The Enigmatic Journey of Black Soldier Fly: Revolutionizing Solid Waste Management

preprint OA: closed
Full text JSON View at publisher
Full text 168,230 characters · extracted from preprint-html · click to expand
The Enigmatic Journey of Black Soldier Fly: Revolutionizing Solid Waste Management | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Enigmatic Journey of Black Soldier Fly: Revolutionizing Solid Waste Management Suriya S, Akhtar Ali Khan, Sadhana Veeramani, Showkat Ahmad Shiek This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3957149/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 3 You are reading this latest preprint version Abstract The rapid urbanization, demographic shifts, and consumer behavior that have resulted in the sector's negative social, economic, and environmental impacts have not only captured the public's attention but also presented municipalities and decision-makers, as well as the general public, with new obstacles to overcome to manage the sector in a way that is both environmentally responsible and economically viable (Diener, 2010). A higher level of life is required due to population growth at such a rapid rate, which greatly increases the production of solid waste, either directly or indirectly. Urban development, economic expansion, and a system's effectiveness in collecting and treating trash are the main determinants of the volume and complexity of waste produced. According to Kaza et al. ( 2018 ), global garbage production is predicted to rise from 2 billion tonnes in 2016 to 3.4 billion tonnes in 2050, with Asian and African nations making up the majority of the increase. Inadequate management of organic waste is one of the biggest issues in emerging nations, which could have catastrophic effects on both the environment and anthropogenic activity. Composting is a tried-and-true method for handling organic waste that can drastically cut down on trash generation. The efficacy of composting can be enhanced by the conversion of organic waste using saprophage (CORS) systems, which feed organisms (saprophages) with decomposing organic waste. As organic waste converters, the Hermetia illucens Linnaeus (Diptera: Stratiomyidae) black soldier fly (BSF) has been introduced. Researchers have concentrated on a BSF-based technique for treating organic waste that is very new (Zurbrugg et al ., 2018). BSF larvae (BSFL) eat organic-rich waste such as food scraps, agro-industrial byproducts, and dairy manure voraciously (Nguyen et al., 2015 ; Meneguz et al., 2018 ). As a result, the nutrients in BSFL can be transformed into crucial proteins and lipids needed in animal feed (Liu et al., 2017 ), filling the gap left by the scarcity of conventional animal feed, whose cost has been rising over time. The waste from the BSFL bioconversion process can also be applied as fertilizer (Xiao et al., 2018 ). Black soldier fly Population growth Solid waste management Fertilizer Biodiesel Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Black soldier fly is a viable candidate for managing solid waste Introduction Municipal solid waste (MSW) management is still a difficult and underappreciated problem in low- and middle-income countries. According to Kumar and Agrawal (2020), India produces roughly 143,449 MT of MSW per day, of which approximately 1,11,000 MT are collected and 35,602 MT are processed. Household waste frequently goes uncollected on streets and drains, particularly in metropolitan and peri-urban regions, drawing disease vectors and clogging waterways. The organic portion typically makes up 80% of all municipal waste, which is a significant amount when compared to other waste components including glass, metal, and paper (Kumar et al ., 2017). Any effective waste management system must include adequate solid waste management. Alternatives to traditional methods of recovering nutrients from organic waste, such as vermicomposting and the treatment of faeces-containing sludge by the aquatic worm Lumbriculus variegatus , are called CORS technologies (Conversion of Organic Refuse by Saprophages). Another CORS solution that combines revenue generation and nutrient recovery is the larval stage of the black soldier fly (BSF), Hermetia illucens L., which digests organic waste. A fly belonging to the Stratiomyidae family that is regularly observed in tropical regions is the black soldier fly, Hermetia illucens L. (1758). Adults drink water, stay away from people, don't sting or bite, and don't spread any particular diseases. The larvae of this non-pest fly consume and destroy several types of organic material. According to Singh and Kumari (2019), domestic trash, animal waste (chicken, pig, and cow manure), and even human excreta were found to be efficiently digested by the larvae. Prepupa, the sixth instar, migrates away from the feed source to pupate, making it simple to gather. The black soldier fly prepupae produced during the waste reduction procedure can be fed to animals. Black soldier fly larvae (BSFL) have been used in small-scale waste management projects using substrates like manure, rice straw, food waste, distillers' grains, fecal sludge, animal waste, kitchen waste, and so on because they are reported to feed on a wide range of organic material (Spranghers et al ., 2017). They may be the most efficient flies in terms of the variety of substrates they can handle as well as processing speed. They have a longer larval stage than flies like house and carrion flies, lasting over three weeks. In comparison to mealworms and crickets, their feed conversion ratios are well recognized to be superior. In more and more places throughout the world, organic waste is being treated using black soldier fly (BSF) larvae. Kingdom : Animalia Phylum : Arthropoda Class : Insecta Order : Diptera Family : Stratiomyidae Genus : Hermetia Species : H. illucens