Moxibustion regulates the polarization of macrophages through the STAT1/miR-155/SOCS1 pathway in rheumatoid arthritis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Moxibustion regulates the polarization of macrophages through the STAT1/miR-155/SOCS1 pathway in rheumatoid arthritis Yu-mei Zhong, Yan-ding Guo, Luo Kun, Xin Yang, Xiu-hua Gao, Hai-yan Zhou This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7764532/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Rheumatoid arthritis (RA) is a chronic autoimmune disease characterized by persistent synovitis. Moxibustion is a natural therapy that exhibits anti-inflammatory bioactivity. However, the mechanism of moxibustion in the treatment of RA still needs further study. Objective: This study aimed to observe the effects of moxibustion on macrophage polarization and the STAT1/miR-155/SOCS1 signaling pathway in rats with RA. Methods: The rats' right hind paws were injected with freundʼs complete adjuvant (FCA) to establish the model of RA. Seven days post-FCA injection, moxibustion therapy was performed on the acupoints of Shenshu (BL23) and Zusanli (ST36) once a day for three weeks. The thickness of the foot pad, histopathological changes and inflammatory cytokines were then analyzed. The Immunofluorescence and Elisa were employed to evaluate the impact of moxibustion on the expression of macrophage's markers and the expression of molecules related to the STAT1/miR-155/SOCS1 signaling pathway. Results: Following the injection of FCA, it was observed that the thickness of the foot pad increased, the joint space narrowed, and a significant number of inflammatory cells infiltrated the area. However, after the moxibustion treatment, these symptoms were improved. Additionally, the levels of IL-23 were down-regulated, while the levels of IL-4, IL-10, and Arginase (Arg)-1 were up-regulated. The polarization balance of macrophages in the RA rats was disrupted, with a stronger polarization towards M1 and a weaker polarization towards M2. Post-moxibustion treatment, the polarization of macrophages was corrected, characterized by an increase in M2-polarized macrophages and a decrease in M1-polarized macrophages. Furthermore, moxibustion inhibited the expression of STAT1 and miR-155 within the STAT1/miR-155/SOCS1 pathway and promoted the expression of SOCS1, which was conducive to regulating the polarization phenotype of macrophages. Conclusion: The results demonstrated that moxibustion regulated the polarization phenotype of macrophages and exhibited anti-inflammatory effects, which may be related to the regulation of macrophage polarization through the STAT1/miR-155/SOCS1 pathway. Rheumatoid arthritis macrophage polarization moxibustion inflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic synovitis. Symptoms such as swelling, pain and stiffness of joints appear in the early stages of the disease. With the progression of the disease, cartilage destruction and bone erosion may occur, eventually leading to severe disability [ 1 ]. Clinical epidemiological data shows that about 1% of the world's population is suffering from RA [ 2 ]. Its morbidity increased by 7.4% from 1990 to 2017 [ 3 ]. Studies have found that the risk of cardiovascular disease, fragility fractures and venous thromboembolism among patients with RA has significantly increased [ 4 – 6 ]. Due to the complex pathogenesis of RA, it is difficult to cure the disease and is prone to cause multiple tissue and organ damages, which have a significant negative affect on the physical and mental health of patients. It has become a refractory autoimmune disease that is widely concerned in the medical field. Although the pathogenesis of RA is not completely clear, it is generally believed that immune abnormality is the core pathological mechanism. Previous studies have shown that in the development and progression of RA [ 7 , 8 ], the excessive activation of immune cells causes a state of long-term high response in the body, and a large number of inflammatory cells such as macrophages and lymphocytes appear in the synovium of the affected joints. Macrophage plays an important part in innate immunity and adaptive immunity. When the local micro-environment alters, macrophage can differentiate into phenotype with different functions. Macrophage is categorized as classically activated M1 (pro-inflammatory) and selectively activated M2 (anti-inflammatory) [ 9 ]. When polarized to M1, the macrophage surface molecule CD86 is highly expressed, and a variety of pro-inflammatory cytokines such as IL-23, TNF-α, IL-6, IL-1β are secreted, which accelerates the degradation of extracellular matrix and cell apoptosis, and promotes the development of inflammation[ 10 ]. When polarized to M2, the macrophage surface molecule CD206 is highly expressed, and promoted the production of arginase 1 (Arg1), IL-10, vascular endothelial growth factor (VEGF), and inhibits the over-activation of immune cells[ 11 ]. When RA occurs, the balance of macrophage polarization is broken[ 12 ], making it hard to resist the inflammatory response of the body. Some scholars believe that visualization of sub-clinical inflamed synovial macrophages can make early diagnosis and therapeutic intervention of RA possible [ 13 ]. Therefore, modulation of macrophage polarization is a feasible strategy to treat RA. In recent years, the pathway of macrophage activation induced by STAT1/miR-155/SOCS1 pathway has attracted widespread attention, especially in RA[ 14 ]. Signal transducerand activator of transcription 1(STAT1) is an important protein that connects signal transduction between cell membrane receptors and effectors, and is involved in regulating macrophage polarization, acting upstream of miR-155 and promoting the transcription of miR-155. SOCS1 is an important medium that promotes the production of immunoregulatory cytokine IL-10 and enhances the polarization of M2 macrophages, and is the target of miR-155. SOCS1 is involved in the downstream signaling cascade of STAT1/ miR-155 and mediates the final polarization of macrophages[ 15 ]. The study revealed that polarization induction of mouse bone marrow-derived macrophages (BMDMs) with STAT1 agonist increased the expression of M1 macrophage markers[ 16 ].Whether these targets in the STAT1/miR-155/SOCS1 pathway are affected by RA inflammation remains to be explored. The decreased polarization of macrophage M2 is a typical manifestation in the RA etiology process. Moxibustion has a good effect on the treatment of RA, but the mechanism is uncertain. Based on these studies, the present study puts forward the hypothesis that "moxibustion promotes the M2 polarization through STAT1/miR-155/SOCS1 pathway, adjusts the imbalanced immune homeostasis, and exhibits the effect of anti-inflammatory". This study aims to further explore the mechanism of moxibustion in treating RA. 2. Materials and Methods 2.1 Animals and experimental groups Six-week-old male Sprague-Dawley rats (weight, 200 ± 20g) were purchased from Chengdu Dasuo Animal Science and Technology Co., Ltd (Chengdu, China) (Permit Number: SCXK 2020-030). The acclimatization time of the rats was one week and they were fed in the room with a temperature of 22–24℃, a humidity of 20% and natural light dark cycles. These animals were free to eat and drink. All animal procedures were approved by the Ethics Committee of Chengdu University of Traditional Chinese Medicine (Approval Number: 2021-11). The rats were divided into three groups ( n = 10): normal rats group (Ctrl); RA rats group (RA); RA rats treated with moxibustion group (Mox). 2.2 Induction of rheumatoid arthritis The rats were induced to develop rheumatoid arthritis with foot pad injection of Freund's complete adjuvant (Sigma Aldrich, St Louis, USA) at 0.5mL/kg on the first day of the experiment[17]. The thickness of the foot pad, redness and swelling were assessed to ensure the development of rheumatoid arthritis. 2.3 Moxibustion Method Moxibustion therapy was employed on the 14th day of the experiment. The location of BL23 and ST36 is based on the standards of the Experimental Acupuncture [18]. BL23 is located 7mm laterally below the spinous process of the second lumbar spine. ST36 is below the knee joint and 6mm beside the anterior tibial muscle. The rat's fur near the acupoints of BL23 and ST36 was shaved to be convenient for moxibustion. Lighting moxa granules Ω (diameter: 2mm, length: 5mm) were placed on acupoints. Five moxa granules were burned at each point per day by alternating bilateral acupoints for 3 consecutive weeks. There was a day off on the seventh day every week. The rats in the control group, and RA group were fixed for 30 minutes without any therapies. Figure 1a and 1b. After the treatment of 3 weeks, the rats were anesthetized with isofurane and then sacrificed. 4ml of blood was extracted from the abdominal aorta and put into a centrifuge tube labeled with serial numbers. After one hour, the supernatant was centrifuged and put into a EP tube stored in a refrigerator with a temperature of -20℃. The sample of the ankle was stored in 4% formaldehyde solution. The synovial tissue was put into a cryopreservation tube and frozen in liquid nitrogen, then it was moved to a refrigerator with a temperature of -80℃for preservation. 2.4 Enzyme-Linked Immunosorbent Assay (Elisa). The expression of Arg-1 and IL-23 in serum was detected by ELISA with specific kits (Elabscience Biotechnology Co., Ltd, Wuhan, China) based on the manufacturer's instructions. Additional Elisa was also applied to detect the expression of IL-4 and IL-10 in serum (Multisciences biotech Co., Ltd, Hangzhou, China). 2.5 Histological Analysis. The synovial tissue was immersed in the 4% paraformaldehyde solution. In accordance with the standard operating procedures of pathological examination, dehydration, paraffin embedding, the making of 5um thick sections, HE staining, and gum sealing were conducted. The sections were observed with different magnifications. HE staining was used to observe the pathological change of joint and to evaluate the proliferation of synovial tissue and fibrous tissue and the infiltration of inflammatory cell. Images were obtained by using trinocular microscope (Motic). 