Full text
64,388 characters
· extracted from
preprint-html
· click to expand
Development of human skin equivalents with inducible ceramide depletion for in vitro modelling of lipid deficiency | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Development of human skin equivalents with inducible ceramide depletion for in vitro modelling of lipid deficiency View ORCID Profile Durotimi O. Dina , View ORCID Profile Miriam Maiellaro , View ORCID Profile Emanuela Camera , View ORCID Profile John T. Connelly doi: https://doi.org/10.1101/2025.01.20.633956 Durotimi O. Dina 1 Centre for Cell Biology and Cutaneous Research, Faculty of Medicine and Dentistry, Queen Mary University of London , 4 Newark Street, London E1 2AT, United Kingdom Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Durotimi O. Dina Miriam Maiellaro 2 Laboratory of Cutaneous Physiopathology and Integrated Center of Metabolomics Research, San Gallicano Dermatological Institute , IRCCS, Via Chianesi 53 - 00144 Rome, Italy Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Miriam Maiellaro Emanuela Camera 2 Laboratory of Cutaneous Physiopathology and Integrated Center of Metabolomics Research, San Gallicano Dermatological Institute , IRCCS, Via Chianesi 53 - 00144 Rome, Italy Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Emanuela Camera John T. Connelly 1 Centre for Cell Biology and Cutaneous Research, Faculty of Medicine and Dentistry, Queen Mary University of London , 4 Newark Street, London E1 2AT, United Kingdom Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for John T. Connelly For correspondence: j.connelly{at}qmul.ac.uk Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The lipid composition of the epidermis plays a critical role in the skin’s barrier function, and defects in lipid synthesis or assembly can cause a spectrum of skin diseases, ranging from dry skin to severe ichthyoses. The aim of this study was to develop an in vitro model of human skin with tuneable lipid deficiency. Human N/TERT keratinocytes were engineered to express doxycycline-inducible short hairpin RNAs targeting ceramide synthase 3 (CerS3), which is essential for synthesis of ultra long chain ceramides and skin barrier function. We show that 3D human skin equivalents (HSEs) with induced knockdown of CerS3 display normal stratification and terminal differentiation but have reduced Nile Red staining for polar lipids. Further analysis of the lipidome by mass spectrometry confirmed a significant reduction in specific classes of ceramides and ceramide chain length in the CerS3 depleted HSEs. We also show that CerS3 knockdown is reversible upon removal of doxycycline and can be used to study recovery and repair of epidermal lipids. Together, these findings provide an overall strategy for genetically tuning the lipid composition within human skin models and establish a new in vitro model of ceramide deficiency. Introduction The skin is a critical first line of defence against pathogens, physical/chemical damage, and ultraviolet radiation, and the uppermost layer of the epidermis, the stratum corneum, forms a selectively permeable barrier that is crucial for the skin’s protective function 1 . The stratum corneum relies on an intricate network of proteins and lipids, including the lipid lamellar bilayer (LLB) and cornified lipid envelope (CLE). The LLB confers the water-impermeable properties of the epidermis and the CLE acts as a sealant for the cohesion of the corneocytes and a scaffold for the LLB 1 – 5 . These lipid-based structures consist of ceramides, cholesterol and fatty acids, with ceramides making up the greatest fraction by mass 6 . The specific class of ω-esterified ultra-long chain (ULC) ceramides, also known as the acylceramides (acylCers), are key for the molecular organisation and subsequent function of the LLB and CLE, and the enzyme ceramide synthase 3 (CerS3) is uniquely required for acylCer synthesis 7 , 8 . To date, five species of ω-esterified hydroxy ceramides have been identified: Cer[EOH], Cer[EOP], Cer[EOS], Cer[EODS] and Cer[EOSD]. Their unique chemical structure, namely their esterification to linoleic acid, is responsible for the formation and organisation of the LLB. Both Cer[EOS] and Cer[EOH] play important roles in the Long Periodicity Phase (LPP) lamellar organisation of the LLB, and it has been shown that in the absence of Cer[EOS] almost no LPP is formed 9 – 11 . Overall deficiencies in ceramides can compromise the barrier function of the skin and contribute to numerous skin conditions, ranging from dry skin to severe ichthyoses 12 – 15 , and LLP malformation directly correlates with an inadequate epidermal barrier and a dry skin phenotype 13 , 16 , 17 . CerS3 deficiency in mice leads to a loss of ULC ceramides and subsequent fatality shortly after birth 20 . Mutations in the CERS3 gene in humans affect barrier function and can cause specific forms of autosomal recessive congenital ichthyoses (ARCI) 18 , 19 . For example, the codon exchange mutation (p.Trp15Arg) results in moderate lamellar ichthyosis with a reduction in long chain acylCers 21 , and similar findings have been reported for other mutations leading to Cers3 deficiency 22 . Thus, Cers3 and acylCers appear to be crucial for the lipid barrier function of the skin. Human skin equivalents (HSEs) that replicate the three-dimensional (3D) structure and function of the skin in vitro are powerful tools for investigating human-specific disease mechanisms and in a few cases have been applied to lipid associated diseases. For example, HSEs constructed using patient-derived keratinocytes have been used to replicate disease phenotypes of CerS3 deficiency in ARCI 21 . HSEs have also been used to model Harlequin Ichthyosis using keratinocytes with engineered knock out of the lipid transporter ATP binding cassette A12 (ABCA12) 23 . Importantly, HSEs are also compatible with lipidomic analysis via mass spectrometry 24 and can be used to replicate key differences in the lipid composition of the epidermis in diseases, such as atopic dermatitis 25 . However, despite these advances and the importance of lipids in the skin barrier, there are limited experimental models that support precise modulation of lipid synthesis. As lipid deficiencies can cause a spectrum of conditions with varying degrees of severity, the ability to precisely tune the amount and composition of lipids within an HSE model would be advantageous for in vitro modelling of human lipid disorders and testing drugs and skincare products. In this study, we developed an inducible HSE model of ceramide deficiency using engineered keratinocytes with doxycycline-inducible knockdown (KD) of CerS3. We focused on CerS3 as a proof of concept as it is a critical regulator of ceramide synthesis in the epidermis and is solely responsible for the synthesis of the acylCer class of lipids. We show that reduction of CerS3 expression in keratinocytes results in a global depletion of polar lipids within the epidermis of the HSE, as well as a lower abundance of specific classes of ceramides and a reduction in ceramide chain length. Moreover, we demonstrate the reversibility of inducible CerS3 KD and ability to study the kinetics of lipid recovery within the HSEs following acute ceramide depletion. Together, these findings establish a robust and tuneable methodology for modelling lipid deficiencies in human skin. Results Establishment of HSEs with inducible CerS3 knockdown To develop