Distribution The Black Soldier Fly can be found across tropical and temperate regions worldwide, as documented by Tomberlin et al. (2002). North America is home to 260 recognized species within the Stratiomyidae family, as reported by (Triplehorn, 2005). During late spring and early fall in the southeastern United States, the black soldier fly thrives, boasting three generations annually in Georgia according to Tomberlin et al. (2002). This fly, widespread throughout the Western Hemisphere, is commonly found in the continental United States. Black soldier flies inhabit every continent except Antarctica. They are native to the tropical and warm temperate regions of the Western Hemisphere, spreading to Eastern Hemisphere continents through human interactions, as noted by May (1961) and Rozkosny (1982). Habitat Black soldier flies are adaptable to various environments, including urban, rural, and forested areas. Adults are frequently observed resting on house walls, windows, tree trunks, and garden plants in residential and farm settings with livestock and poultry. These flies lay their eggs on decomposing organic matter and in the crevices of beehives, with larvae hatching in front of beehives after 4-6 days. The larvae feed on honey and waste materials from the hives, undergoing pupation for 2-20 days if they manage to survive potential bee attacks. They can even dismantle weak beehives. Thriving in a diverse range of decaying plant and animal materials, the larvae are terrestrial scavengers. The robust nature of H. illucens is exemplified by reports of a population exploiting resources from tuna remains preserved in 10% formaldehyde (May, 1961; Rozkosny, 1982). The black soldier fly, known for its eurythermal nature, can withstand a broad spectrum of temperature variations. These flies become active when morning temperatures reach 25 degrees Celsius. Mating takes place midair during the day when temperatures reach 27 degrees Celsius, and females lay their eggs in the early to mid-afternoon when temperatures range from 27.5 to 37.5 degrees Celsius. The ideal humidity for mating and oviposition is between 30% and 90%. While eggs and larvae develop optimally at 27 degrees Celsius, they can tolerate a moderate range of conditions during egg-laying. The development of H. illucens is notably inhibited at 20 degrees Celsius. High temperatures expedite the duration of each life stage compared to lower temperatures (Li et al., 2016; Lord et al., 1994; Sheppard et al., 2002). Taxonomical identification of BSF Sexual dimorphism is evident in black soldier flies, with females generally surpassing males in size. The variability in the white pattern extent on the female head and the size of white spots on the female abdomen adds to the distinctiveness. The male black soldier fly's genitalia, known as the aedeagal complex, is characterized by its slender form and dilation in the basal portion. In contrast, the females possess mostly internal genitalia but feature external structures known as Terminalia. The female Terminalia is of the long type, with long and segmented cerci. The genital furca is subtriangular, pointed proximally, exhibiting a large median aperture and remarkably broad, leaf-shaped posterolateral projections (Oliveira et al., 2016; Rozkosny, 1982). The male black soldier fly is characterized by a plate-like structure on its posterior end, while the female features a scissor-like structure at its tail end, serving as the female sexual organ for mating and oviposition. When a female extends its tail, it indicates readiness for mating, serving as a signal for males to initiate the mating process. The significance of a light source in successful mating might be attributed to aiding the visual recognition of this signal by the males, as suggested by (Yang, 2013). Molecular characterization DNA isolation Genomic DNA from a single fly was isolated using the HotSHOT technique as described by Montero-Pau et al. (2008) and Sadhana et al. (2021). Each fly was transferred into an Eppendorf tube using a camel hair brush, and ethanol within their bodies was removed before homogenization. Subsequently, 20 µl of tissue lysis buffer (10 N NaOH and 0.5 M NaEDTA; pH 8.0) was added to the sample, which was finely ground using a sterile plastic micro pestle and homogenized. The lysate was vortexed and then incubated for 20 minutes at 65°C. Following this, an equal volume of neutralizing buffer (10 mM Tris-HCL, pH 5.0) was added to the homogenate, which was further incubated for 15 minutes at 95 °C, followed by centrifugation for 5 minutes at 12,000 rpm. Finally, the DNA was resuspended in 20 µl of sterile water. The DNA concentration was measured at A260 nm using a spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) prior to polymerase chain reaction (PCR) analysis, with five microliters of the supernatant being used for extraction. Polymerase Chain Reaction (PCR) and Sequencing Polymerase chain reaction (PCR) was employed to amplify the 658 bp mitochondrial cytochrome c oxidase subunit I (mtCOI) gene using universal primers (forward primer LCO 1490 - 5 GGTCAACAAATCATAAAGATATTGG 3 and reverse primer HCO 2198 - 5 TAAACTTCAGGGTGACCAAAAAATCA 3) as described by Vrijenhoek (1994). The PCR was conducted in a thermal cycler (Eppendorf MastercyclerTM, Hamburg, Germany) with a total reaction volume of 20 µl, following the protocol outlined by Sambrook and Russell (2001). After amplification, the DNA products were separated using a 1.0% agarose gel, stained with ethidium bromide (10 mg/ml), and quantified using NanodropOneTM at A260/280 nm. Subsequently, the PCR product underwent purification utilizing the PureLinkTM PCR Purification Kit. Biokart India Pvt. Ltd. (Bengaluru, India) conducted double-pass Sanger dideoxy DNA sequencing to sequence the designated mtCOI forward and reverse primers in both