured in a Calcium-free medium (Yuchunbio, YC-2067, China). 2.2.2 Transfection Cell transfection was performed in 6-well or 24-well plates using Lipo8000 transfection reagent (Beyotime, C0533, China) according to the manufacturer's protocol. H9C2 cells were pre-plated one day before transfection and grew to be 60–70% confluent. Then 3ul liposomes were mixed with 100pmol siRNA (per well of a 6-well plate), or 0.8 µl liposomes were mixed with 20 pmol siRNA (per well of a 24-well plate) incubated at room temperature for 15 min to prepare siRNA/liposome complexes. The complexes were added to the cells and incubated for 6 hours. During the transfection procedure, we utilised a l low glucose DMEM supplemented with 10% FBS, as the presence of serum in the medium would not interfere with the effectiveness of lipo8000. Consequently, cells were in a good growth status and incubated for 6 hours, ultimately achieving a cell confluence of 80–90%. Following this, the transfect medium was aspirated and replenished with low glucose DMEM or treated with PA and glucose for another 24 h. Rat P2X7 siRNA, rat P2X4 siRNA, and nontargeting control siRNA were custom-designed and synthesized by RiboBio. The sequences of control and target siRNAs against rat genes are listed in Table 1 . Table 1 Primer sequences. Designation species Sequence (5'-3') si-negative control Rat TTCTCCGAACGTGTCACGT si-P2rx4-1 Rat CCTGATAAGACCAGCATTT si-P2rx4-2 Rat CCCTCTTGGTAAAGAACAA si-P2rx4-3 Rat TCTACTGCATGAAGAAGAA si-P2rx7-1 Rat GGATGGACCCACAAAGTAA si-P2rx7-2 Rat GAGGAAAGTTTGACATCAT si-P2rx7-3 Rat GTGCAGTGAATGAGTACTA 2.3 ATP content/Cell viability Cells were seeded at a concentration of 5×10 3 cells per well in 96-well plates in triplicate and cultured for 24 h. After treatment, cell viability was assessed by CellTiter-Lumi™ Luminescent Cell Viability Assay Kit (Beyotime, C0058, China) based on ATP content, representing the number of active cells. Detail operation steps were followed as previously described 29 . The luminescence levels were detected using a microplate reader (TECAN Infinite M200, Switzerland). 2.4 LDH release assay LDH release was quantified using the LDH Cytotoxicity Assay Kit (Beyotime, C0017, China) according to the manufacturer’s protocol. In brief, after 24 h treatment, cellular supernatants were replaced with DMEM containing 1%FBS and cultured for another 6 hours to collect LDH released by the cells, as the medium containing 10%FBS and BSA may affect the LDH value. A volume of 120 µl of 1%FBS DMEM supernatant from each well was transferred to a separate 96-well plate. Subsequently, the detection buffer was mixed with the supernatant and incubated at room temperature for 30 min avoid light. Finally, the mixed liquor was detected at a wavelength of 490 nm by a microplate reader (TECAN Infinite M200, Switzerland). A wavelength of 690 nm was employed as the reference wavelength for dual-wavelength determination. 2.5 Caspase 1 activity assay The activity of Caspase 1 was measured with a Caspase 1 Activity Assay Kit (Beyotime, C1101, China) according to the manufacturer’s instructions. Briefly, H9C2 cells were harvested and lysed on ice using the lysis buffer provided in the assay kit. Subsequently, the cell lysates were incubated with a substrate of Caspase 1 (Ac-YVAD-pNA, acetyl-Tyr-Val-Ala-Asp p-nitroanilide) to produce the yellow formazan product pNA at 37°C for 1 hour. The pNA levels were detected at a wavelength of 405 nm by a microplate reader (TECAN Infinite M200, Switzerland). The protein concentration of cell lysate was measured using the Bradford Protein Assay Kit (Beyotime, P0010, China) at a wavelength of 595 nm. 2.6 NADPH oxidase (NOX) activity assay NOX activity of cells was collected by a spectrophotometer (Specord Plus 210, Analytic Jena AG, Jena, Germany) following the instruction of the commercial NOX activity kit (Solarbio, BC0630, China). 2.7 Reactive oxygen species (ROS) detection After treatment, cellular ROS generation was measured by ROS Assay Kit (Beyotime, S0033, China) utilizing a fluorescent probe DCFH-DA. H9C2 cells were preincubated with 10 µM DCFH-DA at 37°C for 20 min, then cellular ROS was quantified using a microplate reader (TECAN Infinite M200, Switzerland) at the exciting light was 488 nm, and the emitted light was 525 nm. Moreover, the accumulation of ROS in H9C2 cells was also verified microscopically (IX71, Olympus, Japan). 2.8 Measurement of MDA levels The contents of MDA in the heart tissue were detected using a commercial kit (Beyotime, S0131, China) according to the instructions. The sample and MDA detection working solution were mixed and performed as described before 30 , and the absorbance was measured at 532 nm using a microplate reader (TECAN Infinite M200, Switzerland). 2.9 HE and Masson staining Heart tissues were fixed with 4% paraformaldehyde and embedded in paraffin. Next, the organ was sectioned at 3–5 µm thickness and stained separately with HE (Solarbio, G1120, China) and Masson’s trichrome (Servicebio, G1006, China). For both stains, slides were blindly observed and photographed with a microscope (XSP-C204, COIC, China). 2.10 Immunohistochemistry The heart tissue sections were stained with primary antibodies against NLRP3 (Servicebio, GB114320-100, China, 1:600), Caspase 1 (Servicebio, GB11383-100, China, 1:500), and IL 1β (Servicebio, GB11113-100, China, 1:250) at 4°C overnight, followed by secondary antibodies incubated for 50min at room temperature. All sections were visualized with diaminobenzidine and blindly observed and photographed with a microscope (XSP-C204, COIC, China). 2.11 Immunofluorescence TUNEL and immunofluorescence double staining of heart tissue sections and fixed cells were performed to evaluate pyroptosis. TUNEL/GSDMD positive can be regarded as a possible indicator of pyroptosis 31 (In the gasdmin family, only GSDMD is expressed in cardiomyocytes 32 ). Tissue sections were obtained as described above. While H9C2 cells were seeded in 6-well culture plates plated with cell-climbing slices. After the treatment, cell-climbing slices were washed with PBS twice and then fixed with 4% paraformaldehyde for 20 min. After that, the cell-climbing slices or tissue sections were treated with a primary antibody against the N terminal of GSDMD (Bioss, BS-14287R, China,1:200) at 4°C overnight, followed by incubation with a secondary antibody for 50 min at room temperature. The nuclei were stained with DAPI for 10 min at room temperature. Finally, the slices and tissue sections were blindly observed and photographed with a microscope (DP74, Olympus, Japan). GSDMD is present in each cardiomyocyte and is therefore difficult to count. However, subsequent to the cleavage of GSDMD, the GSDMD-N terminal will undergo oligomerization and locate to the plasma membrane, nuclear membrane and mitochondrial membrane to form membrane pores. Consequently, we lowered the laser power so that the cells displayed only the stronger GSDMD fluorescent signals and considered them as oligomerized GSDMD-N. 2.12 ELISA Circulating cTn-I in serum was quantitatively analyzed using ELISA kits for mice cTn-I (Mlbio, ml092662, China). The levels of IL 1β in cell supernatants were measured by Rat IL 1β ELISA Kit (MultiSciences Biotech, EK301B, China) according to the manufacturer's instructions. Typically, we incubate samples overnight at four degrees for improved results. 2.13 Protein extraction and Western blotting (WB) Cell and Heart tissue lysis were performed as described before 33 . In brief, a small chunk from the left ventricle at the apex of the heart (30 mg) and H9C2 cells were lysed in RIPA/cell lysis buffer (Beyotime, P0013B, China) supplemented with PMSF (Beyotime, ST506, China), phosphatases inhibitors (Beyotime, P1081, China) and protease inhibitors (Beyotime, P1005, China). Heart tissue was then loaded and homogenized using the bead ruptor (BeadRuptor24, OMNI, USA) at a frequency of 3.55 m/s for 30 s, repeated 3 times. Cells were lysed on ice for 10min. Tissue homogenates and cell lysates were further centrifuged at 4°C for 10 min at 12000×g. After collecting the supernatant, the protein concentration of total homogenate was determined using the BCA method (Beyotime, P0010, China). For the WB experiment, protein lysates in the SDS-PAGE Sample Loading Buffer were boiled for 5 min at 10℃. The samples were separated on 10–12% SDS-PAGE gel and transferred to the PVDF membrane (IPVH00010, Millipore). The membranes were then blocked in QuickBlock™ Blocking Buffer for Western Blot (Beyotime, P0252, China) for 2 h at room temperature and then incubated with primary antibodies directed against PANX1 (12595-1-AP, Proteintech, China), IL 1β (sc-12742, Santa Cruz, USA), P2X7 (A10511, abclonal, China), Caspase1 (A0964, abclonal, China), GSDMD (BS-14287R, Bioss, China), P2X4 (66416-1-Ig, proteintech, China), NLRP3 (DF7438, affinity, China), TXNIP (sc-166234, Santa, USA), NF-κb p65 (WL01980, wanleibio, China), p-NF-κb (WL02169, wanleibio, China), β-tubulin (AF7011, affinity, China), HSP90 (ab13492, abcam, USA), and GAPDH (sc-47724, Santa, USA) and horseradish peroxidase-conjugated secondary antibodies (115-035-003, 111-035-003, Jackson Lab, USA). The protein bands were captured by the ChemiDoc MP Imaging System (Chemidoc mp, BIORAD, USA), and protein intensity was measured using Image J (Image J 1.8.0, NIH, USA). 2.14 RNA isolation and quantitative realtime-PCR (qRT-PCR) Total RNA was extracted from the left ventricle at the apex of the heart (20mg) and H9C2 cells using trizol lysis buffer (Invitrogen, Thermo Fisher Scientific, USA), as per the manufacturer’s instruction. The RNA was reverse-transcribed into cDNA using a cDNA reverse transcription kit (FSQ-101, TOYOBO). For real-time PCR analysis, the gene expression levels were detected by using a real-time system with Hieff qPCR SYBR Green Master Mix (Low Rox Plus) (YEASEN, 11202ES03). The primer sequences of mice and rat samples are found in Table 2 . Table 2 Primer sequences. Primer species Sequence (5'-3') Product length (bp) P2X7 mouse Forward GGCCAAGAAGTTCCAACCTA 130 Reverse CCATTGAGAGCATGGCTTCTTG NLRP3 mouse Forward AAGGCTGCTATCTGGAGGAACT 133 Reverse ACGGACACTCGTCATCTTCAG Caspase 1 mouse Forward CCAGGAGGGAATATGTGGGAC 159 Reverse ACTCCTTGTTTCTCTCCACGG PANX 1 mouse Forward GTGGATTCATACTGCTGGGCT 101 Reverse AGGATGTAGGGGAAGAACTTGTG IL 1β mouse Forward TGCCACCTTTTGACAGTGATG 136 Reverse ATGTGCTGCTGCGAGATTTG IL 18 mouse Forward GACTCTTGCGTCAACTTCAAGG 169 Reverse CAGGCTGTCTTTTGTCAACGA P2X1 mouse Forward CTACCATCGGCTCTGGGATTG 149 Reverse GTCACGTTCACCCTCCCCAG P2X2 mouse Forward TACGAGACGCCCAAGGTGAT 106 Reverse CGATGAAGACGTACCACACGA P2X3 mouse Forward CTACGAGACTACCAAGTCGGTG 108 Reverse TGCAAGAAAACCCACCCCACA P2X4 mouse Forward CACCCACAGCAGTGGAATTG 145 Reverse GGTGAAGTTTTCTGCAGCCTTT P2X5 mouse Forward CAGCTCACCATCCTGTTGTACT 196 Reverse AGAAAACGTTCTCCCCCTGAG P2X6 mouse Forward GTGCTGTGCCCAGATCCAAT 192 Reverse TGCAATCCCAGTGAATGCTGA TXNIP mouse Forward CCCACTTACACTGAGGTGGAT 196 Reverse CCCATCTTGAGGAGTCAGCG GAPDH mouse Forward CCTCGTCCCGTAGACAAAATG 133 Reverse TGAGGTCAATGAAGGGGTCGT P2X7 rat Forward AAACAGAGTGAGCCTGTCGC 164 Reverse TCGCTCATCAAAGCAAAGCTAAC P2X4 rat Forward CCTTCCTGTTCGAGTACGACA 118 Reverse ACGAACACCCACCCGATGA NLRP3 rat Forward CGGACTGACCCATCAATGCT 172 Reverse GCAGCTGACCAACCAGAGTT GAPDH rat Forward CTGGAGAAACCTGCCAAGTATG 138 Reverse GGTGGAAGAATGGGAGTTGCT 2.15 PPI network construction and module analysis The PPI network of functional interaction between P2X proteins and PANX1 and NLRP3 inflammasome was analyzed by STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) website ( http://string-db.org ) 34 . The results were visualized using Cytoscape software. The top 15 high-degree proteins were identified using the cytoHubba plugin; the degree of the protein is represented via the size and colour of nodes, and the combined interaction score (threshold of 0.4) is shown through the edges' width. 2.16 Single-cell expression profile analysis Single-cell expression profile data of P2X1, P2X2, P2X3, P2X4, P2X5, P2X6, P2X7 in heart tissue were obtained from Tabula Muris ( https://tabula-muris.ds.czbiohub.org/ ) 35 . 2.17 Statistical analysis Data are presented as mean ± SEM and statistical analysis was performed using Prism 9.5 (GraphPad Software Inc). For the comparison of two groups, a 2-tailed unpaired Student t-test was used; for comparison between more than two groups, one-way ANOVA with Sidak’s multiple comparisons was used as appropriate. Two-way ANOVA with Sidak’s multiple comparisons to test the difference among groups with various factors (e.g., exercise or HFD/STZ treatment). P values < 0.05 were considered to indicate statistically significant differences. 3. Results 3.1 Exercise training relieves diabetic conditions To identify the impact of early exercise intervention on the progression of diabetes, weekly monitoring of body weight and pre- and post-injection monitoring of blood glucose levels were conducted. Following 15 weeks of adhering to the prescribed diet and exercise training, it was observed that there was no statistically significant variance in body weight across the four experimental groups (Fig. 1 B). Nevertheless, DM mice had a significant loss in lean body mass and an increase in fat body mass compared to the CON mice (Fig. 1 C). Exercise intervention reduced body fat in DM mice but did not prevent lean body loss (Fig. 1 C). Furthermore, the exercise intervention effectively mitigated the increase in blood glucose levels in DM mice (Fig. 1 D) and improved insulin tolerance and glucose tolerance impairment in DM mice (Figs. 1 E and 1 F). Additionally, the effect of exercise intervention and DM modelling on serum cholesterol levels was detected. While DM mice were compared to CON mice, triglyceride (TG), total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C) levels all increased significantly. However, exercise intervention successfully mitigated the elevation of these indicators in DM mice (Fig. 1 G-I). HDL-C (high-density lipoprotein cholesterol), which plays an important role in cholesterol export, increased significantly upon exercise intervention (Fig. 1 J). The findings indicate the successful establishment of a DM mouse model and emphasize the usefulness of early exercise intervention in slowing the progression of DM. 3.2 Exercise training reduces myocardial fibrosis and improves the cardiac function of diabetic hearts We investigated cardiac function using transthoracic echocardiography to evaluate if exercise improved the function of diabetic hearts. DM-induced cardiac contractile dysfunction was reflected by decreased left ventricular ejection fraction (LVEF), left ventricle fractional shortening (LVFS), and increased LVIDs (Fig. 2 C-E). Exercise intervention mitigated these changes: LVEF and LVFS were considerably higher in the exercised DM mice. In contrast, LVIDs were shown to be lower in exercised DM mice (Fig. 2 C-E). Moreover, exercise intervention slightly increased the LVFS of normal chow diet mice, with changes approaching statistical significance (Fig. 2 D). In order to conduct a comprehensive assessment of the cardiac structure, we employed HE and Masson staining to observe potential pathological alterations in the heart. The diabetic myocardium showed structural abnormalities, including the disordered arrangement of the myocardium, disrupted myocardial fibers and progressively extended fibrotic area (Fig. 2 G). In comparison, exercise training alleviated the structural abnormalities and fibrosis of the diabetic myocardium (Fig. 2 G). The confirmation of myocardial injury was further established by a significant increase in serum cTn-I levels, while the exercise intervention did not improve the release of cTn-I. (Fig. 2 H). The presence of fibrosis was additionally validated by a notable elevation in fibrotic indicators collagen I and collagen II in diabetic hearts, which were mitigated by exercise intervention (Fig. 2 I&J). These data demonstrated that exercise intervention could exert cardioprotective effects and delay the development of DCM. 3.3 Exercise training suppresses the priming stage of pyroptosis in diabetic hearts Activation of NF-κB signalling is widely recognized as a priming step of pyroptosis, which induces transcription of NLRP3, IL 1β, and IL 18 11 . The WB results showed that DM increased NF-κB P65 expression and enhanced phosphorylation of NF-κB P65 at Ser536, and exercise reduced phosphorylation of NF-κB P65 in the heart (Fig. 3 A). PCR results showed that the mRNA levels of Caspase 1 and IL 1β were upregulated in diabetic hearts, and exercise intervention reduced the mRNA levels of IL 1β in diabetic hearts (Fig. 3 B). Immunohistochemistry and PCR analysis indicated that NLRP3, Caspase 1, and IL 1β were significantly overexpressed in the cardiac tissues of DM mice and were decreased under the exercise intervention (Fig. 3 C). 3.4 Exercise training represses P2X4 and PANX1 expressions and inhibits NLRP3 activation in diabetic hearts The synergistic participation of P2X7 and PANX1 is considered to play essential roles in inflammation and cell death 36 . A comprehensive signalling network analysis was conducted to uncover the protein-protein functional association (Fig. 4 A). The network showed that among various purinergic receptors, P2X4 and P2X7 were key nodal junctions that interacted with PANX1 and other proteins of the network (Fig. 4 A). Previous studies have shown that the HFD diet and free fatty acids stimulation upregulated PANX1 expression and thus released more ATP into the extracellular space 37,38 . We hypothesized that PANX1 was activated in diabetic hearts, and then PANX1 modulated P2X activation and thus activated the NLRP3 inflammasome, leading to cardiomyocyte pyroptosis. To test this hypothesis, we detected the mRNA and protein levels of PANX1. The mRNA level and the monomer form of PANX1 were increased in diabetic hearts (Fig. 4 B&E). Moreover, exercise intervention effectively decreased the mRNA level and the protein monomer form of PANX1 (Fig. 4 B&E). We next evaluated the expressions of all seven purinergic P2X receptors in the myocardium. qRT-PCR results indicated that the predominant P2X subtypes expressed in the myocardium of normal mice were P2X4 and P2X5 receptors, followed by slight expressions of P2X7 and P2X1. Whereas P2X2, P2X3 and P2X6 expressions were largely absent in the myocardium (Fig. 4 C). Single-cell RNA-seq analysis of mouse hearts yielded similar results (Fig. S1 ). Besides that, the mRNA levels of P2X4, and P2X7 were significantly increased in diabetic hearts. Then, the mRNA level of P2X4 was mildly reduced by exercise intervention, which showed a nearly detectable statistically significant difference (Fig. 4 D). Comparatively, P2X1 and P2X5 did not show a significant difference among the different groups (Fig. 4 D). Furthermore, WB results revealed that the protein levels of P2X4, P2X7, and NLRP3 were significantly raised in the hearts of diabetics. Conversely, exercise intervention decreased the protein levels of P2X4 and NLRP3 (Fig. 4 E). Since previous studies have demonstrated that P2X receptors drive ROS generation, which in turn plays a pivotal role in initiating the activation of the NLRP3 inflammasome 14 , we next determined cardiac oxidative stress levels via measuring cardiac malondialdehyde (MDA) level and NFE2L2 and TXNIP expressions. The results showed that the mRNA level of NFE2L2 was not changed in any groups (Fig. 4 G), while TXNIP protein and mRNA levels were significantly upregulated in diabetic hearts and down-regulated by exercise intervention (Fig. 4 E&F). Similarly, MDA, which was associated with severe oxidative stress and inflammatory response, was significantly elevated in diabetic hearts and relieved by exercise intervention (Fig. 4 H). All of these results strongly suggested that exercise might inhibit NLRP3 inflammasome activation in diabetic hearts by downregulating the PANX1/P2X4/ROS signaling pathway. 