pH-sensitive Nanoformulation of Acetyl-11-Keto-beta-Boswellic Acid (AKBA) as a Potential Antiproliferative Agent in Colon Carcinogenesis (In Vitro and In Vivo)

pH-sensitive Nanoformulation of Acetyl-11-Keto-beta-Boswellic Acid (AKBA) as a Potential Antiproliferative Agent in Colon Carcinogenesis (In Vitro and In Vivo) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article pH-sensitive Nanoformulation of Acetyl-11-Keto-beta-Boswellic Acid (AKBA) as a Potential Antiproliferative Agent in Colon Carcinogenesis (In Vitro and In Vivo) Atiyeh Ale-Ahmad, Sohrab Kazemi, Abdolreza Daraei, Mahdi Sepidarkish, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4289336/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Developing a drug delivery system that can transport a higher concentration to the target cells can improve therapeutic efficacy. This study aimed to develop a novel delivery system for Acetyl-11-Keto-beta-Boswellic Acid (AKBA) using chitosan-sodium alginate-calcium chloride (CS-SA-CaCl 2 ) nanoparticles. The objectives were to evaluate the antiproliferative activity of these nanoparticles against colorectal cancer (CRC) cells and to improve the bioavailability and therapeutic efficacy of AKBA. Results With an extraction efficiency of 12.64%, AKBA was successfully extracted from the gum resin of B. serrata . The nanoparticle delivery system exhibited superior cytotoxicity against HT29 cells compared to free AKBA, AKBA extract (BA-Ex), and 5-FU. Furthermore, the nano formulation (nano-BA-Ex), induced apoptosis in HT29 cells more effectively than the other treatments. In vivo results showed that nanoformulation inhibited chemically induced colon tumorigenesis in mice and significantly reduced the number of aberrant crypt foci (ACFs). Conclusions The developed CS-SA-CaCl 2 nanoparticles loaded with AKBA extract exhibit potential as a potent drug delivery mechanism for the colorectal cancer model. Nano-BA-Ex is a promising strategy for enhancing the solubility, bioavailability, and therapeutic efficacy of BA derivatives. With its multiple effects on cancer cells and controlled drug release through nanocapsules, nano-BA-Ex stands out as a compelling candidate for further preclinical and clinical evaluation in CRC therapy. Colorectal cancer boswellic acid (BA) Acetyl-11-Keto-beta-Boswellic Acid (AKBA) nanoparticle drug delivery system sodium alginate chitosan calcium chloride Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Background Colorectal cancer (CRC) is the second most commonly diagnosed cancer in women and the third most commonly diagnosed cancer in men, accounting for approximately 10% of all cancer diagnoses annually and associated mortality ( 1 ). Despite advances in treatment modalities such as surgery, chemotherapy, and radiotherapy, CRC management faces significant challenges, including late diagnosis and limited treatment efficacy, resulting in unfavorable outcomes such as toxicity, relapse, and drug resistance ( 2 ). Therefore, there is an urgent need for innovative therapeutic strategies targeting multiple carcinogenic mechanisms to effectively manage CRC. Nano drug delivery systems represent a promising approach to overcome the limitations of conventional chemotherapy in cancer treatment. These systems are designed to enhance drug solubility, bioavailability, and targeting, thereby maximizing drug levels at the target site while minimizing systemic toxicity and side effects ( 3 ). They provide precise drug delivery to cancer cells, protect healthy tissues, reduce systemic toxicity and side effects, and allow for controlled drug release over time, potentially improving therapeutic outcomes ( 4 – 7 ). Boswellic acid derivatives, derived from the resin of the genus Boswellia , have attracted attention for their anticancer properties. Compounds such as α- and β-boswellic acid (BA), 3-O-acetyl-α- and β-boswellic acid (ABA), 11-keto-β-boswellic acid (KBA), and 3-O-acetyl-11-keto-β-boswellic acid (AKBA) have demonstrated anti-inflammatory, anti-arthritic, and anticancer effects in various preclinical studies ( 8 ). Their anti-proliferative effect against various types of cancer has been extensively studied in both in vitro and in vivo settings ( 9 ). However, their therapeutic potential is limited by poor solubility and bioavailability ( 10 , 11 ). Researchers have explored alternative delivery methods to address the solubility and bioavailability challenges associated with BA derivatives, including naturally derived polymeric nanoparticles such as sodium alginate (SA) and chitosan (CS). In particular, sodium alginate is a hydrogel-based natural polymer with exceptional properties including chelation, biocompatibility, immunogenicity, and mucoadhesion ( 12 ). Chitosan, another natural polymer, is well-suited for advanced drug delivery systems due to its advantageous properties, including low immunogenicity, mucoadhesiveness, biocompatibility, biodegradability, and nontoxicity ( 13 ). In particular, the pH sensitivity of chitosan-based nanocapsules allows for targeted drug release, enhancing drug bioavailability while minimizing off-target effects ( 14 ). Calcium chloride (CaCl 2 ) has been investigated as a cross-linking agent to form stable CS-SA nanoparticles by linking the amino and carboxyl groups of chitosan and alginate chains, respectively ( 15 ). This cross-linking reaction is crucial for maintaining the stability and integrity of the nanoparticle, preventing rapid drug release, and enhancing mucoadhesive properties, thereby improving drug release kinetics and bioavailability ( 16 – 18 ). Despite the progress in the use of CS-SA-CaCl 2 nanoparticles for various drugs, their application as a delivery system for BA derivatives remains unexplored. Considering the reported anticancer activity of BA derivatives and their solubility problem, the investigation of CS-SA-CaCl 2 nanoparticles as a delivery system provides an opportunity to overcome these limitations and improve their therapeutic efficacy in cancer therapy due to their biocompatibility, biodegradability, mucoadhesiveness, and controlled drug release ( 19 ). Therefore, this study aims to prepare CS-SA-CaCl 2 nanoparticles for the delivery of AKBA and evaluate their anti-proliferative effects on cancer cells. 2. Results 2.1. BA Extraction using Three Phase Partitioning (TPP) followed by Column Chromatography The three-phase partitioning (TPP) method was used to extract AKBA from the gum resin of B. serrata . AKBA-containing fractions (BA-Ex) were isolated, and confirmed via high-performance liquid chromatography (HPLC). Finally, the amount of AKBA in the extract (BA-Ex) was quantified through UV detection at 260 nm (Fig. 1 , blue color). The extraction efficiency was calculated to be 12.64% based on the standard curve of the AKBA standard (Y = 13348X − 16142, R² = 0.9984). 2.2. Preparation and characterization of BA-Extract -loaded nanoparticles (Nano-BA-Ex) Dual crosslinked nanoparticles loaded with BA-Ex were synthesized by ionic pregelation and polyelectrolyte complexation methods using sodium alginate and chitosan. The loading capacity and encapsulation efficiency of nano-BA-Ex were determined to be 6.9% and 75.16%, respectively, based on equations (1) and (2). Field emission scanning electron microscopy (FE-SEM) revealed particle structures with an average diameter of about 100 nm (Fig. 2 A). Further characterization of the nanoparticles included measurement of mean size, polydispersity index (PDI), and zeta potential (ζ-potential) using dynamic light scattering (DLS) and zeta sizer (Fig. 2 B and C). Fourier transform infrared (FTIR) spectra were used to analyze the chemical and crystalline properties of nano-BA-Ex, demonstrating the presence of BA and its derivatives (Fig. 2 D). Specifically, the absorption peak at 1243 cm − 1 indicated the stretching vibration of C-O bonds commonly found in ester groups (-COO-), carboxylic acids (-COOH), or ethers (-C-O-C-), and in some cases, C-N bonds. In addition, the peak observed at 2921 cm − 1 corresponded to the stretching vibration of C-H bonds in aliphatic hydrocarbons, reflecting the symmetric stretching of CH 2 and CH 3 groups, with intensity variations depending on hydrogenation and chemical environment. 2.3. In Vitro 2.3.1. Nano-BA-Ex inhibited cellular growth in HT-29 cells The cytotoxicity of AKBA, BA-Ex, nano-BA-Ex, 5-Fluorouracil (5-FU, as a positive control), and blank nanocarrier on HT29 human colorectal cancer cells and normal fibroblast cells was evaluated using the MTT assay. After 48 hours of each treatment, both cell lines showed a dose-dependent decrease in cell viability for each treatment compared to untreated cells (Fig. 3 ). However, normal fibroblasts exhibited a smaller decrease in cell viability for each treatment than HT29 cells (p < 0.001). Nano-BA-Ex, even at one-tenth concentration, resulted in a significantly greater decrease in cell viability compared to AKBA and BA-Ex, when compared to 5-FU (as positive control), even in one-tenth of concentration (p < 0.001). 2.3.2. Nano-BA-Ex enhanced apoptosis in HT-29 2.3.2.1. Annexin V Staining The annexin V staining assay was employed to assess apoptosis induction following a 48-hour treatment with different test compounds. Flow cytometry analysis revealed distinct populations based on fluorescence intensity in the FITC and PI channels. Cell distribution in distinct quadrants was determined using quadrant statistics. The administration of each test compound led to differences in cell populations within specific quadrants, indicating varying levels of apoptosis induction. Figure 4 A illustrates the distribution of cells in various quadrants following treatment with 5-FU (30 µM), AKBA (100 µM), BA-Ex (100 µM), and nano-BA-Ex (10 µM), compared to the control group, as determined using scatter plots. The distribution of quadrants and the early/late apoptotic rate for each treatment compound are presented in Fig. 4 B, respectively. As shown in Figure B, the apoptosis rate in nano-BA-Ex was higher than 5-FU. 2.3.2.2. Cell Cycle Analysis The effect of various test compounds on cell cycle progression was evaluated. After 48 hours of treatment, flow cytometry was performed on cells and the resulting cell fractions were sorted by DNA content. Treatment with 5-FU (30 µM), AKBA (100 µM), BA-Ex (100 µM), and nano-BA-Ex (10 µM), produced noticeable changes in the distribution of cell cycle phases. Figure 5 A illustrates representative histograms that display the post-treatment cell cycle distribution with the compounds mentioned. Furthermore, the sub-G1 cell fraction, an indicator of apoptotic cells, was assessed based on fluorescence intensity (Fig. 5 B). Notably, the nano-BA-Ex, AKBA, and BA-Ex showed increased sub-G1 cell fractions compared to both the control and 5-FU. 2.4. In vivo 2.4.1. Nano-BA-Ex inhibits colitis-related mouse colon tumorigenesis Pathological characteristics of colon lesions including necrotic index, levels of mitosis, and aberrant crypt foci (ACF) were scored and compared among different groups (e.g. as the average mitoses amount in 10 high-power fields at the lesion) (Fig. 6 ). The results demonstrated a significant difference between the negative control, placebo, 5-FU, BA-Ex, nano-BA-Ex, and nano-BA-Ex/5-FU receiving groups regarding levels of necrosis, mitosis, and ACF. After scoring and staging, the groups that received 5-FU, BA-Ex, nano-BA-Ex, and nano-BA-Ex/5-FU showed a significant decrease in mitosis compared to the placebo group (p < 0.001) (Table 1 ). Although the nano-BA-Ex groups exhibited a higher reduction in mitosis rate compared to 5-FU and BA-Ex, the difference was not statistically significant. ACF was significantly reduced in the groups treated with 5-FU, BA-Ex, nano-BA-Ex, and nano-BA-Ex/5-FU compared to those treated with placebo (p < 0.001)(Table 1 ). Furthermore, the nano-BA-Ex receiving group showed a significantly lower number of ACF compared 5-FU and BA-Ex groups (p < 0.001). The difference was even more pronounced in the group that received a combination of nano-BA-Ex and 5-FU (p < 0.001). Table 1 Comparison between the colon tissue necrosis, mitotic, and Aberrant Crypt Foci (ACF) indices of the different groups against placebo. Necrosis Mean Differences (95% CI) Placebo Nano Carrier 5-FU BA-Ex Nano-BA-Ex Nano-BA-Ex / 5-FU Placebo - -0.10 (-1.38, 1.18) 0.90 (-0.38, 2.18) 0.40 (-0.88, 1.68) 0.70 (-0.58, 1.98) 1.00 (-0.28, 2.28) Nano carrier 0.10 (-1.18, 1.38) - 1.00 (-0.28, 2.28) 0.50 (-0.78, 1.78) 0.80 (-0.48, 2.08) 1.10 (-0.18, 2.38) 5-FU -0.90 (-2.18, 0.38) -1.00 (-2.28, 0.28) - -0.50 (-1.78, 0.78) -0.20 (-1.48, 1.08) 0.10 (-1.18, 1.38) BA-Ex -0.40 (-1.68, 0.88) -0.50 (-1.78, 0.78) 0.50 (-0.78, 1.78) - 0.30 (-0.98, 1.58) 0.60 (-0.68, 1.88) Nano-BA-Ex -0.70 (-1.98, 0.58) -0.80 (-2.08, 0.48) 0.20 (-1.08, 1.48) -0.30 (-1.58, 0.98) - 0.30 (-0.98, 1.58) Nano-BA-Ex / 5-FU -1.00 (-2.28, 0.28) -1.10 (-2.38, 0.18) -0.10 (-1.38, 1.18) -0.60 (-1.88, 0.68) -0.30 (-1.58, 0.98) - Mitosis Mean Differences (95% CI) Placebo Nano carrier 5-FU BA-Ex Nano-BA-Ex Nano-BA-Ex / 5-FU Placebo - 0.50 (-3.22, 4.22) 6.10 (2.38, 9.82) 5.00 (1.28, 8.72) 7.70 (3.98, 11.42) 9.30 (5.58, 13.02) Nano carrier -0.50 (-4.22, 3.22) - 5.60 (1.88, 9.32) 4.50 (0.78, 8.22) 7.20 (3.48, 10.92) 8.80 (5.08, 12.52) 5-FU -6.10 (-9.82, -2.38) -5.60 (-9.32, -1.88) - -1.10 (-4.82, 2.62) 1.60 (-2.12, 5.32) 3.20 (-0.52, 6.92) BA-Ex -5.00 (-8.72, -1.28) -4.50 (-8.22, -0.78) 1.10 (-2.62, 4.82) - 2.70 (-1.02, 6.42) 4.300 (0.58, 8.02) Nano-BA-Ex -7.70 (-11.42, -3.98) -7.20 (-10.92, -3.48) -1.60 (-5.32, 2.12) -2.70 (-6.42, 1.02) - 1.60 (-2.12, 5.32) Nano-BA-Ex / 5-FU -9.30 (-13.02, -5.58) -8.80 (-12.52, -5.08) -3.20 (-6.92, 0.52) -4.300* (-8.02, -0.58) -1.60 (-5.32, 2.12) - ACF Mean Differences (95% CI) Placebo Nano carrier 5-FU BA-Ex Nano-BA-Ex Nano-BA-Ex / 5-FU Placebo - 1.00 (-3.90, 5.90) 12.10 (7.20, 17.00) 9.20 (4.30, 14.10) 17.60 (12.70, 22.50) 18.50 (13.60, 23.40) Nano carrier -1.00 (-5.90, 3.90) - 11.10 (6.20, 16.00) 8.20 (3.30, 13.10) 16.60 (11.70, 21.50) 17.50 (12.60, 22.40) 5-FU -12.10 (-17.00, -7.20) -11.10 (-16.00, -6.20) - -2.90 (-7.80, 2.00) 5.50 (0.60, 10.40) 6.40 (1.50, 11.30) BA-Ex -9.20 (-14.10, -4.30) -8.20 (-13.10, -3.30) 2.90 (-2.00, 7.80) - 8.40 (3.50, 13.30) 9.30 (4.40, 14.20) Nano-BA-Ex -17.60 (-22.50, -12.70) -16.60 (-21.50, -11.70) -5.50 (-10.40, -0.60) -8.40 (-13.30, -3.50) - 0.90 (-4.00, 5.80) Nano-BA-Ex / 5-FU -18.50 (-23.40, -13.60) -17.50 (-22.40, -12.60) -6.40 (-11.30, -1.50) -9.30 (-14.20, -4.40) -0.90 (-5.80, 4.00) - The statistically significant differences are shown in bold. CI: confidence interval. 