directions. Phylogenetic analysis To construct the phylogenetic tree, all Black Soldier Fly (BSF) mtCOI sequences from both the NCBI GenBank and this study were utilized. Sequences were aligned using the sequence alignment editor BioEdit (version 7.0.5.3), and MEGA-X Clustal W (Thompson et al. 1994) was employed to generate multiple sequence alignments and identify a similarity region. Subsequently, a dendrogram was produced in MEGA-X using the maximum likelihood approach with 1000 iterations. Biology and Life Cycle The BSF, commonly referred to as a latrine larva, is a dipteran belonging to the Stratiomyidae family (Diener, 2010). The tropical regions of Central and South America are where it originally originated. The length of an adult H. illucens is around 16 mm (5/8 in). These medium-sized flies have a body that is mostly black, with metallic reflections on the thorax that range from blue to green, and occasionally have a crimson finish to the abdomen. A transparent region is present in the second abdominal tergite. Wide eyes and a broad head are present. The length of the antennae is roughly equal to that of the head. The tarsi are pale and have black legs. The membranous wings are folded and overlapped horizontally on the abdomen during the period when the animal is resting. A mature female can produce anywhere from 206 to 639 eggs at once. These eggs normally hatch in 4 days and are laid in cracks, on surfaces above or beside decaying material, such as manure or compost. Larvae that have just emerged are only 1.0 millimeters (0.04 in) long, but they can grow to be 25 millimeters (1 in) long and weigh between 0.10 and 0.22 grams (1.5 to 3.4 gr) by the time they reach the end of the larval stage. The larvae may consume a wide range of organic substances and can adjust to diets with various nutrient contents. Depending on the food substrates available to the larvae, the larval stage can last anywhere between 18 and 36 days, with the post-feeding (prepupal) stage lasting roughly 7 days (Lohri et al ., 2017). Due to low temperatures or a shortage of food, the length of the larval stage can be extended by months. One to two weeks pass during the pupal stage. When given water and food, such as sugar in captivity or nectar in the wild, adults can normally live 47 to 73 days. They can also survive for around 8 to 10 days on fat stores accumulated during the larval stage when water is given. BSF mass production BSF rearing unit This guarantees that a steady supply of small larvae, or 5-DOL, is constantly available to inoculate the daily volume of biowaste brought into the treatment facility for processing (Sheppard et al ., 2002). But to maintain a steady breeding population, a certain number of larvae hatchlings are kept in the rearing unit. The rearing unit must supply a specific number of 5-DOL, or five-day-old larvae, each day to guarantee the regular treatment of a specified amount of trash. Therefore, it's crucial to manage the individual production phases during raising and to keep an eye on how each one is doing. It is possible and simple to regulate the amount of prepupae that are permitted to pupate in a well-designed BSF nursery. The colony's overall performance is tracked by keeping track of the survival rates at each stage of this cycle, which also highlights any difficulties at a specific stage. Various nurseries may have different survival rates. Egg deposition and egg harvest The placement of all egg packets in one particular area is crucial. This will make it much easier to collect the eggs. To achieve this, provide the cages with an appropriate medium that satisfies the fly's needs for a safe area (i.e., sheltered cavities) for egg deposition and an "attractant" that encourages the female to lay eggs nearby and mimics decomposing organic waste. Before any larvae hatch, the egg packets are harvested after being deposited. It's crucial to keep handling of egg bundles and individual eggs to a minimum because every movement or touch lowers the survival percentage of the eggs. Weighing the entire mass of the eggs and the egg-laying equipment is one way to reduce egg handling. Egg hatching and larvae feeding The harvested egg-laying apparatus is arranged over an open "hatchling container" with a premium food source, along with those harvested the day before. Several days will pass before the larvae hatch. A consistent "shower" of hatchlings into the nursery container is ensured by combining recently harvested egg-laying apparatus with the older egg-laying apparatus. Larvae drop from the egg-laying equipment into the hatchling container below after hatching, where they begin feeding right away. The starter chicken feed and water are the high-quality food supply in the hatchling container. This combination contains 70% or more water. With consistent (same age and size) larvae, BSF waste management is made easier. Better waste intake, conversion rate, and harvesting time planning are now possible. The number and age of young larvae in a hatchling container can be managed and determined by using the hatchling shower. The batch of larvae's homogeneity depends on how often the hatchling container is changed. The homogeneity of the young larvae increases with replacement frequency. Five days after hatching, larvae continue to feed in the same hatchling container. After being removed from the hatchling containers, the 5-DOL are tallied, and a majority of them are subsequently sent to the BSF treatment facility where they are mixed with the garbage. Depending on how much waste needs to be handled and how well the nursery is doing, a tiny portion of the 5-DOL (2–5%) is maintained in the rearing unit. Less 5-DOL will need to be kept in the rearing unit due to high survival rates and several eggs per female. These retained larvae are put into a nursery container where they are continuously