The Doublesex sex determination pathway regulates reproductive division of labor in honey bees

The Doublesex sex determination pathway regulates reproductive division of labor in honey bees | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The Doublesex sex determination pathway regulates reproductive division of labor in honey bees View ORCID Profile Mariana Velasque , View ORCID Profile Lijun Qiu , View ORCID Profile Alexander S. Mikheyev doi: https://doi.org/10.1101/314492 Mariana Velasque 1 Ecology and Evolution Unit, Okinawa Institute of Science and Technology , 1919-1 Tancha, Onna, Kunigami District, Okinawa 904-0412, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Mariana Velasque Lijun Qiu 1 Ecology and Evolution Unit, Okinawa Institute of Science and Technology , 1919-1 Tancha, Onna, Kunigami District, Okinawa 904-0412, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Lijun Qiu Alexander S. Mikheyev 1 Ecology and Evolution Unit, Okinawa Institute of Science and Technology , 1919-1 Tancha, Onna, Kunigami District, Okinawa 904-0412, Japan 2 Evolutionary Genomics Lab, Research School of Biology, Australian National University , Acton, ACT 2601, Australia Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Alexander S. Mikheyev Abstract Full Text Info/History Metrics Preview PDF Abstract Eusociality, the ultimate level of social organization, requires reproductive division of labor, and a sophisticated system of communication to maintain societal homeostasis. Reproductive division of labor is maintained by physiological differences between reproductive and sterile castes, typically dictated by pheromonal queen fertility signals that suppress worker reproduction. Intriguingly, reproduction and pheromonal signalling share regulatory machinery across insects.The gene Doublesex ( Dsx ) controls somatic sex determination and differentiation, including the development of ovaries and secondary sexual characteristics, such as pheromonal signalling. We hypothesized that this regulatory network was co-opted during eusocial evolution to regulate reproductive division of labor. Taking advantage of the breakdown in reproductive division of labor that occurs in honey bees when workers commence to lay eggs in the absence of a queen, we knocked down Dsx to observe effects on ovary development and fertility signal production. As expected, treated workers had lower levels of egg yolk protein, for which Dsx is a cis-regulatory enhancer in other insects, and greatly reduced ovary development. Also as expected, while control workers increased their levels of pheromonal fertility signals, treated workers did not, confirming the role of Dsx in regulating pheromone biosynthesis. We further found that Dsx is part of a large network enriched for regulatory proteins, which is also involved during early larval development, and upregulated in queen-destined larvae. Thus, the ancient developmental framework controlling sex specification and reproduction in solitary insects has been exapted for eusociality, forming the basis for reproductive division of labor and pheromonal signalling pathways. Significance statement Complex social insect societies rely on division of reproductive labor among their members. Reproductive individuals (‘queens’) suppress ‘worker’ reproduction using pheromonal fertility signalling. We show that an ancient regulatory network that controls specification of sex and secondary sexual characteristics in solitary insects, has been co-opted for both both pheromonal signalling and ovary inactivation in honey bees. In addition, this network is also active during caste specification that takes place during the first few days of larval life. These results show that pheromonal signalling and ovary development share a common regulatory framework, potentially explaining why fertility signalling is ‘honest.’ Furthermore, they show that higher levels of biological complexity can arise by rewiring and elaborating ancestral gene regulatory networks. Introduction Eusociality has evolved multiple times across animal lineages, reaching its pinnacle in the social insects. It features ‘queen’ and ‘worker’ castes, which perform reproductive and provisioning tasks, respectively. These castes differ physiologically, with workers forming the disposable ‘somata’ of these societal superorganisms, and queens the ‘germlines.’ The organization of complex social insect societies depends on sophisticated communication systems that modulate reproductive output and other aspects of colony function. Because chemical communication generally evolves rapidly ( 1 , 2 ), and the evolutionary origins of castes are much older, most studies have addressed these aspects of social function separately. However, recent work has demonstrated that queen pheromones are structurally conserved across lineages that independently evolved eusociality, and that pheromonal communication may be pleiotropically linked with caste physiology ( 3 – 6 ). These observations suggest that the two may be controlled by a common regulatory network dating back to solitary ancestors. Ancestrally, solitary females performed both reproductive and provisioning behaviors, which became decoupled into the queen and worker castes of eusocial colonies (the “ovarian ground plan hypothesis”) ( 7 ). This transition may have involved elaboration of a common ancient “genetic toolkit” across different eusocial lineages( 8 ). Building on this hypothesis, over a decade of studies have identified a large number of candidate genes, which include members of nutrient-sensing and juvenile hormone signalling pathways, storage proteins, and a DNA methyltransferase (reviewed in ref. 9 ). However, the pleiotropic interaction between gene regulatory networks, which control caste and pheromonal signalling, has not received much attention until relatively recently, though hormone levels and fertility signalling were shown to be coupled in ants and wasps ( 4 , 5 ). Queen pheromones are honest signals of an individual’s reproductive status (reviewed in ref. 10 ). On one hand, such honesty could lead to the optimal function of a colony, as it allows workers to replace under-performing queens. On the other hand, honest signalling may enable policing of worker reproduction by nestmates. For example, in honey bees under a range of circumstances, workers may activate ovaries in an attempt to reproduce independently by laying male-destined eggs ( 11 ). However, the chemical signatures of laying workers become more queen-like ( 12 ), and they risk execution by their nestmates ( 13 , 14 ). So why should workers advertise their fertility? One