2.4.2. Expression of mRNAs related to inflammation, survival, proliferation, invasion, and angiogenesis The mRNA expression levels of several proteins involved in tumor cell processes including Bcl2 , Cox2, CyclinD1, Mmp9, and Vegf were assessed using quantitative real-time polymerase chain reaction (qRT-PCR). Treatment with various formulations led to a minor alteration in gene expression in comparison to the placebo group. The differential fold-change values for each of these mRNAs between each group are presented in Table 2 . Table 2 Comparison of mRNA gene expression between each study groups against placebo. Bcl2 Fold-change Difference (95% CI) Placebo Nano carrier 5-FU BA-Ex Nano-BA-Ex Nano-BA-Ex / 5-FU Placebo - 1.25 (-5.63, 8.13) -2.35 (-9.23, 4.25) 1.00 (-5.88, 7.88) 1.13 (-5.75, 8.01) 1.27 (-6.16, 8.70) Nano carrier -1.25 (-8.13, 5.63) - -3.61 (-10.48, 3.27) -0.25 (-7.13, 6.63) -0.12 (-7.00, 6.76) 0.02 (-7.41, 7.45) 5-FU 2.35 (-4.52, 9.23) 3.61 (-3.27, 10.48) - 3.36 (-3.52,10.24) 3.48 (-3.40, 10.36) 3.63 (-3.80, 11.06) BA-Ex -1.00 (-7.88, 5.88) 3.61 (-3.27, 10.48) 3.36 (-3.52,10.24) - 3.48 (-3.40, 10.36) 3.63 (-3.80, 11.06) Nano-BA-Ex -1.13 (-8.01, 5.75) 0.12 (-6.76, 7.00) -3.48 (-10.36, 3.4) -0.13 (-7.00, 6.75) - 0.15 (-7.28, 7.58) Nano-BA-Ex / 5-FU -1.27 (-8.70, 6.16) -0.02 (-7.45, 7.41) -3.63 (-11.06, 3.80) -0.27 (-7.70, 7.16) -0.15 (-7.58, 7.28) - Cox2 Fold-change Difference (95% CI) Placebo Nano carrier 5-FU BA-Ex Nano-BA-Ex Nano-BA-Ex / 5-FU Placebo - -2.66 (-7.05, 1.74) -1.86 (-6.25, 2.54) -1.25 (-5.64, 3.15) 0.28 (-4.11, 4.67) 0.58 (-4.16, 5.33) Nano carrier 2.66 (-1.74, 7.05) - 0.80 (-3.59, 5.19) 1.41 (-2.98, 5.80) 2.94 (-1.46, 7.33) 3.24 (-1.50, 7.99) 5-FU 1.86 (-2.54, 6.25) -0.80 (-5.19, 3.59) - 0.61 (-3.78, 5.00) 2.14 (-2.26, 6.53) 2.44 (-2.30, 7.19) BA-Ex 1.25 (-3.15, 5.64) -1.41 (-5.80, 2.98) -0.61 (-5.00, 3.78) - 1.53 (-2.87, 5.92) 1.83 (-2.91, 6.58) Nano-BA-Ex -0.28 (-4.67, 4.11) -2.94 (-7.33, 1.46) -2.14 (-6.53, 2.26) -1.53 (-5.92, 2.87) - 0.31 (-4.44, 5.05) Nano-BA-Ex / 5-FU -0.58 (-5.39, 4.16) -3.24 (-7.99, 1.5) -2.44 (-7.19, 2.30) -1.83 (-6.58, 2.91) -0.31 (-5.05, 4.44) - CyclinD1 Fold-change Difference (95% CI) Placebo Nano carrier 5-FU BA-Ex Nano-BA-Ex Nano-BA-Ex / 5-FU Placebo - -3.99 (-7.88, -0.09) -1.04 (-4.94, 2.86) -3.76 (-7.66, 0.13) -1.00 (-4.89, 2.90) -0.28 (-4.49, 3.93) Nano carrier 3.99 (0.09, 7.88) - 2.95 (-0.95, 6.84) 0.22 (-3.67, 4.12) 2.99 (-0.91, 6.89) 3.70 (-0.51, 7.91) 5-FU 1.04 (-2.86, 4.94) -2.95 (-684, 0.95) - -2.72 (-6.62, 1.17) 0.04 (-3.85, 3.94) 0.76 (-3.45, 4.97) BA-Ex 3.76 (-0.13, 7.66) -0.22 (-4.12, 3.67) 2.72 (-1.17, 6.62) - 2.77 (-1.13, 6.66) 3.48 (-0.73, 7.69) Nano-BA-Ex 1.00 (-2.90, 4.89) -2.99 (-6.89, 0.91) -0.04 (-3.94, 3.85) -2.77 (-6.66, 1.13) - 0.71 (-3.50, 4.92) Nano-BA-Ex / 5-FU 0.28 (-3.93, 4.49) -3.70 (-7.91, 0.51) -0.76 (-4.97, 3.45) -3.48 (-769,0.73) -0.71 (-4.92, 3.50) - Mmp9 Fold-change Difference (95% CI) Placebo Nano carrier 5-FU BA-Ex Nano-BA-Ex Nano-BA-Ex / 5-FU Placebo - -9.65 (-30.97, 11.66) -2.15 (-23.46, 19.16) -7.40 (-28.71, 13.91) -14.02 (-35.33, 7.29) -2.01 (-26.17, 22.15) Nano carrier 9.65 (-11.66, 30.97) - 7.51 (-15.27, 30.29) 2.25 (-20.53, 25.04) -4.37 (-27.15, 18.42) 7.64 (-17.83, 33.11) 5-FU 2.15 (-19.16, 23.46) -7.51 (-30.29, 15.27) - -5.25 (-28.03, 17.53) -11.87 (-34.65, 10.91) 0.14 (-25.33, 25.61) BA-Ex 7.40 (-13.91, 28.71) -2.25 (-25.04, 20.53) 5.25 (-17.53, 28.03) - -6.62 (-29.40, 16.16) 5.39 (-20.08, 30.86) Nano-BA-Ex 14.02 (-7.29, 35.33) 4.37 (-18.42, 27.15) 11.87 (-10.91, 34.65) 6.62 (-16.16, 29.40) - 12.01 (-13.46, 37.48) Nano-BA-Ex / 5-FU 2.01 (-22.15, 26.17) -7.64 (-33.11, 17.83) -0.14 (-25.61, 25.33) -5.39 (-30.86, 20.08) -12.01 (-37.48, 13.46) - Vegf Fold-change Difference (95% CI) Placebo Nano carrier 5-FU BA-Ex Nano-BA-Ex Nano-BA-Ex / 5-FU Placebo - -3.30 (-7.33, 0.74) -0.62 (-4.65, 3.42) 1.39 (-2.64, 5.42) 0.85 (-3.19, 4.88) -0.22 (-4.58, 4.14) Nano carrier 3.30 (-0.74, 7.33) 2.68 (-1.36, 6.71) 4.69 (0.65–8.72) 4.14 (0.11, 8.17) 3.08 (-1.28, 7.43) 5-FU 0.62 (-3.42, 4.65) -2.68 (-6.71, 1.36) -- 2.01 (-2.02, 6.04) 1.46 (-2.57,5.50) 0.40 (-3.96, 4.76) BA-Ex -1.39 (-5.42, 2.64) -1.75 (-5.78, 2.28) -2.01 (-6.04, 2.02) - -0.55 (-4.58, 3.49) -1.61 (-5.97, 2.75) Nano-BA-Ex -0.85 (-4.88, 3.19) -4.14 (-8.17, -0.11) -1.46 (-5-50, 2.57) 0.55 (-3.49, 4.58) - -1.06 (-5.42, 3.29) Nano-BA-Ex / 5-FU 0.22 (-4.14, 4.58) -3.08 (-7.43, 1.28) -0.40 (-4.76, 3.96) 1.61 (-2.75, 5.97) -3.29, 5.42) - The statistically significant differences are shown in bold. CI: confidence intervals. 3. Discussion This study aimed to utilize CS-SA-CaCl 2 nanoparticles as a delivery system for BA derivatives and to evaluate their anti-proliferative activity against cancer cells. The AKBA extraction from B. serrata gum resin using the TPP method followed by column chromatography was successful as confirmed by HPLC with an extraction efficiency of 12.64%. The preparation of pH-sensitive nano-BA-Ex using sodium alginate and chitosan with dual cross-linking via ionic pregelation and polyelectrolyte complexation resulted in approximately 100 nm-sized nanocapsules with a loading capacity of 6.9% and encapsulation efficiency of 75.16%. Previous studies have extensively investigated the cytotoxic effect of AKBA on various colorectal cancer cell lines in vitro ( 20 – 22 ). However, the in vitro results of the present study revealed that nano-BA-Ex exhibited superior cytotoxicity against HT29 cells compared to BA-Ex, free AKBA, and 5-FU, even at one-tenth the concentration. It suggests that the nano-delivery system enhances the bioavailability and therapeutic efficacy of BA derivatives. In addition, nano-BA-Ex induced apoptosis in HT29 cells more effectively than the other treatments as evidenced by Annexin V staining and cell cycle phase analysis. These results suggest that nano-BA-Ex not only inhibits cell growth but also promotes apoptosis, which is a favorable outcome in cancer therapy. Limited research has been conducted on the anticancer effects of nano forms of AKBA. One study evaluated the effects of BAs and their nanoparticles on the proliferation of human hepatoma HepG2 cells. Two different preparation techniques were used: nanoprecipitation and an oil-in-water emulsion/solvent evaporation method. The particles prepared via nanoprecipitation exhibited significantly higher cytotoxicity ( 23 ). Additionally, other structural modifications, such as replacing the acetoxy group with a beta-amino group, introducing an electron-withdrawing group at C-2, or adding a nitrogen-containing substitution in the A-ring, can improve the anticancer effects of AKBA and KBA ( 24 – 27 ). In a recent study, 26 new derivatives of AKBA were synthesized using ethylenediamine as the linking chain on the carboxyl group. The derivatives that targeted mitochondria demonstrated the most effective antiproliferative action, up to 20 times stronger than AKBA ( 28 ). Additionally, Shamraiz et al. synthesized heterocyclic derivatives of BAs and new monomers of AKBA and KBA, as well as bis-AKBA and KBA homodimers, and AKBA-KBA heterodimers ( 29 ). The antiproliferative effects of these dimers were evaluated on several human cancer cell lines, including HT29. The study found that the homodimer of KBA was the most effective, followed by pyrazine derivatives of AKBA, monomers of AKBA, KBA, and homodimers of AKBA. Additionally, a formulation of KBA nanoparticles (KBA-NPs) was designed using the emulsion-diffusion-evaporation method based on poly-DL-lactide-co-glycolide in a separate study. The study evaluated the oral bioavailability and anti-inflammatory effects of KBA and KBA-NPs in the rat paw edema model. The results indicated that KBA-NPs had a 7-fold increase in bioavailability and a 1.7-fold increase in anti-inflammatory activity compared to KBA alone ( 30 ). A self-nanoemulsifying drug delivery system (SNES) has been developed to enhance the oral bioavailability of B. serrata extract ( 31 ). SNES forms emulsions composed of isotropic mixtures of oil, surfactant, and/or co-surfactant with droplet sizes less than 200 nm. These emulsions are effective for oral delivery of bioactive compounds. Both KBA and AKBA exhibited a more than two-fold increase in aqueous solubility and bioaccessibility. In addition, pharmacokinetic evaluations demonstrated that SNES significantly improved the oral bioavailability of KBA and AKBA in mice, resulting in more than twice the bioavailability of the bulk oil solution. The In vivo investigation of the present study showed that nano-BA-Ex inhibited colon tumorigenesis induced by DMH in mice and significantly reduced the number of aberrant crypt foci (ACFs). Molecular studies showed that nano-BA-Ex had a small effect on the expression of several proteins, including Bcl-2 , a marker of tumor survival; COX-2 , a mediator of inflammation; cyclin D1 , associated with cell proliferation; MMP-9 , a protein involved in invasion processes; and VEGF , a protein associated with angiogenesis. However, this effect was not statistically significant. In a previous study, V.R. Yadav et al. reported that AKBA significantly suppressed the expression of several biomarkers in orthotopically implanted CRC tumors in mice. These biomarkers included pro-inflammatory COX2 , tumor survival markers bcl-2 , bcl-xL , IAP-1 and survivin, proliferative cyclin D1 , invasive MMP-9 and ICAM-1 , and angiogenic VEGF and CXCR4 ( 32 ). Later that year, this was confirmed by H. Liu et al. in the adenomatous polyposis coli multiple intestinal neoplasia (APC Min/+ ) mice ( 33 ). The study found that AKBA reduced over 60% of colon polyps and prevented their malignant progression. The chemo-preventive effect of AKBA is attributed to its multifaceted activities, which include antiproliferative, apoptosis-inducing, antiangiogenic, and anti-inflammatory effects achieved through the Wnt/β-catenin and NF-κB/cyclooxygenase-2 pathways inhibition. Nanoformulations and their size can significantly influence gene expression, which may be relevant to therapeutic outcomes. A study demonstrated that a novel pH-responsive hesperidin nanoformulation exhibited anticancer effects on lung adenocarcinoma cells by targeting the Akt/mTOR and MEK/ERK pathways. This nanoformulation decreased the expression of signaling proteins and enhanced the expression of apoptotic markers by upregulating Bax and p53 genes and downregulating the anti-apoptotic gene Bcl-2 ( 34 ). Additionally, research indicated that Ag nanoparticles impacted the viability of MCF-7 and Vero cell lines and altered the expression of apoptotic genes. These nanoparticles selectively induced apoptosis and upregulated tumor suppressor genes ( 35 ). 4. Conclusions This study introduces CS-SA-CaCl2 nanoparticles as a novel delivery system for AKBA with potential anticancer properties. By addressing the limitations of conventional chemotherapy, the research lays the foundation for an effective drug delivery system that enhances the therapeutic efficacy of these derivatives. However, further research is necessary to optimize its formulation, safety, and efficacy, highlighting nano-BA-Ex's potential for future preclinical and clinical evaluation in CRC therapy. 5. Methods 5.1. Materials The gum resin of Boswellia serrata was acquired from a local market in our region. The pure reference standard of AKBA was purchased from Wuhan ChemFaces Biochemical, China (Cat. No. CFN90531). Analytical grade N, N′-Dimethylhydrazine dihydrochloride (DMH), as well as all other chemicals, were purchased from Merck Chemicals located in Darmstadt, Germany. The HPLC-grade solvents were obtained from Dae-Jung, Korea. 5.2. Extraction and Purification of B. serrata Gum Resin AKBA was extracted from the gum resin of B. serrata using the TPP method, as previously described ( 36 ), followed by column chromatographic purification. Briefly, the gum resin of B. serrata was ground in a mill and one gram of sifted powder was soaked in 20 mL of distilled water and stirred gently. Next, ammonium sulfate, at a concentration of 40% (w/v), was added, and the pH was adjusted to 6.0. Twenty milliliters of tert-butyl alcohol (t-butanol) were then added to the mixture prepared at 50°C for 180 minutes. The centrifugation process was performed at 8000g for 20 minutes, resulting in the formation of three layers. A two mL sample was then slowly taken from the upper organic phase, and the concentrated extract was dried in a ventilated oven at 55ºC. The resulting extract was stored as a powder until further analysis. To achieve greater extraction efficiency, the extraction product underwent column chromatography purification. The powder was suspended in methanol and then fractionated through column chromatography on silica gel. The column was eluted using a combination of hexane, chloroform, and methanol (1:1:0.2, v/v) as the elution solvent. Fractions containing AKBA were collected and analyzed using thin-layer chromatography (TLC), while extraction efficiency was assessed through the use of high-performance liquid chromatography (HPLC). The extraction efficiency was evaluated with HPLC (Knauer, Germany) using a C18 column (4.6 × 250 mm, Waters). To measure the amount of AKBA in the resulting extract, 0.001 g of the extract was weighed, dissolved in one ml of methanol (1000 ppm), and subsequently filtered through an HPLC filter (0.45 µm). The resulting extract was then injected into the HPLC machine in a final volume of 20 µl. The mobile phase consisted of methanol, acetonitrile, acidified water, and orthophosphoric acid in a ratio of 55: 40:4.5: 0.5% (v/v) adjusted to pH = 4 with glacial acetic acid, and was used at a flow rate of 1 mL/min. Analysis was conducted via ultraviolet detection at 260 nm, with all experiments repeated thrice. 5.3. Preparation of pH-Sensitive BA-Extract-loaded nanocapsules: (Nano-BA-Ex) BA-Ex-loaded dual-crosslinking nanocapsules were synthesized via the ionic pregelation and polyelectrolyte complexation method using two natural macromolecules, sodium alginate, and chitosan. The procedure was modified from the method outlined by Choukaife et al ( 12 ). First, 100 ml of 0.06% sodium alginate was prepared with deionized water under mechanical stirring for half an hour, following which the pH was adjusted to 4.9. Then, one mL of methanol containing 25 mg of BA-Ex powder was added to the mixture. After stirring for 30 minutes, 20 mL of 0.067% calcium chloride was sprayed into the above and further stirred for 30 minutes to form calcium alginate nanoparticles. Then, 15 mL of 0.005% low molecular weight chitosan (pH adjusted to 4.6) was sprayed into the mixture under continuous stirring for an additional 30 minutes to form double cross-linked particles. The final homogeneous suspension was dried under a vacuum at 50°C. The loading capacity and encapsulation efficiency of nano-BA-Ex were determined using Equations (1) and (2) ( 37 ): Loading Capacity% = (W total BA−Ex added – W free non−entrapped BA−Ex /W total nano−BA−Ex ) ×100 ( 1 ) Encapsulation Efficiency% = (W loaded BA−Ex /W total BA−Ex added ) ×100 ( 2 ) 5.4. Nano-BA-Ex Characterization The nanocapsules loaded with BA-Ex were characterized based on their zeta potential and average size. The average size was determined via DLS, and the PDI was also measured. The zeta potential was obtained by analyzing the electrophoretic mobility of the nanocapsules in an aqueous suspension, using a Zetasizer model NANO-flex 180 DLS from Particle Metrix (Germany). Nanocapsules were observed utilizing a Scanning Electron Microscope (FESEM; ZEISS Sigma model Sigma VP, Germany). The FTIR spectra of the BA-Ex, nanocarrier, and BA-Ex-loaded nanocapsules were acquired using the Nicolet Avatar 360 FTIR System (Thermo, USA) with a scanning range of 4000–400 cm − 1. 5.5. In Vitro Analysis 5.5.1. Cell lines, Growth Medium & Treatment Conditions Human normal primary fibroblasts were obtained from the circumcision site, and the HT29 colon cancer cell line was acquired from the Pasteur Institute of Iran. Fetal bovine serum (FBS), DMEM, and RPMI-1640 medium were purchased from BioIdea (Tehran, Iran). Annexin V, propidium iodide (PI) labeling kit, and MTT cell proliferation reagent, 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide, were purchased from Roche Diagnostics (Mannheim, Germany). Human normal primary fibroblasts and HT29 cells were cultured in DMEM and RPMI-1640 medium, supplemented with 10% FBS, respectively, and maintained at 37ºC in a 5% CO 2 incubator. For treatment, cells were harvested using 0.05% trypsin/0.02% EDTA when they reached approximately 80% confluence and were sub-cultured in the corresponding medium. After overnight incubation for attachment, cells were treated with different concentrations of 5-FU, standard AKBA, BA-Ex, and nano-BA-Ex. The medium containing 5% DMSO was used as a control. 5.5.2. Cell proliferation assay (MTT) Cell viability was assessed using the MTT assay, which quantifies the reduction of tetrazolium salt to formazan by viable cells ( 38 ). The cells were seeded in 96-well plates at a density of 10 5 cells per well with 200 µl of medium. After the cells reached the desired confluency, the media was removed and cells were incubated with different concentrations of each treatment for 48 hours. Cells were then incubated with 50 µL of 0.5 mg/mL MTT for 3 hours at 37°C. The intracellular formazan crystals were dissolved in 150 µL of dimethyl sulfoxide, and the resulting solution was subjected to spectrophotometric analysis at 570 nm to determine the optical density. By comparing the absorbance of treated and untreated cells, the percentage of dissolved colored formazan products was calculated. Triplicate assays were performed, and each experiment was repeated three times for accuracy. 