3.5 Exercise training curtails cardiomyocyte pyroptosis in diabetic hearts Subsequently, to evaluate the extent of cardiomyocyte pyroptosis, we examined Caspase 1, IL 1β, and GSDMD activation by using WB. The results showed that exercise intervention reduced the expression of myocardial cleaved Caspase 1 (P20), mature IL 1β, and N terminal of GSDMD (GSDMD-N) induced by DM (Fig. 5 A). Additionally, pyroptosis was visualized by co-staining GSDMD with TUNEL. In the CON group, the double-positive cardiomyocytes were barely detected, while diabetic hearts occurred with substantial double-positive cardiomyocytes (Fig. 5 B). In contrast, exercise intervention decreased double-positive cardiomyocytes (Fig. 5 B). Collectively, these results confirmed that exercise intervention alleviated cardiomyocyte pyroptosis in the diabetic hearts. 3.6 P2X4 and P2X7 receptors were expressed in different high-fat conditions In contrast to earlier research 26,27 , our findings demonstrated that P2X4 was up-regulated in diabetes hearts and suppressed by exercise intervention, rather than P2X7. We reasoned that there may be a subtle disparity in the modelling approach which may contribute to variations in glycolipid metabolism and lead to the engagement of different P2X receptor subtypes in inflammasome activation within the heart. Consequently, we initially focused on examining the potential induction of P2X4 and P2X7 expression, as well as pyroptosis, in the presence of elevated glucose levels. Nonetheless, almost no decrease in cell viability was observed when the glucose concentration increased from 5.5 mM to 25 mM, whereas a substantial reduction in cell viability was observed at a glucose concentration of 50 mm (Fig. S2A). The P2X4 and P2X7 expression levels did not exhibit substantial alterations in response to high glucose conditions, whereas there was a modest up-regulation of the expression of NLRP3 (Fig. S2B). Hence, it is probable that the high glucose treatment primarily stimulates the expression of inflammatory proteins while not triggering pyroptosis. Next, we treated the H9C2 cells with 25 mM glucose and 100–600 µM PA. PA is a saturated fatty acid reported to be lipotoxic to various cells and is commonly present at high concentrations in patients with type 2 DM 39 . Our results showed cell viability decreased and Lactate dehydrogenase (LDH) release increased with PA concentration (Fig. 6 A&B). WB analysis showed that P2X4 protein level and Caspase1 activity were upregulated with the increase of PA concentration. In contrast, the expressions of P2X7 protein were significantly increased at initially 100–200 µM treatment concentrations of PA. The expression of NLRP3 protein was significantly increased at 100–300 µM treatment concentrations of PA (Fig. 6 D). To confirm the results of the in vitro experiment, we established mouse models with varying durations of a 60% HFD, as well as mice models that combined both a 60% HFD and exercise intervention. Unexpectedly, there were no significant changes observed in the LVIDs, LVIDd, and corrected LV mass among all groups (Fig. S3) LVEF and LVFS were modestly up-regulated in the 15-week HE group compared to the HFD group, and the trend was virtually significant (Fig. 6 F). However, there were no significant alterations observed in the protein level of PANX1 (Fig. 6 G). P2X7 was only significantly activated after 10 weeks of HFD, not after 15 weeks. (Fig. 6 G). Similar to those observed in diabetic mice, exercise training intervention failed to attenuate P2X7 expression in the myocardium of HFD mice (Fig. 6 G). In contrast, the protein levels of P2X4, NLRP3, and cleaved Caspase 1 (P20) showed significant upregulation at 15 weeks rather than at 10 weeks and were significantly decreased after exercise intervention (Fig. 6 G). Taken together, this result further demonstrated that NLRP3 activation due to abnormal lipid metabolism was probably mediated by different P2X in different pathological processes, and that exercise was more likely to suppress NLRP3 activation by reducing P2X4. 3.7 AICAR restrains the expression of P2X4 and activation of NLRP3 inflammasome in high glucose/high PA-treated cardiomyocytes To further explore the mechanism that exercise suppresses NLRP3 inflammasome activation and reduces pyroptosis in the cardiomyocytes via downregulating P2X, we hypothesize that energy metabolism and stress responses during exercise mediate reduced inflammation and pyroptosis in cardiomyocytes. To test this hypothesis, we added AICAR while treating H9C2 cells with high glucose/high PA. AICAR was labelled as an “exercise mimetic,” activating AMPK and PPARδ in the muscle cell, promoting metabolic changes similar to acute and exercise training 40,41 . The results showed that AICAR exhibited a significant protective impact on cell viability and LDH release at 0.1-0.2mM concentration (Fig. 7 A-B). In addition, Caspase1 activity was significantly decreased at 0.2-1mM concentration (Fig. 7 C). The inhibitory effect of AICAR on NLRP3 was observed in a dose-dependent manner, while the optimal inhibition of P2X4 and P2X7 receptors occurred at a concentration range of 0.2-0.5mM AICAR (Fig. 7 D). Nevertheless, the treatment of AICAR did not result in any significant alteration in the expression of PANX1 monomer (Fig. 7 D). Collectively, these results suggested that AICAR rescued high glucose/high PA-induced cardiac inflammation and death and may via inhibit P2X-NLRP3 axis. 3.8 P2X7 and P2X4 KD suppressed high glucose/high PA-induced cardiomyocyte inflammation In order to provide further evidence regarding the involvement of P2X4, P2X7, and NLRP3 in the modulation of cell viability in response to high glucose/high PA or AICAR treatment, we first manipulated the K + and Ca2 + concentrations in the culture medium. Additionally, we administered the NLRP3 inhibitor MCC950. The result showed that cell viability can be efficiently preserved through the inhibition of P2X4 or P2X7 ion channel function, as well as the inhibition of NLRP3 activation (Fig. S4). Moreover, we employed the small interfering RNA (siRNA) technique to examine the effect of P2X4 or P2X7 knockdown (KD) on NLRP3 inflammasome activation and pyroptosis in H9C2 cells. H9C2 cells were transfected with either control shRNA or P2X4/P2X7 shRNA1, 2, 3, and the highest KD efficiency was selected for subsequent experiments. Interestingly, P2X7 knockdown did not decrease the mRNA level of NLRP3 but increased the mRNA level of P2X4 (Fig. 8 A). Similarly, P2X4 knockdown did not decrease the mRNA level of NLRP3 and did not increase the mRNA level of P2X7 (Fig. 8 B). Previous studies have shown that P2X7 and P2X4 are cooperatively activating inflammation 42 . To further unveil the molecular mechanisms underlying P2X7-P2X4 interaction with inflammation processes, we treated the H9C2 cells with high glucose/high PA, and KD P2X4 and P2X7 separately or simultaneously to evaluate the downstream inflammatory activation. Remarkably, KD of P2X4 decreased the mRNA expression of P2X7 and NLRP3 under high glucose/high PA conditions. Equally, KD of P2X7 reduced the mRNA expression of P2X4 and NLRP3 under high glucose/high PA conditions (Fig. 8 C). These results indicated that P2X4 and P2X7 were likely to have functional interactions and amplified the inflammatory signals. Moreover, NLRP3 mRNA expression was further decreased when P2X4 and P2X7 were knocked down simultaneously rather than separately (Fig. 8 C), reiterating that P2X4 was potentially interacting with the P2X7 to activate the inflammatory pathways. 3.9 AICAR curtails high glucose/high PA-induced cardiomyocyte pyroptosis via reduced P2X signalling Next, to further ascertain whether P2X4 and P2X7 were sufficient for pyroptosis and whether exercise-induced energy stress ameliorated pyroptosis via influencing P2X4/P2X7-mediate inflammatory pathways, we performed double IF staining using TUNEL and GSDMD. The IF result showed that double positive cells significantly increased in high glucose/high PA conditions (Fig. 9 A&B). In contrast, the amounts of positive cells were significantly reduced by P2X4 and P2X7 single or double KD or chronic AICAR (0.5mM for 24h) treatment (Fig. 9 A&B). Moreover, P2X4 and P2X7 double KD combined with AICAR treatment failed to significantly decrease the positive cells compared with P2X7 and P2X4 double KD (Fig. 9 A&B), which confirmed that AICAR, at least partly, reduced the pyroptosis via P2X4 and P2X7. Given that P2X-mediated ROS via NADPH oxidase (NOX) is a critical upstream factor in NLRP3 inflammasome activation 14 , we examined cellular ROS and NOX activity levels. The result showed that P2X4 and P2X7 KD alone were not sufficient to affect the production of ROS, while the double KD robustly diminished the production of ROS, and AICAR treatment further reduced ROS generation (Fig. 9 A&C). Of note, P2X4 KD effectively restrained NOX oxidase activity, while P2X7 KD did not (Fig. 9 D). Meanwhile, P2X4/P2X7 double KD failed to further reduce NOX activity, as well as AICAR treatment combined with P2X4/P2X7 double KD (Fig. 9 D). Moreover, AICAR significantly reduced IL 1β release, an effect similar to P2X4/P2X7 double KD. In contrast, AICAR treatment combined with P2X4/P2X7 double KD did not further affect IL 1β release (Fig. 9 E). Collectively, these results suggest that P2X4 may be primarily responsible for NOX-induced oxidative stress. However, inhibition of P2X7 did reduce pyroptosis and slightly reduced IL1β release and ROS production. Since further P2X7 knockdowns on top of P2X4 knockdowns may further slightly reduce pyroptosis and IL1β release, it is plausible to suggest that P2X7 may function as a compensatory mechanism for NLRP3 activation when P2X4 is absent. AICAR can concurrently inhibit P2X4 and P2X7, resulting in a reduction in ROS production, myocardial pyroptosis, and IL1β release. 4. Discussion The formation and progression of DCM are linked to multiple regulatory variables and signaling pathways. All of these adverse variations might result in cell death, therefore leading to reduced cardiac muscle mass, interstitial fibrosis, deteriorated cardiac function, and eventually heart failure 7 . Apoptosis is the most commonly cited culprit for cardiomyocyte death 43–45 . However, apoptosis is typically immunologically silent and could not explain the constantly inflammatory responses and inflammatory cytokines production in diabetes-related cardiomyopathy 46,47 . Our IHC data of NLRP3, IL 1β and Caspase1 also reinforce the general observation that inflammatory proteins and pyroptosis-related proteins are abundantly expressed in diabetic heart 8,47 . We also examined NF-κB and found that it was activated in the diabetic heart and was downregulated by exercise intervention. Of note, NF-κB is a central mediator during the priming step of pyroptosis and can induce the expressions of various pro-inflammatory and pyroptotic genes such as IL 18, IL1β, and NLRP3. In addition, NF-κB-induced pro-survival factor FLICE-like inhibitory protein can suppress Caspase 8 activity, thereby inhibiting apoptosis 48 . Therefore, based on the results of the present study, we demonstrate that exercise intervention could ameliorate DCM via suppressing pyroptosis, not apoptosis. Next, we tried to elucidate how exercise affected the activation of NLRP3 inflammasome. Since K + is a universal requirement for NLRP3 inflammasome activation, we targeted P2X7 due to its role in facilitating the efflux of K+. However, exercise did not inhibit P2X7 expression in the diabetic hearts in the present study. Interestingly, P2X4 upregulation was impeded by exercise in the diabetic hearts. P2X4 belongs to the same P2X receptor family as P2X7. Our findings demonstrated that P2X4 was more abundantly expressed than P2X7 in cardiomyocytes. PANX1 is the upstream signal protein shared by P2X4 and P2X7. Nevertheless, P2X4 is more sensitive to ATP released by PANX1 49 . Previous studies have indicated that PANX1 exhibits activation in the skeletal muscle of HFD mice 37 . Our findings revealed that PANX1 was upregulated in diabetic hearts and downregulated by exercise. From our standpoint, it appears more plausible that PANX1 is responsible for the activation of P2X4, which then triggers the assembly of the NLRP3 inflammasome, ultimately resulting in the induction of pyroptosis. By altering the PANX1/P2X4/NLRP3 signalling pathway, exercise is anticipated to decrease cardiac cell death and ameliorate DCM. One of the interesting findings of the present study was that P2X7 and P2X4 were expressed differently during disease progression. P2X7 was strongly expressed in the cardiac muscle with short-term HFD intervention (10 weeks), while P2X4 was highly expressed with long-term (15 weeks) HFD intervention. Nevertheless, PANX1 expression was not significantly changed after either short-term or long-term HFD intervention. These results may suggest that P2X7 and P2X4 may be activated and play a role in different stages of obesity-induced cardiomyopathy or cardiometabolic disorders and that this activation is independent of PANX1. Simultaneously, the upregulation of P2X4 in long-term (15 weeks) HFD heart corresponded to higher NLRP3 expression and more prominent Caspase1 cleavage. Also, exercise intervention demonstrated a more notable decrease in the expression levels of P2X4, NLRP3, and restrain in Caspase1 cleavage in long-term (15 weeks) HFD heart. Therefore, these results further support our hypothesis that exercise restrains NLRP3 inflammasome activation by affecting P2X4. The results of the present study regarding P2X7 are not completely consistent with previous ones by other teams, which found that P2X7 and NLRP3 were elevated in both DM and HFD settings and that exercise training reduced P2X7 and hence blocked NLRP3 activation 26,27,50 . Nonetheless, our findings do not utterly refute the conclusions of other teams since the exercise intensities and modelling methodologies are slightly different. Furthermore, we did not investigate the gain and loss of function of P2X7 in vivo in the present study. Therefore, it is not reasonable to conclude that P2X7 plays no role in the inflammatory response and functional failure of cardiomyocytes. Indeed, both P2X4 and P2X7 were found to be involved in the activation of NLRP3 inflammasome and pyroptosis in a complementary manner in our in vitro study. Nevertheless, whether PANX1 serves as a significant upstream signal that triggers the activation of P2X7 and P2X4 remains unresolved. The results of our in vitro experiments indicated that PANX1 expression was not altered by high glucose and high lipid. On the contrary, the expression of P2X4 exhibited a lipid concentration-dependent manner, and the expression of P2X7 was also increased under high glucose/high PA. Therefore, it is probable that the high PANX1 expression observed in the DCM model was a result of other abnormal metabolites that were distinct from those observed in the HFD model. The activation of P2X4 and P2X7 in the HFD model might also be induced by signals other than PANX1. Indeed, some researches have demonstrated that within the site of inflammation, the activation of the P2X7 can occur via alternative ligands, including NAD + , non-nucleotide agonists and bactericidal peptides released by inflammatory cells 51 . P2X4 can also be stimulated by extracellular alpha-ketoglutaric acid 52 , and both ethanol and ivermectin can affect P2x4 activation 53 . These findings suggest that P2X might be a more dangerous, multiple DAMP receptor than previously recognised. In addition, P2X4 and P2X7 may also be activated by ATP that is passively released by neighbour dying cells. Direct measurements performed at inflammatory, or tumour sites have revealed that it is not uncommon for ATP concentrations to be as high as a few hundred micromoles extracellularly, which is sufficient to activate P2X7. Unfortunately, due to technical limitations, we were unable to reliably identify and distinguish metabolites in the myocardial extracellular space of mice with STZ/HFD-induced DM model and HFD-induced obesity models. To investigate the effect of exercise training on DCM in vitro , AICAR was employed as exercise mimetics in the present study. AICAR can activate AMPK which is able to activate numerous proteins that are engaged in physical exercise 41 . Furthermore, AICAR impacts metabolism, mitochondria quality and oxidative stress 54 . In the present study, we found that the impact of AICAR on PANX1 and P2X7 is minimal. Conversely, P2X4 protein level and Caspase1 activity were found to be lower with AICAR treatment between 0.2mM and 0.5mM. In addition, AICAR exhibited an inverse relationship with the expression of NLRP3. The above observations could be attributed to the potential role of ACIAR in facilitating AMPK activation and thus autophagic degradation of NLRP3 55 or alternatively, impeding NF-κB pathway to suppress NLRP3 transcription 56 . In other words, AICAR could significantly reduce NLRP3 expression levels. However, to restrain the activation of the inflammasome, it should be in the appropriate concentration range of AICAR. This range corresponds to the concentration at which optimal inhibition of P2X4 was achieved. This observation implies that the activation of the inflammasome is mostly reliant on P2X4. Noteworthy, the observed inhibitory impact of AICAR on P2X7, which approaches statistical significance at a dose of 0.5 mM, it is plausible to suggest that AICAR could potentially impede the activation of inflammasomes by concurrently modulating P2X7. Indeed, the findings of our study indicate that inhibition of P2X4 or P2X7 alone could not produce the same effect as the 0.5mM AICAR treatment. Nevertheless, when inhibition of both P2X7 and P2X4 (double KD), the resulting impact shows similarity to the 0.5mM AICAR treatment. Double KD in conjunction with the administration of AICAR did not further prevent pyroptosis and IL 1β release. In sum, it is a suggestion that the suppression of the NLRP3 inflammasome by AICAR exhibits a dependence on both P2X7 and P2X4 receptors, with greater reliance on P2X4. Some investigations have called into question the capacity of PANX1 to activate P2X7 and NLRP3 inflammasome because P2X7 requires an exceptionally high level of purinergic signalling for its activation 49 . Vince et al. revealed that Caspase 1 activation was unaffected in P2X7 deficient macrophages during PANX1 activation (apoptosis). Additionally, Chen et al. demonstrated that the cleaved form of PANX1 could potentially facilitate the assembly of NLRP3 by directly promoting K + efflux 57,58 . Nevertheless, these researchers might not have considered the potential compensatory mechanisms by other P2X when P2X7 was disrupted. The present study found that under normal physiological conditions, KD of either P2X4 or P2X7 would elevate NLRP3 gene expression, and other P2X might provide compensatory function. Similar analogous phenotypes have been reported in previous studies, such as P2X4 expression was significantly increased when P2X7 was downregulated in E10 cells. Similarly, downregulation of P2X4 leads to increased P2X7 expression and trafficking to the plasma membrane 59 . However, under pathological conditions, P2X4 KD significantly suppressed P2X7-dependent macrophage death 60 . Similarly, BMDCs P2X4-deficiency suppressed P2X7-dependent IL 1β and IL 18 release in response to ATP stimulation 61 . These findings align with our current results, suggesting that P2X4 and P2X7 are functional synergic and exert pro-inflammatory positive feedback upon each other under pathological conditions. Indeed, the exon-intron structure and key motifs of the vertebrate P2X gene are well conserved. In humans, the P2X4 gene is located on chromosome 12, which is very close to P2X7, surpassing other P2X genes. This association is conserved between species. Evidence shows that these two genes have physical and functional interactions, originating from the same ancestor gene, probably produced by local gene duplication 62,63 . Hence, it is more rational to consider both P2X4 and P2X7 while investigating and treating inflammation in DCM. In conclusion, our findings demonstrate that exercise training possesses cardioprotective and anti-inflammatory effects by inhibiting P2X4/NLRP3 in the diabetic heart. Meanwhile, we provide a comprehensive understanding of the molecular mechanisms of P2X4 and P2X7 in modulating the pathophysiological progression of DCM. Declarations Ethical approval All animal experiments were operated and conducted under the approved procedure by the Animal Experiment Committee of East China Normal University (m20201108, m20210404). Consent for publication Not applicable. Competing interests The authors declare no potential competing interests. Funding National Natural Science Foundation of China (Grant 31600967, 31671241); Author Contribution ZH L: investigation, performed the experiments, writing—original draft. YJ Y: construction of obesity mouse models, writing—review. LC S: helping with cell culturing and western blot assay. XY R: assisting with microscopy analysis. Y H: helping with echocardiography experiment. Y Z: helping with bioinformatics analysis. SZ D: investigation, writing—review, supervision, funding acquisition. Y S: investigation, experimental guidelines and supervision, writing—review and editing, funding acquisition. All authors have read and agreed to the published version of the manuscript. Acknowledgements We sincerely express our gratitude to the Instrumental Analysis Center of Shanghai Jiao Tong University for help with the echocardiography experiment. We also thank Prof. Yi Dong of East China Normal University for providing cell culture facilities. Thank Prof. Jian Luo of East China Normal University for providing mice treadmill facilities. The graphical abstract was produced with BioRender. Data availability All data generated and analyzed in this paper are available from the corresponding authors upon request. References Mohanty, R.R., and Das, S. (2017). Inhaled Insulin - Current Direction of Insulin Research. J Clin Diagn Res 11, OE01-OE02. 