possibility is that, unlike many other traits of the solitary ancestor that became decoupled in queens and workers, pheromones and fertility remain functionally linked due to gene regulatory constraints( 6 ). This link is most plausibly seen in the honey bee, where sex and queen pheromones have been studied most extensively. The queen mandibular pheromone (QMP), acts as both a queen pheromone, suppressing worker reproduction, and as a sex pheromone, attracting males during nuptial flights ( 15 ). Surprisingly, both QMP biological functions may be deeply conserved, as QMP can inhibit ovary activation and attract males in fruit flies ( 16 , 17 ). While the molecular mechanisms by which QMP acts as a queen pheromone remain poorly understood, these findings suggest an ancestral function involving both sexual attraction and fertility signalling by the same suite of chemicals. A functional link between fertility and sexual signalling should generally be adaptive in solitary insect females, which have little incentive to hide their reproductive status from potential mates. Indeed, across insect orders, doublesex ( Dsx ), the transcription factor that regulates sexual differentiation in somatic tissues and also controls female sex pheromone production and reception ( 18 , 19 ), further binds to cis -regulatory enhancers of egg yolk proteins ( 20 – 22 ). Based on these observations we hypothesized that Dsx and associated genes may have been co-opted during evolution of reproductive division of labor. This model could parsimoniously explain both reproductive division of labor though worker ovary inactivation, and the concomitant evolution of pheromonal communication systems among a variety of social insects. We experimentally tested this hypothesis in honey bees. In the absence of a queen, reproductive division of labor breaks down as young workers activate ovaries and commence to lay male-destined eggs, while producing a queen-like blend of mandibular pheromone components ( 12 ). We predicted that RNAi-mediated Dsx knockdown would inhibit worker ovary development, specifically by reducing vitellogenin (Vg) expression, because a well-established cis-regulatory link between Dsx and egg yolk protein (specifically Vg) exists ( 20 – 22 ). We also predicted that Dsx knockdown should reduce the amount of queen-like mandibular pheromone produced by workers. We find support for both hypotheses, illustrating the central role of Dsx in the reproductive division of labor. We then used this experimental perturbation to characterize its role in the gene regulatory network of honey bees. Intriguingly, genes involved in this network also play a role during caste determination in young larvae. These data suggest that honey bee eusociality exapted ancient core developmental networks, specifically those involved in sex specification. Results Supplementary figures and tables along with the R code necessary to generate them are hosted on http://mikheyevlab.github.io/dsx-rnai/ . Validation of Dsx knockdown and Vg response We sequenced twenty libraries split evenly among treatment and control groups on an Illumina HiSeq 2500 sequencer at the OIST Sequencing Center (SQC). The experiment yielded 3.5×10 7 ± 4.7×10 6 (s.d.) RSEM-mapped single-end reads per library. The overall fit of observed vs. expected spike-in controls transcripts explained 87% of the variance, indicating adequate technical performance. The fit did not increase at subsequent abundance cutoffs; therefore, we used data for downstream analyses without additional filtration. We detected significantly lower Dsx expression in RNAi-treated worker abdomens using both the RSEM/edgeR and Kallisto/Sleuth pipelines ( Figure 1A ). Levels of Vg were also significantly lower in bees where Dsx was knocked down, and were strongly correlated with those of Dsx , as predicted ( Figure 1B ). Download figure Open in new tab Figure 1 Dsx knockdown confirms the regulatory link between Dsx and Vg in honey bees. (A) RNA-seq confirmed that mean expression levels of Dsx were reduced 43.3% relative to GFP-injected controls (measured in Transcripts Per Million (TPM) mapped reads). (B) As predicted, expression of Dsx and Vg were tightly linked overall, and Vg expression levels were significantly lower in Dsx- knockdown bees (one-tailed p = 0.0082). Vg is an egg yolk precursor, and its levels in workers are strongly socially repressed in queenright colonies ( 69 ). These data support the central role of Dsx in honey bee physiology, in part by direct control of Vg , a key gene involved in coordinating diverse aspects of social organization ( 49 , 50 ). Ovary and pheromonal activation Queens and workers can produce overlapping sets of mandibular components, but major axes of variation successfully separate the two castes, and some components serve to discriminate fertility levels (reviewed in ref. 23 ). The first two principal component axes summarizing pheromonal variation in our data, explained 74% of the variance (49.5% and 24.9%, respectively). The first principal component (PC1) was correlated with 10-HDAA, 10-HDA, 9-HDA and HOB (r = 0.27, 0.25, 0.20 and 0.25, respectively) (Table S1). 10-HDA and 10-HDAA are worker-typical components ( 24 , 25 ). Therefore, PC1 is most correlated with axes of worker mandibular gland pheromone variation. The second principal component (PC2) was strongly correlated with MGP components 9-HDA, 9-ODA and HVA (r = 0.26, 0.37 and 0.17, respectively). Greater levels of 9-HDA and HVA are associated with fecundity in queens ( 26 ), and 9-ODA is the ‘canonical’ queen mandibular pheromone in the bouquet used to attract males ( 15 ). Therefore higher values along the PC2 axis indicate more queen-like mandibular gland pheromone profiles. Pheromonal profile and ovary activation are often linked ( 26 , 27 ), but the specific relationship between pheromone profile composition and ovary activation stage is unknown. Therefore we simultaneously analyzed both phenotypic responses via a cumulative link principal component regression model and ovary activation stage as the response variable. To account for correlations among mandibular pheromone compounds (Figure S2), first two principal components were used as predictors, along with Dsx knockdown treatment, and interactions ( Figure 2 ; Table S2). Dsx knockdown resulted in lower ovary development when compared to the non-target control gene (Z = 3.1, one-tailed p = 0.0011) and more worker-like scores on the PC2 axis (Z=-2.2, one-tailed p=0.015). Furthermore, there was a significant interaction between these two explanatory variables (Z = 2.3, p = 0.021), which meant that Dsx -knockdown