given a specific diet mixture for about two weeks, during which time they develop into prepupae. When all larvae in a nursery container reach the same age, they will all change at roughly the same time. To find a better, dryer place to pupate, the prepupae will attempt to flee the food supply. Pupation Prepupae are harvested and moved into a pupation container after they are wriggled into the transfer container. The containers include a moist substrate (compost) that the prepupae can burrow into as they are disturbed by large masses of other prepupae. The pupation containers are put inside pupation cages, sometimes known as "dark cages," which are completely dark inside to aid in the pupation process. The pupae are adequately protected in this cage from changing outdoor environmental factors, such as moisture, temperature, air movement, etc., in addition to the gloomy environment. The pupation material has slightly dried out after two to three weeks, making it simpler for the flies to emerge from the pupal skin, climb to the top of the material, and leave the pupation containers while remaining confined inside the dark cage. The newly emerged flies won't mate since it is so dark inside the cage; instead, they will just stand still. As a result, the flies in the dark cage provide a steady supply of new adult flies, who, if released into the light, will begin to reproduce. Ten days after being placed in the pupation box, the adults begin to emerge. They then follow a bell-shaped curve and terminate with a few latecomers after 25 days. Mating Emerging flies are removed from the dark cage as needed. This is accomplished by creating a tunnel that connects the dark cage with the unlit cage that is dangling from the mobile frame. It is known as the "love-cage" since this is where mating will occur. The flies will be drawn by the light at the end of the tunnel to fly from the dark cage into the love-cage. To gather the most recently emerged flies, a love cage is sequentially connected to three to four dark cages. With the help of this technique, the fly density inside the love cages may be kept steady and constant. The gathered flies are also all fairly similar in age. A significant advantage of using similar-aged flies in the love-cage is that they are predictable and will copulate and lay eggs at roughly the same time, making it possible to run a nursery business more effectively. The fly hydration gear, egg-laying equipment, and a box with an offensive attractant are all included in the love cages. Thus, the raising cycle has come to an end. Municipal waste Agro-industrial waste Manure and faeces Municipal organic waste Food processing waste Poultry manure Food and restaurant waste Spent grains Pig manure Market waste Slaughterhouse waste Human faeces Faecal sludge The garbage brought into the facility must be fit for the larvae to eat. The trash must first be controlled to make sure it doesn't include any inorganic or hazardous compounds (Lalander et al ., 2019). The next stage is to reduce the trash's particle size, dewater it if it has a high moisture content, and/or mix it with other forms of organic waste to give the larvae a balanced diet and enough moisture (70–80%). The majority of the time, larvae are quite tolerant of the substrates they are fed on. However, it's crucial that the biowaste the facility receives is acceptable for use as larval food. Most organic materials will be handled in one way or another if they have a water content of between 60% and 90% and a particular particle size. The symbiotic microbes that the larvae rely on heavily break down cell structures and make nutrients accessible for the larvae to absorb. However, with little nutrition, development may take longer and the eventual weight of the larva would be smaller. Trash quality control is performed as soon as the waste arrives to make sure it is free of hazardous and inorganic contaminants. The debris can be manually sorted and discarded, and a few plastic bags may not be much of an issue. However, dangerous contaminants must be kept out because they may harm every living thing present, including the workers as well as the associated bacteria and larvae (Lalander et al ., 2020). These substances include acids, solvents, insecticides, detergents, and heavy metals. It's crucial to keep these substances out of the waste stream when they're liquid or dissolved since they can readily contaminate the entire batch. Waste should be rejected if this kind of contamination is detected. Reducing the size of the waste particle is the next necessary step once the waste quality has been guaranteed. The use of a shredder or hammer mill will accomplish this. Whatever the technology, it should be able to reduce trash to particles no larger than 1-2 cm in diameter (Singh and Kumari, 2019). As BSF larvae lack the proper mouthparts to break up huge chunks of trash, this aids in speeding up BSF processing. Increasing the surface area also encourages the growth of the related bacteria. The trash must be dewatered or combined with another, more dry waste source to reduce moisture content if the shredded waste has a water content above 80% (waste at this moisture will have a slurry-like texture, comparable to a fruit mix when ground in a kitchen blender). Water must be added if the water content is less than 70%. Squeezing a handful of waste will show you if it is too dry or not by seeing how much water appears between your fingers when you squeeze the trash. Water that is used for wet and dry waste must be safe to use, which means it must be free of pathogens, heavy metals, and other anti-nutritional components. Parameters about the feedstock Optimal values Suggested pre-processing methods for optimization Nutrient content 21% protein and 21% carbohydrate; C/N ratio: 10-40; High contents of volatile solids Mixing different waste