5.5.3. Flow-cytometric Determination of Apoptosis 5.5.3.1. Annexin V staining The apoptosis assay was performed utilizing annexin V and PI staining. In summary, cells were treated with each test compound for 48 hours, washed with cold PBS, and stained with Annexin V-FITC antibody and PI for 15 minutes at room temperature. Subsequently, the cells were assessed by flow cytometry, and fluorescence intensity was measured in the FITC and PI channels. The proportions of the cell population in different quadrants were analyzed with quadrant statistics. 5.5.3.2. Cell cycle phase analysis Cell cycle analyses were performed by sorting different cell fractions using flow cytometry. Cells were treated with different test compounds, including 5-FU, AKBA, BA-Ex, and nano-BA-Ex, for 48 hours. After trypsinization, the cells were suspended in ice-cold 70% ethanol in PBS and stored at -20ºC until analysis. Then, the cells were fixed and incubated with RNase A (100 mg/mL) for 30 minutes at 37ºC, followed by staining with PI (50 mg/mL) in the dark on ice for another 30 minutes. Nuclear DNA content was quantified with a BD-LSR flow cytometer (Becton Dickinson, USA) equipped with electronic doublet discrimination using blue (488 nm) excitation from an Argon laser. Cell cycle phase distribution was analyzed using Flowjo software. The fluorescence intensity of the sub-G1 cell fraction indicated the population of apoptotic cells. 5.6. In Vivo Analysis 5.6.1. Animals and conditions Male BALB/c mice aged 6–8 weeks were purchased from the Pasteur Institute of Iran and kept under standard conditions in animal care facilities. Five mice per cage were housed with unlimited access to food and water under constant environmental conditions, including equal periods of light and dark, at 20–22°C with 60–70% relative humidity, for 7 days prior to the start of the experiment. All animal experiments were performed according to ARRIVE 2.0 guidelines ( 39 ). 5.6.2. Cancer Induction Cancer was induced by administering weekly intraperitoneal injections of 20 mg/Kg N, N'-dimethylhydrazine dihydrochloride (DMH) ( 40 ). After 15 weeks of weekly DMH injections, the mice were randomly assigned to different treatments (Table 3 ). Each treatment was administered for 8 weeks with weekly weighing and daily monitoring of disease symptoms. At week 24, all mice were intraperitoneally anesthetized using a combination of ketamine-xylazine (K, 75 mg/Kg; X, 25 mg/Kg), and blood was collected by cardiac puncture. Animals were then sacrificed, and colon tissues were removed. The colon of each mouse was collected, washed, and dissected to assess both macroscopic and microscopic inflammatory and neoplastic lesions. After macroscopic evaluation, the colons were divided. One part was fixed in 10% buffered formalin, embedded in paraffin, and subjected to H&E staining for further histopathological examination. The second was preserved in RNA Later at -80°C for molecular analysis. Table 3 Different treatment for each group of mice Groups Treatment condition 1 Healthy Control weekly IP normal saline for 15 weeks / Normal saline gavage weekly for weeks 16 to 23 2 Placebo DMH** (20mg/Kg, I.P.) weekly for 15 weeks / Normal Saline Gavage Placebo for weeks 16 to 23 3 Nano carrier DMH (20mg/Kg, I.P.) weekly for 15 weeks /Blank Nano Carrier for weeks 16 to 23 4 5-FU DMH (20mg/Kg, I.P.) weekly for 15 weeks /25 mg/Kg 5-FU for weeks 16 to 23 5 BA-Ex DMH (20mg/Kg, I.P.) weekly for 15 weeks / 100 mg/Kg BA-Ex for weeks 16 to 23 6 Nano-BA-Ex DMH (20mg/Kg, I.P.) weekly for 15 weeks / 100 mg/Kg Nano-BA-Ex for weeks 16 to 23 7 Nano-BA-Ex / 5-FU DMH (20mg/Kg, I.P.) weekly for 15 weeks /100 mg/Kg Nano-BA-Ex + 25 mg/Kg 5-FU for weeks 16 to 23 * N, N′-Dimethylhydrazine dihydrochloride 5.6.3. Histopathology Colon tissues were soaked in 10% formalin buffer as described. They were then washed with normal saline, fixed, dehydrated, and embedded in paraffin. Blocks were cooled, and 5µm sections were stained with H&E, then examined using an Olympus CX23 light microscope (Japan). The mitotic index, necrosis, and ACF were recorded for each sample and expressed as the mean ± SD per sample. 5.6.4. RNA extraction, complementary DNA synthesis, and quantitative real-time polymerase chain reaction (qRT-PCR) The mRNA expression levels of several proteins involved in tumor cell processes, including Cox-2 (related to inflammation), cyclin D1 (associated with proliferation), Mmp-9 (involved in invasion), Vegf (related to angiogenesis), and Bcl-2 (associated with apoptosis), were evaluated utilizing qRT-PCR after treatment with various formulas. Molecular transcript levels were quantified to estimate mRNA synthesis by calculating the fold change relative to the control. RNA was extracted from 20 mg of each colon tissue sample using the Parstous Total RNA Extraction Kit (Mashhad, Iran). Two-step reverse transcription-PCR was then conducted using first-strand complementary DNA, produced with the cDNA Synthesis Kit from Tehran, Iran. The final reaction volume was 20 µL and included a 1X concentration of SyberGreen gene expression assay in RealQ Plus 2X Master Mix Green without ROX (Stenhuggervej, Denmark). To serve as a negative control, RNAse-free water was used in each run. Specific thermal cycler conditions were applied using a StepOne™ Real-Time PCR system. Primer sequences are displayed in Table 4 . Table 4 Primer sequences for qPCR Bcl2 Forward TGGATGACTGAGTACCTGAACC Reverse ACAGCCAGGAGAAATCAAACA Cyclin d1 Forward CTACCGCACAACGCACTTTCT Reverse GGAGGGGGTCCTTGTTTAGCC Eef2 (Housekeeping gene) Forward CTTCCCTGTTCACCTCTGACTCTG Reverse TGATGGCACGGATCTGATCTACTG MMP9 Forward CGACATAGACGGCATCCAGTATC Reverse TGGGAGGTATAGTGGGACACATAG VEGF Forward CACCCACGACAGAAGGAGAG Reverse CACCAGGGTCTCAATCGGAC Cox2 Forward CAGCACTTCACCCATCAGTTT Reverse CGCAGTTTATGTTGTCTGTCCA 5.7. Statistical Analysis Statistical analysis was performed using the SPSS software 23 (SPSS, Inc., Chicago, Illinois) and GraphPad Prism 8 (GraphPad Software). Data were expressed as mean ± standard deviation (SD). A one-way ANOVA was used to make comparisons between groups, followed by Tukey's multiple comparison tests. The level of statistical significance was set at a p-value below 0.05 (two-tailed). Abbreviations ABA 3-O-acetyl-α- and β-boswellic acid AKBA 3-O-acetyl-11-keto-β-boswellic acid 5-FU 5-Fluorouracil ACF aberrant crypt foci APC Min/+ adenomatous polyposis coli multiple intestinal neoplasia BA α- and β-boswellic acid BA-Ex AKBA-containing fractions of BA extract CaCl2 Calcium chloride CRC Colorectal cancer CS chitosan DLS dynamic light scattering DMH N, N'-dimethylhydrazine dihydrochloride FTIR Fourier transform infrared HPLC high-performance liquid chromatography KBA 11-keto-β-boswellic acid PDI polydispersity index qRT-PCR quantitative real-time polymerase chain reaction SA sodium alginate SNES self-nanoemulsifying drug delivery system TPP three-phase partitioning Declarations Ethics approval and consent to participate Babol University of Medical Sciences' Research Ethics Committees approved and reviewed the experimental protocol with the approval ID IR.MUBABOL.REC.1400.264. Consent for publication Not applicable Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. Competing interests The authors declare that they have no competing interests Funding The present work was supported by Babol University of Medical Sciences, the Iran National Science Foundation (INSF), and Biotechnology Development Council of the Islamic Republic of Iran. Authors' contributions AM, SK, AA, and HP and designed this study. AA carried out the extraction, nanoformulation, in vitro and in vivo experiments. AD supervised the molecular experiments. MS supervised the statistical analysis. AA prepared the original draft. All authors validated the data and read and approved the final manuscript. Correspondence should be addressed to AM and HP. AA: Atiyeh Ale-Ahmad SK: Sohrab Kazemi AD: Abdolreza Daraei MS: Mahdi Sepidarkish AM: Ali Akbar Moghadamnia HP: Hadi Parsian Acknowledgements The authors would like to thank Dr. Mohammad Hosseini for his excellent support and assistance in histopathological examination. References Dekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. Lancet. 2019;394(10207):1467-80. Rejhová A, Opattová A, Čumová A, Slíva D, Vodička P. Natural compounds and combination therapy in colorectal cancer treatment. European journal of medicinal chemistry. 2018;144:582-94. Pérez-Herrero E, Fernández-Medarde A. Advanced targeted therapies in cancer: Drug nanocarriers, the future of chemotherapy. European journal of pharmaceutics and biopharmaceutics. 2015;93:52-79. Naeem M, Awan UA, Subhan F, Cao J, Hlaing SP, Lee J, et al. Advances in colon-targeted nano-drug delivery systems: challenges and solutions. Archives of pharmacal research. 2020;43:153-69. Patra JK, Das G, Fraceto LF, Campos EVR, Rodriguez-Torres MdP, Acosta-Torres LS, et al. Nano based drug delivery systems: recent developments and future prospects. Journal of nanobiotechnology. 2018;16(1):1-33. Adepu S, Ramakrishna S. Controlled drug delivery systems: current status and future directions. Molecules. 2021;26(19):5905. Li Z, Tan S, Li S, Shen Q, Wang K. Cancer drug delivery in the nano era: An overview and perspectives. Oncology reports. 2017;38(2):611-24. Efferth T, Oesch F, editors. Anti-inflammatory and anti-cancer activities of frankincense: Targets, treatments and toxicities. Seminars in cancer biology; 2022: Elsevier. Roy NK, Deka A, Bordoloi D, Mishra S, Kumar AP, Sethi G, Kunnumakkara AB. The potential role of boswellic acids in cancer prevention and treatment. Cancer Letters. 2016;377(1):74-86. Hussain H, Al-Harrasi A, Csuk R, Shamraiz U, Green IR, Ahmed I, et al. Therapeutic potential of boswellic acids: a patent review (1990-2015). Expert Opinion on Therapeutic Patents. 2017;27(1):81-90. Abdel-Tawab M, Werz O, Schubert-Zsilavecz M. Boswellia serrata: an overall assessment of in vitro, preclinical, pharmacokinetic and clinical data. Clinical pharmacokinetics. 2011;50:349-69. Choukaife H, Doolaanea AA, Alfatama M. Alginate Nanoformulation: Influence of Process and Selected Variables. Pharmaceuticals. 2020;13(11):335. Fathi M, Majidi S, Zangabad PS, Barar J, Erfan‐Niya H, Omidi Y. Chitosan‐based multifunctional nanomedicines and theranostics for targeted therapy of cancer. Medicinal research reviews. 2018;38(6):2110-36. Wang W, Meng Q, Li Q, Liu J, Zhou M, Jin Z, Zhao K. Chitosan derivatives and their application in biomedicine. International journal of molecular sciences. 2020;21(2):487. Takka S, Gürel A. Evaluation of chitosan/alginate beads using experimental design: formulation and in vitro characterization. Aaps Pharmscitech. 2010;11:460-6. Khan M, Shah LA, Khan MA, Khattak NS, Zhao H. Synthesis of an un-modified gum arabic and acrylic acid based physically cross-linked hydrogels with high mechanical, self-sustainable and self-healable performance. Materials Science and Engineering: C. 2020;116:111278. Szekalska M, Sosnowska K, Czajkowska-Kośnik A, Winnicka K. Calcium chloride modified alginate microparticles formulated by the spray drying process: A strategy to prolong the release of freely soluble drugs. Materials. 2018;11(9):1522. Wang T, Fleming E, Luo Y. An overview of the biochemistry, synthesis, modification, and evaluation of mucoadhesive polymeric nanoparticles for oral delivery of bioactive compounds. Advanced Composites and Hybrid Materials. 2023;6(1):6. Kiti K, Suwantong O. Bilayer wound dressing based on sodium alginate incorporated with curcumin-β-cyclodextrin inclusion complex/chitosan hydrogel. International Journal of Biological Macromolecules. 2020;164:4113-24. Liu JJ, Huang B, Hooi SC. Acetyl‐keto‐β‐boswellic acid inhibits cellular proliferation through a p21‐dependent pathway in colon cancer cells. British journal of pharmacology. 2006;148(8):1099-107. Takahashi M, Sung B, Shen Y, Hur K, Link A, Boland CR, et al. Boswellic acid exerts antitumor effects in colorectal cancer cells by modulating expression of the let-7 and miR-200 microRNA family. Carcinogenesis. 2012;33(12):2441-9. Shen Y, Takahashi M, Byun H-M, Link A, Sharma N, Balaguer F, et al. Boswellic acid induces epigenetic alterations by modulating DNA methylation in colorectal cancer cells. Cancer biology & therapy. 2012;13(7):542-52. Elnawasany S, Haggag YA, Shalaby SM, Soliman NA, El Saadany AA, Ibrahim MA, Badria F. Anti-cancer effect of nano-encapsulated boswellic acids, curcumin and naringenin against HepG-2 cell line. BMC Complementary Medicine and Therapies. 2023;23(1):270. Li T, Fan P, Ye Y, Luo Q, Lou H. Ring A-modified Derivatives from the Natural Triterpene 3-O-acetyl-11-keto-β-Boswellic Acid and their Cytotoxic Activity. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents). 2017;17(8):1153-67. Csuk R, Niesen-Barthel A, Schäfer R, Barthel A, Al-Harrasi A. Synthesis and antitumor activity of ring A modified 11-keto-β-boswellic acid derivatives. European Journal of Medicinal Chemistry. 2015;92:700-11. Li K, Li L, Wang S, Li X, Ma T, Liu D, et al. Design and synthesis of novel 2-substituted 11-keto-boswellic acid heterocyclic derivatives as anti-prostate cancer agents with Pin1 inhibition ability. European Journal of Medicinal Chemistry. 2017;126:910-9. Huang M, Li A, Zhao F, Xie X, Li K, Jing Y, et al. Design, synthesis and biological evaluation of ring A modified 11-keto-boswellic acid derivatives as Pin1 inhibitors with remarkable anti-prostate cancer activity. Bioorganic & Medicinal Chemistry Letters. 2018;28(19):3187-93. Li C, He Q, Xu Y, Lou H, Fan P. Synthesis of 3-O-acetyl-11-keto-β-boswellic acid (AKBA)-derived amides and their mitochondria-targeted antitumor activities. ACS omega. 2022;7(11):9853-66. Shamraiz U, Hussain H, Ur Rehman N, Al-Shidhani S, Saeed A, Khan HY, et al. Synthesis of new boswellic acid derivatives as potential antiproliferative agents. Natural product research. 2020;34(13):1845-52. Bairwa K, Jachak SM. Nanoparticle formulation of 11-keto-β-boswellic acid (KBA): Anti-inflammatory activity and in vivo pharmacokinetics. Pharmaceutical Biology. 2016;54(12):2909-16. Ting Y, Jiang Y, Zhao S, Li CC, Nibber T, Huang Q. Self-nanoemulsifying system (SNES) enhanced oral bioavailability of boswellic acids. Journal of Functional Foods. 2018;40:520-6. Yadav VR, Prasad S, Sung B, Gelovani JG, Guha S, Krishnan S, Aggarwal BB. Boswellic acid inhibits growth and metastasis of human colorectal cancer in orthotopic mouse model by downregulating inflammatory, proliferative, invasive and angiogenic biomarkers. International journal of cancer. 2012;130(9):2176-84. Liu HP, Gao ZH, Cui SX, Wang Y, Li BY, Lou HX, Qu XJ. Chemoprevention of intestinal adenomatous polyposis by acetyl‐11‐keto‐beta‐boswellic acid in APCMin/+ mice. International journal of cancer. 2013;132(11):2667-81. Pavan S, Prabhu A. Novel pH responsive hesperidin nanoformulation exerts anticancer activity on lung adenocarcinoma cells by targeting Akt/mTOR and MEK/ERK pathways. Journal of Materials Research. 2024:1-15. Sangour MH, Ali IM, Atwan ZW, Al Ali AAALA. Effect of Ag nanoparticles on viability of MCF-7 and Vero cell lines and gene expression of apoptotic genes. Egyptian Journal of Medical Human Genetics. 2021;22:1-11. Niphadkar S, Bokhale N, Rathod V. Extraction of acetyl 11-keto-β-boswellic acid (AKBA) from Boswellia serrata plant oleo gum resin using novel three phase partitioning (TPP) technique. Journal of applied research on medicinal and aromatic plants. 2017;7:41-7. Massella D, Celasco E, Salaün F, Ferri A, Barresi AA. Overcoming the limits of flash nanoprecipitation: Effective loading of hydrophilic drug into polymeric nanoparticles with controlled structure. Polymers. 2018;10(10):1092. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of immunological methods. 1983;65(1-2):55-63. Du Sert NP, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, et al. Reporting animal research: Explanation and elaboration for the ARRIVE guidelines 2.0. PLoS biology. 2020;18(7):e3000411. Abe A, Fukui H, Fujii S, Kono T, Mukawa K, Yoshitake N, et al. Role of Necl‐5 in the pathophysiology of colorectal lesions induced by dimethylhydrazine and/or dextran sodium sulphate. The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland. 2009;217(1):42-53. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4289336","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":293549170,"identity":"3c77a4ab-e4a5-4f72-ac66-976a0ac9b90a","order_by":0,"name":"Atiyeh Ale-Ahmad","email":"","orcid":"","institution":"Student Research committee, Health Research Institute, Babol University of Medical Sciences, Babol","correspondingAuthor":false,"prefix":"","firstName":"Atiyeh","middleName":"","lastName":"Ale-Ahmad","suffix":""},{"id":293549172,"identity":"03bf979d-ea6d-430d-848d-c12ea6346268","order_by":1,"name":"Sohrab Kazemi","email":"","orcid":"","institution":"Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol","correspondingAuthor":false,"prefix":"","firstName":"Sohrab","middleName":"","lastName":"Kazemi","suffix":""},{"id":293549173,"identity":"a80324a0-b611-4f13-895d-01ef3bce7984","order_by":2,"name":"Abdolreza Daraei","email":"","orcid":"","institution":"Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol","correspondingAuthor":false,"prefix":"","firstName":"Abdolreza","middleName":"","lastName":"Daraei","suffix":""},{"id":293549174,"identity":"c4f410e1-1101-400b-985c-2945f902a8db","order_by":3,"name":"Mahdi Sepidarkish","email":"","orcid":"","institution":"Department of Biostatistics and Epidemiology, School of Public Health, Babol University of Medical Sciences, Babol","correspondingAuthor":false,"prefix":"","firstName":"Mahdi","middleName":"","lastName":"Sepidarkish","suffix":""},{"id":293549175,"identity":"49983e37-3f87-41f2-b834-bf41cc3aa661","order_by":4,"name":"Ali Akbar Moghadamnia","email":"","orcid":"","institution":"Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol","correspondingAuthor":false,"prefix":"","firstName":"Ali","middleName":"Akbar","lastName":"Moghadamnia","suffix":""},{"id":293549176,"identity":"d8e50b26-6789-4588-8094-7b9076299d09","order_by":5,"name":"Hadi Parsian","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIiWNgGAWjYBACAyA6AGKwMTAwPmBgOECaFmYDorXA2GwSRGkxZz+88XBBzT17Pvazx6p5au7I8TMwP3x0A48Wy560gsMzjhUntvHkpd3mOfbMWLKBzdg4B5/DDuQYHOZhS0hgY8gxu83DdjhxwwEeNmm8Ws6/AWr5l2DPxv/GrJjnHzFabgBt4W1LYGyTyDFj5m0jSsuzgsMz+xIS2yTeGEvO7TtsLNlMyC/nkzd/LviWYC/fn2P44c23w3L87M0PH+PTAgLMMAYTDwqXGC2MP4hQPQpGwSgYBSMPAACQqU4dL8/5FgAAAABJRU5ErkJggg==","orcid":"","institution":"Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol","correspondingAuthor":true,"prefix":"","firstName":"Hadi","middleName":"","lastName":"Parsian","suffix":""}],"badges":[],"createdAt":"2024-04-18 18:01:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4289336/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4289336/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55404287,"identity":"eca67529-8895-4b2f-a4c5-390a8cdb7727","added_by":"auto","created_at":"2024-04-26 20:19:26","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":24951,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative chromatograms of AKBA standard (in green color), BA-Ex (in blue color), and Nano-BA-Ex (in black color).\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4289336/v1/dd0e615d7d9278c467aaca04.jpg"},{"id":55404291,"identity":"fec8f93a-67e9-48e4-954b-1bcb2d7dbd73","added_by":"auto","created_at":"2024-04-26 20:19:27","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":75098,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of BA-Ex loaded nanocapsules: A) FE-SEM micrographs of nano-BA-Ex, magnification: 30 KX; B) DLS: Particle size (Mean): 104.5± 9.2; C) Zeta Potential (Mean): -37.7 mV, Electrophoretic Mobility (Mean): -0.000292 cm2/Vs; D) Fourier transform infrared (FTIR) spectra of BA-Ex (black), Nano-Carrier (red), and Nano-BA-Ex (Blue)\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4289336/v1/28c8b8d31ba0f1ea9d08e0d2.jpg"},{"id":55404770,"identity":"4ec1cf9f-b175-4280-9f57-442771a711c1","added_by":"auto","created_at":"2024-04-26 20:27:27","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":61798,"visible":true,"origin":"","legend":"\u003cp\u003eRelative cell viability of HT29 (solid colors) \u0026nbsp;and fibroblast cells (shaded colors) after treatment with 5-FU (15, 30, and 60 µM), AKBA (50, 100, and 150 µM), BA-Ex (50, 100, and 150 µM), nano-BA-Ex (5, 10, and 20 µM), and nano-carrier (5, 10, and 20 µM) after 48 hours.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4289336/v1/35dc92942ee6aecab77bb4fa.jpg"},{"id":55404290,"identity":"059f1adc-32d7-4a04-81af-e2af2d7660cb","added_by":"auto","created_at":"2024-04-26 20:19:27","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":72783,"visible":true,"origin":"","legend":"\u003cp\u003eA) Flow Cytometry scatter plots of each treatment on HT29 cells, B) Column chart of early and late apoptotic rate in each compound treatment.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4289336/v1/f3dc23a43f9ec9c9eb5bfb45.jpg"},{"id":55404289,"identity":"6e4371c2-f455-4f86-aba0-bfd0464b298d","added_by":"auto","created_at":"2024-04-26 20:19:27","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":50599,"visible":true,"origin":"","legend":"\u003cp\u003eA) Representative histograms of cell cycle distribution, B) Column chart of Sub-G1 cell fraction in each compound treatment.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4289336/v1/3d685da9e0b8165db906a7b9.jpg"},{"id":55404292,"identity":"4ee64116-8fc9-4849-8d5c-a2d96bd262b8","added_by":"auto","created_at":"2024-04-26 20:19:27","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":128080,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of colon tissue indices of the different groups. Normal tissue presents in the control group. Aberrant crypt foci (ACF) with dysplasia are shown with the down arrow. The epithelium displays nuclear stratification with rounded nuclei. There is a marked depletion of goblet cells in the dysplastic crypts. Mitosis (right arrow) was observed in DMH and therapeutic groups. Magnification 40×, H\u0026amp;E stain.\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4289336/v1/6b1c5fbed753e3dd8980c9f7.jpg"},{"id":55613376,"identity":"4fec392f-3f42-42a9-bd4b-2555f6bbc463","added_by":"auto","created_at":"2024-04-30 14:47:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1737470,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4289336/v1/83a8b1ec-3a9d-4abd-b18f-7b5bc6770856.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"pH-sensitive Nanoformulation of Acetyl-11-Keto-beta-Boswellic Acid (AKBA) as a Potential Antiproliferative Agent in Colon Carcinogenesis (In Vitro and In Vivo)","fulltext":[{"header":"1. Background","content":"\u003cp\u003eColorectal cancer (CRC) is the second most commonly diagnosed cancer in women and the third most commonly diagnosed cancer in men, accounting for approximately 10% of all cancer diagnoses annually and associated mortality (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Despite advances in treatment modalities such as surgery, chemotherapy, and radiotherapy, CRC management faces significant challenges, including late diagnosis and limited treatment efficacy, resulting in unfavorable outcomes such as toxicity, relapse, and drug resistance (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Therefore, there is an urgent need for innovative therapeutic strategies targeting multiple carcinogenic mechanisms to effectively manage CRC.\u003c/p\u003e \u003cp\u003eNano drug delivery systems represent a promising approach to overcome the limitations of conventional chemotherapy in cancer treatment. These systems are designed to enhance drug solubility, bioavailability, and targeting, thereby maximizing drug levels at the target site while minimizing systemic toxicity and side effects (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). They provide precise drug delivery to cancer cells, protect healthy tissues, reduce systemic toxicity and side effects, and allow for controlled drug release over time, potentially improving therapeutic outcomes (\u003cspan additionalcitationids=\"CR5 CR6\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBoswellic acid derivatives, derived from the resin of the genus \u003cem\u003eBoswellia\u003c/em\u003e, have attracted attention for their anticancer properties. Compounds such as α- and β-boswellic acid (BA), 3-O-acetyl-α- and β-boswellic acid (ABA), 11-keto-β-boswellic acid (KBA), and 3-O-acetyl-11-keto-β-boswellic acid (AKBA) have demonstrated anti-inflammatory, anti-arthritic, and anticancer effects in various preclinical studies (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Their anti-proliferative effect against various types of cancer has been extensively studied in both in vitro and in vivo settings (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). However, their therapeutic potential is limited by poor solubility and bioavailability (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eResearchers have explored alternative delivery methods to address the solubility and bioavailability challenges associated with BA derivatives, including naturally derived polymeric nanoparticles such as sodium alginate (SA) and chitosan (CS). In particular, sodium alginate is a hydrogel-based natural polymer with exceptional properties including chelation, biocompatibility, immunogenicity, and mucoadhesion (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Chitosan, another natural polymer, is well-suited for advanced drug delivery systems due to its advantageous properties, including low immunogenicity, mucoadhesiveness, biocompatibility, biodegradability, and nontoxicity (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). In particular, the pH sensitivity of chitosan-based nanocapsules allows for targeted drug release, enhancing drug bioavailability while minimizing off-target effects (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Calcium chloride (CaCl\u003csub\u003e2\u003c/sub\u003e) has been investigated as a cross-linking agent to form stable CS-SA nanoparticles by linking the amino and carboxyl groups of chitosan and alginate chains, respectively (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). This cross-linking reaction is crucial for maintaining the stability and integrity of the nanoparticle, preventing rapid drug release, and enhancing mucoadhesive properties, thereby improving drug release kinetics and bioavailability (\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDespite the progress in the use of CS-SA-CaCl\u003csub\u003e2\u003c/sub\u003e nanoparticles for various drugs, their application as a delivery system for BA derivatives remains unexplored. Considering the reported anticancer activity of BA derivatives and their solubility problem, the investigation of CS-SA-CaCl\u003csub\u003e2\u003c/sub\u003e nanoparticles as a delivery system provides an opportunity to overcome these limitations and improve their therapeutic efficacy in cancer therapy due to their biocompatibility, biodegradability, mucoadhesiveness, and controlled drug release (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Therefore, this study aims to prepare CS-SA-CaCl\u003csub\u003e2\u003c/sub\u003e nanoparticles for the delivery of AKBA and evaluate their anti-proliferative effects on cancer cells.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. BA Extraction using Three Phase Partitioning (TPP) followed by Column Chromatography\u003c/h2\u003e \u003cp\u003eThe three-phase partitioning (TPP) method was used to extract AKBA from the gum resin of \u003cem\u003eB. serrata\u003c/em\u003e. AKBA-containing fractions (BA-Ex) were isolated, and confirmed via high-performance liquid chromatography (HPLC). Finally, the amount of AKBA in the extract (BA-Ex) was quantified through UV detection at 260 nm (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, blue color). The extraction efficiency was calculated to be 12.64% based on the standard curve of the AKBA standard (Y\u0026thinsp;=\u0026thinsp;13348X \u0026minus;\u0026thinsp;16142, R\u0026sup2; = 0.9984).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Preparation and characterization of BA-Extract -loaded nanoparticles (Nano-BA-Ex)\u003c/h2\u003e \u003cp\u003eDual crosslinked nanoparticles loaded with BA-Ex were synthesized by ionic pregelation and polyelectrolyte complexation methods using sodium alginate and chitosan. The loading capacity and encapsulation efficiency of nano-BA-Ex were determined to be 6.9% and 75.16%, respectively, based on equations (1) and (2). Field emission scanning electron microscopy (FE-SEM) revealed particle structures with an average diameter of about 100 nm (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Further characterization of the nanoparticles included measurement of mean size, polydispersity index (PDI), and zeta potential (ζ-potential) using dynamic light scattering (DLS) and zeta sizer (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and C). Fourier transform infrared (FTIR) spectra were used to analyze the chemical and crystalline properties of nano-BA-Ex, demonstrating the presence of BA and its derivatives (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Specifically, the absorption peak at 1243 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicated the stretching vibration of C-O bonds commonly found in ester groups (-COO-), carboxylic acids (-COOH), or ethers (-C-O-C-), and in some cases, C-N bonds. In addition, the peak observed at 2921 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e corresponded to the stretching vibration of C-H bonds in aliphatic hydrocarbons, reflecting the symmetric stretching of CH\u003csub\u003e2\u003c/sub\u003e and CH\u003csub\u003e3\u003c/sub\u003e groups, with intensity variations depending on hydrogenation and chemical environment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. In Vitro\u003c/h2\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.3.1. Nano-BA-Ex inhibited cellular growth in HT-29 cells\u003c/h2\u003e \u003cp\u003eThe cytotoxicity of AKBA, BA-Ex, nano-BA-Ex, 5-Fluorouracil (5-FU, as a positive control), and blank nanocarrier on HT29 human colorectal cancer cells and normal fibroblast cells was evaluated using the MTT assay. After 48 hours of each treatment, both cell lines showed a dose-dependent decrease in cell viability for each treatment compared to untreated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). However, normal fibroblasts exhibited a smaller decrease in cell viability for each treatment than HT29 cells (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Nano-BA-Ex, even at one-tenth concentration, resulted in a significantly greater decrease in cell viability compared to AKBA and BA-Ex, when compared to 5-FU (as positive control), even in one-tenth of concentration (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.3.2. Nano-BA-Ex enhanced apoptosis in HT-29\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section4\"\u003e \u003ch2\u003e2.3.2.1. Annexin V Staining\u003c/h2\u003e \u003cp\u003eThe annexin V staining assay was employed to assess apoptosis induction following a 48-hour treatment with different test compounds. Flow cytometry analysis revealed distinct populations based on fluorescence intensity in the FITC and PI channels. Cell distribution in distinct quadrants was determined using quadrant statistics. The administration of each test compound led to differences in cell populations within specific quadrants, indicating varying levels of apoptosis induction. Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA illustrates the distribution of cells in various quadrants following treatment with 5-FU (30 \u0026micro;M), AKBA (100 \u0026micro;M), BA-Ex (100 \u0026micro;M), and nano-BA-Ex (10 \u0026micro;M), compared to the control group, as determined using scatter plots. The distribution of quadrants and the early/late apoptotic rate for each treatment compound are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, respectively. As shown in Figure B, the apoptosis rate in nano-BA-Ex was higher than 5-FU.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section4\"\u003e \u003ch2\u003e2.3.2.2. Cell Cycle Analysis\u003c/h2\u003e \u003cp\u003eThe effect of various test compounds on cell cycle progression was evaluated. After 48 hours of treatment, flow cytometry was performed on cells and the resulting cell fractions were sorted by DNA content. Treatment with 5-FU (30 \u0026micro;M), AKBA (100 \u0026micro;M), BA-Ex (100 \u0026micro;M), and nano-BA-Ex (10 \u0026micro;M), produced noticeable changes in the distribution of cell cycle phases. Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA illustrates representative histograms that display the post-treatment cell cycle distribution with the compounds mentioned. Furthermore, the sub-G1 cell fraction, an indicator of apoptotic cells, was assessed based on fluorescence intensity (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Notably, the nano-BA-Ex, AKBA, and BA-Ex showed increased sub-G1 cell fractions compared to both the control and 5-FU.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.4. In vivo\u003c/h2\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.4.1. Nano-BA-Ex inhibits colitis-related mouse colon tumorigenesis\u003c/h2\u003e \u003cp\u003ePathological characteristics of colon lesions including necrotic index, levels of mitosis, and aberrant crypt foci (ACF) were scored and compared among different groups (e.g. as the average mitoses amount in 10 high-power fields at the lesion) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The results demonstrated a significant difference between the negative control, placebo, 5-FU, BA-Ex, nano-BA-Ex, and nano-BA-Ex/5-FU receiving groups regarding levels of necrosis, mitosis, and ACF. After scoring and staging, the groups that received 5-FU, BA-Ex, nano-BA-Ex, and nano-BA-Ex/5-FU showed a significant decrease in mitosis compared to the placebo group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Although the nano-BA-Ex groups exhibited a higher reduction in mitosis rate compared to 5-FU and BA-Ex, the difference was not statistically significant.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eACF was significantly reduced in the groups treated with 5-FU, BA-Ex, nano-BA-Ex, and nano-BA-Ex/5-FU compared to those treated with placebo (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001)(Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Furthermore, the nano-BA-Ex receiving group showed a significantly lower number of ACF compared 5-FU and BA-Ex groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The difference was even more pronounced in the group that received a combination of nano-BA-Ex and 5-FU (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison between the colon tissue necrosis, mitotic, and Aberrant Crypt Foci (ACF) indices of the different groups against placebo.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eNecrosis Mean Differences (95% CI)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePlacebo\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eNano Carrier\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eBA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex / 5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-0.10 (-1.38, 1.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.90 (-0.38, 2.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.40 (-0.88, 1.68)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.70 (-0.58, 1.98)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.00 (-0.28, 2.28)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.10 (-1.18, 1.38)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.00 (-0.28, 2.28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.50 (-0.78, 1.78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.80 (-0.48, 2.08)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.10 (-0.18, 2.38)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.90 (-2.18, 0.38)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-1.00 (-2.28, 0.28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-0.50 (-1.78, 0.78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-0.20 (-1.48, 1.08)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.10 (-1.18, 1.38)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.40 (-1.68, 0.88)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-0.50 (-1.78, 0.78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.50 (-0.78, 1.78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.30 (-0.98, 1.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.60 (-0.68, 1.88)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.70 (-1.98, 0.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-0.80 (-2.08, 0.48)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.20 (-1.08, 1.48)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-0.30 (-1.58, 0.98)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.30 (-0.98, 1.58)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.00 (-2.28, 0.28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-1.10 (-2.38, 0.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-0.10 (-1.38, 1.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-0.60 (-1.88, 0.68)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-0.30 (-1.58, 0.98)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eMitosis Mean Differences (95% CI)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePlacebo\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eNano carrier\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eBA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex / 5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.50 (-3.22, 4.22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e6.10 (2.38, 9.82)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e5.00 (1.28, 8.72)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e7.70 (3.98, 11.42)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e9.30 (5.58, 13.02)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.50 (-4.22, 3.22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5.60 (1.88, 9.32)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e4.50 (0.78, 8.22)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e7.20 (3.48, 10.92)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e8.80 (5.08, 12.52)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e-6.10 (-9.82, -2.38)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-5.60 (-9.32, -1.88)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-1.10 (-4.82, 2.62)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.60 (-2.12, 5.32)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.20 (-0.52, 6.92)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e-5.00 (-8.72, -1.28)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-4.50 (-8.22, -0.78)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.10 (-2.62, 4.82)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.70 (-1.02, 6.42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e4.300 (0.58, 8.02)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e-7.70 (-11.42, -3.98)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-7.20 (-10.92, -3.48)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-1.60 (-5.32, 2.12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-2.70 (-6.42, 1.02)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.60 (-2.12, 5.32)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e-9.30 (-13.02, -5.58)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-8.80 (-12.52, -5.08)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-3.20 (-6.92, 0.52)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-4.300* (-8.02, -0.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-1.60 (-5.32, 2.12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eACF Mean Differences (95% CI)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePlacebo\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eNano carrier\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eBA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex / 5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.00 (-3.90, 5.90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e12.10 (7.20, 17.00)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e9.20 (4.30, 14.10)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e17.60 (12.70, 22.50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e18.50 (13.60, 23.40)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.00 (-5.90, 3.90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e11.10 (6.20, 16.00)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8.20 (3.30, 13.10)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e16.60 (11.70, 21.50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e17.50 (12.60, 22.40)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e-12.10 (-17.00, -7.20)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-11.10 (-16.00, -6.20)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-2.90 (-7.80, 2.00)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e5.50 (0.60, 10.40)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e6.40 (1.50, 11.30)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e-9.20 (-14.10, -4.30)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-8.20 (-13.10, -3.30)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.90 (-2.00, 7.80)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e8.40 (3.50, 13.30)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e9.30 (4.40, 14.20)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e-17.60 (-22.50, -12.70)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-16.60 (-21.50, -11.70)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e-5.50 (-10.40, -0.60)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e-8.40 (-13.30, -3.50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.90 (-4.00, 5.80)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e-18.50 (-23.40, -13.60)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-17.50 (-22.40, -12.60)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e-6.40 (-11.30, -1.50)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e-9.30 (-14.20, -4.40)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-0.90 (-5.80, 4.00)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe statistically significant differences are shown in bold.\u003c/p\u003e \u003cp\u003eCI: confidence interval.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.4.2. Expression of mRNAs related to inflammation, survival, proliferation, invasion, and angiogenesis\u003c/h2\u003e \u003cp\u003eThe mRNA expression levels of several proteins involved in tumor cell processes including \u003cem\u003eBcl2\u003c/em\u003e, \u003cem\u003eCox2, CyclinD1, Mmp9, and Vegf\u003c/em\u003e were assessed using quantitative real-time polymerase chain reaction (qRT-PCR). Treatment with various formulations led to a minor alteration in gene expression in comparison to the placebo group. The differential fold-change values for each of these mRNAs between each group are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of mRNA gene expression between each study groups against placebo.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eBcl2 Fold-change Difference (95% CI)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePlacebo\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eNano carrier\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eBA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex / 5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.25 (-5.63, 8.13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-2.35 (-9.23, 4.25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.00 (-5.88, 7.88)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.13 (-5.75, 8.01)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.27 (-6.16, 8.70)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.25 (-8.13, 5.63)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-3.61 (-10.48, 3.27)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-0.25 (-7.13, 6.63)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-0.12 (-7.00, 6.76)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.02 (-7.41, 7.45)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.35 (-4.52, 9.23)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.61 (-3.27, 10.48)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.36 (-3.52,10.24)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.48 (-3.40, 10.36)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.63 (-3.80, 11.06)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.00 (-7.88, 5.88)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.61 (-3.27, 10.48)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.36 (-3.52,10.24)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.48 (-3.40, 10.36)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.63 (-3.80, 11.06)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.13 (-8.01, 5.75)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.12 (-6.76, 7.00)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-3.48 (-10.36, 3.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-0.13 (-7.00, 6.75)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.15 (-7.28, 7.58)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.27 (-8.70, 6.16)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-0.02 (-7.45, 7.41)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-3.63 (-11.06, 3.80)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-0.27 (-7.70, 7.16)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-0.15 (-7.58, 7.28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eCox2 Fold-change Difference (95% CI)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePlacebo\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eNano carrier\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eBA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex / 5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-2.66 (-7.05, 1.74)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-1.86 (-6.25, 2.54)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-1.25 (-5.64, 3.15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.28 (-4.11, 4.67)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.58 (-4.16, 5.33)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.66 (-1.74, 7.05)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.80 (-3.59, 5.19)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.41 (-2.98, 5.80)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.94 (-1.46, 7.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.24 (-1.50, 7.99)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.86 (-2.54, 6.25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-0.80 (-5.19, 3.59)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.61 (-3.78, 5.00)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.14 (-2.26, 6.53)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.44 (-2.30, 7.19)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.25 (-3.15, 5.64)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-1.41 (-5.80, 2.98)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-0.61 (-5.00, 3.78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.53 (-2.87, 5.92)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.83 (-2.91, 6.58)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.28 (-4.67, 4.11)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-2.94 (-7.33, 1.46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-2.14 (-6.53, 2.26)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-1.53 (-5.92, 2.87)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.31 (-4.44, 5.05)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.58 (-5.39, 4.16)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-3.24 (-7.99, 1.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-2.44 (-7.19, 2.30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-1.83 (-6.58, 2.91)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-0.31 (-5.05, 4.44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eCyclinD1 Fold-change Difference (95% CI)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePlacebo\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eNano carrier\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eBA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex / 5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-3.99 (-7.88, -0.09)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-1.04 (-4.94, 2.86)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-3.76 (-7.66, 0.13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-1.00 (-4.89, 2.90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-0.28 (-4.49, 3.93)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.99 (0.09, 7.88)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.95 (-0.95, 6.84)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.22 (-3.67, 4.12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.99 (-0.91, 6.89)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.70 (-0.51, 7.91)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.04 (-2.86, 4.94)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-2.95 (-684, 0.95)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-2.72 (-6.62, 1.