disrupted the relationship between ovary activation level and the amount of pheromone produced. This can be seen in Figure 2 , where control workers show the typical positive association between ovary activation and queen-like mandibular pheromone production, and Dsx -knockdown workers show the opposite pattern. Download figure Open in new tab Figure 2 Dsx knockdown decreases ovary development and production of queen-like mandibular gland components. (A) Worker ovary activation stage. Stage 0 represents underdeveloped ovaries typical of young workers. Stage 1 represents enlarged ovaries. Stage 2 represents ovaries that have begun to develop, containing small oocytes, and Stage 3 denotes developed ovaries with eggs. (B) Ovary activation was significantly lower in Dsx -injected samples vs. controls, indicating that Dsx controls ovary development, as predicted (Z = 3.1,one-tailed p = 0.0011). (C) Higher values along the second principal component axis corresponded to more queen-like mandibular gland profiles (red circle outlines) ( 26 , 70 ). Circle size represents the relative total amount of each component. (D) Dsx knockdown affected the relationship between ovary activation stage and levels of queen-like mandibular pheromones. Box plots show medians and ranges capturing 75% and 95% of the variation, with dashed trend lines showing robust linear model fits to help visualize trends. Our major prediction, that levels of queen mandibular pheromones (QMP) would be lower in treated bees was confirmed (Z = −2.16, one-tailed p = 0.0011). Typically, when workers start to lay eggs, they produce more mandibular pheromone components ( 12 ). However, the relationship between ovary activation stage and pheromonal production, and whether Dsx alters this relationship are unknown. Therefore we included an interaction term (Treatment×PC2) in the model to investigate it. The slope of the relationship was indeed different for Dsx -treated workers, also suggesting that Dsx regulates QMP production, but perhaps not as a simple on-off switch (Z = 2.3, p = 0.021). Given that Dsx controls both fertility signalling and ovary development in other insect orders ( 18 , 20 – 22 ) , our data show that Dsx retained these ancestral functions, although the significant interaction term suggests the potential for additional regulatory elaboration over pheromone production. These changes were not likely due to differences in vitality between the two treatment groups, as they did not differ significantly in mortality (Z = 0.083, p = 0.93, Table S3). Overall mortality levels were similar to other RNAi studies (e.g. ( 28 , 29 ) and within the range expected for the diet ( 30 ). Identifying the Dsx -responsive gene regulatory network Weighted gene co-expression analysis (WGCNA) takes advantage of correlations between gene expression patterns of genes across libraries to identify ‘modules’ of genes showing similar expression profiles ( 31 ). WGCNA has been shown to reconstruct protein-protein interaction networks with reasonable accuracy, based solely on gene expression data ( 32 , 33 ). Therefore, WGCNA allowed us to examine the gene regulatory network surrounding Dsx. In particular we took advantage of the concept of ‘module membership’, which is the overall connectedness of a gene to other members of the same network. More important genes tend to have greater membership. WGCNA identified a network containing Dsx and 966 other genes, out of a total of 13,811 (Table S4). Genes in this network were generally over-expressed in control bees, and their module membership was strongly correlated with the log2 fold-count of control vs. treated gene expression, i.e. , genes most involved in the network showed the greatest responses to Dsx knockdown ( Figure 3 ). This module also contained Vg , as would be expected, due to its tight regulation by Dsx . It also contained another well-known gene that was experimentally shown to affect caste, the DNA methyltransferase Dnmt3 ( 34 ) (Table S5). Within the co-expression module, Dsx was part of a tightly connected network of transcription factors and other regulatory proteins (Figure S3). Overall, the module was enriched for gene ontology terms associated with regulation, particularly of transcription, and signalling (Table S6). Genes in this module were upregulated in control bees, and genes that were more tightly connected to other genes in the module were more likely to respond to Dsx knockdown ( Figure 3A ). Therefore, sensitivity to Dsx knockdown is a core property of this module. Download figure Open in new tab Figure 3 Co-expression networks surrounding Dsx are associated with reproductive division of labor in adults and during larval caste differentiation. (A) The Dsx- responsive module identified from experimental data showed a strong correlation between module membership and differential expression log-fold count (control vs. knockdown). Point color indicates the number of data points in each hexagon (up to a maximum of 20 in the lightest-colored ones). Most fold-count values are positive, indicating that these were generally upregulated in control bees ( i.e. , in reproductively active workers). Module membership measures the extent to which a gene’s expression is correlated with that of other genes in the module. Genes most deeply integrated into the module were also most affected by the experimental treatment, indicating that responsiveness to Dsx knockdown is a core feature of this module. As expected, in addition to Dsx , this module also contained Vg, because expression of both genes is correlated ( Figure 1B ), and dnmt3 , which has been shown to affect caste determination ( 34 ). Figure S1 shows an interactive version of panel A. (B) The Dsx -responsive responsive module that was experimentally identified in adults significantly overlapped a large Dsx -containing module comprising queen-biased genes that is active during early larval development. This suggests that regulatory mechanisms involved in reproductive differentiation in adults and larvae significantly overlap and may share a common core. Does Dsx play a role during larval caste differentiation? In honey bees caste differentiation takes place during early larval development. We asked whether mechanisms identified for maintaining reproductive division of labor in adults also play a role at that stage. While a previous study looking at gene expression during larval caste specification found no differential expression of Dsx ( 35 ) , in our experimental perturbation, we found that the gene-level signal was relatively weak ( Figure 1A ), possibly due to tissue-specific expression