types Fibre content Not too high Pre-fermentation Moisture content 70-80% Dewatering, water addition, and/or mixing different waste types Particle size 1-2 cm Shredding Structure Sufficient for larvae to move through the feedstock, consume it, and breathe Addition of matrix material such as pine shavings or crushed charcoal pH 5-8 Mixing different waste types Solid waste degradation by Hermetia illucens Both the larvae and the adults are not regarded as pests or vectors. Instead, black soldier fly larvae function as crucial decomposers in the same way that redworms do, consuming organic substrates and redistributing nutrients to the soil (Gold et al ., 2018). The larvae can be utilized to compost food scraps from homes and farms because they have ravenous appetites. In addition, black soldier fly larvae (BSFL) are a different source of protein for human nutrition, pet food, animal feed, and aquaculture. To create energy-dense larvae and organic fertilizer, the BSF treats garbage by feeding it to its larvae. This bug is highly appealing for valorizing organic waste due to several BSF traits: The effective conversion of a wide variety of organic waste materials is made possible by the BSF larvae's insatiable appetite for decomposing organic substances; Due to the BSF's brief life cycle and propensity for frequent reproduction, there is always a ready supply of both energy-rich larvae that can be utilized as animal feed and larvae to convert organic waste. Because of its toughness, the BSF is easier to raise and less restrictive to employ in waste treatment; The prepupae can finally be easily gathered because they spontaneously crawl out of the excrement. BSF waste treatment unit Daily transfers of a predetermined quantity of 5-DOL are made from the BSF raising unit to the BSF treatment units holding the waste. The quantity of biowaste contained in a certain volume and surface area will determine how many 5-DOL are added. The 5-DOL from the raising unit is fed here using containers of biowaste. The biowaste is fed to the immature larvae, which develop into giant larvae and process and minimize the waste. On days five and eight, more garbage is placed in the same container while the 5-DOL feeds and grows. This process is repeated until the larvae have grown big enough to be harvested after 12 days of feeding, or on the 13th day. Here are some potential operational parameters for the BSF treatment unit: 60kg of biowaste is fed over 12 days to 40,000 5-DOL per 1m2 treatment area. The nutrients are metabolized into larval biomass as the waste is consumed by the larvae, which also decomposes the organic material. A layer of unprocessed waste can build up heat from bacterial activity if too much trash is consumed, which will render the environment hostile for the larvae. Other scum flies will be drawn to the unattended feed as well. Insufficient trash provision will starve the larvae, slowing both their rate of development and the facility's capacity for waste treatment. Operating parameter Optimal values Feeding rate 20-130 (mg waste) larva -1 day -1 for high biomass production Larval density 1.2-5 larvae cm - ² Waste layer thickness < 7.5 cm or < 15 cm if matrix materials are added to the waste Optimal feeding rate for varying feedstocks Feedstock Optimal feeding rate (mg larva -1 day -1 ) in terms of… References …biomass production …waste reduction …both biomass production and waste reduction Chicken feed (60% moisture content) ≥200 100 100 (Diener et al., 2009) Vegetable and fruit waste ≥130 ≤20 163 (Paz et al., 2015, Saragi and Bagastyo 2015) Dairy manure (~ 70% moisture content) ≥70 ≤27 - (Myers et al., 2014) Human feces (65- 85% moisture content) ≥200 ≤50 - (Banks et al., 2014) Palm kernel meal ≥64 ≤4 - (Caruso et al., 2014) Product harvesting unit The larvae are removed from the jars just before they develop into prepupae. The waste residue alone is a valuable product. Unit following therapy If necessary, owing to local market demand, both products, larvae, and leftovers, may be further processed. Killing the larvae is usually the first step. Larvae can also be refined by drying them out or freezing them, or by separating the protein from the oil in the larvae. Composting or putting the residue into a biogas digester to make fuel are two usual refinement steps for residue. Each container is harvested after garbage has been treated by BSF larvae for 12 days. The larvae have grown to their maximum weight at this point but have not yet developed into prepupae. Thus, their nutritional worth is at its highest. The procedure of harvesting involves separating the larvae from the waste. A manual or automatic shaking sieve can be used for this, making it simple to separate the larvae from the waste. The sieve's mesh size can be larger with a higher shaking frequency. This is because when there is a high shaking frequency, the larvae find it difficult to orient themselves and are unable to crawl through the mesh. To attain higher shaking frequencies than hand sieves, automated shaking sieves are preferred. For human sieving, a sieve mesh size of around 3 mm is recommended, and for automated sieving, a mesh size of about 5 mm. The container's contents are dumped onto the sieve, which is then tilted. The debris falls through the sieve into recipients as it shakes, but the larvae stay on top of the sieve. Due to the sieve's angle, the larvae are directed to the lower angle, which is joined to a bucket into which they fall. In rare cases, where the initial water content of the trash was higher than optimal (>80%), the container at the time of harvesting will include larvae and a liquid slurry of processed waste with some undigested chunks (instead of a crumbly waste residue). In such a situation, a different harvesting technique using flat, non-shaking screens with a 5 mm mesh size is advised. Under