an in vitro human skin model with tuneable control of epidermal lipids we constructed HSEs using keratinocytes with inducible depletion of ceramides, which are essential for maintaining skin moisture and barrier integrity 2 , 26 , 27 . N/TERT keratinocytes were engineered to stably express short-hairpin RNAs (shRNAs) targeting CERS3 under the control of a doxycycline-inducible promoter 28 – 30 , alongside constitutive expression of red fluorescence protein (RFP) ( Figure 1A ). HSEs were constructed by embedding primary dermal fibroblasts in a hydrogel derived from decellularised extracellular matrix of porcine skin (dECM) 31 , and engineered keratinocytes expressing CERS3 targeting or non-targeting control (NTC) shRNAs were seeded on the surface. HSEs were cultured at the air-liquid interface for 14 days to induce epidermal differentiation and stratification ( Figure 1B ), and through the addition of doxycycline (Dox) to the culture medium we aimed to induce CerS3 depletion and disruption of the lipid barrier ( Figure 1C ). Download figure Open in new tab Figure 1: Development of HSEs with inducible CerS3 knockdown. (A) Schematic of the shRNA lentiviral construct (SMARTvector, Horizon Discovery). The constitutively expressed region under the control of the human cytomegalovirus promoter included elements for expression of the Tet-On-3D transactivator and puromycin resistance, while the inducible region contained the shRNA element and tRFP reporter under the control of the TRE3G promoter that is activated by doxycycline (Dox). (B) Schematic overview of the process for constructing 3D HSEs at the air-liquid interface (ALI) of Transwell inserts. (C) Schematic of expected disruption of epidermal lipids following addition of Dox and knockdown of CerS3. (D) Analysis of CERS3 knockdown in 2D culture by RT-qPCR. Data represent fold-change in expression (2-ΔΔCt method) relative to GAPDH and untreated NTC cells for the shRNA-transduced N/TERT lines without or with Dox treatment (0.1 μg/ml) for 7 days. Data are presented as mean +/− SEM. ****P<0.0001 with 2Way ANOVA and Šidák’s multiple comparison test. N=3 experiments. (E) Representative Western blot for CerS3 and GAPDH expression for all cell lines in 2D culture, without or with Dox treatment for 7 days. (F) Immunofluorescence staining for the inducible tRFP reporter gene (red) in HSEs constructed with NTC keratinocytes without or with Dox treatment for 14 days. Scale bar = 50 μm. (G) Representative Western blot for CerS3 and GAPDH in HSEs constructed with NTC, sh1, and sh2 cell lines and cultured without or with Dox for 14 days. Analysis of RFP expression in 2D culture first confirmed inducible transgene activation in transduced cells. Maximal RFP expression was reached within 3 days of treatment with a minimum of 0.1 μg/ml of Dox, which was then used for all subsequent experiments ( Supplementary Figure S1A ). In all four cell lines, over 90% of cells were RFP positive following Dox treatment, while RFP expression was negligible in the absence of Dox ( Supplementary Figure S1B ). RT-qPCR analysis indicated significant CERS3 downregulation with Dox exposure in the sh1 and sh2 lines, but not the NTC and sh3 lines ( Figure 1D ), and a similar KD was observed at the protein level by Western blotting ( Figure 1E ). As the sh3 line showed no effective KD of CerS3, it was excluded from further analysis. Download figure Open in new tab Supplementary Figure S1: Optimisation of transgene induction with doxycycline. (A) RFP fluorescence imaging in N/TERT keratinocytes transduced with NTC shRNA and treated with 0, 0.01, 0.1 or 1 μg/ml of doxycycline for a period of 6 days. Images are representative of N=3 experiments. Scale bar = 50 μm. (B) Flow cytometry for RFP reporter expression across non- targeting control (NTC) and shRNA knockdown cell lines (sh1, sh2 and sh3) in 2D culture without or with 0.1 μg/ml doxycycline treatment for 7 days. Percentage of RFP positive cells are noted for each condition. Data represent N=1 experiment. We next assessed CerS3 KD in 3D HSE models. We confirmed RFP transgene activation through the full thickness of the epidermal layer in the Dox treated cultures ( Figure 1F ). In accordance with the 2D data, a significant reduction in the CerS3 protein was observed for sh1 and sh2 HSEs treated with Dox compared to untreated controls, but not for the NTC HSEs ( Figure 1G , 6B-C ). With these results we confirmed KD efficacy and the ability to inducibly deplete CerS3 within the 3D HSE model using two different shRNA constructs, sh1 and sh2. CerS3 depletion reduces polar lipid content in HSEs independently of epidermal differentiation and stratification To determine the effects of CerS3 depletion in the HSE constructs, we first examined overall changes in epidermal structure and terminal differentiation. Hemotoxylin and eosin (H&E) staining indicated no apparent differences in stratification or cornification in the Dox treated sh1 and sh2 models compared to their untreated controls or NTC models ( Figure 2A ). Likewise, there were no differences in epidermal thickness between any of the conditions ( Supplementary Figure S2 ). Immunofluorescence staining for transglutaminase-1 and loricrin also revealed no discernible differences in expression of late terminal differentiation proteins ( Figure 2B-C ). Download figure Open in new tab Supplementary Figure S2: Epidermal thickness. Quantification of epidermal thicknesses using H&E images from HSEs constructed with NTC, sh1, and sh2 lines and without or with doxycycline treatment for 14 days. Data represent the mean +/− SEM of 3 technical replicates and N = 3 independent experiments. Download figure Open in new tab Figure 2: Analysis of stratification and terminal differentiation in 3D HSEs. (A) Representative images of H&E staining for HSEs constructed with NTC, sh1, or sh2 keratinocytes without or with Dox treatment (0.1 μg/ml) for 14 days. Scale bar = 100 μm. (B) Immunofluorescence staining for transglutaminase 1 and (C) loricrin. Scale bar = 20 μm. Nile Red was then used to detect the levels of non-polar and polar lipids in the epidermal layer 32 , 33 . Staining for both polar and non-polar lipids localised primarily to the stratum corneum in all models ( Figure 3A-B ). While the level of non-polar lipids was not altered in response to CerS3 depletion, we observed a significant reduction in the levels of polar lipids for the Dox treated sh2 HSEs, and there was a small but non-significant reduction in polar lipids in the Dox treated sh1 HSEs ( Figure 3A-B ). Together, these results suggest that induced CerS3 depletion within the HSE model disrupts the polar lipid composition of the stratum corneum independently of keratinocyte terminal differentiation. Download figure Open in new tab Figure 3: Analysis of lipid content in 3D HSEs. (A) Representative images of non-polar (green) and polar (red) lipid staining using Nile Red, for HSEs constructed with NTC, sh1, or sh2 keratinocytes without or with Dox treatment (0.1 μg/ml) for 14 days. Scale bar = 50 μm. (B) Quantification of Nile Red fluorescence intensity for non-polar (left panel) and polar (right panel) signals for all cell lines without or with Dox treatment. Data represent the mean +/− SEM normalised to the untreated NTC HSEs. **P<0.01 with 2-way ANOVA and Šidák’s multiple comparison test. N=3 experiments. CerS3 depletion disrupts the ceramide lipid composition of the HSEs While Nile Red staining