of Dsx ( 36 ) , but the network-level signal and its effects were dramatic ( Figure 3A ). Therefore we asked whether the Dsx -sensitive module present in adults might also play a similar role in the context of larval caste determination. We examined module preservation in two ways. First, we used an integrated statistic (Z summary ) in the WGCNA package ( 31 ), which tests for preservation of a given module in expression data. According to this test, the Dsx- responsive module detected in our experiment was strongly preserved in whole-body larval gene expression data ( 35 ), meaning that it was also co-expressed in 2 and 4 day old queen- and worker-destined larvae (p = 9.9×10 −7 ). In 4-day old larvae, which have committed to their caste-specific developmental trajectories, these genes were generally upregulated in future queens (rho = 0.083, p = 0.015). Second, we performed WGCNA on the same data set, and identified a large module that contained Dsx (Table S7). Membership in this module was likewise correlated with queen development (rho = 0.049, p = 0.0023). Half of the genes (50.5%) from the experimentally identified Dsx -responsive adult module, were found in this developmental module ( Figure 3B ). These results suggest that similar gene regulatory networks play a role in both adult and larval caste differentiation, and are involved in inducing reproductive phenotypes in both cases. Major royal jelly protein also responds to Dsx knockdown A number of genes have been experimentally shown to affect larval caste determination in honey bees (reviewed in ref. 9). From that list, only Vg and Dnmt3 were part of the co-expression module containing Dsx . Though part of a different module, major royal jelly protein ( Mrjp1 ) was also upregulated in control bees (log 2 fold-count = 2.78, p = 0.0036). This gene shows caste-specific expression and its monomeric form is a key dietary component inducing queen development ( 37 ). Discussion While primary mechanisms of insect sex determination are diverse, they always converge on the Dsx pathway, which involves the regulation of various sexually dimorphic traits ( 38 ). Insects have co-opted Dsx for a variety of different functions, ranging from sexual ornamentation in beetles ( 39 – 41 ), to butterfly wing patterning ( 42 ). Importantly, Dsx regulates ovary development and the production of sex pheromones ( 18 , 20 – 22 ). Consequently, the Dsx pathway provides an ancient gene regulatory framework coupling two building blocks of eusociality – differential fertility and pheromonal signalling. We thus hypothesized that it has also been co-opted during the evolution of eusociality. Experimental knockdown of Dsx confirmed that it regulates ovary activation, likely by regulating the egg yolk precursor Vg ( Figure 1 ), and in pheromonal signalling in adult workers ( Figure 2 ). We identified a Dsx -responsive gene co-expression module that is enriched in gene ontology terms associated with biological regulation ( Figure 3A ). This module is also preserved in larval gene expression data, and is specifically associated with the queen-destined developmental trajectory ( Figure 3B ). These data suggest that in honey bees, reproductive division of labor evolved by taking advantage of existing sex-specific developmental regulatory networks. Social evolution may have taken advantage of a ‘genetic toolkit’ consisting of ancient gene regulatory networks that have been re-wired for social living ( 8 , 43 ). Although many studies have provided support for this hypothesis, the components comprising this toolkit and how they interact remain unclear ( 9 , 44 , 45 ). Putative genes in the genetic toolkit that have been identified to date are enriched in members of nutrition and juvenile hormone-signalling pathways (reviewed in ref. 9), all of which act downstream of Dsx during development. For example, Vg is a key toolkit genes, and under its direct Dsx control. Other genes that have been experimentally shown to affect caste, such as Dnmt3 and Mrjp1 also responded to Dsx knockdown suggesting that they interact with it either directly or indirectly. Studies on horned beetles have shown that Dsx interacts with nutritional levels to produce alternative phenotypes, i.e. , the size of horns ( 40 , 46 ). This likely also happens in honey bees, since Vg is sensitive to nutritional state in a variety of insects, including honey bees ( 47 , 48 ). Furthermore, Dsx can indirectly control other aspects of colony function via Vg , which has many coordinating effects on social organization ( 49 , 50 ). Dsx is a nexus in insect development and physiology, interacting with a wide range of other regulatory proteins ( 38 ) (Table S6). Highly connected genes are expected to experience evolutionary constraints as a result of pleiotropic interactions ( 51 , 52 ). Thus, interconnectedness of Dsx may impose constraints on how traits under its control evolve, since they are coupled to a conserved ancestral gene regulatory network. This functional constraint could explain why fertility signalling by queens is honest, and even why ‘cheating’ reproductive workers advertise their behavior despite the risk of execution ( 53 , 54 ). The hypothesis that signalling and ovary activation are pleiotropically linked and therefore constrained to be honest, been proposed previously with experimental data from ants and wasps, though with an emphasis on interactions with juvenile hormone ( 4 – 6 ). Our data are consistent with these observations since Dsx directly regulates Vg , which is integrated into the juvenile hormone and insulin signaling pathways ( 55 ). Therefore, honest signalling may be a byproduct of the proximate mechanisms exapted for eusociality, rather than inherently adaptive in all cases. If Dsx is central to reproductive division of labor in honey bees, why has it not been picked up by other studies as a core gene involved in caste determination, even those that specifically tested for its differential expression (e.g., ( 35 ))? Expression of Dsx is highly tissue-specific ( 36 , 41 , 56 ). Aggregating data at the whole body or body part level is common practice in social insect gene expression studies, but this likely increases the signal-to-noise ratio. This hypothesis is supported by the observation that the only study to date that has detected significant differences in Dsx in honey bees analyzed tissue-specific expression ( 36 ). Furthermore, because Dsx interacts with many other genes, its levels may be constrained within fairly narrow ranges, making differences harder to detect. For example, though we attempted to maximize Dsx variability in our