2.6 Real-time PCR analysis. The mRNA expression was determined by qPCR analysis. Total RNA was extracted from monocytes by using a Trizol reagent and then reversely transcribed with a cDNA synthesis kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s protocol. mRNA expression of β-actin and the selected molecules were determined by using SYBR Green Master Mix (Applied Biosystems). Primer sequences were synthesized by Sangon Biotech (Shanghai, China) as follows in Table 1. The PCR cycling reaction conditions were as follows: pre-incubation at 95℃ for 2 min, followed by 40 cycles of denaturation at 95℃ for 30s and 60℃ for 30s, annealing at 55℃ for 30s, and extension at 72℃ for 30s. The relative expression was analyzed with 2 − ΔΔCT method. Table 1 The primer sequences of RT-PCR Gene Primer sequence miR−155 Forward primer: 5'GCGCGTTAATGCTAATTGTGAT3' Reverse Primer: 5'AGTGCAGGGTCCGAGGTATT3' β-actin Forward primer: 5'TGTCACCAACTGGGACGATA3' Reverse Primer: 5'GGGGTGTTGAAGGTCTCAAA3' 2.7 Immunofluorescence detection The synovial tissue was immersed in 4% paraformaldehyde, and then it was dehydrated, embedded in paraffin and then cut into 5µm thickness. The sections were placed in EDTA for antigen repair. Then, they were blocked with goat serum for 1 h at room temperature. After the blocking procedure was finished, the primary antibodies were added and the sections were incubated at 4 ° C for 24h. The primary antibodies used in the process included anti-CD86 (1:500, Abcam, UK), anti-CD206(1:500, Abcam, UK), anti-STAT1(1:1000, Abcam, UK) and anti-SOCOS1 (1:200, Abcam, UK). The sections were washed with PBS for three times, and then they were incubated with secondary antibody at 37 ° C for 30 min. Then, the nuclei were counter-stained with DAPI. The images were visualized with fluorescence microscope (Nikon Eclipse C1, Japan). 2.8 Statistical analysis Data analysis was performed by using SPSS 25.0 software. The data needs to pass the normality test and the homogeneity test of variance. If the data was normally distributed and had homogeneous variances, difference among groups would be assessed by one way ANOVA test followed by LSD post hoc comparison. Kruskal-Wallis test followed by post hoc Mann-Whitney U test would be applied when there was lack of homogeneity of variances. Data were presented as the mean ± SD. The P value less than 0.05 was thought to be statistically significant. 3. Results 3.1 Effect of moxibustion on the swell of foot pad and the weight The joint swelling in rats can indirectly reflect the degree of inflammation. In this study, for the rats with FCA injection, their foot showed obvious redness and swelling (Fig. 2 a) and the rats' weight gain slowed down(Fig. 2 b), but after the intervention of moxibustion, the redness and swelling symptoms were significantly improved. The rats' foot pad thickness in the moxibustion treatment group decreased (Fig. 2 c) and the rats' weight gain was faster than that of RA group (Fig. 2 b). 3.2 Effect of moxibustion on pathological changes To explore the protective effect of moxibustion on RA, the researchers applied moxibustion on Zusanli (ST36) and Shenshu (BL23) in RA rats. After 3 weeks’s moxibustion treatment, HE staining was used to assessed the the pathological changes of the joint. The result showed that the pathological changes of joint were attenuated after moxibustion treatment (Fig. 3 a). The result of joint pathology score revealed that compared with the RA group, the levels of synovial tissue (Fig. 3 b) and fibrous tissue (Fig. 3 c) proliferation and inflammatory cell infiltration (Fig. 3 d) were reduced in Mox group. The results showed that moxibustion could inhibit the pathological changes of synovitis in rats with RA. 3.3 Effect of moxibustion on the expression of macrophage marker CD86 and CD206 Macrophages are categorized into classically activated M1 and alternatively activated M2 types. When polarized towards the M1 phenotype, the macrophage surface molecule CD86 is highly expressed. Conversely, CD206 is highly expressed when the macrophage is polarized towards the M2 phenotype. The results showed that the expression of CD86 (Fig. 4 a) was up-regulated in RA group compared with the Ctrl group, while the expression of CD206 (Fig. 4 b) was down-regulated. After moxibustion treatment, the expression of macrophages changed, in other words, compared with RA group, the expression of CD206 was increased and the expression of CD86 was decreased ( Fig. 4 a- 4 b). 3.4 Effect of moxibustion on the expression of the related cytokines Arg-1, IL-10 and IL-23 secreted by macrophage When the macrophages were polarized to M2 type, they would over-express Arg-1 and IL-10. When polarized to M1 type, they would over-express IL-23. In this study, the expression levels of Arg-1 and IL-10 in RA group were significantly decreased compared with Ctrl group,while IL-23 was increased. The results of Elisa showed that the content of IL-10 (Fig. 5 a) increased and the content of IL-23 (Fig. 5 b) decreased in Mox group compared with RA group. And the expression of Arg-1 (Fig. 5 c) was slightly increased, but there was no statistical difference. The results indicated that moxibustion could promote the expression of IL-10 and inhabit the expression of IL-23, but it had no effect on the expression of Arg-1. 3.5 Effect of moxibustion on the STAT1/miR-155/SOCS1 signaling pathway The results showed that the expression level of STAT1 (Fig. 6 a) and miR-155 (Fig. 6 b) in RA group was higher than that of the Ctrl group, while the level of SOCS1 (Fig. 6 c) was lower. The expressions of STAT1 and miR-155 were significantly decreased and the expression of SOCS1 was increased in Mox group compared with the RA group. Figure 3 a- 3 c. 4. Discussion Rheumatoid arthritis is an immune-mediated, multisystem inflammatory disease that primarily affects the synovium of the joints. The incidence of RA increases with age, and most RA patients suffer from joint dysfunction and systemic complications. Since its etiology is obscure and involves multiple systems, RA is treated with interdisciplinary approach that includes general therapy, pharmacotherapy and operation therapy [ 19 ]. Non-steroidal anti-inflammatory drugs (NSAIDs) and Disease modifying antirheumatic drugs (DMARDs) are important components for the management of RA. Because the NSAIDs have good anti-inflammatory and analgesic effects, they are widely used in the acute phase of RA [ 20 ]. DMARDs are beneficial in alleviating RA and reducing disease activity [ 21 ]. Although these drugs are conducive to the health of patients, there are some limitations. It has been reported that the taking of NSAIDs are associated with increased cardiovascular risks and it has not been proved to have the function of slowing disease progression [ 22 , 23 ]. Biologics are the targeted therapeutic drugs for immune cells and cytokines, which have the characteristics of quick onset and good efficacy. As the biologics suppress the immune response, patients who get biological treatment are prone to have bacterial and fungal infections [ 24 ]. Therefore, RA patients treated with routine medication are turning to other substitutes, such as the complementary and alternative medicine (CAM)[ 25 ]. Moxibustion is an external therapy based on the theory of TCM. As a supplementary therapy, its effective mechanism may be associated with the thermal effects, radiation effects and pharmacological actions produced by the burning of moxa and the influence of meridians and acupoints. The theory of TCM holds that moxibustion can invigorate qi and stimulate blood circulation, warm meridians, and regulate yin and yang [ 26 ]. Previous results suggested that moxibustion thermal stimulation affects circulation of the blood and regulates the function of the nerves [ 27 ]. In the present study, we investigated the possible mechanism of moxibustion regulating M2 macrophage polarization in RA rat model. During the pathogenesis of RA, T cells are continuously activated and remain in a state of high response for a long time, causing a large number of inflammatory cells to gather in the joints. Among them, macrophage infiltration is a prominent characteristic in the pathological process of RA. Macrophages, as an important part of innate immunity and adaptive immunity, it is the key factor in chronic inflammation and tissue damage. Macrophages are the resident cells of the healthy synovium. After being stimulated by different conditions, macrophages can transform from a specific phenotype to another phenotype, namely, the classically activated M1 type and the selectively activated M2 type. When polarized to M1 type, it plays an important role in the initiation and development of inflammation by producing a large number of pro-inflammatory cytokines, such as TNF-α, IL-1β, IL-12[ 28 ]. In contrast, the M2 phenotype is usually induced by Th-2 cytokines such as IL-4, IL-10 and IL-13, with high expression of CD206, CD163 and Arg1[ 29 ] and has anti-inflammatory effect by inhibiting T cell proliferation and activation and regulating Th2-type immune response[ 30 ]. In the present study, it was found that the expression of M1-type macrophages was up-regulated, while the expression of M2-type macrophages was down-regulated in RA rats. The dynamic equilibrium of macrophage polarization was broken. This differential expression was consistent with the research of Hofkens and Vandooren, that is, in the early stage of inflammation, the polarization of macrophages towards M1-type was enhanced, which weakened the M2-type polarization [ 31 ]. The results of the present study showed that moxibustion of Shenshu (BL23) and Zusanli (ST36) could increase the polarization of M2-type macrophages and inhibit the