suggested that the lipid composition was perturbed in the CerS3 depleted HSEs, further analysis was required to determine the molecular level changes in the lipidome. We therefore performed liquid chromatography and mass spectrometry (LC/MS) analysis to profile the lipid composition of the HSEs with CerS3 depletion. Overall, LC/MS identified 263 known lipid species across all HSE samples. To assess the similarity between the HSE model and human skin, we compared the proportions of different ceramide classes in the epidermis of our control (NTC) HSEs to the epidermis of normal human skin samples. The percentage of Cer[NH], Cer[NDS], Cer[AH], Cer[AP] and Cer[ADS] in the HSEs were within 5% of those in the donor skin samples. The levels of Cer[NP] were 15% lower in the HSE model compared to human skin, while Cer[AS] and Cer[NS] were 6% and 16.5% higher. respectively. Importantly, Cer[EOS], the most abundant acylCer, was the only acylCer detected in our HSE model at 1% compared to 2% in human skin 36 ( Figure 4A ). The overall proportions of ceramides in the epidermis of the human skin samples were also similar to previously reported levels 34 , 35 . These results therefore confirmed that key epidermal ceramides were present within the HSE model and could be quantitatively analysed by LC/MS. Download figure Open in new tab Figure 4: Lipidomic analysis of CerS3 depletion in HSE models. (A) Comparison of the percentage of different ceramide classes out of the total ceramide content between the epidermis of human skin and HSE models constructed with NTC keratinocytes. Yellow = within 5% of human skin, red = higher in the HSE, and blue = lower in the HSE. Data represent the mean of N=3 HSEs from independent experiments. (B) Heat map and hierarchical clustering of lipid classes (263 identified lipid species) and experimental conditions. N=3 experiments. Data represent Log2 transformed levels of each lipid class (pmol) relative to total lipid content (nmol). (C) Volcano plot showing Log2 fold-change and −Log10 P value for all the annotated lipids detected in the HSE models comparing NTC + Dox vs sh1 + Dox and (D) NTC + Dox vs sh2 + Dox. (E) Analysis of ceramide content grouped by different classes, including Cer[EOS], Cer[NDS], Cer[NP], and Cer[NH] alongside levels of linoleic acid (C18:2), saturated fatty acids (FFA:0), total cholesterol, and cholesterol esters (CE), in HSEs constructed with all cell lines without or with Dox treatment for 14 days. Data are represented as mean +/− SEM of pmol of lipid class per nmol of total lipid content. *P<0.05 with unpaired two-tailed Student’s t-test. N=3 experiments. We next examined the effects of CerS3 KD on lipid composition of the HSEs. Hierarchical clustering based on all identified lipids grouped by lipid class revealed distinct patterns of lipid composition, and the Dox treated sh1 and sh2 samples clustered together and away from the untreated and NTC samples ( Figure 4B ), indicating a clear effect of CerS3 depletion on the lipid profile of the HSE. CerS3 depletion in both the sh1 and sh2 lines predominantly caused a downregulation of lipids in the HSE model ( Figure 4C-D ), consistent with the Nile Red staining. Based on a significance criterion of log2 Fc ≥ 1 and a −log10 p value of 1.3, 15 and 3 specific lipid species were significantly downregulated in the Dox treated sh1 and sh2 models, respectively. In addition to individual lipids, we observed a significant downregulation of the ceramide classes Cer[NDS], Cer[NH], and CER[EOS] for both sh1 and sh2 Dox treated HSEs compared to NTC samples, and a downregulation of Cer[NP] for sh1 only ( Figure 4E ). Linoleic acid (C18:2) is the most common fatty acid used to esterify and create acylCers and is cleaved to form the omega-acylated-hydroxy-Cers (ω-OH-Cer) 7 , 26 . Linoleic acid was significantly depleted in the sh1 +Dox group ( Figure 4E ), which we hypothesise may be a feedback response to the decrease in availability of acylceramides. By contrast, there were no significant differences in saturated free fatty acids, cholesterol or other ceramide classes ( Figure 4E ; Supplementary Figure S3 ). Download figure Open in new tab Supplementary Figure S3: Analysis of additional lipid classes. Quantification of levels of lipids in Cer[AH], Cer[AP], Cer [AS], Cer[NS], Cer[ADS], sphingomyelin (SM), Hexosylceramide (HexCer), cholesterol sulphate (CHS), and unsaturated free fatty acids (FFA:1). Data are represented as mean +/− SEM of pmol of each lipid class per nmol of total lipid content. *P< 0.05 with unpaired two-tailed Student’s t-test. N = 3 experiments. Ceramide chain length distribution plays an important role in barrier mechanics 21 , 25 , 35 , 37 , and an increase in shorter chain ceramides leads to a decrease in skin barrier function 37 , 38 . Therefore, we next analysed ceramide chain length changes within our model. Combining all ceramide classes together, there were significant decreases in longer carbon chain length ceramides (C42 and C44) in both the Dox treated sh1 and sh2 samples and a significant increase in the shorter ceramides (C34) in the sh2 group compared to NTC samples ( Figure 5A ). Looking at specific ceramide classes, Cer[NS] and Cer[NH] showed significant reductions in the ratio of long to short chain lipids for the sh1 and sh2 compared to NTC ( Figure 5B ). Together, these findings indicate that CerS3 depletion disrupts the ceramide composition of HSEs, resulting in reduced ceramide content and a shift in the long to short ceramide chain length ratio. Download figure Open in new tab Figure 5: Effects of CerS3 depletion on ceramide chain length in HSE models. (A) Analysis of ceramide chain length in Dox treated HSEs. Data represent the abundance of ceramides with 32 to 66 carbons and are represented as mean +/− SEM. Multiple unpaired t-tests, *P 40 carbons) to shorter chain ceramides (<40 carbons) for the most significantly downregulated classes Cer[NS] and Cer[NH]. Data represent the mean +/− SEM. *P<0.05, **P<0.01 and ***P<0.001 with unpaired two-tailed Student’s t-test. N=3 experiments. Lipid restoration lags CerS3 protein expression in a model of lipid recovery A unique feature of the inducible shRNA model is the ability to switch the KD mechanism on and off in a controllable fashion. To further leverage this inducibility we investigated lipid recovery within the HSE model following restoration of CerS3 expression. Time course analysis of CerS3 expression in 2D culture showed that protein levels began to recover within 3 days after Dox removal and were fully recovered within 6 days ( Supplementary Figure S4 ). We then extended this approach to 3D culture, where CerS3 was depleted for 7 days with the addition of Dox and then allowed to recover for 7 days in the absence of Dox. Lipid content in the recovery model was compared to untreated controls or HSEs with CerS3 depletion over the full 14 day culture ( Figure 6A ). Western blot analysis confirmed a complete recovery of CerS3 at the protein level, in both the sh1 and sh2 HSEs compared to continuous Dox treatment (62% and 55% Cers3 depletion, respectively; Figure 6B-C ). As before, the polar lipid content was significantly reduced in the sh2 cultures treated with Dox and slightly, but not significantly, reduced in the sh1 treated cultures. In the sh2 recovery condition, polar lipid content partially recovered to the untreated levels, resulting in non-significant differences compared to the