10.7860/JCDR/2017/23626.9732. Demir, S., Nawroth, P.P., Herzig, S., and Ekim Ustunel, B. (2021). Emerging Targets in Type 2 Diabetes and Diabetic Complications. Adv Sci (Weinh) 8, e2100275. 10.1002/advs.202100275. Bulani, Y., and Sharma, S.S. (2017). Argatroban Attenuates Diabetic Cardiomyopathy in Rats by Reducing Fibrosis, Inflammation, Apoptosis, and Protease-Activated Receptor Expression. Cardiovasc Drugs Ther 31, 255-267. 10.1007/s10557-017-6732-3. Murtaza, G., Virk, H.U.H., Khalid, M., Lavie, C.J., Ventura, H., Mukherjee, D., Ramu, V., Bhogal, S., Kumar, G., Shanmugasundaram, M., and Paul, T.K. (2019). Diabetic cardiomyopathy - A comprehensive updated review. Prog Cardiovasc Dis 62, 315-326. 10.1016/j.pcad.2019.03.003. Tan, Y., Zhang, Z., Zheng, C., Wintergerst, K.A., Keller, B.B., and Cai, L. (2020). Mechanisms of diabetic cardiomyopathy and potential therapeutic strategies: preclinical and clinical evidence. Nat Rev Cardiol 17, 585-607. 10.1038/s41569-020-0339-2. Mari, S.A., Pluhackova, K., Pipercevic, J., Leipner, M., Hiller, S., Engel, A., and Muller, D.J. (2022). Gasdermin-A3 pore formation propagates along variable pathways. Nat Commun 13, 2609. 10.1038/s41467-022-30232-8. Wei, J., Zhao, Y., Liang, H., Du, W., and Wang, L. (2022). Preliminary evidence for the presence of multiple forms of cell death in diabetes cardiomyopathy. Acta Pharm Sin B 12, 1-17. 10.1016/j.apsb.2021.08.026. Yang, F., Qin, Y., Wang, Y., Meng, S., Xian, H., Che, H., Lv, J., Li, Y., Yu, Y., Bai, Y., and Wang, L. (2019). Metformin Inhibits the NLRP3 Inflammasome via AMPK/mTOR-dependent Effects in Diabetic Cardiomyopathy. Int J Biol Sci 15, 1010-1019. 10.7150/ijbs.29680. Meng, L., Lin, H., Huang, X., Weng, J., Peng, F., and Wu, S. (2022). METTL14 suppresses pyroptosis and diabetic cardiomyopathy by downregulating TINCR lncRNA. Cell Death Dis 13, 38. 10.1038/s41419-021-04484-z. Gao, G., Fu, L., Xu, Y., Tao, L., Guo, T., Fang, G., Zhang, G., Wang, S., Qin, T., Luo, P., and Shen, X. (2022). Cyclovirobuxine D Ameliorates Experimental Diabetic Cardiomyopathy by Inhibiting Cardiomyocyte Pyroptosis via NLRP3 in vivo and in vitro. Front Pharmacol 13, 906548. 10.3389/fphar.2022.906548. Swanson, K.V., Deng, M., and Ting, J.P. (2019). The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol 19, 477-489. 10.1038/s41577-019-0165-0. Chekeni, F.B., Elliott, M.R., Sandilos, J.K., Walk, S.F., Kinchen, J.M., Lazarowski, E.R., Armstrong, A.J., Penuela, S., Laird, D.W., Salvesen, G.S., et al. (2010). Pannexin 1 channels mediate 'find-me' signal release and membrane permeability during apoptosis. Nature 467, 863-867. 10.1038/nature09413. Medina, C.B., Mehrotra, P., Arandjelovic, S., Perry, J.S.A., Guo, Y., Morioka, S., Barron, B., Walk, S.F., Ghesquiere, B., Krupnick, A.S., et al. (2020). Metabolites released from apoptotic cells act as tissue messengers. Nature 580, 130-135. 10.1038/s41586-020-2121-3. Savio, L.E.B., Leite-Aguiar, R., Alves, V.S., Coutinho-Silva, R., and Wyse, A.T.S. (2021). Purinergic signaling in the modulation of redox biology. Redox Biol 47, 102137. 10.1016/j.redox.2021.102137. North, R.A. (2002). Molecular physiology of P2X receptors. Physiol Rev 82, 1013-1067. 10.1152/physrev.00015.2002. McCarthy, A.E., Yoshioka, C., and Mansoor, S.E. (2019). Full-Length P2X7 Structures Reveal How Palmitoylation Prevents Channel Desensitization. Cell 179, 659-670 e613. 10.1016/j.cell.2019.09.017. Illes, P., Muller, C.E., Jacobson, K.A., Grutter, T., Nicke, A., Fountain, S.J., Kennedy, C., Schmalzing, G., Jarvis, M.F., Stojilkovic, S.S., et al. (2021). Update of P2X receptor properties and their pharmacology: IUPHAR Review 30. Br J Pharmacol 178, 489-514. 10.1111/bph.15299. Higashikuni, Y., Liu, W., Numata, G., Tanaka, K., Fukuda, D., Tanaka, Y., Hirata, Y., Imamura, T., Takimoto, E., Komuro, I., and Sata, M. (2023). NLRP3 Inflammasome Activation Through Heart-Brain Interaction Initiates Cardiac Inflammation and Hypertrophy During Pressure Overload. Circulation 147, 338-355. 10.1161/CIRCULATIONAHA.122.060860. Huang, S., Wang, W., Li, L., Wang, T., Zhao, Y., Lin, Y., Huang, W., Wang, Y., and Huang, Z. (2021). P2X7 Receptor Deficiency Ameliorates STZ-induced Cardiac Damage and Remodeling Through PKCbeta and ERK. Front Cell Dev Biol 9, 692028. 10.3389/fcell.2021.692028. Sun, S., Dawuti, A., Gong, D., Wang, R., Yuan, T., Wang, S., Xing, C., Lu, Y., Du, G., and Fang, L. (2022). Puerarin-V Improve Mitochondrial Respiration and Cardiac Function in a Rat Model of Diabetic Cardiomyopathy via Inhibiting Pyroptosis Pathway through P2X7 Receptors. Int J Mol Sci 23. 10.3390/ijms232113015. Braganca, B., Nogueira-Marques, S., Ferreirinha, F., Fontes-Sousa, A.P., and Correia-de-Sa, P. (2019). The Ionotropic P2X4 Receptor has Unique Properties in the Heart by Mediating the Negative Chronotropic Effect of ATP While Increasing the Ventricular Inotropy. Front Pharmacol 10, 1103. 10.3389/fphar.2019.01103. Yang, T., Shen, J.B., Yang, R., Redden, J., Dodge-Kafka, K., Grady, J., Jacobson, K.A., and Liang, B.T. (2014). Novel protective role of endogenous cardiac myocyte P2X4 receptors in heart failure. Circ Heart Fail 7, 510-518. 10.1161/CIRCHEARTFAILURE.113.001023. Shen, J.B., Cronin, C., Sonin, D., Joshi, B.V., Gongora Nieto, M., Harrison, D., Jacobson, K.A., and Liang, B.T. (2007). P2X purinergic receptor-mediated ionic current in cardiac myocytes of calsequestrin model of cardiomyopathy: implications for the treatment of heart failure. Am J Physiol Heart Circ Physiol 292, H1077-1084. 10.1152/ajpheart.00515.2006. Musa, H., Tellez, J.O., Chandler, N.J., Greener, I.D., Maczewski, M., Mackiewicz, U., Beresewicz, A., Molenaar, P., Boyett, M.R., and Dobrzynski, H. (2009). P2 purinergic receptor mRNA in rat and human sinoatrial node and other heart regions. Naunyn Schmiedebergs Arch Pharmacol 379, 541-549. 10.1007/s00210-009-0403-2. Chen, K., Zhang, J., Zhang, W., Zhang, J., Yang, J., Li, K., and He, Y. (2013). ATP-P2X4 signaling mediates NLRP3 inflammasome activation: a novel pathway of diabetic nephropathy. Int J Biochem Cell Biol 45, 932-943. 10.1016/j.biocel.2013.02.009. Wang, T., Li, J., Li, H., Zhong, X., Wang, L., Zhao, S., Liu, X., Huang, Z., and Wang, Y. (2022). Aerobic Exercise Inhibited P2X7 Purinergic Receptors to Improve Cardiac Remodeling in Mice With Type 2 Diabetes. Front Physiol 13, 828020. 10.3389/fphys.2022.828020. Chen, X., Li, H., Wang, K., Liang, X., Wang, W., Hu, X., Huang, Z., and Wang, Y. (2019). Aerobic Exercise Ameliorates Myocardial Inflammation, Fibrosis and Apoptosis in High-Fat-Diet Rats by Inhibiting P2X7 Purinergic Receptors. Front Physiol 10, 1286. 10.3389/fphys.2019.01286. Virtue, S., and Vidal-Puig, A. (2021). GTTs and ITTs in mice: simple tests, complex answers. Nat Metab 3, 883-886. 10.1038/s42255-021-00414-7. Sun, X., Sun, G., Huang, Y., Zhang, S., Tang, X., Zhang, N., Zhao, L., Zhong, R., and Peng, Y. (2020). Glycolytic inhibition by 3-bromopyruvate increases the cytotoxic effects of chloroethylnitrosoureas to human glioma cells and the DNA interstrand cross-links formation. Toxicology 435, 152413. 10.1016/j.tox.2020.152413. Yan, M., Li, Y., Luo, Q., Zeng, W., Shao, X., Li, L., Wang, Q., Wang, D., Zhang, Y., Diao, H., et al. (2022). Mitochondrial damage and activation of the cytosolic DNA sensor cGAS-STING pathway lead to cardiac pyroptosis and hypertrophy in diabetic cardiomyopathy mice. Cell Death Discov 8, 258. 10.1038/s41420-022-01046-w. Li, F., Xu, D., Hou, K., Gou, X., Lv, N., Fang, W., and Li, Y. (2021). Pretreatment of Indobufen and Aspirin and their Combinations with Clopidogrel or Ticagrelor Alleviates Inflammasome Mediated Pyroptosis Via Inhibiting NF-kappaB/NLRP3 Pathway in Ischemic Stroke. J Neuroimmune Pharmacol 16, 835-853. 10.1007/s11481-020-09978-9. Broz, P., Pelegrin, P., and Shao, F. (2020). The gasdermins, a protein family executing cell death and inflammation. Nat Rev Immunol 20, 143-157. 10.1038/s41577-019-0228-2. Mentrup, T., Theodorou, K., Cabrera-Cabrera, F., Helbig, A.O., Happ, K., Gijbels, M., Gradtke, A.C., Rabe, B., Fukumori, A., Steiner, H., et al. (2019). Atherogenic LOX-1 signaling is controlled by SPPL2-mediated intramembrane proteolysis. J Exp Med 216, 807-830. 10.1084/jem.20171438. Szklarczyk, D., Gable, A.L., Lyon, D., Junge, A., Wyder, S., Huerta-Cepas, J., Simonovic, M., Doncheva, N.T., Morris, J.H., Bork, P., et al. (2019). STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res 47, D607-D613. 10.1093/nar/gky1131. Tabula Muris, C., Overall, c., Logistical, c., Organ, c., processing, Library, p., sequencing, Computational data, a., Cell type, a., Writing, g., et al. (2018). Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature 562, 367-372. 10.1038/s41586-018-0590-4. Li, S., Bjelobaba, I., and Stojilkovic, S.S. (2018). Interactions of Pannexin1 channels with purinergic and NMDA receptor channels. Biochim Biophys Acta Biomembr 1860, 166-173. 10.1016/j.bbamem.2017.03.025. Jorquera, G., Meneses-Valdes, R., Rosales-Soto, G., Valladares-Ide, D., Campos, C., Silva-Monasterio, M., Llanos, P., Cruz, G., Jaimovich, E., and Casas, M. (2021). High extracellular ATP levels released through pannexin-1 channels mediate inflammation and insulin resistance in skeletal muscle fibres of diet-induced obese mice. Diabetologia 64, 1389-1401. 10.1007/s00125-021-05418-2. Tam, T.H., Chan, K.L., Boroumand, P., Liu, Z., Brozinick, J.T., Bui, H.H., Roth, K., Wakefield, C.B., Penuela, S., Bilan, P.J., and Klip, A. (2020). Nucleotides released from palmitate-activated murine macrophages attract neutrophils. J Biol Chem 295, 4902-4911. 10.1074/jbc.RA119.010868. Palomer, X., Pizarro-Delgado, J., Barroso, E., and Vazquez-Carrera, M. (2018). Palmitic and Oleic Acid: The Yin and Yang of Fatty Acids in Type 2 Diabetes Mellitus. Trends Endocrinol Metab 29, 178-190. 10.1016/j.tem.2017.11.009. Narkar, V.A., Downes, M., Yu, R.T., Embler, E., Wang, Y.X., Banayo, E., Mihaylova, M.M., Nelson, M.C., Zou, Y., Juguilon, H., et al. (2008). AMPK and PPARdelta agonists are exercise mimetics. Cell 134, 405-415. 10.1016/j.cell.2008.06.051. Hoffman, N.J., Parker, B.L., Chaudhuri, R., Fisher-Wellman, K.H., Kleinert, M., Humphrey, S.J., Yang, P., Holliday, M., Trefely, S., Fazakerley, D.J., et al. (2015). Global Phosphoproteomic Analysis of Human Skeletal Muscle Reveals a Network of Exercise-Regulated Kinases and AMPK Substrates. Cell Metab 22, 922-935. 10.1016/j.cmet.2015.09.001. Zumerle, S., Cali, B., Munari, F., Angioni, R., Di Virgilio, F., Molon, B., and Viola, A. (2019). Intercellular Calcium Signaling Induced by ATP Potentiates Macrophage Phagocytosis. Cell Rep 27, 1-10 e14. 10.1016/j.celrep.2019.03.011. Ma, T., Huang, X., Zheng, H., Huang, G., Li, W., Liu, X., Liang, J., Cao, Y., Hu, Y., and Huang, Y. (2021). SFRP2 Improves Mitochondrial Dynamics and Mitochondrial Biogenesis, Oxidative Stress, and Apoptosis in Diabetic Cardiomyopathy. Oxid Med Cell Longev 2021, 9265016. 10.1155/2021/9265016. Ren, B.C., Zhang, Y.F., Liu, S.S., Cheng, X.J., Yang, X., Cui, X.G., Zhao, X.R., Zhao, H., Hao, M.F., Li, M.D., et al. (2020). Curcumin alleviates oxidative stress and inhibits apoptosis in diabetic cardiomyopathy via Sirt1-Foxo1 and PI3K-Akt signalling pathways. J Cell Mol Med 24, 12355-12367. 10.1111/jcmm.15725. Zhang, B., Li, X., Liu, G., Zhang, C., Zhang, X., Shen, Q., Sun, G., and Sun, X. (2021). Peroxiredomin-4 ameliorates lipotoxicity-induced oxidative stress and apoptosis in diabetic cardiomyopathy. Biomed Pharmacother 141, 111780. 10.1016/j.biopha.2021.111780. Kaze, A.D., Erqou, S., Santhanam, P., Bertoni, A.G., Ahima, R.S., Fonarow, G.C., and Echouffo-Tcheugui, J.B. (2022). Variability of adiposity indices and incident heart failure among adults with type 2 diabetes. Cardiovasc Diabetol 21, 16. 10.1186/s12933-021-01440-1. Fender, A.C., Kleeschulte, S., Stolte, S., Leineweber, K., Kamler, M., Bode, J., Li, N., and Dobrev, D. (2020). Thrombin receptor PAR4 drives canonical NLRP3 inflammasome signaling in the heart. Basic Res Cardiol 115, 10. 10.1007/s00395-019-0771-9. Yeap, H.W., and Chen, K.W. (2022). RIPK1 and RIPK3 in antibacterial defence. Biochem Soc Trans 50, 1583-1594. 10.1042/BST20211242. Schmid, R., and Evans, R.J. (2019). ATP-Gated P2X Receptor Channels: Molecular Insights into Functional Roles. Annu Rev Physiol 81, 43-62. 10.1146/annurev-physiol-020518-114259. Raggi, F., Rossi, C., Faita, F., Distaso, M., Kusmic, C., and Solini, A. (2022). P2X7 Receptor and Heart Function in a Mouse Model of Systemic Inflammation Due to High Fat Diet. J Inflamm Res 15, 2425-2439. 10.2147/JIR.S356038. Di Virgilio, F., Dal Ben, D., Sarti, A.C., Giuliani, A.L., and Falzoni, S. (2017). The P2X7 Receptor in Infection and Inflammation. Immunity 47, 15-31. 10.1016/j.immuni.2017.06.020. Yuan, Y., Zhu, C., Wang, Y., Sun, J., Feng, J., Ma, Z., Li, P., Peng, W., Yin, C., Xu, G., et al. (2022). alpha-Ketoglutaric acid ameliorates hyperglycemia in diabetes by inhibiting hepatic gluconeogenesis via serpina1e signaling. Sci Adv 8, eabn2879. 10.1126/sciadv.abn2879. Popova, M., Trudell, J., Li, K., Alkana, R., Davies, D., and Asatryan, L. (2013). Tryptophan 46 is a site for ethanol and ivermectin action in P2X4 receptors. Purinergic Signal 9, 621-632. 10.1007/s11302-013-9373-4. Viglino, C., Foglia, B., and Montessuit, C. (2019). Chronic AICAR treatment prevents metabolic changes in cardiomyocytes exposed to free fatty acids. Pflugers Arch 471, 1219-1234. 10.1007/s00424-019-02285-0. Cordero, M.D., Williams, M.R., and Ryffel, B. (2018). AMP-Activated Protein Kinase Regulation of the NLRP3 Inflammasome during Aging. Trends Endocrinol Metab 29, 8-17. 10.1016/j.tem.2017.10.009. Kirchner, J., Brune, B., and Namgaladze, D. (2018). AICAR inhibits NFkappaB DNA binding independently of AMPK to attenuate LPS-triggered inflammatory responses in human macrophages. Sci Rep 8, 7801. 10.1038/s41598-018-26102-3. Chen, K.W., Demarco, B., Heilig, R., Shkarina, K., Boettcher, A., Farady, C.J., Pelczar, P., and Broz, P. (2019). Extrinsic and intrinsic apoptosis activate pannexin-1 to drive NLRP3 inflammasome assembly. EMBO J 38. 10.15252/embj.2019101638. Vince, J.E., Wong, W.W., Gentle, I., Lawlor, K.E., Allam, R., O'Reilly, L., Mason, K., Gross, O., Ma, S., Guarda, G., et al. (2012). Inhibitor of apoptosis proteins limit RIP3 kinase-dependent interleukin-1 activation. Immunity 36, 215-227. 10.1016/j.immuni.2012.01.012. Weinhold, K., Krause-Buchholz, U., Rodel, G., Kasper, M., and Barth, K. (2010). Interaction and interrelation of P2X7 and P2X4 receptor complexes in mouse lung epithelial cells. Cell Mol Life Sci 67, 2631-2642. 10.1007/s00018-010-0355-1. Kawano, A., Tsukimoto, M., Noguchi, T., Hotta, N., Harada, H., Takenouchi, T., Kitani, H., and Kojima, S. (2012). Involvement of P2X4 receptor in P2X7 receptor-dependent cell death of mouse macrophages. Biochem Biophys Res Commun 419, 374-380. 10.1016/j.bbrc.2012.01.156. Sakaki, H., Fujiwaki, T., Tsukimoto, M., Kawano, A., Harada, H., and Kojima, S. (2013). P2X4 receptor regulates P2X7 receptor-dependent IL-1beta and IL-18 release in mouse bone marrow-derived dendritic cells. Biochem Biophys Res Commun 432, 406-411. 10.1016/j.bbrc.2013.01.135. Kanellopoulos, J.M., Almeida-da-Silva, C.L.C., Ruutel Boudinot, S., and Ojcius, D.M. (2021). Structural and Functional Features of the P2X4 Receptor: An Immunological Perspective. Front Immunol 12, 645834. 10.3389/fimmu.2021.645834. Hou, Z., and Cao, J. (2016). Comparative study of the P2X gene family in animals and plants. Purinergic Signal 12, 269-281. 10.1007/s11302-016-9501-z. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx Graphicalabstract.png Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3965620","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":273790386,"identity":"3d2c7a97-4077-42d6-9bee-c0bd50301491","order_by":0,"name":"Zonghan Liu","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Zonghan","middleName":"","lastName":"Liu","suffix":""},{"id":273790387,"identity":"928ff497-7744-4e55-8d7d-9639f9079c76","order_by":1,"name":"Yangjun Yang","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Yangjun","middleName":"","lastName":"Yang","suffix":""},{"id":273790388,"identity":"f98bbb87-61fe-48aa-b02c-af3843677d7b","order_by":2,"name":"Luchen Song","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Luchen","middleName":"","lastName":"Song","suffix":""},{"id":273790389,"identity":"ce326a2c-a890-43dc-8fc3-1aee4addd833","order_by":3,"name":"Xinyu Ruan","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Xinyu","middleName":"","lastName":"Ruan","suffix":""},{"id":273790390,"identity":"4e495048-b4ee-42b6-a503-167f5aebf919","order_by":4,"name":"Yuan He","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Yuan","middleName":"","lastName":"He","suffix":""},{"id":273790391,"identity":"9631343f-f353-4fee-a309-92c88be09c31","order_by":5,"name":"Yong Zou","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Zou","suffix":""},{"id":273790392,"identity":"4b67990c-6f1f-435f-a149-50b18d7fbd11","order_by":6,"name":"Shuzhe Ding","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Shuzhe","middleName":"","lastName":"Ding","suffix":""},{"id":273790393,"identity":"2b73935c-685a-4d35-8944-f4a3a6260567","order_by":7,"name":"Yi Sun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYLCCDyi8A0ToYJyRQKoWZh6StBicP2P22PbH4cQNB5gPfi5sY5Dju5HA+LkAn5YbOebGOQmHjSUb2JKlZ7YxGEveSGCWnoFXC4+ZNFCLHD8DjxkzbxtD4oYbCWzMPAQcJm2RcJiHjYH/G0hLPWEtB3LMpBkgtrCBtCQYENIieSOtTLInLd1YspnNWJrnnIThzDMPm6XxaeE7f3ibxA8b68QNx5sffuYps5HnO5588DM+LQoHwFQzMHbADAkgZmzAo4GBQR4iXYdX0SgYBaNgFIxwAAA400O9Cau9XgAAAABJRU5ErkJggg==","orcid":"","institution":"East China Normal University","correspondingAuthor":true,"prefix":"","firstName":"Yi","middleName":"","lastName":"Sun","suffix":""}],"badges":[],"createdAt":"2024-02-18 02:29:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3965620/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3965620/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51424796,"identity":"9c0fd417-7c0f-4f06-9dc2-b6cd5bae3ca4","added_by":"auto","created_at":"2024-02-21 11:13:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":412250,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExercise training prevents the progression of DM.