polarization of M1-type macrophages at the same time. Previous studies demonstrated that the transfer of siRNA IRF5 into the macrophages in RA patients can significantly affect the sub-type conversion of macrophages and alleviate the disease [ 32 ]. The present study results suggested that moxibustion can regulate the polarization of macrophages and relieve the inflammation of RA. The polarization of macrophages is regulated by multiple signals, and it has been confirmed that STAT1/miR-155/SOCS1 pathway has a definite effect on the polarization of macrophages[ 33 ]. STAT1 protein phosphorylation site is tyrosine 701(Tyr701), as an important member of the mediated interferon signal, involved in the regulation of cellular immune response[ 34 ]. The research have revealed that inhibiting the phosphorylation of STAT1 can decrease the expression of miR-155. Thus, the inhibition of SOCS1 was reduced, the expression of Arg-1 and IL-4 was increased, and the polarization of macrophages to M2 was promoted[ 35 ]. Previous studies found that the up-regulation of Tim-3 expression in colon cancer mice inhibited the expression of miR-155 and the activation of STAT1, while the knockdown of SOCS1 conversely inhibited the up-regulation of Arg-1 and IL-10 induced by Tim-3[ 17 ]. In this study, it was found that moxibustion inhibited the expression of STAT1 and miR-155 while promoted SOSC 1 expression, which subsequently up-regulated M2 expression in macrophages and down-regulated M1 expression. Due to the stimulation of local inflammatory micro-environment in RA rats, the polarization of macrophages towards M2 was weakened. Therefore, the expression of M2-type surface marker CD206 and the effector molecules Arg-1 and IL-10 were decreased, while the expression of CD86 was increased, which was consistent with the research results of Zhang et al[ 36 ]. However, moxibustion treatment can promote the polarization of macrophages to M2 type, reduce the production of pro-inflammatory cytokines, and alleviate the inflammatory response of RA. The results demonstrated that moxibustion treatment may promote the polarization of macrophages to M2 type by regulating the expression of STAT1/miR-155/SOCS1 and alleviate the pathological changes of RA. 5. Conclusion The present study demonstrated that moxibustion of Zusanli (ST36) and Shenshu (BL23) acupoints alleviated the pathological changes of the joints in RA rats and had a definite anti-inflammatory effect. Moxibustion regulated the expression of related molecules in the STAT1/miR-155/SOCS1 signaling pathway, regulated the polarization of macrophages, and have anti-inflammatory effects. These findings suggest that moxibustion may serve as a method for RA treatment. Declarations Acknowledgments Thanks to Chengdu university of TCM for providing the research platform for the experiment. Declaration of interest statement The authors declare no Conflict of interest. Ethics approval and consent to participate All animal procedures were approved by the Ethics Committee of Chengdu University of Traditional Chinese Medicine (Approval Number: 2020-03). Consent for publication The authors declare consent for publication. Availability of data and materials All data are available from the corresponding authors upon reasonable request. Funding This work was supported by the grants from the National Natural Science Foundation of China (No.82405558, N0.81973959),the grant from Sichuan Provincial Administration of Traditional Chinese Medicine (25MSZX208), the joint fund of Chengdu University of Traditional Chinese Medicine (No.LH202402023) and the Key Research and Development Support Program of Chengdu Science and Technology Bureau (No.2024-YF05-00922-SN). Authors' contributions HY Z contributed to the conception and design of the study. Experimental operation: YM Z and YD G. Moxibustion therapy: K L and XU G. Statistical analysis: J Z and XH G. Manuscript Draft: YM Z. X Y provided critical insights. The authors read and approved the final manuscript. References Gwinnutt JM, Norton S, Hyrich KL, Lunt M, Combe B, Rincheval N, Ruyssen-Witrand A, Fautrel B, McWilliams DF, Walsh DA, Nikiphorou E, Kiely PDW, Young A, Chipping JR, MacGregor A, Verstappen SMM. Exploring the disparity between inflammation and disability in the 10-year outcomes of people with rheumatoid arthritis. Rheumatology (Oxford). 2022;61(12):4687-4701. ravallese, E.M. and G.S. Firestein, Rheumatoid Arthritis - Common Origins, Divergent Mechanisms. N Engl J Med. 2023. 388(6): 529-542. Moradi-Lakeh M, Forouzanfar MH, Vollset SE, El Bcheraoui C, et al. Burden of musculoskeletal disorders in the Eastern Mediterranean Region, 1990-2013: findings from the Global Burden of Disease Study 2013. Ann Rheum Dis. 2017;76(8):1365-1373. Murphy L. Cardiovascular disease risk in rheumatoid arthritis. Br J Nurs. 2022;31(4):190-192. Ishizu H, Shimizu H, Shimizu T, Ebata T, Ogawa Y, Miyano M, Arita K, Ohashi Y, Iwasaki N. Rheumatoid arthritis is a risk factor for refracture in patients with fragility fractures. Mod Rheumatol. 2022;32(6):1017-1022. Ketfi C, Boutigny A, Mohamedi N, Bouajil S, Magnan B, Amah G, Dillinger JG. Risk of venous thromboembolism in rheumatoid arthritis. Joint Bone Spine. 2021;88(3):105122. Woo SJ, Noh HS, Lee NY, Cheon YH, et al. Myeloid sirtuin 6 deficiency accelerates experimental rheumatoid arthritis by enhancing macrophage activation and infiltration into synovium. EBioMedicine, 2018,38:228-237. Weyand CM, Zeisbrich M, Goronzy JJ. Metabolic signatures of T-cells and macrophages in rheumatoid arthritis. Curr Opin Immunol. 2017;46:112-120. Yunna C, Mengru H, Lei W, Weidong C. Macrophage M1/M2 polarization. Eur J Pharmacol. 2020;877:173090. Meng M, Cao Y, Zhang Y, et al. HnRNPA2B1 Aggravates Inflammation by Promoting M1 Macrophage Polarization. Nutrients. 2023;15(7):1555. Li J, Ren H, Zhang Z, Zhang J, Wei F. Macrophage M2 polarization promotes pulpal inflammation resolution during orthodontic tooth movement. J Cell Mol Med. 2024;28(9):e18350. Cutolo M, Campitiello R, Gotelli E, Soldano S. The Role of M1/M2 Macrophage Polarization in Rheumatoid Arthritis Synovitis. Front Immunol. 2022;13:867260. Chung SJ, Yoon HJ, Youn H, Kim MJ, et al. F-FEDAC as a Targeting Agent for Activated Macrophages in DBA/1 Mice with Collagen-Induced Arthritis: Comparison with F-FDG. J. Nucl. Med, 2018,59(5):839-845 Yin C, Li J, Li S, et al. LncRNA-HOXC-AS2 regulates tumor-associated macrophage polarization through the STAT1/SOCS1 and STAT1/CIITA pathways to promote the progression of non-small cell lung cancer. Cell Signal. 2024;115:111031. Jiang X, Zhou T, Xiao Y, et al. Tim-3 promotes tumor-promoting M2 macrophage polarization by binding to STAT1 and suppressing the STAT1-miR-155 signaling axis. Oncoimmunology. 2016;5(9):e1211219. Li Y, Dong X, He W, et al. Ube2L6 Promotes M1 Macrophage Polarization in High-Fat Diet-Fed Obese Mice via ISGylation of STAT1 to Trigger STAT1 Activation. Obes Facts. 2024;17(1):24-36. Alotaibi BS, Waqas MK, Saleem S, Yasin H, Kharaba Z, Murtaza G. Rheumatoid Arthritis Treatment Potential of Stearic Acid Nanoparticles of Quercetin in Rats. ACS Omega. 2024;9(6):7003-7011. Z. Li, “Experimental acupuncture”, China Press of Traditional Chinese Medicine. 2003;314-316. Littlejohn EA, Monrad SU. Early Diagnosis and Treatment of Rheumatoid Arthritis. Prim Care. 2018;45(2):237-255. Thakur S, Riyaz B, Patil A, Kaur A, Kapoor B, Mishra V. Novel drug delivery systems for NSAIDs in management of rheumatoid arthritis: An overview. Biomed Pharmacother. 2018; 106:1011-1023. Smolen JS, Landewé RBM, Bijlsma JWJ, et al. EULAR recommendations for the management of rheumatoid arthritis with synthetic and biological disease-modifying antirheumatic drugs: 2019 update. Ann Rheum Dis. 2020;79(6):685-699. Ma K, Li L, Liu C, Zhou L, Zhou X. Efficacy and safety of various anti-rheumatic treatments for patients with rheumatoid arthritis: a network meta-analysis. Arch Med Sci. 2019;15(1):33-54. Burmester GR, Pope JE. Novel treatment strategies in rheumatoid arthritis. Lancet. 2017;389(10086):2338-2348. Patel JP, Konanur Srinivasa NK, Gande A, Anusha M, Dar H, Baji DB. The Role of Biologics in Rheumatoid Arthritis: A Narrative Review. Cureus. 2023;15(1):e33293. Baig S, DiRenzo DD. Complementary and Alternative Medicine Use in Rheumatoid Arthritis. Curr Rheumatol Rep. 2020;22(10):61. Deng H, Shen X. The mechanism of moxibustion: ancient theory and modern research. Evid Based Complement Alternat Med. 2013;2013:379291. Wang QM, Gao M, Li SX, Wang B, Xu G, Wen JL. Effect of mild moxibustion with moxa stick and infrared mild moxibustion on skin blood perfusion at Waiguan (TE 5). Zhongguo Zhen Jiu. 2023;43(11):1269-1274. Lin CY, Chen WL, Huang YC, Lim CL, Yang CH. Gum Arabic in combination with IFN-γ promotes the M1 polarization in macrophage. Int J Biol Macromol. 2022;209(Pt A):506-512. de Groot AE, Myers KV, Krueger TEG, Brennen WN, Amend SR, Pienta KJ. Targeting interleukin 4 receptor alpha on tumor-associated macrophages reduces the pro-tumor macrophage phenotype. Neoplasia. 2022;32:100830. Cho KS, Kang SA, Kim SD, Mun SJ, Yu HS, Roh HJ. Dendritic cells and M2 macrophage play an important role in suppression of Th2-mediated inflammation by adipose stem cells-derived extracellular vesicles. Stem Cell Res. 2019;39:101500. Lin W, Shen P, Huang Y, Han L, Ba X, Huang Y, Yan J, Li T, Xu L, Qin K, Chen Z, Tu S. Wutou decoction attenuates the synovial inflammation of collagen-induced arthritis rats via regulating macrophage M1/M2 type polarization. J Ethnopharmacol. 2023;301:115802. Zhu W. The role of different subtypes of macrophages in the pathogenesis of rheumatoid arthritis, Mudanjiang Medical University. 2016. Zhang W, Zhang Y, He Y, Wang X, Fang Q. Lipopolysaccharide mediates time-dependent macrophage M1/M2 polarization through the Tim-3/Galectin-9 signalling pathway. Exp Cell Res. 2019;376(2):124-132. Hua Y, Yuan X, Shen YH, et al. Novel STAT3 Inhibitors Targeting STAT3 Dimerization by Binding to the STAT3 SH2 Domain. Front Pharmacol. 