continuous CerS3 depleted condition ( Figure 6D-E ). These results suggest that there is a latent period between recovery of CerS3 protein expression and full restoration of polar lipid content, and that 7 days is insufficient for a complete recovery of the lipid composition within the in vitro HSE models. Moreover, these findings demonstrate the utility of HSEs with inducible ceramide depletion for the investigation of lipid barrier damage and repair. Download figure Open in new tab Supplementary Figure S4: Analysis of CerS3 recovery kinetics in 2D culture. (A) The 2D knockdown recovery experiment culture timeline. The experiment consisted of a -Dox and a+Dox condition for 9 days, plus four independent recovery conditions where cells were treated with Dox for 3 days following by sample collection at 0, 1, 3, and 6 days after removal of Dox (R0, R1, R3 and R6). (B) Representative Western blot for CerS3 and GAPDH for the two controls and four recovery time points. Download figure Open in new tab Figure 6: Analysis of CerS3 and lipid restoration in a recovery model. (A) Schematic of 14-day experimental timeline for 3D recovery model, including untreated control (14 days - Dox), sustained knockdown (14 days +Dox), and recovery (7 days +Dox followed by 7 days - Dox). (B) Representative Western blot of CerS3 and GAPDH expression in untreated controls, knockdown, and recovery conditions for NTC, sh1, and sh2 HSEs. (C) Quantification of CerS3 protein levels relative to GAPDH and normalised to NTC untreated controls (-Dox). Data are presented as mean +/− SEM. ****P<0.0001 with 2-way ANOVA and Šidák’s multiple comparison test. N=3 experiments. (D) Representative fluorescence images of polar lipids detected with Nile Red staining in untreated controls, knockdown, and recovery conditions for NTC, sh1, and sh2 HSEs. Scale bar = 100 μm. (E) Quantification of Nile Red fluorescence intensity normalised to NTC untreated controls. Data are represented as mean +/− SEM. *P<0.05 with 2-way ANOVA and Šidák’s multiple comparison test. N=3 experiments. Discussion In this study, we established and characterised a 3D HSE model with tuneable depletion of ceramides through inducible shRNA knockdown of CerS3. We demonstrate that depletion of CerS3 disrupts the lipid composition of the epidermal layer, including a reduction in distinct classes of ceramides and a shift in ceramide chain length ratios, consistent with the known roles of CerS3 in the synthesis of ULC ceramides 7 , 27 , 39 . Given that CerS3 levels were not completely knocked down and there were no observable changes in terminal differentiation, we propose that the model best replicates mild forms of lipid deficiency, such as dry skin. By contrast, total loss of CerS3 is known to cause ARCI and more severe phenotypes in skin equivalent models 21 , suggesting that CerS3 levels correlate with the severity of skin disease. Likewise, CerS3 levels are reduced in atopic dermatitis 12 , 15 , 25 , 38 . The ability to tune CerS3 levels in vitro may therefore be a useful approach to gaining new insights into its role in skin barrier diseases. The inducible shRNA strategy employed here has several notable advantages for modelling lipid disorders in human skin. The efficient induction of transgene expression in over 90% of cells and lack of leakiness provided tight control over CerS3 expression with doxycycline, and as demonstrated in the recovery experiments, could be useful for studying kinetics and mechanisms of epidermal barrier repair. In addition, genetic targeting of individual enzymes, such as CerS3, is advantageous for dissecting the role of specific biosynthetic pathways, and this approach could be applied to other ceramide, fatty acid, or cholesterol synthesis pathways in the future. In this study, we also employed engineered immortalised N/TERT keratinocytes, which were advantageous for lentiviral transduction, scale-up, and consistency, while retaining the ability for form well differentiated HSEs. In future studies, it will be interesting to compare the different effects of CerS3 depletion in HSEs generated with primary keratinocytes, which may display a slightly different lipid profile 40 – 43 . Using mass spectrometry, we identified the specific classes of lipids downregulated by CerS3 depletion, namely Cer[NH], Cer[NP], Cer[NDS] and the most abundant acyCer, Cer[EOS]. The former two are notable biomarkers for atopic dermatitis 37 . Our model also recapitulated the frequently reported long to short chain ceramide shift, which compromises barrier function 35 , 37 , 38 . While reductions in the abundance of Cer[EOS] were expected based on the known functions of CerS3 8 , 44 , 45 , the reduction in the precursor linoleic acid and ceramides in other biosynthetic pathways, suggests that CerS3 depletion has indirect effects on the ceramide composition of the epidermis. The inducible model described here may be useful for dissecting crosstalk and feedback mechanisms of ceramide synthesis in future studies. Likewise, incorporation of functional assays, such as transepidermal water loss, and structural analysis of the LLB with small angle x-ray diffraction 5 , 13 , 46 could provide additional insights into structure- function relationships within the model. In summary, the inducible HSE model developed here provides a tuneable platform in which to modulate and study lipid synthesis in the skin. We propose that these systems will be useful tools for investigating human-specific mechanisms of epidermal barrier function and disease processes. In addition, they have the potential to support animal-free testing of drugs or skincare products for lipid disorders in human skin. Materials and Methods 2D Monolayer Culture All reagents were from ThermoFisher unless otherwise stated. The N/TERT human keratinocyte line, was provided by the Rheinwald Lab 47 . N/TERTs were cultured at 37C and 5% CO 2 in FAD medium containing a 1:3 mixture of Ham’s F12 and Dulbecco’s modified Eagle’s culture medium, supplemented with 1% (v/v) penicillin/streptomycin (p/s), 1.8×10 -4 M adenine [Sigma], 10% (v/v) Foetal Bovine Serum (FBS) [Biosera], 5 µg/ml insulin [Sigma], 0.5 µg/ml hydrocortisone, 10 ng/ml epidermal growth factor [Peprotech], 1 x 10 -10 M cholera toxin [Sigma], seeded in T75 flasks (6,000 cells/cm 2 seeding density). N/TERTs were passaged at 60-70% confluency by rinsing with pre-warmed Versene solution followed by incubation with pre-warmed 0.25% trypsin-EDTA. Suspension was neutralised with an equal volume of FAD medium before being collected and centrifuged at 200 g for 5 minutes. Cells were counted and replated at a density of 1×10 6 cell per T75 flask. Primary human fibroblasts were provided by Prof. Michael Philpott and obtained from healthy donor abdominal skin [ethical reference number LREC 08/H0704/65]. Fibroblasts were seeded at a density of 12,000 cells/cm 2 and cultured at 37C and 5% CO 2 in DMEM supplemented with 1% p/s (v/v) and 10% (v/v) FBS. Fibroblasts were used up until passage 7. Decellularised Extracellular Matrix Preparation For the HSE dermal matrix, we used a decellularised extracellular matrix hydrogel (dECM) made from pig skin 31 . Fresh pig skin was cut into 1 cm x 1cm pieces using scalpels with as much fat and hair removed by manual scraping. Pieces were soaked in PBS with 1% (v/v) p/s for 2 hours followed by weighing in sterile tubes. Skin was frozen at −80C for 5 hours prior to being freeze dried overnight. Tissue