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Timeline for diet, STZ treatment, and exercise training plan.\u003c/p\u003e\n\u003cp\u003e(B) Weekly body weight changes among different groups, n=15-22.\u003c/p\u003e\n\u003cp\u003e(C) Body compositions of mice after 15 weeks of diet, STZ injection, and exercise training regimen, n=15-17.\u003c/p\u003e\n\u003cp\u003e(D) Weekly fasting blood glucose level variations among different groups, n=15-17.\u003c/p\u003e\n\u003cp\u003e(E-F) Intraperitoneal insulin tolerance test (ITT) and glucose tolerance test (GTT) among different groups; the bar graph shows data expressed as area under the curve, n=8.\u003c/p\u003e\n\u003cp\u003e(G-J) Blood lipid levels of mice among different groups, n=6.\u003c/p\u003e\n\u003cp\u003eTG, triglyceride; TC, total cholesterol; LDL-C, low-density lipoprotein cholesterol; HDL-C, high-density lipoprotein cholesterol; SED, sedentary; EX, exercise; DM, diabetes mellitus. *P\u0026lt;0.05, **P\u0026lt; 0.01, ***P \u0026lt; 0.001; Data are represented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/a97d3f47daca7fc8aff32c2f.png"},{"id":51425246,"identity":"2f82c70e-ebb4-4511-82b0-64abdadfec4a","added_by":"auto","created_at":"2024-02-21 11:21:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3415995,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExercise training preserved left ventricular systolic function and cardiac structure in diabetic mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-F) Representative M-mode echocardiograms of the left ventricles are shown. Quantification of corrected LV mass (B), LVEF (C), LVFS values (D), LVIDs (E), and LVIDd (F) among different groups, n=7.\u003c/p\u003e\n\u003cp\u003e(G) Representative HE and Masson’s trichrome staining are shown. Scale bar, 50 μm.\u003c/p\u003e\n\u003cp\u003e(H) ELISA assay of circulating cTn-I concentrations among different groups, n=10.\u003c/p\u003e\n\u003cp\u003e(I) Representative WB images of collagen I and collagen III are shown.\u003c/p\u003e\n\u003cp\u003e(J) Statistical graphs of densitometry analysis among different groups were performed and demonstrated as fold change, n=9.\u003c/p\u003e\n\u003cp\u003eSED, sedentary; EX, exercise; DM, diabetes mellitus. *P\u0026lt;0.05, **P\u0026lt; 0.01, ***P \u0026lt; 0.001. Data are represented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/479021557493e7b9d6ba8b21.png"},{"id":51424804,"identity":"51e1bbdd-a8f0-4516-abba-24e33ca856fc","added_by":"auto","created_at":"2024-02-21 11:13:57","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2750974,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExercise training inhibited NF-κB phosphorylation and down-regulated pyroptosis-related gene expression in diabetic hearts.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Left: representative WB images of P-NF-κb P65 (ser536) and NF-κb P65 protein; right: statistical graphs of densitometry analysis among different groups were performed and demonstrated as fold change, n=11.\u003c/p\u003e\n\u003cp\u003e(B) qRT-PCR analysis of NLRP3, IL 1β, IL 18, and Caspase 1 mRNA levels among different groups, n=9.\u003c/p\u003e\n\u003cp\u003e(C) Left: representative IHC pictures of NLRP3, Caspase 1, and IL 1β expression. Scale bar: 50 μm; right: quantified and statistically analyzed IOD result of IHC among different groups and demonstrated as fold change, n=4.\u003c/p\u003e\n\u003cp\u003eSED, sedentary; EX, exercise; DM, diabetes mellitus. *P\u0026lt;0.05, **P\u0026lt; 0.01, ***P \u0026lt; 0.001. Data are represented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/c8168ab492d59652f11e1755.png"},{"id":51425245,"identity":"81ac0cee-75b8-4de4-b576-c10f5fbe8d59","added_by":"auto","created_at":"2024-02-21 11:21:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":654090,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExercise training suppressed PANX1/P2X4/NLRP3 signaling axis and reduced myocardial oxidative stress.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) A protein-protein interaction(PPI) network of NLRP3-related protein and purinergic signaling-related protein.\u003c/p\u003e\n\u003cp\u003e(B) qRT-PCR analysis of PANX1 mRNA levels among different groups, n=9.\u003c/p\u003e\n\u003cp\u003e(C) qRT-PCR analysis of relative mRNA expression of P2X1–7 to GAPDH (housekeeping) in the heart of normal mice, n=4.\u003c/p\u003e\n\u003cp\u003e(D) qRT-PCR analysis of P2X1, P2X4, P2X5, P2X7 mRNA levels among different groups, n=6-9.\u003c/p\u003e\n\u003cp\u003e(E) Left: representative WB images of PANX1, P2X4, P2X7, TXNIP, NLRP3 protein; right \u0026amp; below: statistical graphs of densitometry analysis among different groups were performed and demonstrated as fold change, n=9.\u003c/p\u003e\n\u003cp\u003e(F-G) qRT-PCR analysis of TXNIP and NFE2L2 mRNA levels among different groups, n=6-9.\u003c/p\u003e\n\u003cp\u003e(H) The MDA levels among different groups, n=4.\u003c/p\u003e\n\u003cp\u003eSED, sedentary; EX, exercise; DM, diabetes mellitus. *P\u0026lt;0.05, **P\u0026lt; 0.01, ***P \u0026lt; 0.001. Data are represented as mean ± SEM.\u003c/p\u003e\n\u003cp\u003eSee also Figure S1.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/e78675704db0745114eaf8df.png"},{"id":51425247,"identity":"78f4b7ae-fc2b-4da6-b9b5-a67d71126e03","added_by":"auto","created_at":"2024-02-21 11:21:59","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1812196,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExercise training ameliorates DM-induced cardiomyocyte pyroptosis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Left: representative WB images of Caspase 1, GSDMD, IL 1β protein; right: statistical graphs of densitometry analysis among different groups were performed and demonstrated as fold change, n=9.\u003c/p\u003e\n\u003cp\u003e(B) Representative IF pictures of GSDMD, TUNEL, DAPI, Scale bar: 100um, n=4.\u003c/p\u003e\n\u003cp\u003eSED, sedentary; EX, exercise; DM, diabetes mellitus. *P\u0026lt;0.05, **P\u0026lt; 0.01, ***P \u0026lt; 0.001. Data are represented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/650e9c7394fc40abdba0ed12.png"},{"id":51424800,"identity":"67268b7d-34b3-44af-9fff-cf6f0be21f1d","added_by":"auto","created_at":"2024-02-21 11:13:57","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1444116,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eP2X4 and P2X7 were involved in NLRP3 inflammasome activation of diabetic hearts and high glucose/high PA-induced cardiomyocytes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A\u0026amp;B) The viability of H9C2 cells treated with high Glu/high PA; LDH content in the supernatant of H9C2 cells treated with high Glu/high PA. Experiments were performed in 4 biological replicates with 3 technical replicates.\u003c/p\u003e\n\u003cp\u003e(A) Caspase 1 activity of H9C2 cells treated with high Glu/high PA, all experiments were performed in at least 4 biological replicates.\u003c/p\u003e\n\u003cp\u003e(B) Left: representative WB images of PANX1, NLRP3, P2X7, P2X4 protein; right: statistical graphs of densitometry analysis among different groups were performed and demonstrated as fold change, n=4-6.\u003c/p\u003e\n\u003cp\u003e(C) Representative M-mode echocardiograms of the left ventricles are shown.\u003c/p\u003e\n\u003cp\u003e(D) Quantification of LVEF and LVFS among different groups, n=5.\u003c/p\u003e\n\u003cp\u003e(E) Left: representative WB images of PANX1, P2X7, P2X4, NLRP3, Caspase 1 protein; right: statistical graphs of densitometry analysis among different groups were performed and demonstrated as fold change, n=6.\u003c/p\u003e\n\u003cp\u003eGlu, glucose; PA, palmitic acid; LDH, lactate dehydrogenase; Blank, no treatment; Con, mannitol and BSA treatment as control; CON, normal diet mice; HFD, high-fat diet mice; HE, HFD and exercise mice; *P\u0026lt;0.05, **P\u0026lt; 0.01, ***P \u0026lt; 0.001 versus the CON group (5.5mM glucose) or comparison as indicated. Data are represented as mean ± SEM.\u003c/p\u003e\n\u003cp\u003eSee also Figure S2and Figure S3.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/84fd45a712023e34fdabfde6.png"},{"id":51424799,"identity":"619c08d0-bf34-494a-aca8-1c2b8cc91b94","added_by":"auto","created_at":"2024-02-21 11:13:57","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":378850,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAICAR down-regulated P2X4 and suppressed NLRP3 inflammasome activation of high glucose/high PA-induced cardiomyocytes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A\u0026amp;B) The viability of H9C2 cells treated with AICAR and high Glu/high PA; LDH content in the supernatant of H9C2 cells treated with AICAR and high Glu/high PA Experiments were performed in 4 biological replicates with 3 technical replicates.\u003c/p\u003e\n\u003cp\u003e(A) Left: representative WB images of NLRP3, P2X7, P2X4 protein; right: statistical graphs of densitometry analysis among different groups were performed and demonstrated as fold change, Caspase 1 activity of H9C2 cells treated with AICAR and high Glu/high PA, all experiments were performed in at least 4 biological replicates.\u003c/p\u003e\n\u003cp\u003eGlu, glucose; PA, palmitic acid; LDH, lactate dehydrogenase; Con, mannitol and BSA treatment as control; #P\u0026lt;0.05, ###P\u0026lt;0.001 versus the CON group (5.5mM glucose); *P\u0026lt;0.05, **P\u0026lt; 0.01, ***P \u0026lt; 0.001 versus the Glu+PA group (25mM glu+300μM PA). Data are represented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/271c15b0cd70b92808acd6e1.png"},{"id":51424803,"identity":"3616c342-6862-458a-8a15-a42d6d448fae","added_by":"auto","created_at":"2024-02-21 11:13:57","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":596289,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDown-regulated P2X4 and P2X7 suppressed high glucose/high PA-induced NLRP3 expression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-C) qRT-PCR analysis of P2X7, P2X4, and NLRP3 mRNA levels among different groups, all experiments were performed in at least 4 biological replicates. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001 versus siNC group, #P\u0026lt;0.05 compared to the Glu+PA group (25mM glucose+300μM PA). Data are represented as mean ± SEM.\u003c/p\u003e\n\u003cp\u003eSee also Figure S4.\u003c/p\u003e","description":"","filename":"Fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/172e346d4b694a84278d0f00.png"},{"id":51424807,"identity":"0d1364f8-ad96-4ece-bab7-5dd1c75ea859","added_by":"auto","created_at":"2024-02-21 11:13:58","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1191269,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAICAR treatment and down-regulated P2X4 and P2X7 suppressed high glucose/high PA-induced pyroptosis and oxidative stress.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Representative IF pictures of GSDMD, TUNEL, DAPI, ROS, Scale bar: 100um.\u003c/p\u003e\n\u003cp\u003e(B) Statistical graphs of GSDMD, TUNEL double positive ratio analysis among different groups were performed.\u003c/p\u003e\n\u003cp\u003e(C) Statistical graphs of ROS production analysis among different groups were performed.\u003c/p\u003e\n\u003cp\u003e(D) NOX activity among different groups.\u003c/p\u003e\n\u003cp\u003e(E) The IL 1β levels in cell supernatant among different groups.\u003c/p\u003e\n\u003cp\u003eAll experiments were performed with at least 4biological replicates.\u003c/p\u003e\n\u003cp\u003eGlu, glucose; PA, palmitic acid; LDH, lactate dehydrogenase;\u003c/p\u003e\n\u003cp\u003eNOX, NADH oxidase; Sup, supernatant; **P\u0026lt;0.01, ***P\u0026lt;0.001 versus CON group, #P\u0026lt;0.05, ##P\u0026lt;0.01, ###P\u0026lt;0.0001 compared to the Glu+PA group (25mM glu+300μM PA). Data are represented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Fig9.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/d12c65f1b9f339dd8e005675.png"},{"id":55264208,"identity":"d5372e2c-1668-4861-b3d6-ac67e11c4e49","added_by":"auto","created_at":"2024-04-25 01:40:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5476739,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/0472cb81-40f8-434e-bf7f-a2ed4e547c35.pdf"},{"id":51424802,"identity":"e4887345-02bd-4978-9c8d-4740f2829785","added_by":"auto","created_at":"2024-02-21 11:13:57","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":9850631,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/5e9b57d78fe9e9586908ac8a.docx"},{"id":51424797,"identity":"22d3f32f-d0ee-4104-8538-2629d004ee31","added_by":"auto","created_at":"2024-02-21 11:13:57","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":186406,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-3965620/v1/72e4717b18a6eeff0a324ec2.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Aerobic exercise alleviates diabetic cardiomyopathy via attenuation of P2X4-mediated NLRP3 inflammasome activation and cardiomyocyte pyroptosis","fulltext":[{"header":"Highlights","content":"\u003cp\u003eP2X4/P2X7-NLRP3 is involved in the pathogenesis of cardiomyopathy caused by diabetes or obesity. However, exercise intervention only inhibited P2X4.\u003c/p\u003e\n\u003cp\u003eExercise intervention, chronic AICAR treatment, or knockdown of P2X4 and P2X7 resulted in reduced activation of NLRP3 inflammasome and pyroptosis.\u003c/p\u003e\n\u003cp\u003eP2X7 and P2X4 receptors exhibit a complementary relationship and contribute to the activation of NLRP3 inflammasome. The inhibitory effect of AICAR on NLRP3 inflammasome relies on both P2X7 and P2X4.\u003c/p\u003e\n\u003cp\u003eThe expression of PANX1 monomer increased in the hearts of diabetic mice but was insusceptible to HFD, or high glucose and high PA treatment.\u003c/p\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eDiabetes mellitus (DM) is a chronic metabolic disease caused by absolute or relative insulin secretion deficiency, characterized by hyperglycemia and hyperlipidemia \u003csup\u003e1\u003c/sup\u003e. The long-term development and progression of DM can affect multiple organs, leading to diabetic complications \u003csup\u003e2\u003c/sup\u003e. Diabetic cardiomyopathy (DCM) is one of the most common severe DM complications, significantly contributing to heart failure, arrhythmia, and mortality \u003csup\u003e3\u003c/sup\u003e. The pathogenesis of DCM is complicated, including abnormal fatty acid metabolism, hyperglycemia, oxidative stress, inflammation, and cardiomyocyte death \u003csup\u003e4\u003c/sup\u003e. Due to the complex etiology and limited treatment options, DCM has evolved into an intractable clinical issue with catastrophic repercussions \u003csup\u003e5\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePyroptosis is a newly identified type of necrotic and inflammasome-mediated programmed cell death, characterized by cell swelling, rupture, and release of cytoplasmic content, including pro-inflammatory cytokines IL 1β and IL 18 \u003csup\u003e6\u003c/sup\u003e. Emerging evidence has highlighted the involvement of pyroptosis in the pathogenesis of DCM \u003csup\u003e7\u003c/sup\u003e. It is a well-recognized issue that NLRP3 inflammasome is the crucial component that mediates pyroptosis and contributes to the pathogenesis of DCM; targeting suppression of NLRP3 inflammasome activity had remarkable therapeutic effects \u003csup\u003e8\u0026ndash;10\u003c/sup\u003e. The NLRP3 inflammasome is a complex composed of the damage-associated molecular pattern (DAMP)/pathogen-associated molecular pattern (PAMP) sensor (NLRP3), an adaptor (ASC), and an effector (Caspase 1). Even though it is well-known that NLRP3 inflammasome activation depends on recognizing DAMPs and PAMPs, the exact mechanisms that regulate NLRP3 inflammasome activation are still ambiguous. It is thought to include multiple upstream signals, most of which are not mutually exclusive, including the efflux of potassium ions (K\u003csup\u003e+\u003c/sup\u003e), the influx of calcium ions (Ca\u003csup\u003e2+\u003c/sup\u003e), oxidative stress, metabolic changes, etc. \u003csup\u003e11\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eExtracellular ATP (eATP) is a common DAMP that activates the NLRP3 inflammasome. The high amount of eATP under pathological conditions is mainly released from the pannexin 1 (PANX1) channel \u003csup\u003e12,13\u003c/sup\u003e. P2X receptors are ligand-gated ion channels that could be activated by eATP. eATP causes channel opening of P2X receptors, the influx of Ca\u003csup\u003e2+\u003c/sup\u003e/Sodium ions (Na\u003csup\u003e+\u003c/sup\u003e), or efflux of K\u003csup\u003e+\u003c/sup\u003e, promoting the accumulation of intracellular ROS through activation of NADPH oxidase\u003csup\u003e14\u003c/sup\u003e. Among these receptors, P2X7 is the most structurally and functionally distinct P2X subtype, strongly associated with immunity and inflammation. Different from any other P2X receptors, P2X7 exhibits a complete absence of desensitisation \u003csup\u003e15,16\u003c/sup\u003e. Furthermore, it has been experimentally demonstrated that P2X7 is the sole mediator of K\u003csup\u003e+\u003c/sup\u003e efflux upon binding with ATP \u003csup\u003e17\u003c/sup\u003e. Indeed, P2X7 is activated in various models of cardiomyopathy, and pharmacologically and genetically inhibiting P2X7 can attenuate cardiomyopathy pathology \u003csup\u003e18\u0026ndash;20\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eNevertheless, the function of other P2X subtypes, which are expressed at varying levels in different tissues of humans and mice, remains inadequately comprehended. Noteworthy, P2X are all ion channels that exhibit cation-selective and facilitate the entry of Ca\u003csup\u003e2+\u003c/sup\u003e/Na\u003csup\u003e+\u003c/sup\u003e upon ATP bindings. Since Ca\u003csup\u003e2+\u003c/sup\u003e influx can activate NLRP3 inflammasome, it is possible that other P2X possess the ability to trigger activation of NLRP3 inflammasome. Initial research findings indicated that P2X4 activation elicits enhanced cardiac inotropy and decelerates the heart rate \u003csup\u003e21\u003c/sup\u003e. The mechanism may involve the interaction of P2X4 with eNOS to generate NO or an increase in intracellular Ca2\u0026thinsp;+\u0026thinsp;that increases myocardial contractility \u003csup\u003e22\u003c/sup\u003e. However, an overabundance of NO and Ca2\u0026thinsp;+\u0026thinsp;can also lead to excessive oxidative stress and inflammation, which might sabotage cardiac function. Indeed, a correlation was observed between elevated cardiac P2X4 and heart failure and coronary artery disease \u003csup\u003e23,24\u003c/sup\u003e. Furthermore, activation of P2X4 was proved to lead to the assembly of NLRP3 inflammasome in diabetic nephropathy \u003csup\u003e25\u003c/sup\u003e. Thus, we speculate that NLRP3 inflammasome activation in DCM might also be partially caused by P2X4.\u003c/p\u003e \u003cp\u003eRegular exercise training is a typical non-pharmacologic method to prevent and treat DM and diabetic complications. Aerobic exercise intervention has been shown to inhibit P2X7 elevation, NLRP3 inflammasome activation, and cardiomyocyte death in the heart of high-fat diet (HFD) and DM animal models \u003csup\u003e26,27\u003c/sup\u003e. However, it remains unclear whether the effect of exercise on P2X7 in the hearts of diabetic or obese mice is mediated by the regulation of PANX1. Furthermore, there is still a lack of clarity regarding whether other P2X, which is more sensitive to ATP, contributes to the development of inflammation and cardiac cell death in DCM. Additionally, whether and how exercise might ameliorate DCM in a manner dependent on P2X and NLRP3 inflammasome remains further investigated.