2022;13:836724. Published 2022 May 27. doi:10.3389/fphar.2022.836724 Yan XL, Jia YL, Chen L, et al. Hepatocellular carcinoma-associated mesenchymal stem cells promote hepatocarcinoma progression: role of the S100A4-miR155-SOCS1-MMP9 axis. Hepatology, 2013;57(6):2274-2286. Zhang W, Zhang Y, He Y, Wang X, Fang Q. Lipopolysaccharide mediates time-dependent macrophage M1/M2 polarization through the Tim-3/Galectin-9 signalling pathway. Exp Cell Res, 2019,376(2):124-132. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7764532","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":532155326,"identity":"c28bfcf4-3a1b-47bd-a515-426e803f231d","order_by":0,"name":"Yu-mei Zhong","email":"","orcid":"","institution":"Affiliated Hospital of Integrated Traditional Chinese and Western Medicine of Chengdu University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yu-mei","middleName":"","lastName":"Zhong","suffix":""},{"id":532155327,"identity":"ab37638a-51a9-4643-8f43-6e01ba14719c","order_by":1,"name":"Yan-ding Guo","email":"","orcid":"","institution":"Affiliated Hospital of Integrated Traditional Chinese and Western Medicine of Chengdu University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yan-ding","middleName":"","lastName":"Guo","suffix":""},{"id":532155328,"identity":"ed83fa59-bce4-45b9-a33e-20d8f6024ddd","order_by":2,"name":"Luo Kun","email":"","orcid":"","institution":"Chengdu University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Luo","middleName":"","lastName":"Kun","suffix":""},{"id":532155329,"identity":"0d36cf35-341a-49be-b2f1-9ae7e7e7f4dc","order_by":3,"name":"Xin Yang","email":"","orcid":"","institution":"Chengdu University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Yang","suffix":""},{"id":532155330,"identity":"c9e807c0-ceb0-4063-9035-1bd5f543710b","order_by":4,"name":"Xiu-hua Gao","email":"","orcid":"","institution":"Teaching Hospital of Chengdu University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiu-hua","middleName":"","lastName":"Gao","suffix":""},{"id":532155331,"identity":"a16f916e-f3e8-46f1-a9ff-544c73c83cfa","order_by":5,"name":"Hai-yan Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYDACCQYGZjDJwHyAgQchSJQWtgSgFgOitYAAjwFxWuRnNx+TLqixSOyf3fPxw9u2P/K6DcwHb/Mw2OXh0sI451ia9IxjEokz7pzdLDm3zcBw2wG2ZGsehuRiXFqYJXLMpHnYJBIbbuRuY+ZtM0gwO8ADFGE4kNiAQwsbWMs/icT5N3KeQbXwf8OrhQekhbdNInHDjRw2mC1seLVISKQlW/P2SRhvvJFmLDnnnLHhtsNsxpZzDJJxapGfkQwMn291svNuJD/88KZMTt7sePPDG28q7HBqgQFHhAJwNBkQUA8E9oSVjIJRMApGwYgFAEqLT2GOQtaiAAAAAElFTkSuQmCC","orcid":"","institution":"Chengdu University of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Hai-yan","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2025-10-02 07:38:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7764532/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7764532/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94132429,"identity":"ed9f7c6c-852d-4cfc-847e-4d42383d0d78","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"doc","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4108544,"visible":true,"origin":"","legend":"","description":"","filename":"Themanuscript.doc","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/be4c256aa140f9ee90a38e19.doc"},{"id":94132417,"identity":"3c9c1e1f-8916-4f2e-8ca4-8052893032d7","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7901,"visible":true,"origin":"","legend":"","description":"","filename":"b30cab68fd5a4a65af560a53dfd8e385.json","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/324a73a6771ba96f05d26321.json"},{"id":94132421,"identity":"8e48f355-b62d-48d6-8e46-15900f5fcba3","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":91944,"visible":true,"origin":"","legend":"","description":"","filename":"b30cab68fd5a4a65af560a53dfd8e3851enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/28818f38d2117f89109115ed.xml"},{"id":94133234,"identity":"3a5401d1-5ee2-4bef-bcdc-3e96a6fb4d85","added_by":"auto","created_at":"2025-10-22 18:14:39","extension":"eps","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":393,"visible":true,"origin":"","legend":"","description":"","filename":"drawingimage1.eps","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/d30d54cb01f9e971f0fa19c7.eps"},{"id":94132423,"identity":"1661c7d9-5016-4eb1-a137-1b1747fe7a93","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":183278,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/72873eebe66bae65d2fcb725.jpeg"},{"id":94133235,"identity":"ebeb8c40-120b-493e-b2fb-bda1198de130","added_by":"auto","created_at":"2025-10-22 18:14:39","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":750826,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/f95190f344ac828e581dbe79.jpeg"},{"id":94132427,"identity":"28ae0de6-4f74-4302-bcab-e82c7a1c3166","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1091693,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/1f5da055811632a9d9139af0.jpeg"},{"id":94132430,"identity":"94a8d6fa-c7b4-4e1b-b68c-c9144e7d3171","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2222649,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/a8a635435994fbddf9528608.jpeg"},{"id":94133237,"identity":"c07375cc-d1c8-4a5c-8c3e-be610e1856ee","added_by":"auto","created_at":"2025-10-22 18:14:39","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":121900,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/8a4e9364ca6ff9339d26cc90.jpeg"},{"id":94133412,"identity":"dd5bebdc-c5f0-46c6-ae70-f262af098e6f","added_by":"auto","created_at":"2025-10-22 18:22:39","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1245180,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/c4a9850b228c8595a6289bc0.jpeg"},{"id":94133723,"identity":"71c23f76-b1bb-458b-bb39-878d66f167ef","added_by":"auto","created_at":"2025-10-22 18:30:39","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":965395,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/f7e17475232f43e470be91e1.jpeg"},{"id":94133241,"identity":"192d00ae-12c2-48a9-9776-671049fbad23","added_by":"auto","created_at":"2025-10-22 18:14:39","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41505,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/811340737e090f3127e8c4d8.png"},{"id":94132436,"identity":"07029388-8f7a-4344-88d1-dbf6a05d45b5","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":242242,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/bd20104d3343eb8f28d72c4b.png"},{"id":94132440,"identity":"167c209c-a9f9-41f4-9f62-0caf75fcfc6d","added_by":"auto","created_at":"2025-10-22 18:06:40","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":305390,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/d5b0b42d99af74833b228e3a.png"},{"id":94132438,"identity":"8f0501c1-d127-4866-8888-30d14bd1581b","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":514458,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/cab1f7275fd648a173d37d7c.png"},{"id":94132435,"identity":"451218d0-788f-40bf-a847-1b74d1fdf7a0","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22939,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/932c1156e2994b0ed086ced2.png"},{"id":94132433,"identity":"c78babff-61fa-440f-9331-23d7b75feb4d","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":302678,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/b1f46060e1e589c79bde29f2.png"},{"id":94132441,"identity":"2ea7fbab-6ce0-4458-9052-4c92fac81a74","added_by":"auto","created_at":"2025-10-22 18:06:40","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":221615,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/307063f89c6e1f9128eabdc7.png"},{"id":94132439,"identity":"a9177499-6e17-40d1-976e-af09f4b70feb","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":88021,"visible":true,"origin":"","legend":"","description":"","filename":"b30cab68fd5a4a65af560a53dfd8e3851structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/f9c1abb3ae098429a590f4db.xml"},{"id":94133240,"identity":"7e7070cc-8dc0-457c-bd7b-2e35f9fecd4e","added_by":"auto","created_at":"2025-10-22 18:14:39","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99325,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/14dda21df5290e79e12ba3db.html"},{"id":94132416,"identity":"a9c7e9b9-8fd6-46f5-9842-9dc058ea09a0","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":202259,"visible":true,"origin":"","legend":"\u003cp\u003e(a) depicts the experimental flow chart. (b) represents the moxibustion diagram.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/9ba738e7ce867bad1cbe0671.png"},{"id":94132418,"identity":"e359c5ea-4326-416f-9fbd-2a915a00afb2","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1276109,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of moxibustion on the swell of foot pad and the weight.\u0026nbsp; (c) refers to the redness and swelling symptoms of the foot. (b) represents the trend of body weight. (c) is the foot thickness of rats in each group. Data were expressed as the mean ± SD (\u003cem\u003en\u003c/em\u003e=10). Note: \u003csup\u003e▲▲\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus the Ctrl group; \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus the RA group.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/d2c9ee86654b13493585d5e8.png"},{"id":94133233,"identity":"bc31e9f6-9c57-4344-964d-4b91e921b4df","added_by":"auto","created_at":"2025-10-22 18:14:39","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2157025,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of moxibustion on pathological changes. (a) represents the pathological changes of joint (magnification, ×100 and ×400; scale bar, 100μm and 20μm). (b), (c) and (d) respectively represent the score of synovial tissue proliferation, fibrous tissue proliferation and inflammatory cell infiltration. Data were expressed as the mean ± SD (\u003cem\u003en\u003c/em\u003e=10). Note: \u003csup\u003e▲▲\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus the Ctrl group; \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus the RA group.