was digested overnight at 4C in 560 U/L Dispase [Sigma] solution dissolved in a 10 mM sodium acetate (pH 7.5) and 5mM calcium acetate buffer solution at 2 ml per gram of tissue to disrupt the epidermal-dermal association. The epidermis was then scraped off using tweezers and the dermis washed thrice in sterile ddH 2 O, before being washed with constant stirring overnight at room temperature in 70% ethanol. The dermis was then treated with 0.25% Trypsin/0.1% EDTA for 1 hour at 40C using a heated plate stirrer. Dermis was again washed in sterile ddH 2 O, before being incubated at room temperature under constant stirring for 6 hours in a 1% Triton-X, 0.26% EDTA, 0.69% Tris buffer solution. After 6 hours, this solution was replaced with fresh buffer solution and the dermis was incubated overnight on the magnetic stirrer. The tissue was then washed thrice in sterile ddH 2 O, followed by freezing at 80C before being freeze-dried overnight. The dried tissue was weighed and digested at 20 mg/ml acidic pepsin solution, which was prepared by dissolving Pepsin A [Sigma] at a final concentration of 1 mg/ml in 0.01 M hydrochloric acid. The dermis was digested at room temperature for 3 days under constant stirring until tissue was fully dissolved. The resulting dECM was aliquoted and stored at −20°C. 3D Human Skin Equivalent Models HSE models were made in 12-well Transwell plates utilising 0.4 µm inserts [Merck]. Fibroblasts were mixed with thawed aliquots of dECM to make a 1×10 5 cells/ml suspension and 340 µl of solution was subsequently pipetted onto the apical side of the Transwell insert. The solution was left to solidify for 2 hours in the incubator. After which, 340 µl of FAD- suspended N/TERTs were added on top of the solidified gel. An additional 340 µl of FAD medium was added to the apical side of the Transwell insert, with a further 500 µl of FAD added to the bottom of the well plate prior to overnight incubation. The following day, the inserts were raised to an air-liquid interface by removing medium from the apical side of the Transwell insert, leaving the top surface of the construct dry. HSEs were maintained at an air-liquid interface for 14 days with basal media changes conducted every day. From day 7 onwards, basal media was supplemented with 50 µg/ml ascorbic acid. Design and Selection of CERS3 shRNA Sequences Three lentiviral inducible SMARTvectors (100 µl, 1×10 7 TU/ml) were purchased for the CERS3 protein coding targets and the shRNA target sequences were selected from pre-designed sequences [Horizon Discovery Ltd]. For the target gene, three knockdown sequences, named sh1, sh2 and sh3, were all unique in that they targeted multiple splice variants and their alignments with the CERS3 gene did not overlap. The fourth did not have a targeting nucleotide sequence and was used as a non-targeting control group (NTC). Each construct was transduced into separate N/TERT cell populations, making four transduced cell lines in total ( Table 1 ). View this table: View inline View popup Download powerpoint Table 1: List of the product numbers and identification codes for the selected shRNA constructs Knockdown Cell Line Transduction, Selection and Activation N/TERT cells to be transduced were seeded at a density of 30,000 cells/cm 2 in 6 well plates, before incubating in transduction medium with 6 µg/ml polybrene and lentiviral particles at 1.0 multiplicity of infection for 24 hours. Cells were then left to recover in fresh medium for a further 24 hours. After, N/TERTs were cultured until confluent in FAD medium supplemented with 1 μg/ml puromycin before being replated and cultured again until confluent, then cryopreserved. Optimisation of doxycycline concentration was performed on the inducible Non-Targeting Control (NTC) population and monitored by expression of the RFP transgene. Flow Cytometry Transduced cells from monolayer culture were resuspended in PBS (10 x 10 6 cells/ml) and analysed using the Becton Dickinson FACS Aria IIIu [BD Biosciences]. RFP was detected on the Yellow-Green 582/12nm channel with Forward Scatter (FSC-A) and Side Scatter (SSC-A) detected on the blue laser with doublet discrimination determined by Side Scatter Width (SSC-W). Histological Processing, Embedding and Staining On day 14, HSEs were removed from the Transwell inserts, gently rinsed with PBS and fixed in 4% paraformaldehyde (PFA) for 30 minutes. After two subsequent rinses in PBS, the HSEs were placed individually in tissue processor cassettes and stored in 70% ethanol prior to overnight dehydration in the Tissue-TEK processor [Sakura]. HSEs were paraffin embedded and sectioned using the Leica RM2235 microtome [Leica Biosystems] into 8 μm-thick sections on glass SuperFrost slides. For H&E staining, sections were incubated in two separate solutions of xylene for 3 minutes each. Afterwards, slides were incubated in separate solutions of decreasing alcohol concentrations for 3 minutes each (100%, 90% and 70%) followed by a further 3-minute incubation in ddH2O. Slides were then sequentially submerged in haematoxylin for 3 minutes, rinsed, then dipped in acid alcohol 5 times before being rinsed in running ddH2O for 5 minutes. Slides were then checked for the presence of stained nuclei under a light microscope, then submerged in eosin solution for 3 minutes before rinsing in running ddH2O for 5 minutes. For dehydration, sections were incubated in increasing solutions of ethanol for 3 minutes each (70%, 90% and 100%), before transferring to the two separate xylene solutions for an additional 3 minutes. Finally, H&E-stained slides were mounted with coverslips using DPX Mountant [Sigma] before imaging with the Nikon Eclipse 80i Stereology Microscope [Nikon]. For immunofluorescence, after deparaffinisation, tissue sections were boiled at 100°C for 15 minutes for antigen retrieval in pH 6 citrate buffer solution consisting of 10 mM sodium citrate tribasic and 1M HCL in ddH2O. Sections were then left to cool in the same buffer for 15 minutes. Tissues were permeabilised with 0.05% Triton-PBS solution for 5 minutes, followed by two subsequent PBS rinses before being placed in a blocking solution of 1% (w/v) fish gelatin [Sigma] and 2% (w/v) FBS in PBS for 1 hour. Sections were then incubated with the selected primary antibodies diluted in blocking solution at 4C overnight. Primary antibodies included anti-keratin 14 (Sc-59724, Santa Cruz [1:100]), anti-Loricrin (ab85679, Abcam [1:80]), anti-TGM1 (HP040171, Atlas Antibodies [1:200]) and anti-tRFP (AB233, Evrogen [1:1000]). The next day, after rinsing with PBS, secondary antibodies diluted in blocking solution were applied to each section, covered then stored for 1 hour at room temperature. Secondary antibodies were anti-mouse Alexafluor 568 (A11004, ThermoFisher [1:1000]) and anti-rabbit Alexafluor 488 (A11008 ThermoFisher [1:1000]). After briefly rinsing with PBS, mounting medium with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (104139, Abcam) was applied to each of the sections and cover-slipped ready for imaging. Images were acquired using either the Leica DM4000 Epifluorescence or the Leica DM5000B Epifluorescence microscopes [Leica Microsystems]. Normal human skin samples followed the same procedure. For Nile red staining, samples were first deparaffinised as described previously. Then a stock solution containing 0.05% Nile red in acetone was diluted to 2.5 μg/ml with 75:25 (v/v) glycerol-ddH2O, followed by rapid