experiment, it varied only by an order of magnitude ( Figure 1B ), though that was sufficient to induce phenotypic effects ( Figure 2 ). Future work should examine fine-scale changes in the expression of Dsx across honey bee tissues and over time to identify developmental hotspots that may be associated with caste determination and other aspects of social function. Conclusion Building on prior knowledge of the extensive role of Dsx in insect development and polyphenism, we experimentally showed that it participates in a core gene regulatory network that is involved in reproductive division of labor in honey bees and that can indirectly control many aspects of social function by regulating Vg levels ( 49 ). It may also play a role in epigenetic reprogramming, as it occurs in the same module as dnmt3 , a DNA methyltransferase known to affect caste ( 34 ). We also found that this network is associated with caste differentiation during early larval development. Furthermore, a recent study found that Dsx is differentially expressed among castes in an ant ( 57 ), and coupling between ovary development and reproductive signalling has been reported in ants and in wasps ( 4 , 5 ), suggesting that exaptation of the sex determination pathway may have been widespread for independent origins of eusociality. A deeper understanding of the regulatory network surrounding Dsx and comparative studies should provide novel insights into the mechanisms, evolutionary potential, and constraints of eusocial evolution. Materials and Methods Laboratory experiments Experimental procedures were performed blind. dsRNA Dsx and control solutions were labeled with distinct colors during microinjection, and their identities were not revealed during acquisition of pheromonal profiles and ovary activation data to prevent subconscious bias. dsRNA Synthesis We designed a pair of primers for the female-specific F2 isoform of Dsx (NCBI ID NM_001134935.1), which differs from the other Dsx isoform that is expressed in both sexes (NCBI ID NM_001134936). Primers were fused with the T7-promoter sequence (underlined) at their 5’ end(DSX-forward: TAATACGACTCACTATAGGG TTCTTCGGTCCCTCAACCAC; DSX-reverse: TAATACGACTCACTATAGGG GTCTGTGGCAAATGGGTGAC). We used a similar method to design the Green Fluorescent Protein (GFP) primer (GFP-forward: 5’- TAATACGACTCACTATAGGGCGA AGTGGAGAGGGTGAAGGTGA; GFP-reverse: TAATACGACTCACTATAGGGCGA GGTAAAAGGACAGGGCCATC). We extracted total RNA from a 14 day old queen using TRIzol ® and synthesized cDNA as described by Aird et al . ( 58 ). We used the cDNA as the template to amplify the target portion of the Dsx gene and the pET6Xhn-GFPuv vector (Clontech) to amplify the GFP gene. We purified PCR amplicons by solid phase reversible immobilization with 19% PEG. The amplicons were then used as templates for dsRNA synthesis using the MEGAscrip kit (Ambion). The synthesized dsRNA products were purified using MEGAclear kit (Ambion) and eluted with nuclease-free water. The quantity and quality of dsRNA were evaluated using NanoDrop 2000C (Thermo Scientific) and Agilent RNA-6000 Pico kit, respectively. Microinjection We collected brood combs from Apis mellifera ligustica colonies from the apiary of the Okinawa Institute of Science and Technology (OIST), Okinawa, Japan. We used brood frames from six different colonies collected on October 23th and November 6th 2017 and incubated overnight at 35 ° C and 70% humidity ( 59 ). The next day, we collected approximately 300 newly emerged workers and randomly mixed them (150 were used on October 24th and 150 on November 7th 2017). Prior to injection, we immobilized bees by cooling them at 4 ° C for 1-2 minutes and fixed on beeswax plates using two crossed pins. In this position, we inserted the needle between the 3rd and 4th tergite (at the side of the abdomen) and injected newly emerged honey bees with 1 μL dsRNA solution (N=31) of the target gene DSX or 1μL dsRNA solution (N=31) of a non-target control gene green fluorescent protein (GFP), a non-honey bee gene. We diluted all dsRNA used in this experiment to 1ng/μL, as our pilot study shown a higher mortality rate when bees were injected with higher concentrations. Different microneedles and Microloader pipette tips (Eppendorf, cat. no. 5242 956.003) were used for each bee. After the injection, we kept workers on the wax plates until their recovery and discarded all bees showing signs of haemolymph leakage. We housed experimental bees individually in cages containing 20 nurse bees (from a different experimental colony) and 5 newly emerged bees (from the same cohort) for 10 days at 35°C and 70% humidity. Studies with honey bees indicate that experimental cages can mimic the effects of a queenless colony ( 60 ), stimulating ovary development. Moreover, as royal jelly has a high nutritive value, promoting higher rates of ovary development, we also fed honey bees with 50% royal jelly mixed in honey and water ( 30 ). Assessment of worker ovary development On the 11th day after microinjection, we dissected surviving experimental bees ( 30 ). Heads were removed, immediately frozen and stored at −80 ° C for further pheromonal analysis (see below). To quantify ovary activation, we scored dissected ovaries on a scale from 0 to 3, as described by ( 59 ), with 0 being used for underdeveloped ovaries (without distinguishable oocytes), 1 for ovaries containing visible oocytes, 2 for ovaries containing sausage-shaped oocytes, and 3 when they had a fully developed egg. To prevent RNA degradation, honey bees were dissected submerged in RNA Later ® (Ambion), then frozen and stored at −80 ° C. Analysis of mandibular gland pheromones On the 11th day after microinjection, honey bee heads were frozen immediately after decapitation. They were transferred to 1 mL borosilicate glass tubes, inserted into a 2-mL Eppendorf tubes containing 400 μL of chloroform and 5 μL of internal standard solution (composed of 1 mg of octanoic acid, 1 mg of tetradecane in 4 mL dichloromethane) and stored for at least 24 h at −30 ° C. Prior to gas chromatography, the sample was divided in half (to be stored as a backup for further analysis) and the other half (200 μL) was evaporated until near dryness with a gentle nitrogen stream. The residue was redissolved in 30 uL BSTFA, pyridine at 2:1 ratio and incubated at 70 ° with shaking for 1 h. One μL of that solution was injected into the GC/MS. MGP concentration was estimated as: , where Cp is the peak of the MGP compound, STp is the peak area of the internal standard, and STm is the internal standard concentration. RNA-seq library preparation From each treatment group, we selected 10 