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/0d1fb164257d8049cd28d127.png"},{"id":94132420,"identity":"3dddfc3c-36b7-402b-85ba-61469d02cafe","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4274808,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of moxibustion on the expression of macrophage marker. (a) and (b) represent the expression of different macrophage markers CD86 and CD206 in synovial tissue (magnification, ×400; scale bar, 20μm). Data were expressed as the mean ± SD (\u003cem\u003en\u003c/em\u003e=10). Arrows represent the positive expression.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/6a90e5c0edb34568215afbd5.png"},{"id":94133411,"identity":"84970ddf-04ba-4fa7-aab6-f9e0e4be27ce","added_by":"auto","created_at":"2025-10-22 18:22:39","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":84214,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of moxibustion on the expression of the related cytokines secreted by macrophage. The levels of IL-10 (a), IL-23(b), and Arg-1(c) in peripheral blood were analyzed by Elisa. Data were expressed as the mean ± SD (\u003cem\u003en\u003c/em\u003e=10). Note: \u003csup\u003e▲\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e▲▲\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus the Ctrl group; \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus the RA group.\u0026nbsp;\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/b790b48d328e9be28774f5ab.png"},{"id":94132426,"identity":"75431485-9f12-457d-9152-5d8250c5727b","added_by":"auto","created_at":"2025-10-22 18:06:39","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5196000,"visible":true,"origin":"","legend":"\u003cp\u003eEffect on the STAT1/miR-155/SOCS1 signaling pathway. (a) represent the expression of STAT1 in synovial tissue (magnification, ×400; scale bar, 25μm). The expression of miR-155 (b) was detected by PCR. Immunohistochemistry was used to examine the expression of SOCS1 (c). Data were expressed as the mean ± SD (\u003cem\u003en\u003c/em\u003e=10). Note: \u003csup\u003e▲▲\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus the Ctrl group; \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus the RA group. Arrows represent the positive expression.\u003c/p\u003e","description":"","filename":"61.png","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/20468fae95694b6275b5e6bb.png"},{"id":94598420,"identity":"1133f73d-37b5-4fd8-8a93-999e5f4965d0","added_by":"auto","created_at":"2025-10-28 18:52:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":18818385,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7764532/v1/3e9b0780-530d-472a-ae51-675cc3ca1d1c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Moxibustion regulates the polarization of macrophages through the STAT1/miR-155/SOCS1 pathway in rheumatoid arthritis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eRheumatoid arthritis (RA) is an autoimmune disease characterized by chronic synovitis. Symptoms such as swelling, pain and stiffness of joints appear in the early stages of the disease. With the progression of the disease, cartilage destruction and bone erosion may occur, eventually leading to severe disability [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Clinical epidemiological data shows that about 1% of the world's population is suffering from RA [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Its morbidity increased by 7.4% from 1990 to 2017 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Studies have found that the risk of cardiovascular disease, fragility fractures and venous thromboembolism among patients with RA has significantly increased [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Due to the complex pathogenesis of RA, it is difficult to cure the disease and is prone to cause multiple tissue and organ damages, which have a significant negative affect on the physical and mental health of patients. It has become a refractory autoimmune disease that is widely concerned in the medical field.\u003c/p\u003e\u003cp\u003eAlthough the pathogenesis of RA is not completely clear, it is generally believed that immune abnormality is the core pathological mechanism. Previous studies have shown that in the development and progression of RA [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], the excessive activation of immune cells causes a state of long-term high response in the body, and a large number of inflammatory cells such as macrophages and lymphocytes appear in the synovium of the affected joints. Macrophage plays an important part in innate immunity and adaptive immunity. When the local micro-environment alters, macrophage can differentiate into phenotype with different functions. Macrophage is categorized as classically activated M1 (pro-inflammatory) and selectively activated M2 (anti-inflammatory) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. When polarized to M1, the macrophage surface molecule CD86 is highly expressed, and a variety of pro-inflammatory cytokines such as IL-23, TNF-α, IL-6, IL-1β are secreted, which accelerates the degradation of extracellular matrix and cell apoptosis, and promotes the development of inflammation[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. When polarized to M2, the macrophage surface molecule CD206 is highly expressed, and promoted the production of arginase 1 (Arg1), IL-10, vascular endothelial growth factor (VEGF), and inhibits the over-activation of immune cells[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. When RA occurs, the balance of macrophage polarization is broken[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], making it hard to resist the inflammatory response of the body. Some scholars believe that visualization of sub-clinical inflamed synovial macrophages can make early diagnosis and therapeutic intervention of RA possible [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Therefore, modulation of macrophage polarization is a feasible strategy to treat RA.\u003c/p\u003e\u003cp\u003eIn recent years, the pathway of macrophage activation induced by STAT1/miR-155/SOCS1 pathway has attracted widespread attention, especially in RA[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Signal transducerand activator of transcription 1(STAT1) is an important protein that connects signal transduction between cell membrane receptors and effectors, and is involved in regulating macrophage polarization, acting upstream of miR-155 and promoting the transcription of miR-155. SOCS1 is an important medium that promotes the production of immunoregulatory cytokine IL-10 and enhances the polarization of M2 macrophages, and is the target of miR-155. SOCS1 is involved in the downstream signaling cascade of STAT1/ miR-155 and mediates the final polarization of macrophages[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The study revealed that polarization induction of mouse bone marrow-derived macrophages (BMDMs) with STAT1 agonist increased the expression of M1 macrophage markers[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].Whether these targets in the STAT1/miR-155/SOCS1 pathway are affected by RA inflammation remains to be explored.\u003c/p\u003e\u003cp\u003eThe decreased polarization of macrophage M2 is a typical manifestation in the RA etiology process. Moxibustion has a good effect on the treatment of RA, but the mechanism is uncertain. Based on these studies, the present study puts forward the hypothesis that \"moxibustion promotes the M2 polarization through STAT1/miR-155/SOCS1 pathway, adjusts the imbalanced immune homeostasis, and exhibits the effect of anti-inflammatory\". This study aims to further explore the mechanism of moxibustion in treating RA.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003e2.1 Animals and experimental groups\u003c/h2\u003e\n \u003cp\u003eSix-week-old male Sprague-Dawley rats (weight, 200\u0026thinsp;\u0026plusmn;\u0026thinsp;20g) were purchased from Chengdu Dasuo Animal Science and Technology Co., Ltd (Chengdu, China) (Permit Number: SCXK 2020-030). The acclimatization time of the rats was one week and they were fed in the room with a temperature of 22\u0026ndash;24℃, a humidity of 20% and natural light dark cycles. These animals were free to eat and drink. All animal procedures were approved by the Ethics Committee of Chengdu University of Traditional Chinese Medicine (Approval Number: 2021-11). The rats were divided into three groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;10): normal rats group (Ctrl); RA rats group (RA); RA rats treated with moxibustion group (Mox).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\"\u003e\n \u003ch2\u003e2.2 Induction of rheumatoid arthritis\u003c/h2\u003e\n \u003cp\u003eThe rats were induced to develop rheumatoid arthritis with foot pad injection of Freund\u0026apos;s complete adjuvant (Sigma Aldrich, St Louis, USA) at 0.5mL/kg on the first day of the experiment[17]. The thickness of the foot pad, redness and swelling were assessed to ensure the development of rheumatoid arthritis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\"\u003e\n \u003ch2\u003e2.3 Moxibustion Method\u003c/h2\u003e\n \u003cp\u003eMoxibustion therapy was employed on the 14th day of the experiment. The location of BL23 and ST36 is based on the standards of the Experimental Acupuncture [18]. BL23 is located 7mm laterally below the spinous process of the second lumbar spine. ST36 is below the knee joint and 6mm beside the anterior tibial muscle. The rat\u0026apos;s fur near the acupoints of BL23 and ST36 was shaved to be convenient for moxibustion. Lighting moxa granules Ω (diameter: 2mm, length: 5mm) were placed on acupoints. Five moxa granules were burned at each point per day by alternating bilateral acupoints for 3 consecutive weeks. There was a day off on the seventh day every week. The rats in the control group, and RA group were fixed for 30 minutes without any therapies. Figure\u0026nbsp;1a and 1b.