\u003c/p\u003e \u003cp\u003eIn this study, we showed that regular exercise intervention mitigated the development of DCM by suppressing NLRP3 inflammasome activation and pyroptosis. The pathogenesis of DCM is associated with the participation of P2X4 and P2X7, which exhibit a synergistic impact. Nevertheless, it is more plausible that regular exercise training dampens the NLRP3 inflammation activation via the reduction of P2X4 protein levels, thereby leading to a decrease in pyroptosis. Our results provide novel insight into the mechanism of exercise intervention in regulating DCM pathological progression.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Establishment of animal models\u003c/h2\u003e \u003cp\u003e5-week-old male C57BL/6J mice were purchased from the animal experiment center of East China Normal University (Shanghai, China). The mice were housed appropriately (12 h light/dark cycle, 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C temperature, 40\u0026ndash;70% relative humidity) with access to food and water \u003cem\u003ead libitum\u003c/em\u003e. Mice were subjected to adaptive feeding for one week and were used for the following experiments.\u003c/p\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003e2.1.1 Diabetes model\u003c/h2\u003e \u003cp\u003eThe mice were randomly divided into four groups: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) normal chow diet (CON); (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) normal chow diet\u0026thinsp;+\u0026thinsp;exercise (EX); (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) 45%HFD\u0026thinsp;+\u0026thinsp;STZ (STZ, S0130, Sigma-Aldrich) (DM); and (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) 45%HFD\u0026thinsp;+\u0026thinsp;STZ\u0026thinsp;+\u0026thinsp;exercise (DM\u0026thinsp;+\u0026thinsp;EX). The DM group mice were fed 45%HFD for 4 weeks. After 4-week HFD feeding, the DM group mice were subjected to a single intraperitoneal injection of 100 mg/kg of streptozotocin, which was freshly dissolved in a 0.1 mol/L sodium citrate buffer with a pH of 4.5. Mice with fasting blood glucose (FBG) levels exceeding 11.1 mmol/L were identified as diabetic mice and were continuously fed with 45% HFD for 9 weeks. As a control of DM, mice were fed a normal chow diet for four weeks, then injected with an equal volume of sodium citrate buffer, similar to the DM group, and maintained on the normal chow diet for 9 weeks. Treadmill exercise was conducted one week after intraperitoneal injection of STZ or sodium citrate buffer. The exercise adaption protocol was performed at 5 min for warming up (6 m/min), 30 min for formal training (8 m/min), 5 min for relaxing (6 m/min), and 3 days/week. After 1 week of exercise adaption, mice were subjected to formal exercise training. The training protocol was performed at 5 min for warming up (8 m/min), 50 min for formal training (12 m/min), and 5 min for relaxing (8 m/min), 5 days/week for 8 weeks.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.1.2 HFD-induced obesity Model\u003c/h2\u003e \u003cp\u003eThe mice were randomly divided into three groups: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) normal chow diet (CON); (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) 60%HFD (HFD); and (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) 60%HFD\u0026thinsp;+\u0026thinsp;exercise (HE). The HFD group mice were fed 60% HFD for either 10 or 15 weeks. Simultaneously, the CON group mice were fed a normal chow diet for either 10 or 15 weeks. The exercise adaption protocol was that speed increased from 7 m/min to 13 m/min, and the running duration increased from 15 min/day to 60 min/day for 1 week. The exercise training protocol was 5 min for warming up (7 m/min), 60 min for formal training (13 m/min), and 5 min for relaxing (7 m/min) for 10 or 15 weeks.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.1.3 Body compositions\u003c/h2\u003e \u003cp\u003eOne day after the last exercise training session, the body compositions of live mice were measured using the AccuFat MRI system (AccuFat-1050, MAG-MED, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.1.4 Glucose tolerance test (GTT) and insulin tolerance test (ITT)\u003c/h2\u003e \u003cp\u003eGTT and ITT experiments were carried out during the last two weeks of the experiment. The mice in each group were assigned to receive GTT and ITT experiments in a random manner. The assay was performed according to the previous study\u003csup\u003e28\u003c/sup\u003e. Specifically, to test insulin tolerance, mice were given an intraperitoneal injection of insulin (0.75U/kg body weight) after 4 h of fasting. To test glucose tolerance, mice were given an intraperitoneal injection of glucose (1.25 g/kg body weight) after 6 h of fasting. Blood glucose levels were measured from tail venous blood before (0min) and after insulin or glucose injection at 15, 30, 45, 60, 90, and 120 min.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.1.5 Echocardiography\u003c/h2\u003e \u003cp\u003eEchocardiograms were performed in M mode using the Vevo 3100 echocardiography system (VisualSonics Inc., Canada). In brief, mice were lightly anaesthetized with isoflurane (2.5% for induction and 1.5% for maintenance). M-mode echocardiogram was performed on the parasternal long-axis section of the left ventricle (LV) to record the end-systolic and the corresponding end-diastolic LV anterior wall thickness (LVAWs and LVAWd) as well as LV inner diastolic and systolic dimensions (LVIDd and LVIDs). The measurements were obtained from at least three beats at a similar stabilized heart rate and were averaged. All echocardiograms were performed by an experienced investigator blind to the animal treatments.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Cell culture and experimental treatments\u003c/h2\u003e \u003cp\u003eRat myocardial cell line H9C2 was purchased from the Stem Cell Bank, Chinese Academy of Sciences. H9C2 cells were cultured at 37\u0026deg;C, 5% CO2 in high glucose Dulbecco\u0026rsquo;s modified eagle medium (DMEM)(Gibico, 11995065, USA) supplemented with 10% (vol/vol) fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 \u0026micro;g/mL). When H9C2 cells had reached 80% confluency, they were seeded and cultured in 6-well or 96-well plates with low glucose DMEM (Gibico, 11885084, USA) for the subsequent experiments.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.2.1 Drug treatments\u003c/h2\u003e \u003cp\u003eH9C2 cells were treated with the indicated concentrations of glucose (Sigma, G7021) and PA (Sigma, P0500) for 24h at a confluency of 80%. The PA was conjugated with 15% BSA solution to prepare a 10 mM stock solution. At the same time, the PA-free 15% BSA was used as control reagents added to cells to ensure that each well received an equal volume of BSA. Mannitol was used to balance the osmolarity of the solution, depending on the glucose concentration. For the AICAR (Selleckchem, S1802, USA) treatment, cells were treated with various concentrations of AICAR (0.1-2mM dissolved in Ultrapure water) for 24 h concurrently with glucose and PA treatment. For the MCC950 (Selleckchem, S7809, USA) treatment, cells were treated with the inhibitors MCC950 (5nM dissolved in DMSO according to the manufacturer\u0026rsquo;s instruction) 10\u0026ndash;20 min prior to glucose and PA treatment. KCl (25 mM) and CaCl\u003csub\u003e2\u003c/sub\u003e (0.9 or 1.8 mM) were added together with PA treatment and cultured in a Calcium-free medium (Yuchunbio, YC-2067, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.2.2 Transfection\u003c/h2\u003e \u003cp\u003eCell transfection was performed in 6-well or 24-well plates using Lipo8000 transfection reagent (Beyotime, C0533, China) according to the manufacturer's protocol. H9C2 cells were pre-plated one day before transfection and grew to be 60\u0026ndash;70% confluent. Then 3ul liposomes were mixed with 100pmol siRNA (per well of a 6-well plate), or 0.8 \u0026micro;l liposomes were mixed with 20 pmol siRNA (per well of a 24-well plate) incubated at room temperature for 15 min to prepare siRNA/liposome complexes. The complexes were added to the cells and incubated for 6 hours. During the transfection procedure, we utilised a l low glucose DMEM supplemented with 10% FBS, as the presence of serum in the medium would not interfere with the effectiveness of lipo8000. Consequently, cells were in a good growth status and incubated for 6 hours, ultimately achieving a cell confluence of 80\u0026ndash;90%. Following this, the transfect medium was aspirated and replenished with low glucose DMEM or treated with PA and glucose for another 24 h.\u003c/p\u003e \u003cp\u003eRat P2X7 siRNA, rat P2X4 siRNA, and nontargeting control siRNA were custom-designed and synthesized by RiboBio. The sequences of control and target siRNAs against rat genes are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDesignation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003especies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi-negative control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTCCGAACGTGTCACGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi-P2rx4-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGATAAGACCAGCATTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi-P2rx4-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCTCTTGGTAAAGAACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi-P2rx4-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTACTGCATGAAGAAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi-P2rx7-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATGGACCCACAAAGTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi-P2rx7-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGAAAGTTTGACATCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi-P2rx7-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGCAGTGAATGAGTACTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.3 ATP content/Cell viability\u003c/h2\u003e \u003cp\u003eCells were seeded at a concentration of 5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells per well in 96-well plates in triplicate and cultured for 24 h. After treatment, cell viability was assessed by CellTiter-Lumi\u0026trade; Luminescent Cell Viability Assay Kit (Beyotime, C0058, China) based on ATP content, representing the number of active cells. Detail operation steps were followed as previously described \u003csup\u003e29\u003c/sup\u003e. The luminescence levels were detected using a microplate reader (TECAN Infinite M200, Switzerland).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.4 LDH release assay\u003c/h2\u003e \u003cp\u003eLDH release was quantified using the LDH Cytotoxicity Assay Kit (Beyotime, C0017, China) according to the manufacturer\u0026rsquo;s protocol. In brief, after 24 h treatment, cellular supernatants were replaced with DMEM containing 1%FBS and cultured for another 6 hours to collect LDH released by the cells, as the medium containing 10%FBS and BSA may affect the LDH value. A volume of 120 \u0026micro;l of 1%FBS DMEM supernatant from each well was transferred to a separate 96-well plate. Subsequently, the detection buffer was mixed with the supernatant and incubated at room temperature for 30 min avoid light. Finally, the mixed liquor was detected at a wavelength of 490 nm by a microplate reader (TECAN Infinite M200, Switzerland). A wavelength of 690 nm was employed as the reference wavelength for dual-wavelength determination.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Caspase 1 activity assay\u003c/h2\u003e \u003cp\u003eThe activity of Caspase 1 was measured with a Caspase 1 Activity Assay Kit (Beyotime, C1101, China) according to the manufacturer\u0026rsquo;s instructions. Briefly, H9C2 cells were harvested and lysed on ice using the lysis buffer provided in the assay kit. Subsequently, the cell lysates were incubated with a substrate of Caspase 1 (Ac-YVAD-pNA, acetyl-Tyr-Val-Ala-Asp p-nitroanilide) to produce the yellow formazan product pNA at 37\u0026deg;C for 1 hour. The pNA levels were detected at a wavelength of 405 nm by a microplate reader (TECAN Infinite M200, Switzerland). The protein concentration of cell lysate was measured using the Bradford Protein Assay Kit (Beyotime, P0010, China) at a wavelength of 595 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.6 NADPH oxidase (NOX) activity assay\u003c/h2\u003e \u003cp\u003eNOX activity of cells was collected by a spectrophotometer (Specord Plus 210, Analytic Jena AG, Jena, Germany) following the instruction of the commercial NOX activity kit (Solarbio, BC0630, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Reactive oxygen species (ROS) detection\u003c/h2\u003e \u003cp\u003eAfter treatment, cellular ROS generation was measured by ROS Assay Kit (Beyotime, S0033, China) utilizing a fluorescent probe DCFH-DA. H9C2 cells were preincubated with 10 \u0026micro;M DCFH-DA at 37\u0026deg;C for 20 min, then cellular ROS was quantified using a microplate reader (TECAN Infinite M200, Switzerland) at the exciting light was 488 nm, and the emitted light was 525 nm. Moreover, the accumulation of ROS in H9C2 cells was also verified microscopically (IX71, Olympus, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Measurement of MDA levels\u003c/h2\u003e \u003cp\u003eThe contents of MDA in the heart tissue were detected using a commercial kit (Beyotime, S0131, China) according to the instructions. The sample and MDA detection working solution were mixed and performed as described before \u003csup\u003e30\u003c/sup\u003e, and the absorbance was measured at 532 nm using a microplate reader (TECAN Infinite M200, Switzerland).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.9 HE and Masson staining\u003c/h2\u003e \u003cp\u003eHeart tissues were fixed with 4% paraformaldehyde and embedded in paraffin. Next, the organ was sectioned at 3\u0026ndash;5 \u0026micro;m thickness and stained separately with HE (Solarbio, G1120, China) and Masson\u0026rsquo;s trichrome (Servicebio, G1006, China). For both stains, slides were blindly observed and photographed with a microscope (XSP-C204, COIC, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Immunohistochemistry\u003c/h2\u003e \u003cp\u003eThe heart tissue sections were stained with primary antibodies against NLRP3 (Servicebio, GB114320-100, China, 1:600), Caspase 1 (Servicebio, GB11383-100, China, 1:500), and IL 1β (Servicebio, GB11113-100, China, 1:250) at 4\u0026deg;C overnight, followed by secondary antibodies incubated for 50min at room temperature. All sections were visualized with diaminobenzidine and blindly observed and photographed with a microscope (XSP-C204, COIC, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Immunofluorescence\u003c/h2\u003e \u003cp\u003eTUNEL and immunofluorescence double staining of heart tissue sections and fixed cells were performed to evaluate pyroptosis. TUNEL/GSDMD positive can be regarded as a possible indicator of pyroptosis \u003csup\u003e31\u003c/sup\u003e (In the gasdmin family, only GSDMD is expressed in cardiomyocytes\u003csup\u003e32\u003c/sup\u003e). Tissue sections were obtained as described above. While H9C2 cells were seeded in 6-well culture plates plated with cell-climbing slices. After the treatment, cell-climbing slices were washed with PBS twice and then fixed with 4% paraformaldehyde for 20 min. After that, the cell-climbing slices or tissue sections were treated with a primary antibody against the N terminal of GSDMD (Bioss, BS-14287R, China,1:200) at 4\u0026deg;C overnight, followed by incubation with a secondary antibody for 50 min at room temperature. The nuclei were stained with DAPI for 10 min at room temperature. Finally, the slices and tissue sections were blindly observed and photographed with a microscope (DP74, Olympus, Japan).\u003c/p\u003e \u003cp\u003eGSDMD is present in each cardiomyocyte and is therefore difficult to count. However, subsequent to the cleavage of GSDMD, the GSDMD-N terminal will undergo oligomerization and locate to the plasma membrane, nuclear membrane and mitochondrial membrane to form membrane pores. Consequently, we lowered the laser power so that the cells displayed only the stronger GSDMD fluorescent signals and considered them as oligomerized GSDMD-N.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e2.12 ELISA\u003c/h2\u003e \u003cp\u003eCirculating cTn-I in serum was quantitatively analyzed using ELISA kits for mice cTn-I (Mlbio, ml092662, China). The levels of IL 1β in cell supernatants were measured by Rat IL 1β ELISA Kit (MultiSciences Biotech, EK301B, China) according to the manufacturer's instructions. Typically, we incubate samples overnight at four degrees for improved results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Protein extraction and Western blotting (WB)\u003c/h2\u003e \u003cp\u003eCell and Heart tissue lysis were performed as described before \u003csup\u003e33\u003c/sup\u003e. In brief, a small chunk from the left ventricle at the apex of the heart (30 mg) and H9C2 cells were lysed in RIPA/cell lysis buffer (Beyotime, P0013B, China) supplemented with PMSF (Beyotime, ST506, China), phosphatases inhibitors (Beyotime, P1081, China) and protease inhibitors (Beyotime, P1005, China). Heart tissue was then loaded and homogenized using the bead ruptor (BeadRuptor24, OMNI, USA) at a frequency of 3.55 m/s for 30 s, repeated 3 times. Cells were lysed on ice for 10min. Tissue homogenates and cell lysates were further centrifuged at 4\u0026deg;C for 10 min at 12000\u0026times;g. After collecting the supernatant, the protein concentration of total homogenate was determined using the BCA method (Beyotime, P0010, China).