honey bees (20 total, 10 honey bees with lower and 10 bees with higher ovary activation scores). RNA was isolated using standard TRI-zol ® Reagent (Life Technologies) procedure, except that RNA was precipitated in the presence of 0.35 μL of glycogen (20 μg/μL concentration). Total RNA from each bee was diluted in 10 μL of nuclease free water. Quantity of RNA was examined with NanoDrop 2000c spectrophotometer (Thermo Scientific) and quality with Argument 2100 bioanalyzer (Agilent Technologies). cDNA synthesis, amplification, and preparation of RNA-Seq libraries was performed using the protocol described by Aird et al . ( 58 ), including the addition of ERCC92 spike-in controls. Libraries were sequenced on an Illumina HiSeq 2500, and raw reads were deposited into DDBJ under BioProject accession number PRJDB6980. Data analysis All statistical analyses and results can be viewed on http://mikheyevlab.github.io/dsx-rnai/ . We summarize them here in brief. We present two-tailed p-values throughout, except for the four statistical tests where we predicted specific directional effects in response to treatment in knockdown vs. control bees: levels of Dsx and Vg , and in levels of ovary activation and queen-like pheromone components ( 61 ). RNA-seq analysis The NCBI Annotation Release 103 of the honey bee (Amel_4.5) genome was used for differential gene expression analysis. Our goal was fourfold: (a) to validate Dsx knockdown, (b) to test for corresponding Vg decrease in knockdown bees, (c) identify the network of genes co-expressed with Dsx , and (d) examine the extent to which this network is involved in larval caste differentiation using data from He et al. ( 35 ) We employed two alternative approaches for differential gene expression analysis: a more traditional pipeline (RSEM) using read mapping and an alignment-free method (Kallisto) ( 62 – 64 ). We used edgeR for differential gene expression of RSEM data, and Sleuth for Kallisto data ( 65 , 66 ). They gave the same results for Dsx and Vg levels, and we proceeded with the former pipeline for weighted gene co-expression analysis (WGCNA) to identify the Dsx -responsive module ( 31 ). We conducted our analysis in adult bees because we were interested in the effects of Dsx on both ovary development and pheromonal signalling. However, we were also interested in determining whether similar mechanisms may be involved in larval caste determination. We tested for preservation of the Dsx -responsive module in the extensive data set from He et al. ( 35 ), who compared transcriptional differences between worker- and queen-destined larvae during the first four days of development. Pheromonal level and ovary activation analysis To the best of our knowledge, the relationship between ovary activation stage and mandibular gland profile has not been investigated. Therefore, we were interested in testing the relationship between Dsx knockdown, pheromone production, and ovary activation state in a joint analysis. Because ovary activation is an ordered factor variable, it was best suited as a response variable for a cumulative link model regression analysis. However, levels of mandibular gland components are not independent, as they share pathways ( 67 ), and can be highly correlated (Figure S2). To account for multicollinearity we conducted a principal component regression ( 68 ). The number of principal components was chosen by adding them stepwise in order of the amount of variance they explained, until the overall model fit ceased to improve, according to likelihood ratio tests. This resulted in two principal components as explanatory variables, which happened to explain a preponderance of the variance and also had biologically significant interpretations, being correlated with worker and queen axes of pheromonal variation. Furthemore, to ensure that effects were not due to concomitant differences in vitality, we also compared mortality between knockdown and control bees using a binomial mixed model. Acknowledgements We would like to thank Alejandro Villar of the OIST mass spectrometry center for carrying out the pheromone derivatization and for help with the interpretation of mass spectra. We also thank Jarol Chen for her drawings. We express appreciation to Steven D. Aird, Luke Holman, Armin Moczek, and Michael Warner for comments on the manuscript. We are grateful to Luke Holman for discussion and suggestions over the course of the study. This work was funded by OIST subsidy funding and by JSPS KAKENHI grants 16H06209 and 16KK0175 to ASM. Footnotes Email: mikheyev{at}homologo.us References 1. ↵ Shirangi TR , Dufour HD , Williams TM , Carroll SB ( 2009 ) Rapid evolution of sex pheromone-producing enzyme expression in Drosophila . PLoS Biol 7 ( 8 ): e1000168 . OpenUrl CrossRef PubMed 2. ↵ Mullen SP , Mendelson TC , Schal C , Shaw KL ( 2007 ) Rapid evolution of cuticular hydrocarbons in a species radiation of acoustically diverse Hawaiian crickets (Gryllidae: trigonidiinae: Laupala ) . Evolution 61 ( 1 ): 223 – 231 . OpenUrl CrossRef PubMed Web of Science 3. ↵ Van Oystaeyen A , et al. ( 2014 ) Conserved class of queen pheromones stops social insect workers from reproducing . Science 343 ( 6168 ): 287 – 290 . OpenUrl Abstract / FREE Full Text 4. ↵ Oliveira RC , et al. ( 2017 ) Hormonal pleiotropy helps maintain queen signal honesty in a highly eusocial wasp . Sci Rep 7 ( 1 ): 1654 . OpenUrl CrossRef 5. ↵ Holman L ( 2012 ) Costs and constraints conspire to produce honest signaling: insights from an ant queen pheromone . Evolution 66 ( 7 ): 2094 – 2105 . OpenUrl CrossRef PubMed Web of Science 6. ↵ Holman L , Linksvayer TA , d’Ettorre P ( 2013 ) Genetic constraints on dishonesty and caste dimorphism in an ant . Am Nat 181 ( 2 ): 161 – 170 . OpenUrl CrossRef PubMed Web of Science 7. ↵ Ito Y Brown J L Kikkawa West-Eberhard MJ ( 1987 ) Flexible strategy and social evolution . Animal Societies: Theories and Facts , ed Ito Y Brown J L Kikkawa ( Japan Scientific Society Press , Tokyo, Japan ), pp 35 – 51 . 