\u003c/p\u003e\n \u003cp\u003eAfter the treatment of 3 weeks, the rats were anesthetized with isofurane and then sacrificed. 4ml of blood was extracted from the abdominal aorta and put into a centrifuge tube labeled with serial numbers. After one hour, the supernatant was centrifuged and put into a EP tube stored in a refrigerator with a temperature of -20℃. The sample of the ankle was stored in 4% formaldehyde solution. The synovial tissue was put into a cryopreservation tube and frozen in liquid nitrogen, then it was moved to a refrigerator with a temperature of -80℃for preservation.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e2.4 Enzyme-Linked Immunosorbent Assay (Elisa).\u003c/strong\u003e The expression of Arg-1 and IL-23 in serum was detected by ELISA with specific kits (Elabscience Biotechnology Co., Ltd, Wuhan, China) based on the manufacturer\u0026apos;s instructions. Additional Elisa was also applied to detect the expression of IL-4 and IL-10 in serum (Multisciences biotech Co., Ltd, Hangzhou, China).\u003cbr\u003e\u003cstrong\u003e2.5 Histological Analysis.\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe synovial tissue was immersed in the 4% paraformaldehyde solution. In accordance with the standard operating procedures of pathological examination, dehydration, paraffin embedding, the making of 5um thick sections, HE staining, and gum sealing were conducted. The sections were observed with different magnifications. HE staining was used to observe the pathological change of joint and to evaluate the proliferation of synovial tissue and fibrous tissue and the infiltration of inflammatory cell. Images were obtained by using trinocular microscope (Motic).\u003c/p\u003e\n \u003cdiv id=\"Sec6\"\u003e\n \u003ch2\u003e2.6 Real-time PCR analysis.\u003c/h2\u003e\n \u003cp\u003eThe mRNA expression was determined by qPCR analysis. Total RNA was extracted from monocytes by using a Trizol reagent and then reversely transcribed with a cDNA synthesis kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer\u0026rsquo;s protocol. mRNA expression of \u0026beta;-actin and the selected molecules were determined by using SYBR Green Master Mix (Applied Biosystems). Primer sequences were synthesized by Sangon Biotech (Shanghai, China) as follows in Table 1. The PCR cycling reaction conditions were as follows: pre-incubation at 95℃ for 2 min, followed by 40 cycles of denaturation at 95℃ for 30s and 60℃ for 30s, annealing at 55℃ for 30s, and extension at 72℃ for 30s. The relative expression was analyzed with 2\u0026thinsp;\u0026minus;\u0026thinsp;\u003csup\u003e\u0026Delta;\u0026Delta;CT\u003c/sup\u003e method.\u003c/p\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eThe primer sequences of RT-PCR\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003eGene\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003ePrimer sequence\u003cbr\u003e\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003emiR\u0026minus;155\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eForward primer: 5\u0026apos;GCGCGTTAATGCTAATTGTGAT3\u0026apos;\u003cbr\u003eReverse Primer: 5\u0026apos;AGTGCAGGGTCCGAGGTATT3\u0026apos;\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026beta;-actin\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eForward primer: 5\u0026apos;TGTCACCAACTGGGACGATA3\u0026apos;\u003cbr\u003eReverse Primer: 5\u0026apos;GGGGTGTTGAAGGTCTCAAA3\u0026apos;\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec7\"\u003e\n \u003ch2\u003e2.7 Immunofluorescence detection\u003c/h2\u003e\n \u003cp\u003eThe synovial tissue was immersed in 4% paraformaldehyde, and then it was dehydrated, embedded in paraffin and then cut into 5\u0026micro;m thickness. The sections were placed in EDTA for antigen repair. Then, they were blocked with goat serum for 1 h at room temperature. After the blocking procedure was finished, the primary antibodies were added and the sections were incubated at 4\u003csup\u003e\u0026deg;\u003c/sup\u003eC for 24h. The primary antibodies used in the process included anti-CD86 (1:500, Abcam, UK), anti-CD206(1:500, Abcam, UK), anti-STAT1(1:1000, Abcam, UK) and anti-SOCOS1 (1:200, Abcam, UK). The sections were washed with PBS for three times, and then they were incubated with secondary antibody at 37\u003csup\u003e\u0026deg;\u003c/sup\u003eC for 30 min. Then, the nuclei were counter-stained with DAPI. The images were visualized with fluorescence microscope (Nikon Eclipse C1, Japan).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003e2.8 Statistical analysis\u003c/h2\u003e\n \u003cp\u003eData analysis was performed by using SPSS 25.0 software. The data needs to pass the normality test and the homogeneity test of variance. If the data was normally distributed and had homogeneous variances, difference among groups would be assessed by one way ANOVA test followed by LSD post hoc comparison. Kruskal-Wallis test followed by post hoc Mann-Whitney U test would be applied when there was lack of homogeneity of variances. Data were presented as the mean \u0026plusmn; SD. The \u003cem\u003eP\u003c/em\u003e value less than 0.05 was thought to be statistically significant.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1 Effect of moxibustion on the swell of foot pad and the weight\u003c/h2\u003e\n \u003cp\u003eThe joint swelling in rats can indirectly reflect the degree of inflammation. In this study, for the rats with FCA injection, their foot showed obvious redness and swelling (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea) and the rats\u0026apos; weight gain slowed down(Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb), but after the intervention of moxibustion, the redness and swelling symptoms were significantly improved. The rats\u0026apos; foot pad thickness in the moxibustion treatment group decreased (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec) and the rats\u0026apos; weight gain was faster than that of RA group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 Effect of moxibustion on pathological changes\u003c/h2\u003e\n \u003cp\u003eTo explore the protective effect of moxibustion on RA, the researchers applied moxibustion on Zusanli (ST36) and Shenshu (BL23) in RA rats. After 3 weeks\u0026rsquo;s moxibustion treatment, HE staining was used to assessed the the pathological changes of the joint. The result showed that the pathological changes of joint were attenuated after moxibustion treatment (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). The result of joint pathology score revealed that compared with the RA group, the levels of synovial tissue (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb) and fibrous tissue (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec) proliferation and inflammatory cell infiltration (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed) were reduced in Mox group. The results showed that moxibustion could inhibit the pathological changes of synovitis in rats with RA.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3 Effect of moxibustion on the expression of macrophage marker CD86 and CD206\u003c/h2\u003e\n \u003cp\u003eMacrophages are categorized into classically activated M1 and alternatively activated M2 types. When polarized towards the M1 phenotype, the macrophage surface molecule CD86 is highly expressed. Conversely, CD206 is highly expressed when the macrophage is polarized towards the M2 phenotype. The results showed that the expression of CD86 (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea) was up-regulated in RA group compared with the Ctrl group, while the expression of CD206 (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb) was down-regulated. After moxibustion treatment, the expression of macrophages changed, in other words, compared with RA group, the expression of CD206 was increased and the expression of CD86 was decreased ( Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea-\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e3.4 Effect of moxibustion on the expression of the related cytokines Arg-1, IL-10 and IL-23 secreted by macrophage\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eWhen the macrophages were polarized to M2 type, they would over-express Arg-1 and IL-10. When polarized to M1 type, they would over-express IL-23. In this study, the expression levels of Arg-1 and IL-10 in RA group were significantly decreased compared with Ctrl group,while IL-23 was increased. The results of Elisa showed that the content of IL-10 (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea) increased and the content of IL-23 (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb) decreased in Mox group compared with RA group. And the expression of Arg-1 (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec) was slightly increased, but there was no statistical difference. The results indicated that moxibustion could promote the expression of IL-10 and inhabit the expression of IL-23, but it had no effect on the expression of Arg-1.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5 Effect of moxibustion on the STAT1/miR-155/SOCS1 signaling pathway\u003c/h2\u003e\n \u003cp\u003eThe results showed that the expression level of STAT1 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ea) and miR-155 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eb) in RA group was higher than that of the Ctrl group, while the level of SOCS1 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ec) was lower. The expressions of STAT1 and miR-155 were significantly decreased and the expression of SOCS1 was increased in Mox group compared with the RA group. Figure \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea-\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec.\u003c/p\u003e\n\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eRheumatoid arthritis is an immune-mediated, multisystem inflammatory disease that primarily affects the synovium of the joints. The incidence of RA increases with age, and most RA patients suffer from joint dysfunction and systemic complications. Since its etiology is obscure and involves multiple systems, RA is treated with interdisciplinary approach that includes general therapy, pharmacotherapy and operation therapy [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Non-steroidal anti-inflammatory drugs (NSAIDs) and Disease modifying antirheumatic drugs (DMARDs) are important components for the management of RA. Because the NSAIDs have good anti-inflammatory and analgesic effects, they are widely used in the acute phase of RA [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. DMARDs are beneficial in alleviating RA and reducing disease activity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Although these drugs are conducive to the health of patients, there are some limitations. It has been reported that the taking of NSAIDs are associated with increased cardiovascular risks and it has not been proved to have the function of slowing disease progression [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Biologics are the targeted therapeutic drugs for immune cells and cytokines, which have the characteristics of quick onset and good efficacy. As the biologics suppress the immune response, patients who get biological treatment are prone to have bacterial and fungal infections [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Therefore, RA patients treated with routine medication are turning to other substitutes, such as the complementary and alternative medicine (CAM)[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Moxibustion is an external therapy based on the theory of TCM. As a supplementary therapy, its effective mechanism may be associated with the thermal effects, radiation effects and pharmacological actions produced by the burning of moxa and the influence of meridians and acupoints. The theory of TCM holds that moxibustion can invigorate qi and stimulate blood circulation, warm meridians, and regulate yin and yang [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Previous results suggested that moxibustion thermal stimulation affects circulation of the blood and regulates the function of the nerves [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In the present study, we investigated the possible mechanism of moxibustion regulating M2 macrophage polarization in RA rat model.\u003c/p\u003e\u003cp\u003eDuring the pathogenesis of RA, T cells are continuously activated and remain in a state of high response for a long time, causing a large number of inflammatory cells to gather in the joints. Among them, macrophage infiltration is a prominent characteristic in the pathological process of RA. Macrophages, as an important part of innate immunity and adaptive immunity, it is the key factor in chronic inflammation and tissue damage. Macrophages are the resident cells of the healthy synovium. After being stimulated by different conditions, macrophages can transform from a specific phenotype to another phenotype, namely, the classically activated M1 type and the selectively activated M2 type. When polarized to M1 type, it plays an important role in the initiation and development of inflammation by producing a large number of pro-inflammatory cytokines, such as TNF-α, IL-1β, IL-12[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In contrast, the M2 phenotype is usually induced by Th-2 cytokines such as IL-4, IL-10 and IL-13, with high expression of CD206, CD163 and Arg1[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] and has anti-inflammatory effect by inhibiting T cell proliferation and activation and regulating Th2-type immune response[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In the present study, it was found that the expression of M1-type macrophages was up-regulated, while the expression of M2-type macrophages was down-regulated in RA rats. The dynamic equilibrium of macrophage polarization was broken. This differential expression was consistent with the research of Hofkens and Vandooren, that is, in the early stage of inflammation, the polarization of macrophages towards M1-type was enhanced, which weakened the M2-type polarization [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The results of the present study showed that moxibustion of Shenshu (BL23) and Zusanli (ST36) could increase the polarization of M2-type macrophages and inhibit the polarization of M1-type macrophages at the same time. Previous studies demonstrated that the transfer of siRNA IRF5 into the macrophages in RA patients can significantly affect the sub-type conversion of macrophages and alleviate the disease [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The present study results suggested that moxibustion can regulate the polarization of macrophages and relieve the inflammation of RA.\u003c/p\u003e\u003cp\u003eThe polarization of macrophages is regulated by multiple signals, and it has been confirmed that STAT1/miR-155/SOCS1 pathway has a definite effect on the polarization of macrophages[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. STAT1 protein phosphorylation site is tyrosine 701(Tyr701), as an important member of the mediated interferon signal, involved in the regulation of cellular immune response[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The research have revealed that inhibiting the phosphorylation of STAT1 can decrease the expression of miR-155. Thus, the inhibition of SOCS1 was reduced, the expression of Arg-1 and IL-4 was increased, and the polarization of macrophages to M2 was promoted[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Previous studies found that the up-regulation of Tim-3 expression in colon cancer mice inhibited the expression of miR-155 and the activation of STAT1, while the knockdown of SOCS1 conversely inhibited the up-regulation of Arg-1 and IL-10 induced by Tim-3[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In this study, it was found that moxibustion inhibited the expression of STAT1 and miR-155 while promoted SOSC 1 expression, which subsequently up-regulated M2 expression in macrophages and down-regulated M1 expression. Due to the stimulation of local inflammatory micro-environment in RA rats, the polarization of macrophages towards M2 was weakened. Therefore, the expression of M2-type surface marker CD206 and the effector molecules Arg-1 and IL-10 were decreased, while the expression of CD86 was increased, which was consistent with the research results of Zhang et al[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. However, moxibustion treatment can promote the polarization of macrophages to M2 type, reduce the production of pro-inflammatory cytokines, and alleviate the inflammatory response of RA. The results demonstrated that moxibustion treatment may promote the polarization of macrophages to M2 type by regulating the expression of STAT1/miR-155/SOCS1 and alleviate the pathological changes of RA.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe present study demonstrated that moxibustion of Zusanli (ST36) and Shenshu (BL23) acupoints alleviated the pathological changes of the joints in RA rats and had a definite anti-inflammatory effect. Moxibustion regulated the expression of related molecules in the STAT1/miR-155/SOCS1 signaling pathway, regulated the polarization of macrophages, and have anti-inflammatory effects. These findings suggest that moxibustion may serve as a method for RA treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgments \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThanks to Chengdu university of TCM for providing the research platform for the experiment.\u003c/p\u003e\n\u003cp\u003eDeclaration of interest statement\u003c/p\u003e\n\u003cp\u003eThe authors declare no Conflict of interest.\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eAll animal procedures were approved by the Ethics Committee of Chengdu University of Traditional Chinese Medicine (Approval Number: 2020-03).\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eThe authors declare consent for publication.\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials\u003c/p\u003e\n\u003cp\u003eAll data are available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003eFunding\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis work was supported by the grants from the National Natural Science Foundation of China (No.82405558, N0.81973959),the grant from Sichuan Provincial Administration of Traditional Chinese Medicine (25MSZX208), the joint fund of Chengdu University of Traditional Chinese Medicine (No.LH202402023) and the Key Research and Development Support Program of Chengdu Science and Technology Bureau (No.2024-YF05-00922-SN).\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp\u003eHY Z contributed to the conception and design of the study. Experimental operation: YM Z and YD G. Moxibustion therapy: K L and XU G. Statistical analysis: J Z and XH G. Manuscript Draft: YM Z. X Y provided critical insights. The authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGwinnutt JM, Norton S, Hyrich KL, Lunt M, Combe B, Rincheval N, Ruyssen-Witrand A, Fautrel B, McWilliams DF, Walsh DA, Nikiphorou E, Kiely PDW, Young A, Chipping JR, MacGregor A, Verstappen SMM. Exploring the disparity between inflammation and disability in the 10-year outcomes of people with rheumatoid arthritis. Rheumatology (Oxford). 2022;61(12):4687-4701. \u003c/li\u003e\n\u003cli\u003eravallese, E.M. and G.S. Firestein, Rheumatoid Arthritis - Common Origins, Divergent Mechanisms. N Engl J Med. 2023. 388(6): 529-542.\u003c/li\u003e\n\u003cli\u003eMoradi-Lakeh M, Forouzanfar MH, Vollset SE, El Bcheraoui C, et al. Burden of musculoskeletal disorders in the Eastern Mediterranean Region, 1990-2013: findings from the Global Burden of Disease Study 2013. Ann Rheum Dis. 2017;76(8):1365-1373.