vortexing. Then a drop of the glycerol-dye solution (20 μl) was applied to each tissue section and immediately covered with a coverslip. Slides were imaged 30 minutes later using the Leica DM4000 Epifluorescence microscope [Leica Microsystems]. Image Analysis Fluorescence intensity of IF and Nile red staining were analysed with ImageJ by demarcating the epidermis and measuring the integrated intensity and mean grey values of the epidermis within the region of interest (ROI). For background subtraction, a region without tissue was measured using the same approach. Corrected total cell fluorescence was calculated by multiplying the ROI area by the mean fluorescence of the background and subtracting this value from the integrated density. Western Blotting HSEs were removed from the Transwell inserts and the epidermal layers were separated from the dermal matrix using a scalpel, rinsed with PBS and placed into 1.5 ml microcentrifuge tubes. Tissues were then placed on ice and immersed in 125 µl of a supplemented radio immunoprecipitation assay (RIPA) buffer solution containing 1X protease inhibitor [Sigma]. Samples were vortexed for 20 seconds, homogenised for 20 seconds and sonicated for 5 minutes before being homogenised again for an additional 20 seconds. Samples were then centrifuged for 10 minutes at 4C at a rate of 9,000 xg. Supernatants were collected and stored at −20C. Equal amounts (20 µg) of protein were loaded onto the 4%−20% Mini-PROTEAN TG Precast Protein running gels [Bio-Rad] and run at 100 V for 1.5 hours. Membrane transfer was performed at 300 A for 1.5 hours onto a 0.45 µm nitrocellulose membrane or the TransBlot Turbo Fast Transfer system [Bio-Rad] was used for the transfer step. Membranes were blocked with 5% milk in Tris-Buffered Saline with 0.1% Tween (TBS-T). Membranes were incubated with primary antibodies, anti-CerS3 [HPA006092 Sigma (1:1000)] and anti-GAPDH [MAB374, Millipore (1:5000)] diluted in blocking solution, overnight at 4C. Membranes were then washed three times in TBS-T for 5 minutes and incubated for an additional 1 hour at room temperature with secondary antibodies, anti-mouse HRP [P0447 Dako (1:15000)] and anti-rabbit [P0448 Dako (1:5000)], diluted in 5% milk. Blots were washed again, three times for 5 minutes, and developed with Enhanced Chemiluminescence HRP substrate. Imaging was carried out on the ChemiDoc XRS imaging system [Bio-Rad]. Densitometry analysis of band intensity was performed using ImageJ. RT-qPCR RNA extraction was performed using the RNeasy Plus Mini Kit [Qiagen], following the protocol provided without the incorporation of either β-mercaptoethanol or dithiothreitol to the lysis RLT buffer. Samples were analysed for RNA content and purity using the NanoDrop ND-1000 Spectrophotometer. For cDNA conversion, RNA samples were diluted to 1 µg total RNA for each sample and the LunaScript RT SuperMix Kit [New England Bio Labs] was used for reverse transcription. Primers were designed using the University of California Santa Cruz (UCSC) Genome Browser [ https://genome.ucsc.edu/ ] in parallel with the National Centre for Biotechnology Information’s (NCBI) Primer-BLAST tool [ https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ]. The CERS3 primer sequence was (CCATCCAGTAGCTTCGCCTC and TCAGAGAGCAGCTTCCAACG). Primers were subsequently synthesised by Sigma-Aldrich at 100 µM concentrations in solution. GAPDH primers were synthesised by Eurofins [Eurofins Scientific]. PCR reaction master mixes were made on ice using the 2x qPCRBIO Sybr Green Mix Hi-ROX kit [PCR Biosystems], with primers diluted to a 10 µM concentration. For each primer pair, non-cDNA triplicates were used as controls and GAPDH was the housekeeper gene for all samples. Well plates were briefly spun prior to analysis on the StepOne Plu Real-Time PCR System [Applied Biosystems]. Analysis was performed using the ΔΔCt relative quantification method. Mass Spectrometry Lipid extraction was performed using a modified version of the Folch Extraction Method 48 , 49 . Briefly, HSEs were washed twice in cold PBS before removal of the epidermal layers manually with a scalpel. Epidermal sheets were then placed in Agilent A-Line Amber Glass Vials and dissolved in a 2:1 chloroform/methanol solution at 4C overnight on a shaker. The supernatant was then removed, and the solution was filtered (0.4 µm pore size) and placed into fresh glass vials. Solutions were then dried with nitrogen gas and stored at −80C until analysis. Lipid extracts were suspended in 200 µL of CHCl 3 :MeOH (2:1 v/v). 40 µL of a mixture of deuterated internal standards was added to the samples to control the intraday heterogeneity and to quantitate the relative abundance of detected lipids. The mixture included deuterated cholesterol-2,2,3,4,4,6-d6 (d6-CH, 320 pmol), deuterated cholesterol sulfate sodium salt (d7-CHS, 160 pmol), Hexadecanoic-9,9,10,10,11,11,12,12,13,13,14,14,15,15,16,16,16-d17 acid (d17-PA, 640 pmol), N-palmitoyl-d31-D-erythro-sphingosine (d31-Cer16:0, 8 pmol), glyceryl Trihexadecanoate-d98 (d98TG 48:0, 160 pmol), 1-pentadecanoyl-2-oleyol(d7)-sn-glycerol (15:0-18:1(d7) DG, 272 pmol), 25,26,26,26,27,27,27-heptadeuteriocholest-5-en-3ß-ol (9Z-octadecenoate) (18:1(d7) CE, 243 pmol), 1-pentadecanoyl-2-oleoyl(d7)-sn-glycero-3-phosphocholine (15:0-18:1(d7) PC, 212 pmol), 1-pentadecanoyl-2-oleoyl(d7)-sn-glycero-3-phosphoethanolamine (15:0-18:1(d7) PE, 225 pmol), N-oleoyl-D-erythro-sphingosylphosphorylcholine-d9 (d18:1-18:1(d9) SM, 217 pmol). The volume was filtered through the Captiva Vacuum (Agilent Technologies) with a pore size of 0.2 µm, and the filtrate was collected in graduated glass vials, dried under nitrogen flow and suspended in 200 µL CHCl 3 :MeOH (2:1 v/v). For quantitative measurement of cholesterol a GC-MS analysis was performed. 20 µL of the lipid extract was dried under nitrogen and then derivatised with 20 µL of 1% trimethylchlorosilane in pyridine. The reaction carried out at 60C for 60 minutes can produce the trimethylsilyl (TMS) derivatives of most lipids. The GC-MS instrument was an 8890 GC System combined with a 5977B Series MSD single-quadrupole (Agilent Technologies). Helium was used as the carrier gas; the flow rate was 1.2 ml/min. The analysis was conducted on the 30m x 0.250mm (i.d.) x 0.25µm film thickness HP-5MS UI fused silica column (Agilent Technologies), chemically bound with a 5%-phenyl-methylpolysiloxane phase. The GC oven program was as follows: 80C at 0 min, 280C at 33 min, 310C to final run time of 49 minutes. Samples were acquired in scan mode following EI ionization 50 . Triglycerides, diglycerides, and cholesteryl esters were detected in Reverse Phase-HPLC (RP-HPLC) under positive electrospray ionization ((+)ESI) conditions. Free fatty acids, ceramides, hexosylceramides, and cholesterol sulfate were analysed under negative electrospray ionization ((-)ESI) conditions. To separate polar and hydrophilic compounds, Hydrophilic Interaction Liquid Chromatography (HILIC) was used. Phosphatidylcholines, ether-linked phosphatidyl-choline, sphingomyelins, phosphatidylethanolamines, and ether-linked phosphatidyl-ethanolamine, were detected in HILIC (+)ESI mode. RPLC separation was conducted on an Agilent Technologies Infinity II 1260 series HPLC system equipped with a degasser, a quaternary pump, an autosampler and a column compartment. For the RP-HPLC separation a Zorbax Eclipse Plus C18 column (2.1 x 50 mm, 1.8 µm particle size) (Agilent Technologies) was