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.04 (-3.85, 3.94)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.76 (-3.45, 4.97)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.76 (-0.13, 7.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-0.22 (-4.12, 3.67)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.72 (-1.17, 6.62)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.77 (-1.13, 6.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.48 (-0.73, 7.69)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.00 (-2.90, 4.89)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-2.99 (-6.89, 0.91)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-0.04 (-3.94, 3.85)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-2.77 (-6.66, 1.13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.71 (-3.50, 4.92)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.28 (-3.93, 4.49)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-3.70 (-7.91, 0.51)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-0.76 (-4.97, 3.45)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-3.48 (-769,0.73)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-0.71 (-4.92, 3.50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eMmp9 Fold-change Difference (95% CI)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePlacebo\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eNano carrier\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eBA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex / 5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-9.65 (-30.97, 11.66)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-2.15 (-23.46, 19.16)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-7.40 (-28.71, 13.91)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-14.02 (-35.33, 7.29)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-2.01 (-26.17, 22.15)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.65 (-11.66, 30.97)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.51 (-15.27, 30.29)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.25 (-20.53, 25.04)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-4.37 (-27.15, 18.42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7.64 (-17.83, 33.11)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.15 (-19.16, 23.46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-7.51 (-30.29, 15.27)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-5.25 (-28.03, 17.53)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-11.87 (-34.65, 10.91)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.14 (-25.33, 25.61)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.40 (-13.91, 28.71)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-2.25 (-25.04, 20.53)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.25 (-17.53, 28.03)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-6.62 (-29.40, 16.16)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.39 (-20.08, 30.86)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14.02 (-7.29, 35.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.37 (-18.42, 27.15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.87 (-10.91, 34.65)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.62 (-16.16, 29.40)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e12.01 (-13.46, 37.48)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.01 (-22.15, 26.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-7.64 (-33.11, 17.83)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-0.14 (-25.61, 25.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-5.39 (-30.86, 20.08)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-12.01 (-37.48, 13.46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eVegf Fold-change Difference (95% CI)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003ePlacebo\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eNano carrier\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eBA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNano-BA-Ex / 5-FU\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-3.30 (-7.33, 0.74)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-0.62 (-4.65, 3.42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.39 (-2.64, 5.42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.85 (-3.19, 4.88)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-0.22 (-4.58, 4.14)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.30 (-0.74, 7.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.68 (-1.36, 6.71)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e4.69 (0.65\u0026ndash;8.72)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e4.14 (0.11, 8.17)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.08 (-1.28, 7.43)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.62 (-3.42, 4.65)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-2.68 (-6.71, 1.36)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e--\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.01 (-2.02, 6.04)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.46 (-2.57,5.50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.40 (-3.96, 4.76)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-1.39 (-5.42, 2.64)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-1.75 (-5.78, 2.28)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-2.01 (-6.04, 2.02)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-0.55 (-4.58, 3.49)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-1.61 (-5.97, 2.75)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-0.85 (-4.88, 3.19)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e-4.14 (-8.17, -0.11)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-1.46 (-5-50, 2.57)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.55 (-3.49, 4.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-1.06 (-5.42, 3.29)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.22 (-4.14, 4.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-3.08 (-7.43, 1.28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-0.40 (-4.76, 3.96)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.61 (-2.75, 5.97)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-3.29, 5.42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe statistically significant differences are shown in bold.\u003c/p\u003e \u003cp\u003eCI: confidence intervals.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eThis study aimed to utilize CS-SA-CaCl\u003csub\u003e2\u003c/sub\u003e nanoparticles as a delivery system for BA derivatives and to evaluate their anti-proliferative activity against cancer cells. The AKBA extraction from \u003cem\u003eB. serrata\u003c/em\u003e gum resin using the TPP method followed by column chromatography was successful as confirmed by HPLC with an extraction efficiency of 12.64%. The preparation of pH-sensitive nano-BA-Ex using sodium alginate and chitosan with dual cross-linking via ionic pregelation and polyelectrolyte complexation resulted in approximately 100 nm-sized nanocapsules with a loading capacity of 6.9% and encapsulation efficiency of 75.16%.\u003c/p\u003e \u003cp\u003ePrevious studies have extensively investigated the cytotoxic effect of AKBA on various colorectal cancer cell lines \u003cem\u003ein vitro\u003c/em\u003e (\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). However, the \u003cem\u003ein vitro\u003c/em\u003e results of the present study revealed that nano-BA-Ex exhibited superior cytotoxicity against HT29 cells compared to BA-Ex, free AKBA, and 5-FU, even at one-tenth the concentration. It suggests that the nano-delivery system enhances the bioavailability and therapeutic efficacy of BA derivatives. In addition, nano-BA-Ex induced apoptosis in HT29 cells more effectively than the other treatments as evidenced by Annexin V staining and cell cycle phase analysis. These results suggest that nano-BA-Ex not only inhibits cell growth but also promotes apoptosis, which is a favorable outcome in cancer therapy.\u003c/p\u003e \u003cp\u003eLimited research has been conducted on the anticancer effects of nano forms of AKBA. One study evaluated the effects of BAs and their nanoparticles on the proliferation of human hepatoma HepG2 cells. Two different preparation techniques were used: nanoprecipitation and an oil-in-water emulsion/solvent evaporation method. The particles prepared via nanoprecipitation exhibited significantly higher cytotoxicity (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Additionally, other structural modifications, such as replacing the acetoxy group with a beta-amino group, introducing an electron-withdrawing group at C-2, or adding a nitrogen-containing substitution in the A-ring, can improve the anticancer effects of AKBA and KBA (\u003cspan additionalcitationids=\"CR25 CR26\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). In a recent study, 26 new derivatives of AKBA were synthesized using ethylenediamine as the linking chain on the carboxyl group. The derivatives that targeted mitochondria demonstrated the most effective antiproliferative action, up to 20 times stronger than AKBA (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Additionally, Shamraiz \u003cem\u003eet al.\u003c/em\u003e synthesized heterocyclic derivatives of BAs and new monomers of AKBA and KBA, as well as bis-AKBA and KBA homodimers, and AKBA-KBA heterodimers (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). The antiproliferative effects of these dimers were evaluated on several human cancer cell lines, including HT29. The study found that the homodimer of KBA was the most effective, followed by pyrazine derivatives of AKBA, monomers of AKBA, KBA, and homodimers of AKBA. Additionally, a formulation of KBA nanoparticles (KBA-NPs) was designed using the emulsion-diffusion-evaporation method based on poly-DL-lactide-co-glycolide in a separate study. The study evaluated the oral bioavailability and anti-inflammatory effects of KBA and KBA-NPs in the rat paw edema model. The results indicated that KBA-NPs had a 7-fold increase in bioavailability and a 1.7-fold increase in anti-inflammatory activity compared to KBA alone (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA self-nanoemulsifying drug delivery system (SNES) has been developed to enhance the oral bioavailability of \u003cem\u003eB. serrata\u003c/em\u003e extract (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). SNES forms emulsions composed of isotropic mixtures of oil, surfactant, and/or co-surfactant with droplet sizes less than 200 nm. These emulsions are effective for oral delivery of bioactive compounds. Both KBA and AKBA exhibited a more than two-fold increase in aqueous solubility and bioaccessibility. In addition, pharmacokinetic evaluations demonstrated that SNES significantly improved the oral bioavailability of KBA and AKBA in mice, resulting in more than twice the bioavailability of the bulk oil solution.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eIn vivo\u003c/em\u003e investigation of the present study showed that nano-BA-Ex inhibited colon tumorigenesis induced by DMH in mice and significantly reduced the number of aberrant crypt foci (ACFs). Molecular studies showed that nano-BA-Ex had a small effect on the expression of several proteins, including \u003cem\u003eBcl-2\u003c/em\u003e, a marker of tumor survival; \u003cem\u003eCOX-2\u003c/em\u003e, a mediator of inflammation; \u003cem\u003ecyclin D1\u003c/em\u003e, associated with cell proliferation; \u003cem\u003eMMP-9\u003c/em\u003e, a protein involved in invasion processes; and \u003cem\u003eVEGF\u003c/em\u003e, a protein associated with angiogenesis. However, this effect was not statistically significant. In a previous study, V.R. Yadav \u003cem\u003eet al.\u003c/em\u003e reported that AKBA significantly suppressed the expression of several biomarkers in orthotopically implanted CRC tumors in mice. These biomarkers included pro-inflammatory \u003cem\u003eCOX2\u003c/em\u003e, tumor survival markers \u003cem\u003ebcl-2\u003c/em\u003e, \u003cem\u003ebcl-xL\u003c/em\u003e, \u003cem\u003eIAP-1\u003c/em\u003e and survivin, proliferative \u003cem\u003ecyclin D1\u003c/em\u003e, invasive \u003cem\u003eMMP-9\u003c/em\u003e and \u003cem\u003eICAM-1\u003c/em\u003e, and angiogenic \u003cem\u003eVEGF\u003c/em\u003e and \u003cem\u003eCXCR4\u003c/em\u003e (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Later that year, this was confirmed by H. Liu et al. in the adenomatous polyposis coli multiple intestinal neoplasia (APC\u003csup\u003eMin/+\u003c/sup\u003e) mice (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). The study found that AKBA reduced over 60% of colon polyps and prevented their malignant progression. The chemo-preventive effect of AKBA is attributed to its multifaceted activities, which include antiproliferative, apoptosis-inducing, antiangiogenic, and anti-inflammatory effects achieved through the Wnt/β-catenin and NF-κB/cyclooxygenase-2 pathways inhibition.\u003c/p\u003e \u003cp\u003eNanoformulations and their size can significantly influence gene expression, which may be relevant to therapeutic outcomes. A study demonstrated that a novel pH-responsive hesperidin nanoformulation exhibited anticancer effects on lung adenocarcinoma cells by targeting the Akt/mTOR and MEK/ERK pathways. This nanoformulation decreased the expression of signaling proteins and enhanced the expression of apoptotic markers by upregulating Bax and p53 genes and downregulating the anti-apoptotic gene Bcl-2 (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Additionally, research indicated that Ag nanoparticles impacted the viability of MCF-7 and Vero cell lines and altered the expression of apoptotic genes. These nanoparticles selectively induced apoptosis and upregulated tumor suppressor genes (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e).\u003c/p\u003e"},{"header":"4. Conclusions","content":"\u003cp\u003eThis study introduces CS-SA-CaCl2 nanoparticles as a novel delivery system for AKBA with potential anticancer properties. By addressing the limitations of conventional chemotherapy, the research lays the foundation for an effective drug delivery system that enhances the therapeutic efficacy of these derivatives. However, further research is necessary to optimize its formulation, safety, and efficacy, highlighting nano-BA-Ex's potential for future preclinical and clinical evaluation in CRC therapy.\u003c/p\u003e"},{"header":"5. Methods","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e5.1. Materials\u003c/h2\u003e \u003cp\u003eThe gum resin of \u003cem\u003eBoswellia serrata\u003c/em\u003e was acquired from a local market in our region. The pure reference standard of AKBA was purchased from Wuhan ChemFaces Biochemical, China (Cat. No. CFN90531). Analytical grade N, N\u0026prime;-Dimethylhydrazine dihydrochloride (DMH), as well as all other chemicals, were purchased from Merck Chemicals located in Darmstadt, Germany. The HPLC-grade solvents were obtained from Dae-Jung, Korea.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e5.2. Extraction and Purification of \u003cem\u003eB. serrata\u003c/em\u003e Gum Resin\u003c/h2\u003e \u003cp\u003eAKBA was extracted from the gum resin of \u003cem\u003eB. serrata\u003c/em\u003e using the TPP method, as previously described (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), followed by column chromatographic purification. Briefly, the gum resin of \u003cem\u003eB. serrata\u003c/em\u003e was ground in a mill and one gram of sifted powder was soaked in 20 mL of distilled water and stirred gently. Next, ammonium sulfate, at a concentration of 40% (w/v), was added, and the pH was adjusted to 6.0. Twenty milliliters of tert-butyl alcohol (t-butanol) were then added to the mixture prepared at 50\u0026deg;C for 180 minutes. The centrifugation process was performed at 8000g for 20 minutes, resulting in the formation of three layers. A two mL sample was then slowly taken from the upper organic phase, and the concentrated extract was dried in a ventilated oven at 55\u0026ordm;C. The resulting extract was stored as a powder until further analysis.