the flat screen that is not moving is a container. Then, the flat screen is covered with the contents of the container. Since the larvae desire to stay out of the sunlight, the liquid will flow through it as well as the larvae, eventually falling into the container below. To be eliminated, larger residue chunks will stay on top of the screen. With a sizable strainer spoon, the primarily floating larvae in the container beneath the flat screen can be taken out, rinsed, and then put into a drying container with coco peat or another type of dry material (such as sawdust) to dry. For roughly one day, the larvae are in the drying container. The quality of the final product is improved by giving the animals time to empty their stomachs while also cleaning their skin as they move about in this material. Post-treatment of the larvae and residue Larvae may be harvested and then sold alive to clients (at reptile farms or bird markets, for example). Utilizing them to make feed pellets is an additional strategy. To create a mixture that fits the nutritional needs of the intended animal (broiler chickens, layer hens, various fish species, etc.), freshly caught larvae can be combined with other components (such as soy meal, sorghum, maize, etc.). It is possible to put this combination directly into a pelletizer, which will compress it into feed pellets. To guarantee that they can be easily sanitized, stored, and transported to the appropriate clients, larvae will typically require some sort of post-processing. Sanitizing entails eliminating any bacteria that may stick to the skin of the larvae and making sure that the larvae empty their intestines, which contain only partially digested waste. For this, we advise using boiling water. The larvae are instantaneously killed and the product is sanitized by dipping them into a big pan of hot water for roughly two minutes. The crumbly waste needs to be post-processed to create stable, mature compost. To achieve this, a variety of measures can be considered. The easiest method is to compost the leftover material for two months. This will produce a mature, stable product that can be marketed similarly to compost. Another choice is to feed the leftovers into a vermicomposting facility to raise (and sell) worms and produce a stable and mature vermicompost. Feeding the residue into an anaerobic digester (biogas reactor) is the third alternative presented here, which is appropriate when the residue is moist slurry-like, and high in moisture. PRODUCTS: PROPERTIES AND APPLICATIONS Economic importance The adult black soldier fly is generally not considered a pest, as highlighted by Newton et al. (2005). Leveraging the efficient recycling capabilities of the larvae, a "Black Soldier Fly Manure Management System" has been proposed to address livestock waste reduction while simultaneously providing a valuable food source for fish and other animals. In a program outlined by Newton et al. (2005), black soldier fly larvae were fed swine manure, resulting in a significant reduction in waste material. The manure, loaded with larvae, was placed in a basin where, as the larvae matured, they decreased the manure volume by 50%. An estimated 45,000 larvae could consume 24 kg of swine manure in just 14 days. As the larvae reach maturity, they naturally crawl out of the basin, facilitating a self-harvesting process, and become readily available as livestock feed. Apart from being a rich source of oil and protein for animal feed, black soldier fly larvae exhibit the potential to transform organic waste into a nutrient-dense fertilizer. BSF Larvae Depending on the kind of garbage used as a food source and the stage at which they are taken, BSF larvae have different chemical compositions (Spranghers et al ., 2017). BSF larvae are said to have high protein and fat levels regardless of the feedstock (Lalander et al ., 2019). According to Liu et al. (2017), they contain 35 to 44% DM: Dry Matter of crude protein. Depending on the trash fed to the larvae and its lipid profile, the lipid content varies greatly, ranging from 14 to 49% DM (Liland et al ., 2017). The average ash concentration is considerable (12% DM), but the range is wide (3 to 26% DM) (Caruso et al ., 2014; Spranghers et al ., 2017). According to Wang et al. (2020), the fatty acid profile of the feedstock affects the fatty acid profile of BSF larvae. According to (Spranghers et al ., 2017), depending on the feedstock, the proportion of saturated fatty acids in the fatty acid profile of BSF larvae ranges from 65 to 90% in weight (DM basis). Additionally, lauric acid (C12:0), palmitic acid (C16:0), and oleic acid (C18:1n9c) are said to be the three most prevalent fatty acids in the BSF lipid profile (Kim et al ., 2020). According to Barragan-Fonseca et al. (2017), BSF larvae have rather high levels of calcium (9 to 86 g kg-1 DM), phosphorus (4 to 5 g kg-1 DM), and potassium (5 to 6 g kg-1 DM). In terms of the essential amino acid profile, lysine, valine, and leucine are notably abundant in BSF larvae (Liland et al ., 2017). The nutritional value of BSF larvae can be increased by altering their diet, according to several scientists. In this context, it was found by (Diener et al ., 2009) that adding fish offal to the diet of BSF larvae results in the production of larvae that are higher in omega-3 fatty acids than those fed exclusively dairy manure. Additionally, it was found by (Liland et al ., 2017) that incorporating seaweed in the larvae's diet increases the biomass's content of beneficial elements such as EPA (omega-3 fatty acid), iodine, and vitamin E. Additionally, (Raksasat et al ., 2021) noted that BSF larvae had higher protein and fat levels after fermenting the leftovers after coconut milk extraction for four weeks. Black Soldier Fly Larvae as Animal Feed Source BSF larvae are an intriguing replacement for