\u003c/p\u003e \u003cp\u003eFor the WB experiment, protein lysates in the SDS-PAGE Sample Loading Buffer were boiled for 5 min at 10℃. The samples were separated on 10\u0026ndash;12% SDS-PAGE gel and transferred to the PVDF membrane (IPVH00010, Millipore). The membranes were then blocked in QuickBlock\u0026trade; Blocking Buffer for Western Blot (Beyotime, P0252, China) for 2 h at room temperature and then incubated with primary antibodies directed against PANX1 (12595-1-AP, Proteintech, China), IL 1β (sc-12742, Santa Cruz, USA), P2X7 (A10511, abclonal, China), Caspase1 (A0964, abclonal, China), GSDMD (BS-14287R, Bioss, China), P2X4 (66416-1-Ig, proteintech, China), NLRP3 (DF7438, affinity, China), TXNIP (sc-166234, Santa, USA), NF-κb p65 (WL01980, wanleibio, China), p-NF-κb (WL02169, wanleibio, China), β-tubulin (AF7011, affinity, China), HSP90 (ab13492, abcam, USA), and GAPDH (sc-47724, Santa, USA) and horseradish peroxidase-conjugated secondary antibodies (115-035-003, 111-035-003, Jackson Lab, USA). The protein bands were captured by the ChemiDoc MP Imaging System (Chemidoc mp, BIORAD, USA), and protein intensity was measured using Image J (Image J 1.8.0, NIH, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e2.14 RNA isolation and quantitative realtime-PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from the left ventricle at the apex of the heart (20mg) and H9C2 cells using trizol lysis buffer (Invitrogen, Thermo Fisher Scientific, USA), as per the manufacturer\u0026rsquo;s instruction. The RNA was reverse-transcribed into cDNA using a cDNA reverse transcription kit (FSQ-101, TOYOBO). For real-time PCR analysis, the gene expression levels were detected by using a real-time system with Hieff qPCR SYBR Green Master Mix (Low Rox Plus) (YEASEN, 11202ES03). The primer sequences of mice and rat samples are found in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003especies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eSequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eProduct length (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCCAAGAAGTTCCAACCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e130\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCATTGAGAGCATGGCTTCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAGGCTGCTATCTGGAGGAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e133\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACGGACACTCGTCATCTTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCaspase 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCAGGAGGGAATATGTGGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e159\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACTCCTTGTTTCTCTCCACGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePANX 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTGGATTCATACTGCTGGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e101\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGATGTAGGGGAAGAACTTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL 1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCCACCTTTTGACAGTGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e136\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATGTGCTGCTGCGAGATTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL 18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGACTCTTGCGTCAACTTCAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e169\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAGGCTGTCTTTTGTCAACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTACCATCGGCTCTGGGATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e149\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTCACGTTCACCCTCCCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTACGAGACGCCCAAGGTGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e106\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGATGAAGACGTACCACACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTACGAGACTACCAAGTCGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e108\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCAAGAAAACCCACCCCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACCCACAGCAGTGGAATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e145\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTGAAGTTTTCTGCAGCCTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAGCTCACCATCCTGTTGTACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e196\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGAAAACGTTCTCCCCCTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTGCTGTGCCCAGATCCAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e192\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCAATCCCAGTGAATGCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTXNIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCCACTTACACTGAGGTGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e196\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCCATCTTGAGGAGTCAGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCTCGTCCCGTAGACAAAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e133\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGAGGTCAATGAAGGGGTCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003erat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAACAGAGTGAGCCTGTCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e164\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCGCTCATCAAAGCAAAGCTAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP2X4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003erat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCTTCCTGTTCGAGTACGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e118\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACGAACACCCACCCGATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003erat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGGACTGACCCATCAATGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e172\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCAGCTGACCAACCAGAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003erat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGGAGAAACCTGCCAAGTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e138\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTGGAAGAATGGGAGTTGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e2.15 PPI network construction and module analysis\u003c/h2\u003e \u003cp\u003eThe PPI network of functional interaction between P2X proteins and PANX1 and NLRP3 inflammasome was analyzed by STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://string-db.org\u003c/span\u003e\u003cspan address=\"http://string-db.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) \u003csup\u003e34\u003c/sup\u003e. The results were visualized using Cytoscape software. The top 15 high-degree proteins were identified using the cytoHubba plugin; the degree of the protein is represented via the size and colour of nodes, and the combined interaction score (threshold of 0.4) is shown through the edges' width.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e2.16 Single-cell expression profile analysis\u003c/h2\u003e \u003cp\u003eSingle-cell expression profile data of P2X1, P2X2, P2X3, P2X4, P2X5, P2X6, P2X7 in heart tissue were obtained from Tabula Muris ( \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://tabula-muris.ds.czbiohub.org/\u003c/span\u003e\u003cspan address=\"https://tabula-muris.ds.czbiohub.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) \u003csup\u003e35\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e2.17 Statistical analysis\u003c/h2\u003e \u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM and statistical analysis was performed using Prism 9.5 (GraphPad Software Inc). For the comparison of two groups, a 2-tailed unpaired Student t-test was used; for comparison between more than two groups, one-way ANOVA with Sidak\u0026rsquo;s multiple comparisons was used as appropriate. Two-way ANOVA with Sidak\u0026rsquo;s multiple comparisons to test the difference among groups with various factors (e.g., exercise or HFD/STZ treatment). P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to indicate statistically significant differences.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Exercise training relieves diabetic conditions\u003c/h2\u003e \u003cp\u003eTo identify the impact of early exercise intervention on the progression of diabetes, weekly monitoring of body weight and pre- and post-injection monitoring of blood glucose levels were conducted. Following 15 weeks of adhering to the prescribed diet and exercise training, it was observed that there was no statistically significant variance in body weight across the four experimental groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Nevertheless, DM mice had a significant loss in lean body mass and an increase in fat body mass compared to the CON mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Exercise intervention reduced body fat in DM mice but did not prevent lean body loss (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Furthermore, the exercise intervention effectively mitigated the increase in blood glucose levels in DM mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) and improved insulin tolerance and glucose tolerance impairment in DM mice (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Additionally, the effect of exercise intervention and DM modelling on serum cholesterol levels was detected. While DM mice were compared to CON mice, triglyceride (TG), total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C) levels all increased significantly. However, exercise intervention successfully mitigated the elevation of these indicators in DM mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG-I). HDL-C (high-density lipoprotein cholesterol), which plays an important role in cholesterol export, increased significantly upon exercise intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). The findings indicate the successful establishment of a DM mouse model and emphasize the usefulness of early exercise intervention in slowing the progression of DM.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Exercise training reduces myocardial fibrosis and improves the cardiac function of diabetic hearts\u003c/h2\u003e \u003cp\u003eWe investigated cardiac function using transthoracic echocardiography to evaluate if exercise improved the function of diabetic hearts. DM-induced cardiac contractile dysfunction was reflected by decreased left ventricular ejection fraction (LVEF), left ventricle fractional shortening (LVFS), and increased LVIDs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E). Exercise intervention mitigated these changes: LVEF and LVFS were considerably higher in the exercised DM mice. In contrast, LVIDs were shown to be lower in exercised DM mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E). Moreover, exercise intervention slightly increased the LVFS of normal chow diet mice, with changes approaching statistical significance (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn order to conduct a comprehensive assessment of the cardiac structure, we employed HE and Masson staining to observe potential pathological alterations in the heart. The diabetic myocardium showed structural abnormalities, including the disordered arrangement of the myocardium, disrupted myocardial fibers and progressively extended fibrotic area (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). In comparison, exercise training alleviated the structural abnormalities and fibrosis of the diabetic myocardium (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). The confirmation of myocardial injury was further established by a significant increase in serum cTn-I levels, while the exercise intervention did not improve the release of cTn-I. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). The presence of fibrosis was additionally validated by a notable elevation in fibrotic indicators collagen I and collagen II in diabetic hearts, which were mitigated by exercise intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI\u0026amp;J). These data demonstrated that exercise intervention could exert cardioprotective effects and delay the development of DCM.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec30\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Exercise training suppresses the priming stage of pyroptosis in diabetic hearts\u003c/h2\u003e \u003cp\u003eActivation of NF-κB signalling is widely recognized as a priming step of pyroptosis, which induces transcription of NLRP3, IL 1β, and IL 18 \u003csup\u003e11\u003c/sup\u003e. The WB results showed that DM increased NF-κB P65 expression and enhanced phosphorylation of NF-κB P65 at Ser536, and exercise reduced phosphorylation of NF-κB P65 in the heart (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). PCR results showed that the mRNA levels of Caspase 1 and IL 1β were upregulated in diabetic hearts, and exercise intervention reduced the mRNA levels of IL 1β in diabetic hearts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Immunohistochemistry and PCR analysis indicated that NLRP3, Caspase 1, and IL 1β were significantly overexpressed in the cardiac tissues of DM mice and were decreased under the exercise intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Exercise training represses P2X4 and PANX1 expressions and inhibits NLRP3 activation in diabetic hearts\u003c/h2\u003e \u003cp\u003eThe synergistic participation of P2X7 and PANX1 is considered to play essential roles in inflammation and cell death \u003csup\u003e36\u003c/sup\u003e. A comprehensive signalling network analysis was conducted to uncover the protein-protein functional association (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The network showed that among various purinergic receptors, P2X4 and P2X7 were key nodal junctions that interacted with PANX1 and other proteins of the network (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Previous studies have shown that the HFD diet and free fatty acids stimulation upregulated PANX1 expression and thus released more ATP into the extracellular space \u003csup\u003e37,38\u003c/sup\u003e. We hypothesized that PANX1 was activated in diabetic hearts, and then PANX1 modulated P2X activation and thus activated the NLRP3 inflammasome, leading to cardiomyocyte pyroptosis. To test this hypothesis, we detected the mRNA and protein levels of PANX1. The mRNA level and the monomer form of PANX1 were increased in diabetic hearts (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB\u0026amp;E). Moreover, exercise intervention effectively decreased the mRNA level and the protein monomer form of PANX1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB\u0026amp;E). We next evaluated the expressions of all seven purinergic P2X receptors in the myocardium. qRT-PCR results indicated that the predominant P2X subtypes expressed in the myocardium of normal mice were P2X4 and P2X5 receptors, followed by slight expressions of P2X7 and P2X1. Whereas P2X2, P2X3 and P2X6 expressions were largely absent in the myocardium (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Single-cell RNA-seq analysis of mouse hearts yielded similar results (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Besides that, the mRNA levels of P2X4, and P2X7 were significantly increased in diabetic hearts. Then, the mRNA level of P2X4 was mildly reduced by exercise intervention, which showed a nearly detectable statistically significant difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Comparatively, P2X1 and P2X5 did not show a significant difference among the different groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Furthermore, WB results revealed that the protein levels of P2X4, P2X7, and NLRP3 were significantly raised in the hearts of diabetics. Conversely, exercise intervention decreased the protein levels of P2X4 and NLRP3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSince previous studies have demonstrated that P2X receptors drive ROS generation, which in turn plays a pivotal role in initiating the activation of the NLRP3 inflammasome \u003csup\u003e14\u003c/sup\u003e, we next determined cardiac oxidative stress levels via measuring cardiac malondialdehyde (MDA) level and NFE2L2 and TXNIP expressions. The results showed that the mRNA level of NFE2L2 was not changed in any groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG), while TXNIP protein and mRNA levels were significantly upregulated in diabetic hearts and down-regulated by exercise intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE\u0026amp;F). Similarly, MDA, which was associated with severe oxidative stress and inflammatory response, was significantly elevated in diabetic hearts and relieved by exercise intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). All of these results strongly suggested that exercise might inhibit NLRP3 inflammasome activation in diabetic hearts by downregulating the PANX1/P2X4/ROS signaling pathway.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Exercise training curtails cardiomyocyte pyroptosis in diabetic hearts\u003c/h2\u003e \u003cp\u003eSubsequently, to evaluate the extent of cardiomyocyte pyroptosis, we examined Caspase 1, IL 1β, and GSDMD activation by using WB. The results showed that exercise intervention reduced the expression of myocardial cleaved Caspase 1 (P20), mature IL 1β, and N terminal of GSDMD (GSDMD-N) induced by DM (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Additionally, pyroptosis was visualized by co-staining GSDMD with TUNEL. In the CON group, the double-positive cardiomyocytes were barely detected, while diabetic hearts occurred with substantial double-positive cardiomyocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). In contrast, exercise intervention decreased double-positive cardiomyocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Collectively, these results confirmed that exercise intervention alleviated cardiomyocyte pyroptosis in the diabetic hearts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec33\" class=\"Section2\"\u003e \u003ch2\u003e3.6 P2X4 and P2X7 receptors were expressed in different high-fat conditions\u003c/h2\u003e \u003cp\u003eIn contrast to earlier research \u003csup\u003e26,27\u003c/sup\u003e, our findings demonstrated that P2X4 was up-regulated in diabetes hearts and suppressed by exercise intervention, rather than P2X7. We reasoned that there may be a subtle disparity in the modelling approach which may contribute to variations in glycolipid metabolism and lead to the engagement of different P2X receptor subtypes in inflammasome activation within the heart. Consequently, we initially focused on examining the potential induction of P2X4 and P2X7 expression, as well as pyroptosis, in the presence of elevated glucose levels. Nonetheless, almost no decrease in cell viability was observed when the glucose concentration increased from 5.5 mM to 25 mM, whereas a substantial reduction in cell viability was observed at a glucose concentration of 50 mm (Fig. S2A). The P2X4 and P2X7 expression levels did not exhibit substantial alterations in response to high glucose conditions, whereas there was a modest up-regulation of the expression of NLRP3 (Fig. S2B). Hence, it is probable that the high glucose treatment primarily stimulates the expression of inflammatory proteins while not triggering pyroptosis.\u003c/p\u003e \u003cp\u003eNext, we treated the H9C2 cells with 25 mM glucose and 100\u0026ndash;600 \u0026micro;M PA. PA is a saturated fatty acid reported to be lipotoxic to various cells and is commonly present at high concentrations in patients with type 2 DM \u003csup\u003e39\u003c/sup\u003e. Our results showed cell viability decreased and Lactate dehydrogenase (LDH) release increased with PA concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u0026amp;B). WB analysis showed that P2X4 protein level and Caspase1 activity were upregulated with the increase of PA concentration. In contrast, the expressions of P2X7 protein were significantly increased at initially 100\u0026ndash;200 \u0026micro;M treatment concentrations of PA. The expression of NLRP3 protein was significantly increased at 100\u0026ndash;300 \u0026micro;M treatment concentrations of PA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo confirm the results of the \u003cem\u003ein vitro\u003c/em\u003e experiment, we established mouse models with varying durations of a 60% HFD, as well as mice models that combined both a 60% HFD and exercise intervention. Unexpectedly, there were no significant changes observed in the LVIDs, LVIDd, and corrected LV mass among all groups (Fig. S3) LVEF and LVFS were modestly up-regulated in the 15-week HE group compared to the HFD group, and the trend was virtually significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). However, there were no significant alterations observed in the protein level of PANX1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). P2X7 was only significantly activated after 10 weeks of HFD, not after 15 weeks. (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). Similar to those observed in diabetic mice, exercise training intervention failed to attenuate P2X7 expression in the myocardium of HFD mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). In contrast, the protein levels of P2X4, NLRP3, and cleaved Caspase 1 (P20) showed significant upregulation at 15 weeks rather than at 10 weeks and were significantly decreased after exercise intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). Taken together, this result further demonstrated that NLRP3 activation due to abnormal lipid metabolism was probably mediated by different P2X in different pathological processes, and that exercise was more likely to suppress NLRP3 activation by reducing P2X4.