8. ↵ Toth AL , Robinson GE ( 2007 ) Evo-devo and the evolution of social behavior . Trends Genet 23 ( 7 ): 334 – 341 . OpenUrl CrossRef PubMed Web of Science 9. ↵ Okada Y , Watanabe Y , Tin MMY , Tsuji K , Mikheyev AS ( 2017 ) Social dominance alters nutrition-related gene expression immediately: transcriptomic evidence from a monomorphic queenless ant . Mol Ecol 26 ( 11 ): 2922 – 2938 . OpenUrl 10. ↵ Oi CA , et al. ( 2015 ) The origin and evolution of social insect queen pheromones: Novel hypotheses and outstanding problems . Bioessays 37 ( 7 ): 808 – 821 . OpenUrl CrossRef PubMed 11. ↵ Holmes MJ , Oldroyd BP , Duncan M , Allsopp MH , Beekman M ( 2013 ) Cheaters sometimes prosper: targeted worker reproduction in honeybee ( Apis mellifera ) colonies during swarming . Mol Ecol 22 ( 16 ): 4298 – 4306 . OpenUrl CrossRef Web of Science 12. ↵ Tan K , Yang M , Wang Z , Radloff SE , Pirk CWW ( 2012 ) The pheromones of laying workers in two honeybee sister species: Apis cerana and Apis mellifera . J Comp Physiol A Neuroethol Sens Neural Behav Physiol 198 ( 4 ): 319 – 323 . OpenUrl PubMed 13. ↵ Wenseleers T , Ratnieks FLW ( 2006 ) Enforced altruism in insect societies . Nature 444 ( 7115 ): 50 . OpenUrl CrossRef PubMed Web of Science 14. ↵ Smith AA , Hölldober B , Liebig J ( 2009 ) Cuticular hydrocarbons reliably identify cheaters and allow enforcement of altruism in a social insect . Curr Biol 19 ( 1 ): 78 – 81 . OpenUrl CrossRef PubMed Web of Science 15. ↵ Brockmann A , Dietz D , Spaethe J , Tautz J ( 2006 ) Beyond 9-ODA: sex pheromone communication in the European honey bee Apis mellifera L . J Chem Ecol 32 ( 3 ): 657 – 667 . OpenUrl CrossRef PubMed Web of Science 16. ↵ Camiletti AL , Percival-Smith A , Thompson GJ ( 2013 ) Honey bee queen mandibular pheromone inhibits ovary development and fecundity in a fruit fly . Entomol Exp Appl 147 ( 3 ): 262 – 268 . OpenUrl 17. ↵ Croft JR , Liu T , Camiletti AL , Simon AF , Thompson GJ ( 2017 ) Sexual response of male Drosophila to honey bee queen mandibular pheromone: implications for genetic studies of social insects . J Comp Physiol A Neuroethol Sens Neural Behav Physiol 203 ( 2 ): 143 – 149 . OpenUrl 18. ↵ Jallon J-M , Lauge G , Orssaud L , Antony C ( 1988 ) Female pheromones in Drosophila melanogaster are controlled by the doublesex locus . Genet Res 51 ( 1 ): 17 – 22 . OpenUrl Web of Science 19. ↵ Suzuki MG , Funaguma S , Kanda T , Tamura T , Shimada T ( 2005 ) Role of the male BmDSX protein in the sexual differentiation of Bombyx mori . Evol Dev 7 ( 1 ): 58 – 68 . OpenUrl CrossRef PubMed 20. ↵ Suzuki MG , Funaguma S , Kanda T , Tamura T , Shimada T ( 2003 ) Analysis of the biological functions of a doublesex homologue in Bombyx mori . Dev Genes Evol 213 ( 7 ): 345 – 354 . OpenUrl CrossRef PubMed Web of Science 21. Burtis KC , Coschigano KT , Baker BS , Wensink PC ( 1991 ) The doublesex proteins of Drosophila melanogaster bind directly to a sex-specific yolk protein gene enhancer . EMBO J 10 ( 9 ): 2577 – 2582 . OpenUrl PubMed Web of Science 22. ↵ Shukla JN , Palli SR ( 2012 ) Doublesex target genes in the red flour beetle, Tribolium castaneum . Sci Rep 2 : 948 . OpenUrl PubMed 23. ↵ Mucignat-Caretta C Bortolotti L , Costa C ( 2014 ) Chemical Communication in the Honey Bee Society . Neurobiology of Chemical Communication , ed Mucignat-Caretta C ( CRC Press/Taylor & Francis, Boca Raton (FL) ). 24. ↵ Plettner E , Sutherland GR , Slessor KN , Winston ML ( 1995 ) Why not be a queen? Regioselectivity in mandibular secretions of honeybee castes . J Chem Ecol 21 ( 7 ): 1017 – 1029 . OpenUrl CrossRef PubMed Web of Science 25. ↵ Plettner E , et al. ( 1997 ) Species- and Caste-Determined Mandibular Gland Signals in Honeybees ( Apis ) . J Chem Ecol 23 ( 2 ): 363 – 377 . OpenUrl CrossRef Web of Science 26. ↵ Strauss K , et al. ( 2008 ) The role of the queen mandibular gland pheromone in honeybees ( Apis mellifera ): honest signal or suppressive agent? Behav Ecol Sociobiol 62 ( 9 ): 1523 – 1531 . OpenUrl CrossRef Web of Science 27. ↵ Niu D-F , et al. ( 2016 ) Reproductive traits and mandibular gland pheromone of anarchistic honey bee workers Apis mellifera occurring in China . Apidologie 47 ( 4 ): 515 – 526 . OpenUrl 28. ↵ Patel A , et al. ( 2007 ) The making of a queen: TOR pathway is a key player in diphenic caste development . PLoS One 2 ( 6 ): e509 . OpenUrl CrossRef PubMed 29. ↵ Nunes FMF , Simões ZLP ( 2009 ) A non-invasive method for silencing gene transcription in honeybees maintained under natural conditions . Insect Biochem Mol Biol 39 ( 2 ): 157 – 160 . OpenUrl CrossRef PubMed 30. ↵ Lin H , Winston ML ( 1998 ) The role of nutrition and temperature in the ovarian development of the worker honey bee ( Apis mellifera ) . Can Entomol 130 ( 6 ): 883 – 891 . OpenUrl CrossRef 31. ↵ Langfelder P , Horvath S ( 2008 ) WGCNA: an R package for weighted correlation network analysis . BMC Bioinformatics 9 ( 1 ): 559 . OpenUrl CrossRef PubMed 32. ↵ Zhao W , et al. ( 2010 ) Weighted gene coexpression network analysis: state of the art . J Biopharm Stat 20 ( 2 ): 281 – 300 . OpenUrl CrossRef PubMed 33. ↵ Allen JD , Xie Y , Chen M , Girard L , Xiao G ( 2012 ) Comparing statistical methods for constructing large scale gene networks . PLoS One 7 ( 1 ): e29348 . OpenUrl CrossRef PubMed 34. ↵ Kucharski R , Maleszka J , Foret S , Maleszka R ( 2008 ) Nutritional control of reproductive status in honeybees via DNA methylation . Science 319 ( 5871 ): 1827 – 1830 . OpenUrl Abstract / FREE Full Text 35. ↵ He X-J , Jiang W-J , Zhou M , Barron AB , Zeng Z-J ( 2017 ) A comparison of honeybee ( Apis mellifera ) queen, worker and drone larvae by RNA-Seq . Insect Sci . doi: 10.1111/1744-7917.12557 . OpenUrl CrossRef 36. ↵ Johnson BR , Jasper WC ( 2016 ) Complex patterns of differential expression in candidate master regulatory genes for social behavior in honey bees . Behav Ecol Sociobiol 70 ( 7 ): 1033 – 1043 . OpenUrl CrossRef 37. ↵ Kamakura M ( 2011 ) Royalactin induces queen differentiation in honeybees . Nature 473 ( 7348 ): 478 – 483 . OpenUrl CrossRef PubMed Web of Science 38. ↵ Verhulst EC , van de Zande L ( 2015 ) Double nexus—Doublesex is the connecting element in sex determination . Brief Funct Genomics 14 ( 6 ): 396 – 406 . OpenUrl CrossRef PubMed 39. ↵ Ito Y , et al. ( 2013 ) The role of doublesex in the evolution of exaggerated horns in the Japanese rhinoceros beetle . EMBO Rep 14 ( 6 ): 561 – 567 . OpenUrl Abstract / FREE Full Text 40. ↵ Kijimoto T , Moczek AP ( 2012 ) Diversification of doublesex function underlies morph-, sex-, and species-specific development of beetle horns . Proceedings of the National Academy of Sciences 1 . 