used. The column temperature was set at 60C, the maximum operating pressure was 600 Bar/9000 psi. Cell extracts were eluted with a binary gradient of (A) MilliQ water (18.2 Ω) and (B) in MeOH/iPrOH 80/20 and the flow rate was 0.3 ml/min. Mobile phase additive was used to improve ionization efficiency. HILIC separation was performed on a HALO HILIC column (Advanced Materials Technolog), 2.1 x 50 mm, 2.7 µm particle size, with maximum operating pressure at 600 Bar/9000 psi. The column temperature was set at 40C. The mobile phase consisted of (A) aqueous solutions of 5mM ammonium formate in MilliQ water (18.2 Ω) and (C) ACN. The mobile phase flow rate was 0.4 ml/min. The HPLC instrument was connected by an ESI Dual Agilent Jet Stream (AJS) interface with an Agilent Technologies (Santa Clara, CA, USA) 6545 Quadrupole Time of Flight (Q-TOF) as mass spectrometer. Nitrogen was used as a gas for both the nebulisation and desolvation processes. The ion source gas temperature was 200 °C with a flow rate of 12 L/min; the nebuliser pressure was 40 psi. Sheath gas temperature was set at 350 °C; sheath gas flow rate of 12 L/min. The fragmentor voltage parameter was 120 V and the skimmer 40 V. Data were collected in all ion MS/MS modes, at 0, 20, 40V of collision energies. The m/z range for MS an MS/MS of 59-1700 at a mass resolving power of 40,000. Internal mass calibration for accurate mass measurement used two reference ions: m/z 121.0509 and m/z 922.0098 (+)ESI, m/z 119.0363 and m/z 940.0015 (-)ESI. For analysis, all data were derived by normalizing the response of the individual lipid by the response of the same-class labelled internal standard (e.g. free fatty acids vs deuterated-palmitic acid, cholesterol vs deuterated-cholesterol, etc.) and multiplied by the iSTD pmole. Resulting pmoles were normalized by total nmole amount of each sample. A t-test was performed to determine significant differences between sample groups and how they are related. Differences were considered statistically significant with P-values (p) ≤ 0.05. Additional analyses and graphing (volcano and PCA plots) were conducted using R Statistical Software (v2023.06.1+524 “Mountain Hydrangea”). Data Availability Statement All data will be made available on request. Conflict of Interest Statement The authors state no conflict of interest. Author Contributions Investigation: DD, MM, HK. Formal Analysis: DD, MM, HK, CE, JTC. Writing – original draft: DD and JTC. Writing – review and editing: DD, CE, JTC. Conceptualisation: JTC. Supervision: JTC. Funding Acquisition: JTC Acknowledgements This work was funded by a PhD studentship from the BBSRC London Interdisciplinary Doctoral Programme (LIDo). We thank Dr Matthew Caley and Prof. Edel O’Toole for their advice and guidance on retroviral transductions and HSE methods. References 1. ↵ Nemes , Z. & Steinert , P. M . Bricks and mortar of the epidermal barrier . Exp Mol Med 31 , 5 – 19 ( 1999 ). OpenUrl CrossRef PubMed Web of Science 2. ↵ Elias , P. M. et al. Formation and functions of the corneocyte lipid envelope (CLE) . Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids vol. 1841 314 – 318 Preprint at doi: 10.1016/j.bbalip.2013.09.011 ( 2014 ). OpenUrl CrossRef 3. Wertz , P. W. , Swartzendruber , D. C. , Kitko , D. J. , Madison , K. C. & Downing , D. T . The role of the corneocyte lipid envelopes in cohesion of the stratum corneum . Journal of Investigative Dermatology 169 – 172 ( 1989 ) doi: 10.1111/1523-1747.ep12277394 . OpenUrl CrossRef PubMed 4. Feingold , K. R. & Elias , P. M . Role of lipids in the formation and maintenance of the cutaneous permeability barrier . Biochim Biophys Acta Mol Cell Biol Lipids 1841 , 280 – 294 ( 2014 ). OpenUrl 5. ↵ Van Smeden , J. , Janssens , M. , Gooris , G. S. & Bouwstra , J. A . The important role of stratum corneum lipids for the cutaneous barrier function . Biochim Biophys Acta Mol Cell Biol Lipids 1841 , 295 – 313 ( 2014 ). OpenUrl 6. ↵ Kendall , A. C. , Kiezel-Tsugunova , M. , Brownbridge , L. C. , Harwood , J. L. & Nicolaou , A . Lipid functions in skin: Differential effects of n-3 polyunsaturated fatty acids on cutaneous ceramides, in a human skin organ culture model . Biochim Biophys Acta Biomembr 1859 , 1679 – 1689 ( 2017 ). OpenUrl CrossRef 7. ↵ Rabionet , M. , Gorgas , K. & Sandhoff , R . Ceramide synthesis in the epidermis . Biochim Biophys Acta Mol Cell Biol Lipids 1841 , 422 – 434 ( 2014 ). OpenUrl 8. ↵ Kihara , A . Synthesis and degradation pathways, functions, and pathology of ceramides and epidermal acylceramides . Prog Lipid Res 63 , 50 – 69 ( 2016 ). OpenUrl CrossRef PubMed 9. ↵ Bouwstra , J. A. , Dubbelaar , F. E. R. , Gooris , G. S. & Ponec , M . The Lipid Organisation in the Skin Barrier . Acta Derm Venereol 23 – 30 ( 2000 ). 10. Bouwstra , J. , et al. New Aspects of the Skin Barrier Organization . Skin Pharmacol Appl Skin Physiol vol. 14 www.karger.com/journals/sph ( 2001 ). 11. ↵ Bouwstra , J. A. , et al. Role of Ceramide 1 in the Molecular Organization of the Stratum Corneum Lipids . Journal of Lipid Research vol. 39 ( 1998 ). 12. ↵ Coderch , L. , López , O. , De La Maza , A. & Parra , J. L. Ceramides and Skin Function . Am J Clin Dermatol 4 , 107 – 129 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 13. ↵ Schreiner , V. et al. Barrier characteristics of different human skin types investigated with X-ray diffraction, lipid analysis, and electron microscopy imaging . Journal of Investigative Dermatology 114 , 654 – 660 ( 2000 ). OpenUrl CrossRef PubMed 14. Shen , C. P. et al. Skin Ceramide Profile in Children with Atopic Dermatitis . Dermatitis 29 , 219 – 222 ( 2018 ). OpenUrl CrossRef PubMed 15. ↵ Sahle , F. F. , Gebre-Mariam , T. , Dobner , B. , Wohlrab , J. & Neubert , R. H. H . Skin diseases associated with the depletion of stratum corneum lipids and stratum corneum lipid substitution therapy . Skin Pharmacol Physiol 28 , 42 – 55 ( 2015 ). OpenUrl CrossRef PubMed 16. ↵ Bouwstra , J. A. , Gooris , G. S. , Dubbelaar , F. E. R. & Ponec , M . Phase behavior of stratum corneum lipid mixtures based on human ceramides: The role of natural and synthetic ceramide 1 . Journal of Investigative Dermatology 118 , 606 – 617 ( 2002 ). OpenUrl CrossRef PubMed 17. ↵ Imokawa , G. et al. Decreased Level of Ceramides in Stratum Corneum of Atopic Dermatitis: An Etiologic Factor in Atopic Dry Skin? Journal of Investigative Dermatology 96 , 523 – 526 ( 1991 ). OpenUrl CrossRef PubMed Web of Science 18. ↵ Elias , P. M. et al. Stratum corneum lipids in disorders of cornification. Steroid sulfatase and cholesterol sulfate in normal desquamation and the pathogenesis of recessive X-linked ichthyosis . Journal of Clinical Investigation 74 , 1414 – 1421 ( 1984 ). OpenUrl CrossRef PubMed Web of Science 19. ↵ Oji , V. et al. Revised nomenclature and classification of inherited ichthyoses: Results of the First Ichthyosis Consensus Conference in Sorze 2009 . J Am Acad Dermatol 63 , 607 – 641 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 20. ↵ Jennemann , R. et al. Loss of ceramide synthase 3 causes lethal skin barrier disruption . Hum Mol Genet 21 , 586 – 608 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 21. ↵ Eckl , K. M. et al. Impaired epidermal ceramide synthesis causes autosomal recessive congenital ichthyosis and reveals the importance of ceramide acyl chain length . Journal of Investigative Dermatology 133 , 2202 – 2211 ( 2013 ). OpenUrl CrossRef PubMed 22. ↵ Radner , F. P. W. et