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.7 AICAR restrains the expression of P2X4 and activation of NLRP3 inflammasome in high glucose/high PA-treated cardiomyocytes\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further explore the mechanism that exercise suppresses NLRP3 inflammasome activation and reduces pyroptosis in the cardiomyocytes via downregulating P2X, we hypothesize that energy metabolism and stress responses during exercise mediate reduced inflammation and pyroptosis in cardiomyocytes. To test this hypothesis, we added AICAR while treating H9C2 cells with high glucose/high PA. AICAR was labelled as an \u0026ldquo;exercise mimetic,\u0026rdquo; activating AMPK and PPARδ in the muscle cell, promoting metabolic changes similar to acute and exercise training \u003csup\u003e40,41\u003c/sup\u003e. The results showed that AICAR exhibited a significant protective impact on cell viability and LDH release at 0.1-0.2mM concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-B). In addition, Caspase1 activity was significantly decreased at 0.2-1mM concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). The inhibitory effect of AICAR on NLRP3 was observed in a dose-dependent manner, while the optimal inhibition of P2X4 and P2X7 receptors occurred at a concentration range of 0.2-0.5mM AICAR (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). Nevertheless, the treatment of AICAR did not result in any significant alteration in the expression of PANX1 monomer (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). Collectively, these results suggested that AICAR rescued high glucose/high PA-induced cardiac inflammation and death and may via inhibit P2X-NLRP3 axis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section2\"\u003e \u003ch2\u003e3.8 P2X7 and P2X4 KD suppressed high glucose/high PA-induced cardiomyocyte inflammation\u003c/h2\u003e \u003cp\u003eIn order to provide further evidence regarding the involvement of P2X4, P2X7, and NLRP3 in the modulation of cell viability in response to high glucose/high PA or AICAR treatment, we first manipulated the K\u0026thinsp;+\u0026thinsp;and Ca2\u0026thinsp;+\u0026thinsp;concentrations in the culture medium. Additionally, we administered the NLRP3 inhibitor MCC950. The result showed that cell viability can be efficiently preserved through the inhibition of P2X4 or P2X7 ion channel function, as well as the inhibition of NLRP3 activation (Fig. S4).\u003c/p\u003e \u003cp\u003eMoreover, we employed the small interfering RNA (siRNA) technique to examine the effect of P2X4 or P2X7 knockdown (KD) on NLRP3 inflammasome activation and pyroptosis in H9C2 cells. H9C2 cells were transfected with either control shRNA or P2X4/P2X7 shRNA1, 2, 3, and the highest KD efficiency was selected for subsequent experiments. Interestingly, P2X7 knockdown did not decrease the mRNA level of NLRP3 but increased the mRNA level of P2X4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). Similarly, P2X4 knockdown did not decrease the mRNA level of NLRP3 and did not increase the mRNA level of P2X7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). Previous studies have shown that P2X7 and P2X4 are cooperatively activating inflammation \u003csup\u003e42\u003c/sup\u003e. To further unveil the molecular mechanisms underlying P2X7-P2X4 interaction with inflammation processes, we treated the H9C2 cells with high glucose/high PA, and KD P2X4 and P2X7 separately or simultaneously to evaluate the downstream inflammatory activation. Remarkably, KD of P2X4 decreased the mRNA expression of P2X7 and NLRP3 under high glucose/high PA conditions. Equally, KD of P2X7 reduced the mRNA expression of P2X4 and NLRP3 under high glucose/high PA conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). These results indicated that P2X4 and P2X7 were likely to have functional interactions and amplified the inflammatory signals. Moreover, NLRP3 mRNA expression was further decreased when P2X4 and P2X7 were knocked down simultaneously rather than separately (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC), reiterating that P2X4 was potentially interacting with the P2X7 to activate the inflammatory pathways.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec35\" class=\"Section2\"\u003e \u003ch2\u003e3.9 AICAR curtails high glucose/high PA-induced cardiomyocyte pyroptosis via reduced P2X signalling\u003c/h2\u003e \u003cp\u003eNext, to further ascertain whether P2X4 and P2X7 were sufficient for pyroptosis and whether exercise-induced energy stress ameliorated pyroptosis via influencing P2X4/P2X7-mediate inflammatory pathways, we performed double IF staining using TUNEL and GSDMD. The IF result showed that double positive cells significantly increased in high glucose/high PA conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA\u0026amp;B). In contrast, the amounts of positive cells were significantly reduced by P2X4 and P2X7 single or double KD or chronic AICAR (0.5mM for 24h) treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA\u0026amp;B). Moreover, P2X4 and P2X7 double KD combined with AICAR treatment failed to significantly decrease the positive cells compared with P2X7 and P2X4 double KD (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA\u0026amp;B), which confirmed that AICAR, at least partly, reduced the pyroptosis via P2X4 and P2X7. Given that P2X-mediated ROS via NADPH oxidase (NOX) is a critical upstream factor in NLRP3 inflammasome activation \u003csup\u003e14\u003c/sup\u003e, we examined cellular ROS and NOX activity levels. The result showed that P2X4 and P2X7 KD alone were not sufficient to affect the production of ROS, while the double KD robustly diminished the production of ROS, and AICAR treatment further reduced ROS generation (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA\u0026amp;C). Of note, P2X4 KD effectively restrained NOX oxidase activity, while P2X7 KD did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). Meanwhile, P2X4/P2X7 double KD failed to further reduce NOX activity, as well as AICAR treatment combined with P2X4/P2X7 double KD (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). Moreover, AICAR significantly reduced IL 1β release, an effect similar to P2X4/P2X7 double KD. In contrast, AICAR treatment combined with P2X4/P2X7 double KD did not further affect IL 1β release (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eE). Collectively, these results suggest that P2X4 may be primarily responsible for NOX-induced oxidative stress. However, inhibition of P2X7 did reduce pyroptosis and slightly reduced IL1β release and ROS production. Since further P2X7 knockdowns on top of P2X4 knockdowns may further slightly reduce pyroptosis and IL1β release, it is plausible to suggest that P2X7 may function as a compensatory mechanism for NLRP3 activation when P2X4 is absent. AICAR can concurrently inhibit P2X4 and P2X7, resulting in a reduction in ROS production, myocardial pyroptosis, and IL1β release.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe formation and progression of DCM are linked to multiple regulatory variables and signaling pathways. All of these adverse variations might result in cell death, therefore leading to reduced cardiac muscle mass, interstitial fibrosis, deteriorated cardiac function, and eventually heart failure \u003csup\u003e7\u003c/sup\u003e. Apoptosis is the most commonly cited culprit for cardiomyocyte death \u003csup\u003e43\u0026ndash;45\u003c/sup\u003e. However, apoptosis is typically immunologically silent and could not explain the constantly inflammatory responses and inflammatory cytokines production in diabetes-related cardiomyopathy \u003csup\u003e46,47\u003c/sup\u003e. Our IHC data of NLRP3, IL 1β and Caspase1 also reinforce the general observation that inflammatory proteins and pyroptosis-related proteins are abundantly expressed in diabetic heart \u003csup\u003e8,47\u003c/sup\u003e. We also examined NF-κB and found that it was activated in the diabetic heart and was downregulated by exercise intervention. Of note, NF-κB is a central mediator during the priming step of pyroptosis and can induce the expressions of various pro-inflammatory and pyroptotic genes such as IL 18, IL1β, and NLRP3. In addition, NF-κB-induced pro-survival factor FLICE-like inhibitory protein can suppress Caspase 8 activity, thereby inhibiting apoptosis \u003csup\u003e48\u003c/sup\u003e. Therefore, based on the results of the present study, we demonstrate that exercise intervention could ameliorate DCM via suppressing pyroptosis, not apoptosis.\u003c/p\u003e \u003cp\u003eNext, we tried to elucidate how exercise affected the activation of NLRP3 inflammasome. Since K\u0026thinsp;+\u0026thinsp;is a universal requirement for NLRP3 inflammasome activation, we targeted P2X7 due to its role in facilitating the efflux of K+. However, exercise did not inhibit P2X7 expression in the diabetic hearts in the present study. Interestingly, P2X4 upregulation was impeded by exercise in the diabetic hearts. P2X4 belongs to the same P2X receptor family as P2X7. Our findings demonstrated that P2X4 was more abundantly expressed than P2X7 in cardiomyocytes. PANX1 is the upstream signal protein shared by P2X4 and P2X7. Nevertheless, P2X4 is more sensitive to ATP released by PANX1 \u003csup\u003e49\u003c/sup\u003e. Previous studies have indicated that PANX1 exhibits activation in the skeletal muscle of HFD mice \u003csup\u003e37\u003c/sup\u003e. Our findings revealed that PANX1 was upregulated in diabetic hearts and downregulated by exercise. From our standpoint, it appears more plausible that PANX1 is responsible for the activation of P2X4, which then triggers the assembly of the NLRP3 inflammasome, ultimately resulting in the induction of pyroptosis. By altering the PANX1/P2X4/NLRP3 signalling pathway, exercise is anticipated to decrease cardiac cell death and ameliorate DCM.\u003c/p\u003e \u003cp\u003eOne of the interesting findings of the present study was that P2X7 and P2X4 were expressed differently during disease progression. P2X7 was strongly expressed in the cardiac muscle with short-term HFD intervention (10 weeks), while P2X4 was highly expressed with long-term (15 weeks) HFD intervention. Nevertheless, PANX1 expression was not significantly changed after either short-term or long-term HFD intervention. These results may suggest that P2X7 and P2X4 may be activated and play a role in different stages of obesity-induced cardiomyopathy or cardiometabolic disorders and that this activation is independent of PANX1. Simultaneously, the upregulation of P2X4 in long-term (15 weeks) HFD heart corresponded to higher NLRP3 expression and more prominent Caspase1 cleavage. Also, exercise intervention demonstrated a more notable decrease in the expression levels of P2X4, NLRP3, and restrain in Caspase1 cleavage in long-term (15 weeks) HFD heart. Therefore, these results further support our hypothesis that exercise restrains NLRP3 inflammasome activation by affecting P2X4. The results of the present study regarding P2X7 are not completely consistent with previous ones by other teams, which found that P2X7 and NLRP3 were elevated in both DM and HFD settings and that exercise training reduced P2X7 and hence blocked NLRP3 activation \u003csup\u003e26,27,50\u003c/sup\u003e. Nonetheless, our findings do not utterly refute the conclusions of other teams since the exercise intensities and modelling methodologies are slightly different. Furthermore, we did not investigate the gain and loss of function of P2X7 \u003cem\u003ein vivo\u003c/em\u003e in the present study. Therefore, it is not reasonable to conclude that P2X7 plays no role in the inflammatory response and functional failure of cardiomyocytes. Indeed, both P2X4 and P2X7 were found to be involved in the activation of NLRP3 inflammasome and pyroptosis in a complementary manner in our \u003cem\u003ein vitro\u003c/em\u003e study.\u003c/p\u003e \u003cp\u003eNevertheless, whether PANX1 serves as a significant upstream signal that triggers the activation of P2X7 and P2X4 remains unresolved. The results of our \u003cem\u003ein vitro\u003c/em\u003e experiments indicated that PANX1 expression was not altered by high glucose and high lipid. On the contrary, the expression of P2X4 exhibited a lipid concentration-dependent manner, and the expression of P2X7 was also increased under high glucose/high PA. Therefore, it is probable that the high PANX1 expression observed in the DCM model was a result of other abnormal metabolites that were distinct from those observed in the HFD model. The activation of P2X4 and P2X7 in the HFD model might also be induced by signals other than PANX1. Indeed, some researches have demonstrated that within the site of inflammation, the activation of the P2X7 can occur via alternative ligands, including NAD\u003csup\u003e+\u003c/sup\u003e, non-nucleotide agonists and bactericidal peptides released by inflammatory cells \u003csup\u003e51\u003c/sup\u003e. P2X4 can also be stimulated by extracellular alpha-ketoglutaric acid \u003csup\u003e52\u003c/sup\u003e, and both ethanol and ivermectin can affect P2x4 activation \u003csup\u003e53\u003c/sup\u003e. These findings suggest that P2X might be a more dangerous, multiple DAMP receptor than previously recognised. In addition, P2X4 and P2X7 may also be activated by ATP that is passively released by neighbour dying cells. Direct measurements performed at inflammatory, or tumour sites have revealed that it is not uncommon for ATP concentrations to be as high as a few hundred micromoles extracellularly, which is sufficient to activate P2X7. Unfortunately, due to technical limitations, we were unable to reliably identify and distinguish metabolites in the myocardial extracellular space of mice with STZ/HFD-induced DM model and HFD-induced obesity models.\u003c/p\u003e \u003cp\u003eTo investigate the effect of exercise training on DCM \u003cem\u003ein vitro\u003c/em\u003e, AICAR was employed as exercise mimetics in the present study. AICAR can activate AMPK which is able to activate numerous proteins that are engaged in physical exercise \u003csup\u003e41\u003c/sup\u003e. Furthermore, AICAR impacts metabolism, mitochondria quality and oxidative stress \u003csup\u003e54\u003c/sup\u003e. In the present study, we found that the impact of AICAR on PANX1 and P2X7 is minimal. Conversely, P2X4 protein level and Caspase1 activity were found to be lower with AICAR treatment between 0.2mM and 0.5mM. In addition, AICAR exhibited an inverse relationship with the expression of NLRP3. The above observations could be attributed to the potential role of ACIAR in facilitating AMPK activation and thus autophagic degradation of NLRP3 \u003csup\u003e55\u003c/sup\u003e or alternatively, impeding NF-κB pathway to suppress NLRP3 transcription \u003csup\u003e56\u003c/sup\u003e. In other words, AICAR could significantly reduce NLRP3 expression levels. However, to restrain the activation of the inflammasome, it should be in the appropriate concentration range of AICAR. This range corresponds to the concentration at which optimal inhibition of P2X4 was achieved. This observation implies that the activation of the inflammasome is mostly reliant on P2X4. Noteworthy, the observed inhibitory impact of AICAR on P2X7, which approaches statistical significance at a dose of 0.5 mM, it is plausible to suggest that AICAR could potentially impede the activation of inflammasomes by concurrently modulating P2X7. Indeed, the findings of our study indicate that inhibition of P2X4 or P2X7 alone could not produce the same effect as the 0.5mM AICAR treatment. Nevertheless, when inhibition of both P2X7 and P2X4 (double KD), the resulting impact shows similarity to the 0.5mM AICAR treatment. Double KD in conjunction with the administration of AICAR did not further prevent pyroptosis and IL 1β release. In sum, it is a suggestion that the suppression of the NLRP3 inflammasome by AICAR exhibits a dependence on both P2X7 and P2X4 receptors, with greater reliance on P2X4.\u003c/p\u003e \u003cp\u003eSome investigations have called into question the capacity of PANX1 to activate P2X7 and NLRP3 inflammasome because P2X7 requires an exceptionally high level of purinergic signalling for its activation \u003csup\u003e49\u003c/sup\u003e. Vince et al. revealed that Caspase 1 activation was unaffected in P2X7 deficient macrophages during PANX1 activation (apoptosis). Additionally, Chen et al. demonstrated that the cleaved form of PANX1 could potentially facilitate the assembly of NLRP3 by directly promoting K\u0026thinsp;+\u0026thinsp;efflux \u003csup\u003e57,58\u003c/sup\u003e. Nevertheless, these researchers might not have considered the potential compensatory mechanisms by other P2X when P2X7 was disrupted. The present study found that under normal physiological conditions, KD of either P2X4 or P2X7 would elevate NLRP3 gene expression, and other P2X might provide compensatory function. Similar analogous phenotypes have been reported in previous studies, such as P2X4 expression was significantly increased when P2X7 was downregulated in E10 cells. Similarly, downregulation of P2X4 leads to increased P2X7 expression and trafficking to the plasma membrane \u003csup\u003e59\u003c/sup\u003e. However, under pathological conditions, P2X4 KD significantly suppressed P2X7-dependent macrophage death \u003csup\u003e60\u003c/sup\u003e. Similarly, BMDCs P2X4-deficiency suppressed P2X7-dependent IL 1β and IL 18 release in response to ATP stimulation \u003csup\u003e61\u003c/sup\u003e. These findings align with our current results, suggesting that P2X4 and P2X7 are functional synergic and exert pro-inflammatory positive feedback upon each other under pathological conditions. Indeed, the exon-intron structure and key motifs of the vertebrate P2X gene are well conserved. In humans, the P2X4 gene is located on chromosome 12, which is very close to P2X7, surpassing other P2X genes. This association is conserved between species. Evidence shows that these two genes have physical and functional interactions, originating from the same ancestor gene, probably produced by local gene duplication \u003csup\u003e62,63\u003c/sup\u003e. Hence, it is more rational to consider both P2X4 and P2X7 while investigating and treating inflammation in DCM.\u003c/p\u003e \u003cp\u003eIn conclusion, our findings demonstrate that exercise training possesses cardioprotective and anti-inflammatory effects by inhibiting P2X4/NLRP3 in the diabetic heart. Meanwhile, we provide a comprehensive understanding of the molecular mechanisms of P2X4 and P2X7 in modulating the pathophysiological progression of DCM.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eEthical approval\u003c/strong\u003e \u003cp\u003e All animal experiments were operated and conducted under the approved procedure by the Animal Experiment Committee of East China Normal University (m20201108, m20210404).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare no potential competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eNational Natural Science Foundation of China (Grant 31600967, 31671241);\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZH L: investigation, performed the experiments, writing\u0026mdash;original draft. YJ Y: construction of obesity mouse models, writing\u0026mdash;review. LC S: helping with cell culturing and western blot assay. XY R: assisting with microscopy analysis. Y H: helping with echocardiography experiment. Y Z: helping with bioinformatics analysis. SZ D: investigation, writing\u0026mdash;review, supervision, funding acquisition. Y S: investigation, experimental guidelines and supervision, writing\u0026mdash;review and editing, funding acquisition. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe sincerely express our gratitude to the Instrumental Analysis Center of Shanghai Jiao Tong University for help with the echocardiography experiment. We also thank Prof. Yi Dong of East China Normal University for providing cell culture facilities. Thank Prof. Jian Luo of East China Normal University for providing mice treadmill facilities. The graphical abstract was produced with BioRender.