\u003c/li\u003e\n\u003cli\u003eMurphy L. Cardiovascular disease risk in rheumatoid arthritis. Br J Nurs. 2022;31(4):190-192. \u003c/li\u003e\n\u003cli\u003eIshizu H, Shimizu H, Shimizu T, Ebata T, Ogawa Y, Miyano M, Arita K, Ohashi Y, Iwasaki N. Rheumatoid arthritis is a risk factor for refracture in patients with fragility fractures. Mod Rheumatol. 2022;32(6):1017-1022. \u003c/li\u003e\n\u003cli\u003eKetfi C, Boutigny A, Mohamedi N, Bouajil S, Magnan B, Amah G, Dillinger JG. Risk of venous thromboembolism in rheumatoid arthritis. Joint Bone Spine. 2021;88(3):105122. \u003c/li\u003e\n\u003cli\u003eWoo SJ, Noh HS, Lee NY, Cheon YH, et al. Myeloid sirtuin 6 deficiency accelerates experimental rheumatoid arthritis by enhancing macrophage activation and infiltration into synovium. EBioMedicine, 2018,38:228-237. \u003c/li\u003e\n\u003cli\u003eWeyand CM, Zeisbrich M, Goronzy JJ. Metabolic signatures of T-cells and macrophages in rheumatoid arthritis. Curr Opin Immunol. 2017;46:112-120. \u003c/li\u003e\n\u003cli\u003eYunna C, Mengru H, Lei W, Weidong C. Macrophage M1/M2 polarization. Eur J Pharmacol. 2020;877:173090. \u003c/li\u003e\n\u003cli\u003eMeng M, Cao Y, Zhang Y, et al. HnRNPA2B1 Aggravates Inflammation by Promoting M1 Macrophage Polarization. Nutrients. 2023;15(7):1555. \u003c/li\u003e\n\u003cli\u003eLi J, Ren H, Zhang Z, Zhang J, Wei F. Macrophage M2 polarization promotes pulpal inflammation resolution during orthodontic tooth movement. J Cell Mol Med. 2024;28(9):e18350. \u003c/li\u003e\n\u003cli\u003eCutolo M, Campitiello R, Gotelli E, Soldano S. The Role of M1/M2 Macrophage Polarization in Rheumatoid Arthritis Synovitis. Front Immunol. 2022;13:867260.\u003c/li\u003e\n\u003cli\u003eChung SJ, Yoon HJ, Youn H, Kim MJ, et al. F-FEDAC as a Targeting Agent for Activated Macrophages in DBA/1 Mice with Collagen-Induced Arthritis: Comparison with F-FDG. J. Nucl. Med, 2018,59(5):839-845\u003c/li\u003e\n\u003cli\u003eYin C, Li J, Li S, et al. LncRNA-HOXC-AS2 regulates tumor-associated macrophage polarization through the STAT1/SOCS1 and STAT1/CIITA pathways to promote the progression of non-small cell lung cancer. Cell Signal. 2024;115:111031. \u003c/li\u003e\n\u003cli\u003eJiang X, Zhou T, Xiao Y, et al. Tim-3 promotes tumor-promoting M2 macrophage polarization by binding to STAT1 and suppressing the STAT1-miR-155 signaling axis. Oncoimmunology. 2016;5(9):e1211219. \u003c/li\u003e\n\u003cli\u003eLi Y, Dong X, He W, et al. Ube2L6 Promotes M1 Macrophage Polarization in High-Fat Diet-Fed Obese Mice via ISGylation of STAT1 to Trigger STAT1 Activation. Obes Facts. 2024;17(1):24-36.\u003c/li\u003e\n\u003cli\u003eAlotaibi BS, Waqas MK, Saleem S, Yasin H, Kharaba Z, Murtaza G. Rheumatoid Arthritis Treatment Potential of Stearic Acid Nanoparticles of Quercetin in Rats. ACS Omega. 2024;9(6):7003-7011. \u003c/li\u003e\n\u003cli\u003eZ. Li, \u0026ldquo;Experimental acupuncture\u0026rdquo;, China Press of Traditional Chinese Medicine. 2003;314-316.\u003c/li\u003e\n\u003cli\u003eLittlejohn EA, Monrad SU. Early Diagnosis and Treatment of Rheumatoid Arthritis. Prim Care. 2018;45(2):237-255. \u003c/li\u003e\n\u003cli\u003eThakur S, Riyaz B, Patil A, Kaur A, Kapoor B, Mishra V. Novel drug delivery systems for NSAIDs in management of rheumatoid arthritis: An overview. Biomed Pharmacother. 2018; 106:1011-1023. \u003c/li\u003e\n\u003cli\u003eSmolen JS, Landew\u0026eacute; RBM, Bijlsma JWJ, et al. EULAR recommendations for the management of rheumatoid arthritis with synthetic and biological disease-modifying antirheumatic drugs: 2019 update. Ann Rheum Dis. 2020;79(6):685-699. \u003c/li\u003e\n\u003cli\u003eMa K, Li L, Liu C, Zhou L, Zhou X. Efficacy and safety of various anti-rheumatic treatments for patients with rheumatoid arthritis: a network meta-analysis. Arch Med Sci. 2019;15(1):33-54. \u003c/li\u003e\n\u003cli\u003eBurmester GR, Pope JE. Novel treatment strategies in rheumatoid arthritis. Lancet. 2017;389(10086):2338-2348.\u003c/li\u003e\n\u003cli\u003ePatel JP, Konanur Srinivasa NK, Gande A, Anusha M, Dar H, Baji DB. The Role of Biologics in Rheumatoid Arthritis: A Narrative Review. Cureus. 2023;15(1):e33293. \u003c/li\u003e\n\u003cli\u003eBaig S, DiRenzo DD. Complementary and Alternative Medicine Use in Rheumatoid Arthritis. Curr Rheumatol Rep. 2020;22(10):61. \u003c/li\u003e\n\u003cli\u003eDeng H, Shen X. The mechanism of moxibustion: ancient theory and modern research. Evid Based Complement Alternat Med. 2013;2013:379291. \u003c/li\u003e\n\u003cli\u003eWang QM, Gao M, Li SX, Wang B, Xu G, Wen JL. Effect of mild moxibustion with moxa stick and infrared mild moxibustion on skin blood perfusion at Waiguan (TE 5). Zhongguo Zhen Jiu. 2023;43(11):1269-1274. \u003c/li\u003e\n\u003cli\u003eLin CY, Chen WL, Huang YC, Lim CL, Yang CH. Gum Arabic in combination with IFN-\u0026gamma; promotes the M1 polarization in macrophage. Int J Biol Macromol. 2022;209(Pt A):506-512. \u003c/li\u003e\n\u003cli\u003ede Groot AE, Myers KV, Krueger TEG, Brennen WN, Amend SR, Pienta KJ. Targeting interleukin 4 receptor alpha on tumor-associated macrophages reduces the pro-tumor macrophage phenotype. Neoplasia. 2022;32:100830. \u003c/li\u003e\n\u003cli\u003eCho KS, Kang SA, Kim SD, Mun SJ, Yu HS, Roh HJ. Dendritic cells and M2 macrophage play an important role in suppression of Th2-mediated inflammation by adipose stem cells-derived extracellular vesicles. Stem Cell Res. 2019;39:101500. \u003c/li\u003e\n\u003cli\u003eLin W, Shen P, Huang Y, Han L, Ba X, Huang Y, Yan J, Li T, Xu L, Qin K, Chen Z, Tu S. Wutou decoction attenuates the synovial inflammation of collagen-induced arthritis rats via regulating macrophage M1/M2 type polarization. J Ethnopharmacol. 2023;301:115802. \u003c/li\u003e\n\u003cli\u003eZhu W. The role of different subtypes of macrophages in the pathogenesis of rheumatoid arthritis, Mudanjiang Medical University. 2016.\u003c/li\u003e\n\u003cli\u003eZhang W, Zhang Y, He Y, Wang X, Fang Q. Lipopolysaccharide mediates time-dependent macrophage M1/M2 polarization through the Tim-3/Galectin-9 signalling pathway. Exp Cell Res. 2019;376(2):124-132. \u003c/li\u003e\n\u003cli\u003eHua Y, Yuan X, Shen YH, et al. Novel STAT3 Inhibitors Targeting STAT3 Dimerization by Binding to the STAT3 SH2 Domain. Front Pharmacol. 2022;13:836724. Published 2022 May 27. doi:10.3389/fphar.2022.836724\u003c/li\u003e\n\u003cli\u003eYan XL, Jia YL, Chen L, et al. Hepatocellular carcinoma-associated mesenchymal stem cells promote hepatocarcinoma progression: role of the S100A4-miR155-SOCS1-MMP9 axis. Hepatology, 2013;57(6):2274-2286. \u003c/li\u003e\n\u003cli\u003eZhang W, Zhang Y, He Y, Wang X, Fang Q. Lipopolysaccharide mediates time-dependent macrophage M1/M2 polarization through the Tim-3/Galectin-9 signalling pathway. Exp Cell Res, 2019,376(2):124-132. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Rheumatoid arthritis, macrophage polarization, moxibustion, inflammation","lastPublishedDoi":"10.21203/rs.3.rs-7764532/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7764532/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Rheumatoid arthritis (RA) is a chronic autoimmune disease characterized by persistent synovitis. Moxibustion is a natural therapy that exhibits anti-inflammatory bioactivity. However, the mechanism of moxibustion in the treatment of RA still needs further study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective:\u003c/strong\u003e This study aimed to observe the effects of moxibustion on macrophage polarization and the STAT1/miR-155/SOCS1 signaling pathway in rats with RA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eThe rats' right hind paws were injected with freundʼs complete adjuvant (FCA) to establish the model of RA. Seven days post-FCA injection, moxibustion therapy was performed on the acupoints of Shenshu (BL23) and Zusanli (ST36) once a day for three weeks. The thickness of the foot pad, histopathological changes and inflammatory cytokines were then analyzed. The Immunofluorescence and Elisa were employed to evaluate the impact of moxibustion on the expression of macrophage's markers and the expression of molecules related to the STAT1/miR-155/SOCS1 signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eFollowing the injection of FCA, it was observed that the thickness of the foot pad increased, the joint space narrowed, and a significant number of inflammatory cells infiltrated the area. However, after the moxibustion treatment, these symptoms were improved. Additionally, the levels of IL-23 were down-regulated, while the levels of IL-4, IL-10, and Arginase (Arg)-1 were up-regulated. The polarization balance of macrophages in the RA rats was disrupted, with a stronger polarization towards M1 and a weaker polarization towards M2. Post-moxibustion treatment, the polarization of macrophages was corrected, characterized by an increase in M2-polarized macrophages and a decrease in M1-polarized macrophages. Furthermore, moxibustion inhibited the expression of STAT1 and miR-155 within the STAT1/miR-155/SOCS1 pathway and promoted the expression of SOCS1, which was conducive to regulating the polarization phenotype of macrophages.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThe results demonstrated that moxibustion regulated the polarization phenotype of macrophages and exhibited anti-inflammatory effects, which may be related to the regulation of macrophage polarization through the STAT1/miR-155/SOCS1 pathway.\u003c/p\u003e","manuscriptTitle":"Moxibustion regulates the polarization of macrophages through the STAT1/miR-155/SOCS1 pathway in rheumatoid arthritis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-22 18:06:34","doi":"10.21203/rs.3.rs-7764532/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"14c04ead-23b1-4087-a252-7b007be6d13f","owner":[],"postedDate":"October 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-28T18:17:02+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-22 18:06:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7764532","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7764532","identity":"rs-7764532","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.