\u003c/p\u003e \u003cp\u003eTo achieve greater extraction efficiency, the extraction product underwent column chromatography purification. The powder was suspended in methanol and then fractionated through column chromatography on silica gel. The column was eluted using a combination of hexane, chloroform, and methanol (1:1:0.2, v/v) as the elution solvent. Fractions containing AKBA were collected and analyzed using thin-layer chromatography (TLC), while extraction efficiency was assessed through the use of high-performance liquid chromatography (HPLC).\u003c/p\u003e \u003cp\u003eThe extraction efficiency was evaluated with HPLC (Knauer, Germany) using a C18 column (4.6 \u0026times; 250 mm, Waters). To measure the amount of AKBA in the resulting extract, 0.001 g of the extract was weighed, dissolved in one ml of methanol (1000 ppm), and subsequently filtered through an HPLC filter (0.45 \u0026micro;m). The resulting extract was then injected into the HPLC machine in a final volume of 20 \u0026micro;l. The mobile phase consisted of methanol, acetonitrile, acidified water, and orthophosphoric acid in a ratio of 55: 40:4.5: 0.5% (v/v) adjusted to pH\u0026thinsp;=\u0026thinsp;4 with glacial acetic acid, and was used at a flow rate of 1 mL/min. Analysis was conducted via ultraviolet detection at 260 nm, with all experiments repeated thrice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e5.3. Preparation of pH-Sensitive BA-Extract-loaded nanocapsules: (Nano-BA-Ex)\u003c/h2\u003e \u003cp\u003eBA-Ex-loaded dual-crosslinking nanocapsules were synthesized via the ionic pregelation and polyelectrolyte complexation method using two natural macromolecules, sodium alginate, and chitosan. The procedure was modified from the method outlined by Choukaife et al (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). First, 100 ml of 0.06% sodium alginate was prepared with deionized water under mechanical stirring for half an hour, following which the pH was adjusted to 4.9. Then, one mL of methanol containing 25 mg of BA-Ex powder was added to the mixture. After stirring for 30 minutes, 20 mL of 0.067% calcium chloride was sprayed into the above and further stirred for 30 minutes to form calcium alginate nanoparticles. Then, 15 mL of 0.005% low molecular weight chitosan (pH adjusted to 4.6) was sprayed into the mixture under continuous stirring for an additional 30 minutes to form double cross-linked particles. The final homogeneous suspension was dried under a vacuum at 50\u0026deg;C. The loading capacity and encapsulation efficiency of nano-BA-Ex were determined using Equations (1) and (2) (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e):\u003c/p\u003e \u003cp\u003eLoading Capacity% = (W \u003csub\u003etotal BA\u0026minus;Ex added \u0026ndash;\u003c/sub\u003e W \u003csub\u003efree non\u0026minus;entrapped BA\u0026minus;Ex\u003c/sub\u003e /W \u003csub\u003etotal nano\u0026minus;BA\u0026minus;Ex\u003c/sub\u003e) \u0026times;100 (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eEncapsulation Efficiency% = (W \u003csub\u003eloaded BA\u0026minus;Ex\u003c/sub\u003e /W \u003csub\u003etotal BA\u0026minus;Ex added\u003c/sub\u003e) \u0026times;100 (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e5.4. Nano-BA-Ex Characterization\u003c/h2\u003e \u003cp\u003eThe nanocapsules loaded with BA-Ex were characterized based on their zeta potential and average size. The average size was determined via DLS, and the PDI was also measured. The zeta potential was obtained by analyzing the electrophoretic mobility of the nanocapsules in an aqueous suspension, using a Zetasizer model NANO-flex 180 DLS from Particle Metrix (Germany). Nanocapsules were observed utilizing a Scanning Electron Microscope (FESEM; ZEISS Sigma model Sigma VP, Germany). The FTIR spectra of the BA-Ex, nanocarrier, and BA-Ex-loaded nanocapsules were acquired using the Nicolet Avatar 360 FTIR System (Thermo, USA) with a scanning range of 4000\u0026ndash;400 cm\u0026thinsp;\u0026minus;\u0026thinsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e5.5. In Vitro Analysis\u003c/h2\u003e \u003cdiv id=\"Sec21\" class=\"Section3\"\u003e \u003ch2\u003e5.5.1. Cell lines, Growth Medium \u0026amp; Treatment Conditions\u003c/h2\u003e \u003cp\u003eHuman normal primary fibroblasts were obtained from the circumcision site, and the HT29 colon cancer cell line was acquired from the Pasteur Institute of Iran. Fetal bovine serum (FBS), DMEM, and RPMI-1640 medium were purchased from BioIdea (Tehran, Iran). Annexin V, propidium iodide (PI) labeling kit, and MTT cell proliferation reagent, 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide, were purchased from Roche Diagnostics (Mannheim, Germany).\u003c/p\u003e \u003cp\u003eHuman normal primary fibroblasts and HT29 cells were cultured in DMEM and RPMI-1640 medium, supplemented with 10% FBS, respectively, and maintained at 37\u0026ordm;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. For treatment, cells were harvested using 0.05% trypsin/0.02% EDTA when they reached approximately 80% confluence and were sub-cultured in the corresponding medium. After overnight incubation for attachment, cells were treated with different concentrations of 5-FU, standard AKBA, BA-Ex, and nano-BA-Ex. The medium containing 5% DMSO was used as a control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e \u003ch2\u003e5.5.2. Cell proliferation assay (MTT)\u003c/h2\u003e \u003cp\u003eCell viability was assessed using the MTT assay, which quantifies the reduction of tetrazolium salt to formazan by viable cells (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). The cells were seeded in 96-well plates at a density of 10\u003csup\u003e5\u003c/sup\u003e cells per well with 200 \u0026micro;l of medium. After the cells reached the desired confluency, the media was removed and cells were incubated with different concentrations of each treatment for 48 hours. Cells were then incubated with 50 \u0026micro;L of 0.5 mg/mL MTT for 3 hours at 37\u0026deg;C. The intracellular formazan crystals were dissolved in 150 \u0026micro;L of dimethyl sulfoxide, and the resulting solution was subjected to spectrophotometric analysis at 570 nm to determine the optical density. By comparing the absorbance of treated and untreated cells, the percentage of dissolved colored formazan products was calculated. Triplicate assays were performed, and each experiment was repeated three times for accuracy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003e5.5.3. Flow-cytometric Determination of Apoptosis\u003c/h2\u003e \u003cdiv id=\"Sec24\" class=\"Section4\"\u003e \u003ch2\u003e5.5.3.1. Annexin V staining\u003c/h2\u003e \u003cp\u003eThe apoptosis assay was performed utilizing annexin V and PI staining. In summary, cells were treated with each test compound for 48 hours, washed with cold PBS, and stained with Annexin V-FITC antibody and PI for 15 minutes at room temperature. Subsequently, the cells were assessed by flow cytometry, and fluorescence intensity was measured in the FITC and PI channels. The proportions of the cell population in different quadrants were analyzed with quadrant statistics.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section4\"\u003e \u003ch2\u003e5.5.3.2. Cell cycle phase analysis\u003c/h2\u003e \u003cp\u003eCell cycle analyses were performed by sorting different cell fractions using flow cytometry. Cells were treated with different test compounds, including 5-FU, AKBA, BA-Ex, and nano-BA-Ex, for 48 hours. After trypsinization, the cells were suspended in ice-cold 70% ethanol in PBS and stored at -20\u0026ordm;C until analysis. Then, the cells were fixed and incubated with RNase A (100 mg/mL) for 30 minutes at 37\u0026ordm;C, followed by staining with PI (50 mg/mL) in the dark on ice for another 30 minutes. Nuclear DNA content was quantified with a BD-LSR flow cytometer (Becton Dickinson, USA) equipped with electronic doublet discrimination using blue (488 nm) excitation from an Argon laser. Cell cycle phase distribution was analyzed using Flowjo software. The fluorescence intensity of the sub-G1 cell fraction indicated the population of apoptotic cells.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e5.6. In Vivo Analysis\u003c/h2\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003e5.6.1. Animals and conditions\u003c/h2\u003e \u003cp\u003eMale BALB/c mice aged 6\u0026ndash;8 weeks were purchased from the Pasteur Institute of Iran and kept under standard conditions in animal care facilities. Five mice per cage were housed with unlimited access to food and water under constant environmental conditions, including equal periods of light and dark, at 20\u0026ndash;22\u0026deg;C with 60\u0026ndash;70% relative humidity, for 7 days prior to the start of the experiment. All animal experiments were performed according to ARRIVE 2.0 guidelines (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section3\"\u003e \u003ch2\u003e5.6.2. Cancer Induction\u003c/h2\u003e \u003cp\u003eCancer was induced by administering weekly intraperitoneal injections of 20 mg/Kg N, N'-dimethylhydrazine dihydrochloride (DMH) (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). After 15 weeks of weekly DMH injections, the mice were randomly assigned to different treatments (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Each treatment was administered for 8 weeks with weekly weighing and daily monitoring of disease symptoms. At week 24, all mice were intraperitoneally anesthetized using a combination of ketamine-xylazine (K, 75 mg/Kg; X, 25 mg/Kg), and blood was collected by cardiac puncture. Animals were then sacrificed, and colon tissues were removed. The colon of each mouse was collected, washed, and dissected to assess both macroscopic and microscopic inflammatory and neoplastic lesions. After macroscopic evaluation, the colons were divided. One part was fixed in 10% buffered formalin, embedded in paraffin, and subjected to H\u0026amp;E staining for further histopathological examination. The second was preserved in RNA Later at -80\u0026deg;C for molecular analysis.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDifferent treatment for each group of mice\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTreatment condition\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHealthy Control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eweekly IP normal saline for 15 weeks / Normal saline gavage weekly for weeks 16 to 23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePlacebo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDMH** (20mg/Kg, I.P.) weekly for 15 weeks / Normal Saline Gavage Placebo for weeks 16 to 23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNano carrier\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDMH (20mg/Kg, I.P.) weekly for 15 weeks /Blank Nano Carrier for weeks 16 to 23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDMH (20mg/Kg, I.P.) weekly for 15 weeks /25 mg/Kg 5-FU for weeks 16 to 23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDMH (20mg/Kg, I.P.) weekly for 15 weeks / 100 mg/Kg BA-Ex for weeks 16 to 23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNano-BA-Ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDMH (20mg/Kg, I.P.) weekly for 15 weeks / 100 mg/Kg Nano-BA-Ex for weeks 16 to 23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNano-BA-Ex / 5-FU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDMH (20mg/Kg, I.P.) weekly for 15 weeks /100 mg/Kg Nano-BA-Ex\u0026thinsp;+\u0026thinsp;25 mg/Kg 5-FU for weeks 16 to 23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e* N, N\u0026prime;-Dimethylhydrazine dihydrochloride\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section3\"\u003e \u003ch2\u003e5.6.3. Histopathology\u003c/h2\u003e \u003cp\u003eColon tissues were soaked in 10% formalin buffer as described. They were then washed with normal saline, fixed, dehydrated, and embedded in paraffin. Blocks were cooled, and 5\u0026micro;m sections were stained with H\u0026amp;E, then examined using an Olympus CX23 light microscope (Japan). The mitotic index, necrosis, and ACF were recorded for each sample and expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD per sample.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec30\" class=\"Section3\"\u003e \u003ch2\u003e5.6.4. RNA extraction, complementary DNA synthesis, and quantitative real-time polymerase chain reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003eThe mRNA expression levels of several proteins involved in tumor cell processes, including \u003cem\u003eCox-2\u003c/em\u003e (related to inflammation), cyclin D1 (associated with proliferation), \u003cem\u003eMmp-9\u003c/em\u003e (involved in invasion), \u003cem\u003eVegf\u003c/em\u003e (related to angiogenesis), and \u003cem\u003eBcl-2\u003c/em\u003e (associated with apoptosis), were evaluated utilizing qRT-PCR after treatment with various formulas. Molecular transcript levels were quantified to estimate mRNA synthesis by calculating the fold change relative to the control. RNA was extracted from 20 mg of each colon tissue sample using the Parstous Total RNA Extraction Kit (Mashhad, Iran). Two-step reverse transcription-PCR was then conducted using first-strand complementary DNA, produced with the cDNA Synthesis Kit from Tehran, Iran. The final reaction volume was 20 \u0026micro;L and included a 1X concentration of SyberGreen gene expression assay in RealQ Plus 2X Master Mix Green without ROX (Stenhuggervej, Denmark). To serve as a negative control, RNAse-free water was used in each run. Specific thermal cycler conditions were applied using a StepOne\u0026trade; Real-Time PCR system. Primer sequences are displayed in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBcl2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGATGACTGAGTACCTGAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAGCCAGGAGAAATCAAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eCyclin d1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTACCGCACAACGCACTTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGGGGTCCTTGTTTAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eEef2\u003c/b\u003e\u003c/p\u003e \u003cp\u003e(Housekeeping gene)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCCCTGTTCACCTCTGACTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATGGCACGGATCTGATCTACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eMMP9\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGACATAGACGGCATCCAGTATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGGAGGTATAGTGGGACACATAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eVEGF\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCCACGACAGAAGGAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCAGGGTCTCAATCGGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eCox2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCACTTCACCCATCAGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCAGTTTATGTTGTCTGTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003e5.7. Statistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using the SPSS software 23 (SPSS, Inc., Chicago, Illinois) and GraphPad Prism 8 (GraphPad Software). Data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). A one-way ANOVA was used to make comparisons between groups, followed by Tukey's multiple comparison tests. The level of statistical significance was set at a p-value below 0.05 (two-tailed).