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eAll data generated and analyzed in this paper are available from the corresponding authors upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMohanty, R.R., and Das, S. (2017). Inhaled Insulin - Current Direction of Insulin Research. J Clin Diagn Res 11, OE01-OE02. 10.7860/JCDR/2017/23626.9732.\u003c/li\u003e\n\u003cli\u003eDemir, S., Nawroth, P.P., Herzig, S., and Ekim Ustunel, B. (2021). Emerging Targets in Type 2 Diabetes and Diabetic Complications. Adv Sci (Weinh) 8, e2100275. 10.1002/advs.202100275.\u003c/li\u003e\n\u003cli\u003eBulani, Y., and Sharma, S.S. (2017). Argatroban Attenuates Diabetic Cardiomyopathy in Rats by Reducing Fibrosis, Inflammation, Apoptosis, and Protease-Activated Receptor Expression. Cardiovasc Drugs Ther 31, 255-267. 10.1007/s10557-017-6732-3.\u003c/li\u003e\n\u003cli\u003eMurtaza, G., Virk, H.U.H., Khalid, M., Lavie, C.J., Ventura, H., Mukherjee, D., Ramu, V., Bhogal, S., Kumar, G., Shanmugasundaram, M., and Paul, T.K. (2019). Diabetic cardiomyopathy - A comprehensive updated review. Prog Cardiovasc Dis 62, 315-326. 10.1016/j.pcad.2019.03.003.\u003c/li\u003e\n\u003cli\u003eTan, Y., Zhang, Z., Zheng, C., Wintergerst, K.A., Keller, B.B., and Cai, L. (2020). Mechanisms of diabetic cardiomyopathy and potential therapeutic strategies: preclinical and clinical evidence. Nat Rev Cardiol 17, 585-607. 10.1038/s41569-020-0339-2.\u003c/li\u003e\n\u003cli\u003eMari, S.A., Pluhackova, K., Pipercevic, J., Leipner, M., Hiller, S., Engel, A., and Muller, D.J. (2022). Gasdermin-A3 pore formation propagates along variable pathways. Nat Commun 13, 2609. 10.1038/s41467-022-30232-8.\u003c/li\u003e\n\u003cli\u003eWei, J., Zhao, Y., Liang, H., Du, W., and Wang, L. (2022). Preliminary evidence for the presence of multiple forms of cell death in diabetes cardiomyopathy. Acta Pharm Sin B 12, 1-17. 10.1016/j.apsb.2021.08.026.\u003c/li\u003e\n\u003cli\u003eYang, F., Qin, Y., Wang, Y., Meng, S., Xian, H., Che, H., Lv, J., Li, Y., Yu, Y., Bai, Y., and Wang, L. (2019). Metformin Inhibits the NLRP3 Inflammasome via AMPK/mTOR-dependent Effects in Diabetic Cardiomyopathy. Int J Biol Sci 15, 1010-1019. 10.7150/ijbs.29680.\u003c/li\u003e\n\u003cli\u003eMeng, L., Lin, H., Huang, X., Weng, J., Peng, F., and Wu, S. (2022). METTL14 suppresses pyroptosis and diabetic cardiomyopathy by downregulating TINCR lncRNA. Cell Death Dis 13, 38. 10.1038/s41419-021-04484-z.\u003c/li\u003e\n\u003cli\u003eGao, G., Fu, L., Xu, Y., Tao, L., Guo, T., Fang, G., Zhang, G., Wang, S., Qin, T., Luo, P., and Shen, X. (2022). Cyclovirobuxine D Ameliorates Experimental Diabetic Cardiomyopathy by Inhibiting Cardiomyocyte Pyroptosis via NLRP3 in vivo and in vitro. Front Pharmacol 13, 906548. 10.3389/fphar.2022.906548.\u003c/li\u003e\n\u003cli\u003eSwanson, K.V., Deng, M., and Ting, J.P. (2019). The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol 19, 477-489. 10.1038/s41577-019-0165-0.\u003c/li\u003e\n\u003cli\u003eChekeni, F.B., Elliott, M.R., Sandilos, J.K., Walk, S.F., Kinchen, J.M., Lazarowski, E.R., Armstrong, A.J., Penuela, S., Laird, D.W., Salvesen, G.S., et al. (2010). Pannexin 1 channels mediate \u0026apos;find-me\u0026apos; signal release and membrane permeability during apoptosis. Nature 467, 863-867. 10.1038/nature09413.\u003c/li\u003e\n\u003cli\u003eMedina, C.B., Mehrotra, P., Arandjelovic, S., Perry, J.S.A., Guo, Y., Morioka, S., Barron, B., Walk, S.F., Ghesquiere, B., Krupnick, A.S., et al. (2020). Metabolites released from apoptotic cells act as tissue messengers. Nature 580, 130-135. 10.1038/s41586-020-2121-3.\u003c/li\u003e\n\u003cli\u003eSavio, L.E.B., Leite-Aguiar, R., Alves, V.S., Coutinho-Silva, R., and Wyse, A.T.S. (2021). Purinergic signaling in the modulation of redox biology. Redox Biol 47, 102137. 10.1016/j.redox.2021.102137.\u003c/li\u003e\n\u003cli\u003eNorth, R.A. (2002). Molecular physiology of P2X receptors. Physiol Rev 82, 1013-1067. 10.1152/physrev.00015.2002.\u003c/li\u003e\n\u003cli\u003eMcCarthy, A.E., Yoshioka, C., and Mansoor, S.E. (2019). Full-Length P2X7 Structures Reveal How Palmitoylation Prevents Channel Desensitization. Cell 179, 659-670 e613. 10.1016/j.cell.2019.09.017.\u003c/li\u003e\n\u003cli\u003eIlles, P., Muller, C.E., Jacobson, K.A., Grutter, T., Nicke, A., Fountain, S.J., Kennedy, C., Schmalzing, G., Jarvis, M.F., Stojilkovic, S.S., et al. (2021). Update of P2X receptor properties and their pharmacology: IUPHAR Review 30. Br J Pharmacol 178, 489-514. 10.1111/bph.15299.\u003c/li\u003e\n\u003cli\u003eHigashikuni, Y., Liu, W., Numata, G., Tanaka, K., Fukuda, D., Tanaka, Y., Hirata, Y., Imamura, T., Takimoto, E., Komuro, I., and Sata, M. (2023). NLRP3 Inflammasome Activation Through Heart-Brain Interaction Initiates Cardiac Inflammation and Hypertrophy During Pressure Overload. Circulation 147, 338-355. 10.1161/CIRCULATIONAHA.122.060860.\u003c/li\u003e\n\u003cli\u003eHuang, S., Wang, W., Li, L., Wang, T., Zhao, Y., Lin, Y., Huang, W., Wang, Y., and Huang, Z. (2021). P2X7 Receptor Deficiency Ameliorates STZ-induced Cardiac Damage and Remodeling Through PKCbeta and ERK. Front Cell Dev Biol 9, 692028. 10.3389/fcell.2021.692028.\u003c/li\u003e\n\u003cli\u003eSun, S., Dawuti, A., Gong, D., Wang, R., Yuan, T., Wang, S., Xing, C., Lu, Y., Du, G., and Fang, L. (2022). Puerarin-V Improve Mitochondrial Respiration and Cardiac Function in a Rat Model of Diabetic Cardiomyopathy via Inhibiting Pyroptosis Pathway through P2X7 Receptors. Int J Mol Sci 23. 10.3390/ijms232113015.\u003c/li\u003e\n\u003cli\u003eBraganca, B., Nogueira-Marques, S., Ferreirinha, F., Fontes-Sousa, A.P., and Correia-de-Sa, P. (2019). The Ionotropic P2X4 Receptor has Unique Properties in the Heart by Mediating the Negative Chronotropic Effect of ATP While Increasing the Ventricular Inotropy. Front Pharmacol 10, 1103. 10.3389/fphar.2019.01103.\u003c/li\u003e\n\u003cli\u003eYang, T., Shen, J.B., Yang, R., Redden, J., Dodge-Kafka, K., Grady, J., Jacobson, K.A., and Liang, B.T. (2014). Novel protective role of endogenous cardiac myocyte P2X4 receptors in heart failure. Circ Heart Fail 7, 510-518. 10.1161/CIRCHEARTFAILURE.113.001023.\u003c/li\u003e\n\u003cli\u003eShen, J.B., Cronin, C., Sonin, D., Joshi, B.V., Gongora Nieto, M., Harrison, D., Jacobson, K.A., and Liang, B.T. (2007). P2X purinergic receptor-mediated ionic current in cardiac myocytes of calsequestrin model of cardiomyopathy: implications for the treatment of heart failure. Am J Physiol Heart Circ Physiol 292, H1077-1084. 10.1152/ajpheart.00515.2006.\u003c/li\u003e\n\u003cli\u003eMusa, H., Tellez, J.O., Chandler, N.J., Greener, I.D., Maczewski, M., Mackiewicz, U., Beresewicz, A., Molenaar, P., Boyett, M.R., and Dobrzynski, H. (2009). P2 purinergic receptor mRNA in rat and human sinoatrial node and other heart regions. Naunyn Schmiedebergs Arch Pharmacol 379, 541-549. 10.1007/s00210-009-0403-2.\u003c/li\u003e\n\u003cli\u003eChen, K., Zhang, J., Zhang, W., Zhang, J., Yang, J., Li, K., and He, Y. (2013). ATP-P2X4 signaling mediates NLRP3 inflammasome activation: a novel pathway of diabetic nephropathy. Int J Biochem Cell Biol 45, 932-943. 10.1016/j.biocel.2013.02.009.\u003c/li\u003e\n\u003cli\u003eWang, T., Li, J., Li, H., Zhong, X., Wang, L., Zhao, S., Liu, X., Huang, Z., and Wang, Y. (2022). Aerobic Exercise Inhibited P2X7 Purinergic Receptors to Improve Cardiac Remodeling in Mice With Type 2 Diabetes. Front Physiol 13, 828020. 10.3389/fphys.2022.828020.\u003c/li\u003e\n\u003cli\u003eChen, X., Li, H., Wang, K., Liang, X., Wang, W., Hu, X., Huang, Z., and Wang, Y. (2019). Aerobic Exercise Ameliorates Myocardial Inflammation, Fibrosis and Apoptosis in High-Fat-Diet Rats by Inhibiting P2X7 Purinergic Receptors. Front Physiol 10, 1286. 10.3389/fphys.2019.01286.\u003c/li\u003e\n\u003cli\u003eVirtue, S., and Vidal-Puig, A. (2021). GTTs and ITTs in mice: simple tests, complex answers. Nat Metab 3, 883-886. 10.1038/s42255-021-00414-7.\u003c/li\u003e\n\u003cli\u003eSun, X., Sun, G., Huang, Y., Zhang, S., Tang, X., Zhang, N., Zhao, L., Zhong, R., and Peng, Y. (2020). Glycolytic inhibition by 3-bromopyruvate increases the cytotoxic effects of chloroethylnitrosoureas to human glioma cells and the DNA interstrand cross-links formation. Toxicology 435, 152413. 10.1016/j.tox.2020.152413.\u003c/li\u003e\n\u003cli\u003eYan, M., Li, Y., Luo, Q., Zeng, W., Shao, X., Li, L., Wang, Q., Wang, D., Zhang, Y., Diao, H., et al. (2022). Mitochondrial damage and activation of the cytosolic DNA sensor cGAS-STING pathway lead to cardiac pyroptosis and hypertrophy in diabetic cardiomyopathy mice. Cell Death Discov 8, 258. 10.1038/s41420-022-01046-w.\u003c/li\u003e\n\u003cli\u003eLi, F., Xu, D., Hou, K., Gou, X., Lv, N., Fang, W., and Li, Y. (2021). Pretreatment of Indobufen and Aspirin and their Combinations with Clopidogrel or Ticagrelor Alleviates Inflammasome Mediated Pyroptosis Via Inhibiting NF-kappaB/NLRP3 Pathway in Ischemic Stroke. J Neuroimmune Pharmacol 16, 835-853. 10.1007/s11481-020-09978-9.\u003c/li\u003e\n\u003cli\u003eBroz, P., Pelegrin, P., and Shao, F. (2020). The gasdermins, a protein family executing cell death and inflammation. Nat Rev Immunol 20, 143-157. 10.1038/s41577-019-0228-2.\u003c/li\u003e\n\u003cli\u003eMentrup, T., Theodorou, K., Cabrera-Cabrera, F., Helbig, A.O., Happ, K., Gijbels, M., Gradtke, A.C., Rabe, B., Fukumori, A., Steiner, H., et al. (2019). Atherogenic LOX-1 signaling is controlled by SPPL2-mediated intramembrane proteolysis. J Exp Med 216, 807-830. 10.1084/jem.20171438.\u003c/li\u003e\n\u003cli\u003eSzklarczyk, D., Gable, A.L., Lyon, D., Junge, A., Wyder, S., Huerta-Cepas, J., Simonovic, M., Doncheva, N.T., Morris, J.H., Bork, P., et al. (2019). STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res 47, D607-D613. 10.1093/nar/gky1131.\u003c/li\u003e\n\u003cli\u003eTabula Muris, C., Overall, c., Logistical, c., Organ, c., processing, Library, p., sequencing, Computational data, a., Cell type, a., Writing, g., et al. (2018). Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature 562, 367-372. 10.1038/s41586-018-0590-4.\u003c/li\u003e\n\u003cli\u003eLi, S., Bjelobaba, I., and Stojilkovic, S.S. (2018). Interactions of Pannexin1 channels with purinergic and NMDA receptor channels. Biochim Biophys Acta Biomembr 1860, 166-173. 10.1016/j.bbamem.2017.03.025.\u003c/li\u003e\n\u003cli\u003eJorquera, G., Meneses-Valdes, R., Rosales-Soto, G., Valladares-Ide, D., Campos, C., Silva-Monasterio, M., Llanos, P., Cruz, G., Jaimovich, E., and Casas, M. (2021). High extracellular ATP levels released through pannexin-1 channels mediate inflammation and insulin resistance in skeletal muscle fibres of diet-induced obese mice. Diabetologia 64, 1389-1401. 10.1007/s00125-021-05418-2.\u003c/li\u003e\n\u003cli\u003eTam, T.H., Chan, K.L., Boroumand, P., Liu, Z., Brozinick, J.T., Bui, H.H., Roth, K., Wakefield, C.B., Penuela, S., Bilan, P.J., and Klip, A. (2020). Nucleotides released from palmitate-activated murine macrophages attract neutrophils. J Biol Chem 295, 4902-4911. 10.1074/jbc.RA119.010868.\u003c/li\u003e\n\u003cli\u003ePalomer, X., Pizarro-Delgado, J., Barroso, E., and Vazquez-Carrera, M. (2018). Palmitic and Oleic Acid: The Yin and Yang of Fatty Acids in Type 2 Diabetes Mellitus. Trends Endocrinol Metab 29, 178-190. 10.1016/j.tem.2017.11.009.\u003c/li\u003e\n\u003cli\u003eNarkar, V.A., Downes, M., Yu, R.T., Embler, E., Wang, Y.X., Banayo, E., Mihaylova, M.M., Nelson, M.C., Zou, Y., Juguilon, H., et al. (2008). AMPK and PPARdelta agonists are exercise mimetics. Cell 134, 405-415. 10.1016/j.cell.2008.06.051.\u003c/li\u003e\n\u003cli\u003eHoffman, N.J., Parker, B.L., Chaudhuri, R., Fisher-Wellman, K.H., Kleinert, M., Humphrey, S.J., Yang, P., Holliday, M., Trefely, S., Fazakerley, D.J., et al. (2015). Global Phosphoproteomic Analysis of Human Skeletal Muscle Reveals a Network of Exercise-Regulated Kinases and AMPK Substrates. Cell Metab 22, 922-935. 10.1016/j.cmet.2015.09.001.\u003c/li\u003e\n\u003cli\u003eZumerle, S., Cali, B., Munari, F., Angioni, R., Di Virgilio, F., Molon, B., and Viola, A. (2019). Intercellular Calcium Signaling Induced by ATP Potentiates Macrophage Phagocytosis. Cell Rep 27, 1-10 e14. 10.1016/j.celrep.2019.03.011.\u003c/li\u003e\n\u003cli\u003eMa, T., Huang, X., Zheng, H., Huang, G., Li, W., Liu, X., Liang, J., Cao, Y., Hu, Y., and Huang, Y. (2021). SFRP2 Improves Mitochondrial Dynamics and Mitochondrial Biogenesis, Oxidative Stress, and Apoptosis in Diabetic Cardiomyopathy. Oxid Med Cell Longev 2021, 9265016. 10.1155/2021/9265016.\u003c/li\u003e\n\u003cli\u003eRen, B.C., Zhang, Y.F., Liu, S.S., Cheng, X.J., Yang, X., Cui, X.G., Zhao, X.R., Zhao, H., Hao, M.F., Li, M.D., et al. (2020). Curcumin alleviates oxidative stress and inhibits apoptosis in diabetic cardiomyopathy via Sirt1-Foxo1 and PI3K-Akt signalling pathways. J Cell Mol Med 24, 12355-12367. 10.1111/jcmm.15725.\u003c/li\u003e\n\u003cli\u003eZhang, B., Li, X., Liu, G., Zhang, C., Zhang, X., Shen, Q., Sun, G., and Sun, X. (2021). Peroxiredomin-4 ameliorates lipotoxicity-induced oxidative stress and apoptosis in diabetic cardiomyopathy. Biomed Pharmacother 141, 111780. 10.1016/j.biopha.2021.111780.\u003c/li\u003e\n\u003cli\u003eKaze, A.D., Erqou, S., Santhanam, P., Bertoni, A.G., Ahima, R.S., Fonarow, G.C., and Echouffo-Tcheugui, J.B. (2022). Variability of adiposity indices and incident heart failure among adults with type 2 diabetes. Cardiovasc Diabetol 21, 16. 10.1186/s12933-021-01440-1.\u003c/li\u003e\n\u003cli\u003eFender, A.C., Kleeschulte, S., Stolte, S., Leineweber, K., Kamler, M., Bode, J., Li, N., and Dobrev, D. (2020). Thrombin receptor PAR4 drives canonical NLRP3 inflammasome signaling in the heart. Basic Res Cardiol 115, 10. 10.1007/s00395-019-0771-9.\u003c/li\u003e\n\u003cli\u003eYeap, H.W., and Chen, K.W. (2022). RIPK1 and RIPK3 in antibacterial defence. Biochem Soc Trans 50, 1583-1594. 10.1042/BST20211242.\u003c/li\u003e\n\u003cli\u003eSchmid, R., and Evans, R.J. (2019). ATP-Gated P2X Receptor Channels: Molecular Insights into Functional Roles. Annu Rev Physiol 81, 43-62. 10.1146/annurev-physiol-020518-114259.\u003c/li\u003e\n\u003cli\u003eRaggi, F., Rossi, C., Faita, F., Distaso, M., Kusmic, C., and Solini, A. (2022). P2X7 Receptor and Heart Function in a Mouse Model of Systemic Inflammation Due to High Fat Diet. J Inflamm Res 15, 2425-2439. 10.2147/JIR.S356038.\u003c/li\u003e\n\u003cli\u003eDi Virgilio, F., Dal Ben, D., Sarti, A.C., Giuliani, A.L., and Falzoni, S. (2017). The P2X7 Receptor in Infection and Inflammation. Immunity 47, 15-31. 10.1016/j.immuni.2017.06.020.\u003c/li\u003e\n\u003cli\u003eYuan, Y., Zhu, C., Wang, Y., Sun, J., Feng, J., Ma, Z., Li, P., Peng, W., Yin, C., Xu, G., et al. (2022). alpha-Ketoglutaric acid ameliorates hyperglycemia in diabetes by inhibiting hepatic gluconeogenesis via serpina1e signaling. Sci Adv 8, eabn2879. 10.1126/sciadv.abn2879.\u003c/li\u003e\n\u003cli\u003ePopova, M., Trudell, J., Li, K., Alkana, R., Davies, D., and Asatryan, L. (2013). Tryptophan 46 is a site for ethanol and ivermectin action in P2X4 receptors. Purinergic Signal 9, 621-632. 10.1007/s11302-013-9373-4.\u003c/li\u003e\n\u003cli\u003eViglino, C., Foglia, B., and Montessuit, C. (2019). Chronic AICAR treatment prevents metabolic changes in cardiomyocytes exposed to free fatty acids. Pflugers Arch 471, 1219-1234. 10.1007/s00424-019-02285-0.\u003c/li\u003e\n\u003cli\u003eCordero, M.D., Williams, M.R., and Ryffel, B. (2018). AMP-Activated Protein Kinase Regulation of the NLRP3 Inflammasome during Aging. Trends Endocrinol Metab 29, 8-17. 10.1016/j.tem.2017.10.009.\u003c/li\u003e\n\u003cli\u003eKirchner, J., Brune, B., and Namgaladze, D. (2018). AICAR inhibits NFkappaB DNA binding independently of AMPK to attenuate LPS-triggered inflammatory responses in human macrophages. Sci Rep 8, 7801. 10.1038/s41598-018-26102-3.\u003c/li\u003e\n\u003cli\u003eChen, K.W., Demarco, B., Heilig, R., Shkarina, K., Boettcher, A., Farady, C.J., Pelczar, P., and Broz, P. (2019). Extrinsic and intrinsic apoptosis activate pannexin-1 to drive NLRP3 inflammasome assembly. EMBO J 38. 10.15252/embj.2019101638.\u003c/li\u003e\n\u003cli\u003eVince, J.E., Wong, W.W., Gentle, I., Lawlor, K.E., Allam, R., O\u0026apos;Reilly, L., Mason, K., Gross, O., Ma, S., Guarda, G., et al. (2012). Inhibitor of apoptosis proteins limit RIP3 kinase-dependent interleukin-1 activation. Immunity 36, 215-227. 10.1016/j.immuni.2012.01.012.\u003c/li\u003e\n\u003cli\u003eWeinhold, K., Krause-Buchholz, U., Rodel, G., Kasper, M., and Barth, K. (2010). Interaction and interrelation of P2X7 and P2X4 receptor complexes in mouse lung epithelial cells. Cell Mol Life Sci 67, 2631-2642. 10.1007/s00018-010-0355-1.\u003c/li\u003e\n\u003cli\u003eKawano, A., Tsukimoto, M., Noguchi, T., Hotta, N., Harada, H., Takenouchi, T., Kitani, H., and Kojima, S. (2012). Involvement of P2X4 receptor in P2X7 receptor-dependent cell death of mouse macrophages. Biochem Biophys Res Commun 419, 374-380. 10.1016/j.bbrc.2012.01.156.\u003c/li\u003e\n\u003cli\u003eSakaki, H., Fujiwaki, T., Tsukimoto, M., Kawano, A., Harada, H., and Kojima, S. (2013). P2X4 receptor regulates P2X7 receptor-dependent IL-1beta and IL-18 release in mouse bone marrow-derived dendritic cells. Biochem Biophys Res Commun 432, 406-411. 10.1016/j.bbrc.2013.01.135.\u003c/li\u003e\n\u003cli\u003eKanellopoulos, J.M., Almeida-da-Silva, C.L.C., Ruutel Boudinot, S., and Ojcius, D.M. (2021). Structural and Functional Features of the P2X4 Receptor: An Immunological Perspective. Front Immunol 12, 645834. 10.3389/fimmu.2021.645834.\u003c/li\u003e\n\u003cli\u003eHou, Z., and Cao, J. (2016). Comparative study of the P2X gene family in animals and plants. Purinergic Signal 12, 269-281. 10.1007/s11302-016-9501-z.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Diabetic cardiomyopathy, Aerobic exercise, P2X receptors, NLRP3 inflammasome, Pyroptosis, AICAR","lastPublishedDoi":"10.21203/rs.3.rs-3965620/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3965620/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Diabetic cardiomyopathy (DCM) is one of the most prevalent diabetic complications associated with chronic low-grade inflammation. P2X purinergic receptors and NLRP3 inflammasome have been reported to be enriched in DCM hearts. They are regarded as partners in the crime of inflammation and inflammatory type of cell death, pyroptosis. Exercise is an effective nonpharmacological therapy for DCM though the involving mechanisms are ill-defined. The cardioprotective role of exercise may rely heavily on its anti-inflammatory effect. However, whether exercise modulates P2X and NLRP3 inflammasome activation and thus ameliorates DCM pathologies and pyroptosis needs to be clarified entirely. In this study, we found that P2X4/P2X7-NLRP3 is involved in the pathogenesis of DCM. Exercise serves a cardioprotective effect through the inhibition of the P2X4/ROS/NLRP3 signalling pathway. AICAR exerts an inhibitory effect on NLRP3 inflammasome and pyroptosis by simultaneously targeting P2X4 and P2X7, showing an exercise mimic effect. Overall, we proposed novel insights into the therapeutic and preventive effects of early exercise intervention on DCM progress.","manuscriptTitle":"Aerobic exercise alleviates diabetic cardiomyopathy via attenuation of P2X4-mediated NLRP3 inflammasome activation and cardiomyocyte pyroptosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-21 11:13:52","doi":"10.21203/rs.3.rs-3965620/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0c900e93-0355-46e7-b7fa-47d15d2b078f","owner":[],"postedDate":"February 21st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-22T12:33:33+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-21 11:13:52","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3965620","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3965620","identity":"rs-3965620","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}