fishmeal and soybean meal, which are typically used as feed in animal production but are unsustainable and getting more and more expensive (Jucker et al ., 2020). This is because BSF larvae have a high protein and fat content, which suggests that they may be utilized as animal feed. Substituting conventional feed, either partially or entirely, with black soldier fly (BSF) larvae has proven to be effective in promoting growth and enhancing the quality of various monogastric animal species. This includes fish, such as channel catfish ( Ictalurus punctatus ) (Spranghers et al ., 2017), blue tilapia ( Oreochromis aureus ), Nile tilapia ( Oreochromis niloticus ) (Li et al ., 2020), rainbow trout ( Oncorhynchus mykiss ) (Jucker et al ., 2020), Atlantic salmon ( Salmo salar ) (Pang et al ., 2020), as well as crustaceans like Pacific white shrimp ( Litopenaeus vannamei ). Moreover, positive outcomes were observed in livestock, including pigs and chickens. Nevertheless, Makkar et al. (2014) advised further feeding experiments, considering that certain studies have indicated decreased growth performance. This recommendation stems from the variability in results attributed to the type of feedstock used to nourish the larvae, as highlighted by Myers et al. (2014). Addressing the need for refining larvae-based feed formulations, particularly the protein, fat, and fiber ratio, is crucial, as emphasized by Wong et al. (2021). To achieve a more balanced diet and enhance digestibility and feeding value, some authors propose separating protein from fat and chitin. Defatted larvae, for instance, exhibit a higher protein content of approximately 60% compared to whole larvae, as noted by Gold et al. (2020), Kim et al. (2020), and Klammsteiner et al. (2020). Additionally, the optimal stage for harvesting larvae to produce high-value animal feed is a subject of consideration. Some authors argue that harvesting larvae before reaching the prepupal stage may result in a more valuable feed product, as suggested by Gold et al. (2020) and Myers et al. (2014). In their examination of the nutritional evolution of black soldier fly (BSF) throughout its lifecycle, Liu et al. (2017) discovered that crude protein and fat contents peak during the early prepupal stage. However, this heightened nutritional value comes at the expense of digestibility. Notably, prepupae possess a higher chitin content compared to larvae, rendering them less digestible for chickens and fish, as observed by Caruso et al. (2014). Consequently, some researchers, such as Marco et al. (2021), opted to use mature larvae that had not yet reached the prepupal stage in their feeding trials, while others, like Singh and Kumari (2019), employed prepupae in their experiments. In their exploration of the chemical safety of employing BSF larvae as a protein source for animal feed, Raksasat et al. (2021) assessed the levels of an extensive array of chemical contaminants comprising 1,140 analyzed compounds, such as veterinary medicines, pesticides, heavy metals, dioxins, polychlorinated biphenyls, polyaromatic hydrocarbons, and mycotoxins in BSF larvae raised on agroindustrial waste. The findings indicated that all recorded concentrations were below the maximum levels recommended by reputable organizations, including the European Commission, the World Health Organization, and the Codex Alimentarius. Nevertheless, caution was raised regarding the potential risk of metal bioaccumulation in the larvae, particularly for cadmium. Various studies have demonstrated that heavy metals can accumulate in BSF larvae, displaying distinct accumulation patterns depending on the specific metal involved. When BSF larvae are fed with contaminated substrates, the concentrations of heavy metals in the larvae and prepupae bodies, in comparison to those in the initial feedstock, exhibit higher levels for cadmium, equivalent levels for zinc, reduced levels for chromium, and no detectable levels for lead, as reported by Gold et al. (2018). In light of these findings, Lohri et al. (2017) recommended refraining from using waste contaminated by heavy metals as feedstock in BSF waste treatment. Regarding pharmaceuticals and pesticides, the findings of Liu et al. (2017) support a study by Lalander et al. (2019), wherein no bioaccumulation was observed in BSF larvae fed with waste containing various pharmaceuticals and pesticides. In terms of microbiological risks, Zhang et al. (2020), who investigated bacterial diversity throughout the BSF lifecycle using pyrosequencing, noted the presence of bacteria from six different phyla, with Bacteroidetes and Proteobacteria being the most predominant, accounting for two-thirds of the identified bacteria. Among the bacteria present throughout the entire BSF lifecycle, Enterobacterials and Xanthomonadales were identified as potential pathogens. Furthermore, it's worth noting that BSF larvae can be contaminated by certain pathogens present in the processed waste. Specifically, Lalander et al. (2019) identified Salmonella spp. in larvae exposed to contaminated animal and human feces. Additionally, they noted the presence of Ascaris ova within both the larvae and prepupae. However, the concentration of these organisms was observed to be lower in the gut of the prepupae compared to the larvae, indicating that prepupae tend to empty their gut before migrating to their pupation site. Consequently, using prepupae instead of larvae as animal feed might be considered a safer option. On the topic of plant pathogens, Irawan et al. (2020) examined the antibacterial properties of larval extract from BSF and determined that larval extract plays a crucial role in defending against plant pathogens. Nevertheless, Klammsteiner et al. (2020), who did not delve into the microbiological risks associated with using BSF larvae as animal feed, highlighted that Type