al. Mutations in CERS3 Cause Autosomal RecessiveCongenital Ichthyosis in Humans . PLOS Genetics vol. 9 1 – 11 Preprint at ( 2013 ). OpenUrl 23. ↵ Enjalbert , F. et al. 3D model of harlequin ichthyosis reveals inflammatory therapeutic targets . Journal of Clinical Investigation ( 2020 ) doi: 10.1172/JCI132987 . OpenUrl CrossRef PubMed 24. ↵ Thakoersing , V. S. et al. Increased presence of monounsaturated fatty acids in the stratum corneum of human skin equivalents . Journal of Investigative Dermatology 133 , 59 – 67 ( 2013 ). OpenUrl CrossRef PubMed 25. ↵ Danso , M. et al. Altered expression of epidermal lipid bio-synthesis enzymes in atopic dermatitis skin is accompanied by changes in stratum corneum lipid composition . J Dermatol Sci 88 , 57 – 66 ( 2017 ). OpenUrl CrossRef PubMed 26. ↵ Breiden , B. & Sandhoff , K . The role of sphingolipid metabolism in cutaneous permeabilitybarrier formation . Biochim Biophys Acta Mol Cell Biol Lipids 1841 , 441 – 452 ( 2014 ). OpenUrl 27. ↵ Akiyama , M . Corneocyte lipid envelope (CLE), the key structure for skin barrier function and ichthyosis pathogenesis . Journal of Dermatological Science vol. 88 3 – 9 Preprint at doi: 10.1016/j.jdermsci.2017.06.002 ( 2017 ). OpenUrl CrossRef PubMed 28. ↵ Baron , U. & Bujard , H . Tet repressor-based system for regulated gene expression in eukaryotic cells: Principles and advances . Methods Enzymol 327 , 401 – 421 ( 2000 ). OpenUrl CrossRef PubMed Web of Science 29. Zhou , X. , Vink , M. , Klaver , B. , Berkhout , B. & Das , A. T . Optimization of the Tet-On system for regulated gene expression through viral evolution . Gene Ther 13 , 1382 – 1390 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 30. ↵ Loew , R. , Heinz , N. , Hampf , M. , Bujard , H. & Gossen , M. Improved Tet-Responsive Promoters with Minimized Background Expression. http://www.gene-regulation.com/pub/databases . ( 2010 ). 31. ↵ Sarmin , A. M. & Connelly , J. T . Fabrication of Human Skin Equivalents Using Decellularized Extracellular Matrix . Curr Protoc 2 , 1 – 10 ( 2022 ). OpenUrl 32. ↵ Greenspan , S. D. F. and P. Application of Nile Red, a Fluorescent Hydrophobic Probe, for the Detection of Neutral Lipid Deposits in Tissue Sections: a Fluorescent of Neutral Hydrophobic Lipid Deposits in Tissue Sections: Comparison with Oil Red O . The Journal of Histochemistry and Cytochemistry 833 – 836 ( 1985 ). 33. ↵ Ming Sheu , H. , Tsai , J.-C. & Wong , T.-W. Modified Nile Red Staining Method for Improved Visualization of Neutral Lipid Depositions in Stratum Corneum Skin Disease Epidemiology View Project Desmosome Structure, Function and Skin Diseases View Project . Article in Journal of the Formosan Medical Association https://www.researchgate.net/publication/299175895 ( 2003 ). 34. ↵ T’Kindt , R. et al. Profiling and characterizing skin ceramides using reversed-phase liquid chromatography-quadrupole time-of-flight mass spectrometry . Anal Chem 84 , 403 – 411 ( 2012 ). OpenUrl CrossRef PubMed 35. ↵ Suzuki , M. , Ohno , Y. & Kihara , A . Whole picture of human stratum corneum ceramides, including the chain-length diversity of long-chain bases . J Lipid Res 63 , 1 – 13 ( 2022 ). OpenUrl 36. ↵ Kováčik , A. , Roh , J. & Vávrová , K . The chemistry and biology of 6-hydroxyceramide, the youngest member of the human sphingolipid family . ChemBioChem vol. 15 1555 – 1562 Preprint at doi: 10.1002/cbic.201402153 ( 2014 ). OpenUrl CrossRef PubMed 37. ↵ Ishikawa , J. et al. Changes in the ceramide profile of atopic dermatitis patients . Journal of Investigative Dermatology vol. 130 2511 – 2514 Preprint at doi: 10.1038/jid.2010.161 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 38. ↵ Janssens , M. et al. Increase in short-chain ceramides correlates with an altered lipid organization and decreased barrier function in atopic eczema patients . J Lipid Res 53 , 2755 – 2766 ( 2012 ). OpenUrl Abstract / FREE Full Text 39. ↵ Mizutani , Y. et al. Cooperative Synthesis of Ultra Long-Chain Fatty Acid and Ceramide during Keratinocyte Differentiation . PLoS One 8 , ( 2013 ). 40. ↵ Danso , M. O. et al. Exploring the potentials of nurture: 2nd and 3rd generation explant human skin equivalents . J Dermatol Sci 77 , 102 – 109 ( 2015 ). OpenUrl CrossRef PubMed 41. Van Drongelen , V. et al. Barrier properties of an N/TERT-based human skin equivalent . Tissue Eng Part A 20 , 3041 – 3049 ( 2014 ). OpenUrl CrossRef PubMed 42. Derr , K. et al. Fully Three-Dimensional Bioprinted Skin Equivalent Constructs with Validated Morphology and Barrier Function . Tissue Eng Part C Methods 25 , 334 – 343 ( 2019 ). OpenUrl CrossRef PubMed 43. ↵ Reijnders , C. M. A. et al. Development of a Full-Thickness Human Skin Equivalent in Vitro Model Derived from TERT-Immortalized Keratinocytes and Fibroblasts . Tissue Eng Part A 21 , 2448 – 2459 ( 2015 ). OpenUrl CrossRef PubMed 44. ↵ Wegner , M. S. , Schiffmann , S. , Parnham , M. J. , Geisslinger , G. & Grösch , S . The enigma of ceramide synthase regulation in mammalian cells . Prog Lipid Res 63 , 93 – 119 ( 2016 ). OpenUrl CrossRef PubMed 45. ↵ Mizutani , Y. , Mitsutake , S. , Tsuji , K. , Kihara , A. & Igarashi , Y . Ceramide biosynthesis in keratinocyte and its role in skin function . Biochimie 91 , 784 – 790 ( 2009 ). OpenUrl CrossRef PubMed 46. ↵ Mieremet , A. et al. Unravelling effects of relative humidity on lipid barrier formation in human skin equivalents . Arch Dermatol Res 311 , 679 – 689 ( 2019 ). OpenUrl CrossRef PubMed 47. ↵ Dickson , M. A. et al. Human keratinocytes that express hTERT and also bypass a p16(INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics . Mol Cell Biol 20 , 1436 – 47 ( 2000 ). OpenUrl Abstract / FREE Full Text 48. ↵ Bligh , E.G. and Dyer , W. J . Canadian Journal of Biochemistry and Physiology . Can J Biochem Physiol 37 , ( 1959 ). 49. ↵ Folch , J. , Ascoli , I. , Lees , M. , Meath , J. A. & LeBaron , F. N. Preparation of Lipide Extracts from Brain Tissue . ( 1951 ). 50. ↵ Ludovici , M. et al. Influence of the sebaceous gland density on the stratum corneum lipidome . Sci Rep 8 , ( 2018 ). View the discussion thread. Back to top Previous Next Posted January 24, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Development of human skin equivalents with inducible ceramide depletion for in vitro modelling of lipid deficiency Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Development of human skin equivalents with inducible ceramide depletion for in vitro modelling of lipid deficiency Durotimi O. Dina , Miriam Maiellaro , Emanuela Camera , John T. Connelly bioRxiv 2025.01.20.633956; doi: https://doi.org/10.1101/2025.01.20.633956 Share This Article: Copy Citation Tools Development of human skin equivalents with inducible ceramide depletion for in vitro modelling of lipid deficiency Durotimi O. Dina , Miriam Maiellaro , Emanuela Camera , John T. Connelly bioRxiv 2025.01.20.633956; doi: https://doi.org/10.1101/2025.01.20.633956 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Bioengineering Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13894) Bioinformatics (41951) Biophysics (21455) Cancer Biology (18592) Cell Biology (25507) Clinical Trials (138) Developmental Biology (13380) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24321) Genetics (15610) Genomics (22509) Immunology (17737) Microbiology (40398) Molecular Biology (17182) Neuroscience (88618) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7641) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.