9 ( 50 ): 20526 – 20531 . OpenUrl 41. ↵ Ledón-Rettig CC , Zattara EE , Moczek AP ( 2017 ) Asymmetric interactions between doublesex and tissue- and sex-specific target genes mediate sexual dimorphism in beetles . Nat Commun 8 : 14593 . OpenUrl 42. ↵ Kunte K , et al. ( 2014 ) Doublesex is a mimicry supergene . Nature 507 ( 7491 ): 229 – 232 . OpenUrl CrossRef PubMed Web of Science 43. ↵ Toth AL , et al. ( 2007 ) Wasp gene expression supports an evolutionary link between maternal behavior and eusociality . Science 318 ( 5849 ): 441 – 444 . OpenUrl Abstract / FREE Full Text 44. ↵ Morandin C , et al. ( 2016 ) Comparative transcriptomics reveals the conserved building blocks involved in parallel evolution of diverse phenotypic traits in ants . Genome Biol 17 : 43 . OpenUrl CrossRef 45. ↵ Berens AJ , Hunt JH , Toth AL ( 2015 ) Comparative transcriptomics of convergent evolution: different genes but conserved pathways underlie caste phenotypes across lineages of eusocial insects . Mol Biol Evol 32 ( 3 ): 690 – 703 . OpenUrl CrossRef PubMed 46. ↵ Gotoh H , et al. ( 2014 ) Developmental link between sex and nutrition; doublesex regulates sex-specific mandible growth via juvenile hormone signaling in stag beetles . PLoS Genet 10 ( 1 ): e1004098 . OpenUrl CrossRef PubMed 47. ↵ Bitondi MMG , Simões ZLP ( 1996 ) The relationship between level of pollen in the diet, vitellogenin and juvenile hormone titres in Africanized Apis mellifera workers . J Apic Res 35 ( 1 ): 27 – 36 . OpenUrl 48. ↵ Attardo GM , Hansen IA , Raikhel AS ( 2005 ) Nutritional regulation of vitellogenesis in mosquitoes: implications for anautogeny . Insect Biochem Mol Biol 35 ( 7 ): 661 – 675 . OpenUrl CrossRef PubMed Web of Science 49. ↵ Nelson CM , Ihle KE , Fondrk MK , Page RE , Amdam GV ( 2007 ) The gene vitellogenin has multiple coordinating effects on social organization . PLoS Biol 5 ( 3 ): e62 . OpenUrl CrossRef PubMed 50. ↵ Guidugli KR , et al. ( 2005 ) Vitellogenin regulates hormonal dynamics in the worker caste of a eusocial insect . FEBS Lett 579 ( 22 ): 4961 – 4965 . OpenUrl CrossRef PubMed Web of Science 51. ↵ Caspari E ( 1952 ) Pleiotropic gene action . Evolution 6 ( 1 ): 1 – 18 . OpenUrl CrossRef 52. ↵ Artieri CG , Haerty W , Singh RS ( 2009 ) Ontogeny and phylogeny: molecular signatures of selection, constraint, and temporal pleiotropy in the development of Drosophila . BMC Biol 7 ( 1 ): 42 . OpenUrl CrossRef PubMed 53. ↵ Heinze J , d’Ettorre P ( 2009 ) Honest and dishonest communication in social Hymenoptera . J Exp Biol 212 ( 12 ): 1775 – 1779 . OpenUrl Abstract / FREE Full Text 54. ↵ Keller L , Nonacs P ( 1993 ) The role of queen pheromones in social insects: queen control or queen signal? Anim Behav 45 ( 4 ): 787 – 794 . OpenUrl CrossRef Web of Science 55. ↵ Corona M , et al. ( 2007 ) Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee longevity . Proc Natl Acad Sci U S A 104 ( 17 ): 7128 – 7133 . OpenUrl Abstract / FREE Full Text 56. ↵ Clough E , et al. ( 2014 ) Sex- and tissue-specific functions of Drosophila doublesex transcription factor target genes . Dev Cell 31 ( 6 ): 761 – 773 . OpenUrl CrossRef PubMed 57. ↵ Klein A , et al. ( 2016 ) Evolution of social insect polyphenism facilitated by the sex differentiation cascade . PLoS Genet 12 ( 3 ): e1005952 . OpenUrl 58. ↵ Aird SD , et al. ( 2013 ) Quantitative high-throughput profiling of snake venom gland transcriptomes and proteomes ( Ovophis okinavensis and Protobothrops flavoviridis ) . BMC Genomics 14 ( 1 ): 790 . OpenUrl CrossRef PubMed 59. ↵ Formesyn EM , et al. ( 2014 ) Reproduction of honeybee workers is regulated by epidermal growth factor receptor signaling . Gen Comp Endocrinol 197 ( 1 ): 1 – 4 . OpenUrl 60. ↵ Miller DG III . , Ratnieks FLW ( 2001 ) The timing of worker reproduction and breakdown of policing behaviour in queenless honey bee ( Apis mellifera L.) societies . Insectes Soc 48 ( 2 ): 178 – 184 . OpenUrl CrossRef Web of Science 61. ↵ Ruxton GD , Neuhäuser M ( 2010 ) When should we use one-tailed hypothesis testing?: One-tailed hypothesis testing . Methods Ecol Evol 1 ( 2 ): 114 – 117 . OpenUrl 62. ↵ Li B , Dewey CN ( 2011 ) RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome . BMC Bioinformatics 12 ( 1 ): 323 . OpenUrl CrossRef PubMed 63. Bray NL , Pimentel H , Melsted P , Pachter L ( 2016 ) Near-optimal probabilistic RNA-seq quantification . Nat Biotechnol 34 ( 5 ): 525 – 527 . OpenUrl CrossRef PubMed 64. ↵ Langmead B ( 2010 ) Aligning short sequencing reads with Bowtie . Curr Protoc Bioinformatics 32 ( 1 ): 11 – 17 . OpenUrl 65. ↵ Robinson MD , McCarthy DJ , Smyth GK ( 2010 ) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data . Bioinformatics 26 ( 1 ): 139 – 140 . OpenUrl CrossRef PubMed Web of Science 66. ↵ Pimentel H , Bray NL , Puente S , Melsted P , Pachter L ( 2017 ) Differential analysis of RNA-seq incorporating quantification uncertainty . Nat Methods 14 ( 7 ): 687 – 690 . OpenUrl CrossRef PubMed 67. ↵ Plettner E , Slessor KN , Winston ML , Oliver JE ( 1996 ) Caste-selective pheromone biosynthesis in honeybees . Science 271 ( 5257 ): 1851 – 1853 . OpenUrl Abstract / FREE Full Text 68. ↵ Jolliffe IT ( 2006 ) Principal Component Analysis ( Springer Science & Business Media ). 69. ↵ Koywiwattrakul P , Sittipraneed S ( 2009 ) Expression of vitellogenin and transferrin in activated ovaries of worker honey bees, Apis mellifera . Biochem Genet 47 ( 1-2 ): 19 – 26 . OpenUrl PubMed 70. ↵ Rhodes JW , Lacey MJ , Harden S ( 2007 ) Changes with age in queen honey bee ( Apis mellifera ) head chemical constituents (Hymenoptera: Apidae) . Sociobiology 50 ( 1 ): 11 – 22 . OpenUrl Back to top Previous Next Posted May 04, 2018. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The Doublesex sex determination pathway regulates reproductive division of labor in honey bees Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The Doublesex sex determination pathway regulates reproductive division of labor in honey bees Mariana Velasque , Lijun Qiu , Alexander S. Mikheyev bioRxiv 314492; doi: https://doi.org/10.1101/314492 Share This Article: Copy Citation Tools The Doublesex sex determination pathway regulates reproductive division of labor in honey bees Mariana Velasque , Lijun Qiu , Alexander S. Mikheyev bioRxiv 314492; doi: https://doi.org/10.1101/314492 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (8051) Biochemistry (18818) Bioengineering (14943) Bioinformatics (44613) Biophysics (22677) Cancer Biology (19800) Cell Biology (26984) Clinical Trials (138) Developmental Biology (14018) Ecology (21076) Epidemiology (2067) Evolutionary Biology (25514) Genetics (16209) Genomics (23574) Immunology (18768) Microbiology (42664) Molecular Biology (18132) Neuroscience (93790) Paleontology (703) Pathology (2994) Pharmacology and Toxicology (5112) Physiology (8148) Plant Biology (16043) Scientific Communication and Education (2099) Synthetic Biology (4578) Systems Biology (10264) Zoology (2394) window.__CF$cv$params={r:'a41e884ba9004eb9',t:'MTc5MDU1NDMwMw==',u:'01a0e55a76f077389150116d7a01ed7f',ut:'QgeVei.RfbAdu71SfHlXq27.Evgwq3nbzcjTJQQOXjg-1790554306-1.2.1.1-RL1klPOKKtUHd4H1BSeFZtzTd3bzge7Z5lFJGpdog7y2gi87hseGpPV2X08UCEdbwav0f.hiuGLc8pvqahB.QADpVvFcuRX0dAQ508QLgQY',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();