\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"542\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eABA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003e3-O-acetyl-\u0026alpha;- and \u0026beta;-boswellic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eAKBA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003e3-O-acetyl-11-keto-\u0026beta;-boswellic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003e5-FU\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003e5-Fluorouracil\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eACF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003eaberrant crypt foci\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eAPC\u003csup\u003eMin/+\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003eadenomatous polyposis coli multiple intestinal neoplasia\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eBA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026alpha;- and \u0026beta;-boswellic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eBA-Ex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003eAKBA-containing fractions of BA extract\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eCaCl2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003eCalcium chloride\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eCRC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003eColorectal cancer \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003echitosan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eDLS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003edynamic light scattering\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eDMH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003eN, N\u0026apos;-dimethylhydrazine dihydrochloride\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eFTIR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003eFourier transform infrared\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eHPLC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003ehigh-performance liquid chromatography\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eKBA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003e11-keto-\u0026beta;-boswellic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003ePDI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003epolydispersity index\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003equantitative real-time polymerase chain reaction\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eSA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003esodium alginate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eSNES\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003eself-nanoemulsifying drug delivery system\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.867158671586715%\" valign=\"bottom\"\u003e\n \u003cp\u003eTPP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"84.13284132841328%\" valign=\"bottom\"\u003e\n \u003cp\u003ethree-phase partitioning\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBabol University of Medical Sciences\u0026apos; Research Ethics Committees approved and reviewed the experimental protocol with the approval ID IR.MUBABOL.REC.1400.264.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present work was supported by Babol University of Medical Sciences, the Iran National Science Foundation (INSF), and Biotechnology Development Council of the Islamic Republic of Iran.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAM, SK, AA, and HP and designed this study. AA carried out the extraction, nanoformulation, in vitro and in vivo experiments. AD supervised the molecular experiments. MS supervised the statistical analysis. AA prepared the original draft. All authors validated the data and read and approved the final manuscript. Correspondence should be addressed to AM and HP.\u003c/p\u003e\n\u003cp\u003eAA: \u0026nbsp; Atiyeh Ale-Ahmad\u003c/p\u003e\n\u003cp\u003eSK: Sohrab Kazemi\u003c/p\u003e\n\u003cp\u003eAD: Abdolreza Daraei\u003c/p\u003e\n\u003cp\u003eMS: Mahdi Sepidarkish\u003c/p\u003e\n\u003cp\u003eAM: Ali Akbar Moghadamnia\u003c/p\u003e\n\u003cp\u003eHP: Hadi Parsian\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Dr. Mohammad Hosseini for his excellent support and assistance in histopathological examination.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. Lancet. 2019;394(10207):1467-80.\u003c/li\u003e\n\u003cli\u003eRejhov\u0026aacute; A, Opattov\u0026aacute; A, Čumov\u0026aacute; A, Sl\u0026iacute;va D, Vodička P. Natural compounds and combination therapy in colorectal cancer treatment. European journal of medicinal chemistry. 2018;144:582-94.\u003c/li\u003e\n\u003cli\u003eP\u0026eacute;rez-Herrero E, Fern\u0026aacute;ndez-Medarde A. Advanced targeted therapies in cancer: Drug nanocarriers, the future of chemotherapy. European journal of pharmaceutics and biopharmaceutics. 2015;93:52-79.\u003c/li\u003e\n\u003cli\u003eNaeem M, Awan UA, Subhan F, Cao J, Hlaing SP, Lee J, et al. Advances in colon-targeted nano-drug delivery systems: challenges and solutions. Archives of pharmacal research. 2020;43:153-69.\u003c/li\u003e\n\u003cli\u003ePatra JK, Das G, Fraceto LF, Campos EVR, Rodriguez-Torres MdP, Acosta-Torres LS, et al. Nano based drug delivery systems: recent developments and future prospects. Journal of nanobiotechnology. 2018;16(1):1-33.\u003c/li\u003e\n\u003cli\u003eAdepu S, Ramakrishna S. Controlled drug delivery systems: current status and future directions. Molecules. 2021;26(19):5905.\u003c/li\u003e\n\u003cli\u003eLi Z, Tan S, Li S, Shen Q, Wang K. Cancer drug delivery in the nano era: An overview and perspectives. Oncology reports. 2017;38(2):611-24.\u003c/li\u003e\n\u003cli\u003eEfferth T, Oesch F, editors. Anti-inflammatory and anti-cancer activities of frankincense: Targets, treatments and toxicities. Seminars in cancer biology; 2022: Elsevier.\u003c/li\u003e\n\u003cli\u003eRoy NK, Deka A, Bordoloi D, Mishra S, Kumar AP, Sethi G, Kunnumakkara AB. The potential role of boswellic acids in cancer prevention and treatment. Cancer Letters. 2016;377(1):74-86.\u003c/li\u003e\n\u003cli\u003eHussain H, Al-Harrasi A, Csuk R, Shamraiz U, Green IR, Ahmed I, et al. Therapeutic potential of boswellic acids: a patent review (1990-2015). Expert Opinion on Therapeutic Patents. 2017;27(1):81-90.\u003c/li\u003e\n\u003cli\u003eAbdel-Tawab M, Werz O, Schubert-Zsilavecz M. Boswellia serrata: an overall assessment of in vitro, preclinical, pharmacokinetic and clinical data. Clinical pharmacokinetics. 2011;50:349-69.\u003c/li\u003e\n\u003cli\u003eChoukaife H, Doolaanea AA, Alfatama M. Alginate Nanoformulation: Influence of Process and Selected Variables. Pharmaceuticals. 2020;13(11):335.\u003c/li\u003e\n\u003cli\u003eFathi M, Majidi S, Zangabad PS, Barar J, Erfan‐Niya H, Omidi Y. Chitosan‐based multifunctional nanomedicines and theranostics for targeted therapy of cancer. Medicinal research reviews. 2018;38(6):2110-36.\u003c/li\u003e\n\u003cli\u003eWang W, Meng Q, Li Q, Liu J, Zhou M, Jin Z, Zhao K. Chitosan derivatives and their application in biomedicine. International journal of molecular sciences. 2020;21(2):487.\u003c/li\u003e\n\u003cli\u003eTakka S, G\u0026uuml;rel A. Evaluation of chitosan/alginate beads using experimental design: formulation and in vitro characterization. Aaps Pharmscitech. 2010;11:460-6.\u003c/li\u003e\n\u003cli\u003eKhan M, Shah LA, Khan MA, Khattak NS, Zhao H. Synthesis of an un-modified gum arabic and acrylic acid based physically cross-linked hydrogels with high mechanical, self-sustainable and self-healable performance. Materials Science and Engineering: C. 2020;116:111278.\u003c/li\u003e\n\u003cli\u003eSzekalska M, Sosnowska K, Czajkowska-Kośnik A, Winnicka K. Calcium chloride modified alginate microparticles formulated by the spray drying process: A strategy to prolong the release of freely soluble drugs. Materials. 2018;11(9):1522.\u003c/li\u003e\n\u003cli\u003eWang T, Fleming E, Luo Y. An overview of the biochemistry, synthesis, modification, and evaluation of mucoadhesive polymeric nanoparticles for oral delivery of bioactive compounds. Advanced Composites and Hybrid Materials. 2023;6(1):6.\u003c/li\u003e\n\u003cli\u003eKiti K, Suwantong O. Bilayer wound dressing based on sodium alginate incorporated with curcumin-\u0026beta;-cyclodextrin inclusion complex/chitosan hydrogel. International Journal of Biological Macromolecules. 2020;164:4113-24.\u003c/li\u003e\n\u003cli\u003eLiu JJ, Huang B, Hooi SC. Acetyl‐keto‐\u0026beta;‐boswellic acid inhibits cellular proliferation through a p21‐dependent pathway in colon cancer cells. British journal of pharmacology. 2006;148(8):1099-107.\u003c/li\u003e\n\u003cli\u003eTakahashi M, Sung B, Shen Y, Hur K, Link A, Boland CR, et al. Boswellic acid exerts antitumor effects in colorectal cancer cells by modulating expression of the let-7 and miR-200 microRNA family. Carcinogenesis. 2012;33(12):2441-9.\u003c/li\u003e\n\u003cli\u003eShen Y, Takahashi M, Byun H-M, Link A, Sharma N, Balaguer F, et al. Boswellic acid induces epigenetic alterations by modulating DNA methylation in colorectal cancer cells. Cancer biology \u0026amp; therapy. 2012;13(7):542-52.\u003c/li\u003e\n\u003cli\u003eElnawasany S, Haggag YA, Shalaby SM, Soliman NA, El Saadany AA, Ibrahim MA, Badria F. Anti-cancer effect of nano-encapsulated boswellic acids, curcumin and naringenin against HepG-2 cell line. BMC Complementary Medicine and Therapies. 2023;23(1):270.\u003c/li\u003e\n\u003cli\u003eLi T, Fan P, Ye Y, Luo Q, Lou H. Ring A-modified Derivatives from the Natural Triterpene 3-O-acetyl-11-keto-\u0026beta;-Boswellic Acid and their Cytotoxic Activity. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents). 2017;17(8):1153-67.\u003c/li\u003e\n\u003cli\u003eCsuk R, Niesen-Barthel A, Sch\u0026auml;fer R, Barthel A, Al-Harrasi A. Synthesis and antitumor activity of ring A modified 11-keto-\u0026beta;-boswellic acid derivatives. European Journal of Medicinal Chemistry. 2015;92:700-11.\u003c/li\u003e\n\u003cli\u003eLi K, Li L, Wang S, Li X, Ma T, Liu D, et al. Design and synthesis of novel 2-substituted 11-keto-boswellic acid heterocyclic derivatives as anti-prostate cancer agents with Pin1 inhibition ability. European Journal of Medicinal Chemistry. 2017;126:910-9.\u003c/li\u003e\n\u003cli\u003eHuang M, Li A, Zhao F, Xie X, Li K, Jing Y, et al. Design, synthesis and biological evaluation of ring A modified 11-keto-boswellic acid derivatives as Pin1 inhibitors with remarkable anti-prostate cancer activity. Bioorganic \u0026amp; Medicinal Chemistry Letters. 2018;28(19):3187-93.\u003c/li\u003e\n\u003cli\u003eLi C, He Q, Xu Y, Lou H, Fan P. Synthesis of 3-O-acetyl-11-keto-\u0026beta;-boswellic acid (AKBA)-derived amides and their mitochondria-targeted antitumor activities. ACS omega. 2022;7(11):9853-66.\u003c/li\u003e\n\u003cli\u003eShamraiz U, Hussain H, Ur Rehman N, Al-Shidhani S, Saeed A, Khan HY, et al. Synthesis of new boswellic acid derivatives as potential antiproliferative agents. Natural product research. 2020;34(13):1845-52.\u003c/li\u003e\n\u003cli\u003eBairwa K, Jachak SM. Nanoparticle formulation of 11-keto-\u0026beta;-boswellic acid (KBA): Anti-inflammatory activity and in vivo pharmacokinetics. Pharmaceutical Biology. 2016;54(12):2909-16.\u003c/li\u003e\n\u003cli\u003eTing Y, Jiang Y, Zhao S, Li CC, Nibber T, Huang Q. Self-nanoemulsifying system (SNES) enhanced oral bioavailability of boswellic acids. Journal of Functional Foods. 2018;40:520-6.\u003c/li\u003e\n\u003cli\u003eYadav VR, Prasad S, Sung B, Gelovani JG, Guha S, Krishnan S, Aggarwal BB. Boswellic acid inhibits growth and metastasis of human colorectal cancer in orthotopic mouse model by downregulating inflammatory, proliferative, invasive and angiogenic biomarkers. International journal of cancer. 2012;130(9):2176-84.\u003c/li\u003e\n\u003cli\u003eLiu HP, Gao ZH, Cui SX, Wang Y, Li BY, Lou HX, Qu XJ. Chemoprevention of intestinal adenomatous polyposis by acetyl‐11‐keto‐beta‐boswellic acid in APCMin/+ mice. International journal of cancer. 2013;132(11):2667-81.\u003c/li\u003e\n\u003cli\u003ePavan S, Prabhu A. Novel pH responsive hesperidin nanoformulation exerts anticancer activity on lung adenocarcinoma cells by targeting Akt/mTOR and MEK/ERK pathways. Journal of Materials Research. 2024:1-15.\u003c/li\u003e\n\u003cli\u003eSangour MH, Ali IM, Atwan ZW, Al Ali AAALA. Effect of Ag nanoparticles on viability of MCF-7 and Vero cell lines and gene expression of apoptotic genes. Egyptian Journal of Medical Human Genetics. 2021;22:1-11.\u003c/li\u003e\n\u003cli\u003eNiphadkar S, Bokhale N, Rathod V. Extraction of acetyl 11-keto-\u0026beta;-boswellic acid (AKBA) from Boswellia serrata plant oleo gum resin using novel three phase partitioning (TPP) technique. Journal of applied research on medicinal and aromatic plants. 2017;7:41-7.\u003c/li\u003e\n\u003cli\u003eMassella D, Celasco E, Sala\u0026uuml;n F, Ferri A, Barresi AA. Overcoming the limits of flash nanoprecipitation: Effective loading of hydrophilic drug into polymeric nanoparticles with controlled structure. Polymers. 2018;10(10):1092.\u003c/li\u003e\n\u003cli\u003eMosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of immunological methods. 1983;65(1-2):55-63.\u003c/li\u003e\n\u003cli\u003eDu Sert NP, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, et al. Reporting animal research: Explanation and elaboration for the ARRIVE guidelines 2.0. PLoS biology. 2020;18(7):e3000411.\u003c/li\u003e\n\u003cli\u003eAbe A, Fukui H, Fujii S, Kono T, Mukawa K, Yoshitake N, et al. Role of Necl‐5 in the pathophysiology of colorectal lesions induced by dimethylhydrazine and/or dextran sodium sulphate. The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland. 2009;217(1):42-53.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Colorectal cancer, boswellic acid (BA), Acetyl-11-Keto-beta-Boswellic Acid (AKBA), nanoparticle drug delivery system, sodium alginate, chitosan, calcium chloride","lastPublishedDoi":"10.21203/rs.3.rs-4289336/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4289336/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eDeveloping a drug delivery system that can transport a higher concentration to the target cells can improve therapeutic efficacy. This study aimed to develop a novel delivery system for Acetyl-11-Keto-beta-Boswellic Acid (AKBA) using chitosan-sodium alginate-calcium chloride (CS-SA-CaCl\u003csub\u003e2\u003c/sub\u003e) nanoparticles. The objectives were to evaluate the antiproliferative activity of these nanoparticles against colorectal cancer (CRC) cells and to improve the bioavailability and therapeutic efficacy of AKBA.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eWith an extraction efficiency of 12.64%, AKBA was successfully extracted from the gum resin of \u003cem\u003eB. serrata\u003c/em\u003e. The nanoparticle delivery system exhibited superior cytotoxicity against HT29 cells compared to free AKBA, AKBA extract (BA-Ex), and 5-FU. Furthermore, the nano formulation (nano-BA-Ex), induced apoptosis in HT29 cells more effectively than the other treatments. In vivo results showed that nanoformulation inhibited chemically induced colon tumorigenesis in mice and significantly reduced the number of aberrant crypt foci (ACFs).\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe developed CS-SA-CaCl\u003csub\u003e2\u003c/sub\u003e nanoparticles loaded with AKBA extract exhibit potential as a potent drug delivery mechanism for the colorectal cancer model. Nano-BA-Ex is a promising strategy for enhancing the solubility, bioavailability, and therapeutic efficacy of BA derivatives. With its multiple effects on cancer cells and controlled drug release through nanocapsules, nano-BA-Ex stands out as a compelling candidate for further preclinical and clinical evaluation in CRC therapy.\u003c/p\u003e","manuscriptTitle":"pH-sensitive Nanoformulation of Acetyl-11-Keto-beta-Boswellic Acid (AKBA) as a Potential Antiproliferative Agent in Colon Carcinogenesis (In Vitro and In Vivo)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-26 20:19:22","doi":"10.21203/rs.3.rs-4289336/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"211479b5-3f6d-4b85-9624-7b64a1cab788","owner":[],"postedDate":"April 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-07T10:04:29+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-26 20:19:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4289336","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4289336","identity":"rs-4289336","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}