of Waste Substrate Type of fuel Amount of fuel (g) References Diary manure (1248 g) Biodiesel 15.80 (Elsayed et al., 2020) Chicken manure (1000 g) Biodiesel 91.40 (Shelomi 2020) Cattle manure (1000 g) Biodiesel 35.50 Pig manure (1000 g)) Biodiesel 57.80 (Lalander et al., 2019) Faeces (1 g) Biogas 0.13 Food waste (1 g) Biogas 0.22 such risks can be significantly minimized through appropriate post-processing techniques. Production of Biodiesel Exploration into biodiesel production from the oil extracted from BSF larvae is underway. Several studies, examining the fatty acids profile, have indicated that lipids from BSF larvae, when fed with diverse substrates including food waste (Bin Kamari, 2021), fruit waste (Raksasat et al ., 2021), sewage sludge, cattle, chicken, and pig manure (Pang et al ., 2020), palm decanter cake from an oil palm mill (Leong et al., 2016), and rice straw (Zhang et al ., 2020), possess characteristics suitable for biodiesel production. Bin Kamari (2021) even proposed that producing biodiesel from the oil of BSF larvae fed on swine manure could yield as much energy as anaerobic digestion of the same manure. Additionally, the fuel properties of biodiesel derived from the lipids of BSF larvae fed on animal manure are comparable to those of other biodiesels, such as rapeseed oil-based biodiesel. Furthermore, as per the findings of Kim et al. (2020), biodiesels derived from BSF larvae fed on rice straw and restaurant waste meet the majority of the criteria outlined in the European standard EN 14214. Production of Chitin In addition to the notable protein and lipid content of BSF larvae, which can be harnessed for animal feeding and biodiesel production, another valuable extractable from BSF larvae is chitin, a major constituent of the larvae's cuticle or exoskeleton. Chitin holds commercial significance due to its elevated nitrogen content (6.9%), surpassing that of synthetic cellulose, as highlighted by Caruso et al. (2014). This compound finds applications as a chelating agent in medicines, cosmetics, biotechnologies, phytosanitary products, and industrial items (Wang et al ., 2020). Exploring the extraction of chitin from BSF larvae and entering specific markets with this product could potentially enhance the economic value derived from the larvae. However, the economic feasibility of this chitin extraction process from BSF larvae remains an unexplored area. Waste Residue Few studies have delved into the properties of the waste residue compared to the research on larvae. Lalander et al. (2019) observed that processing a combination of pig manure, dog food, and human feces by the BSF led to a 45% increase in the concentration of total phosphorus per gram of total solids in the waste residue and an almost 160% increase in total ammonium nitrogen (NH4 +-N). This suggests the potential suitability of the waste residue for agricultural use as a soil amendment. The capability of BSF larvae to convert organic nitrogen into ammonium nitrogen was also noted by Egnew et al. (2021), who found that BSF feeding on vegetal and food waste significantly enhanced nitrogen mineralization. They reported a five to six-times increase in the concentration of ammonium in the leachate. The C/N ratio of the waste residue is contingent on the initial C/N ratio of the feedstock, with literature values ranging from 10 to 43 for the C/N ratio of the final waste residue, corresponding to the reported range for the C/N ratio of the feedstock (Saragi and Bagastyo 2015). The pH range of the waste residue typically falls between 7 to 8, as reported by Lalander et al. (2019), which aligns with the optimal range for plant growth as indicated by Spranghers et al. (2017). The moisture content of the waste residue is contingent on the initial moisture content of the waste. In the case of food waste, Cheng et al. (2017) observed that when the initial moisture content was 70% and 75%, the moisture content of the waste residue after the feeding period decreased to approximately 50%. Conversely, when the initial moisture content was 80%, it did not decrease and remained above 80% throughout the entire BSF waste treatment process. Use as Fertilizer Limited studies have explored the efficacy of BSF waste residue, whether in its raw or post-processed form, as a fertilizer for diverse crops. Fischer and Romano (2021) presented promising findings concerning the utilization of waste residue resulting from the bioconversion of food waste by BSF as an alternative to traditional fertilizer. Notably, they found no significant difference in the chemical composition between the BSF waste residue and an unspecified commercial fertilizer. Furthermore, the growth rate and chemical composition of Chinese cabbages cultivated on BSF residue mirrored those of cabbages grown using commercial fertilizer. Similarly, agricultural trials conducted in Ghana demonstrated that applying BSF biofertilizer (i.e., BSF waste residue composted for one to three weeks) at a rate of 10 tonnes per hectare, in conjunction with inorganic fertilizer, could boost crop yield by up to 55% compared to using inorganic fertilizer alone for various local short-cycle cash crops, particularly onions and maize. Additionally, the application of BSF biofertilizer alone yielded superior results compared to combining poultry manure with inorganic fertilizer (Gold et al ., 2020). Contrastingly, Newton et al. (2005) documented suboptimal outcomes concerning the growth of basil ( Ocimum basilcum ) and sudangrass ( Sorghan sudanense ) cultivated on swine manure processed by BSF larvae (without post-treatment) and mixed with either clay or sand. This subpar performance could be attributed to the immaturity of the waste residue derived from the BSF process, as noted by Lohri et al. (2017). This immaturity leads to oxygen depletion in the soil upon application, thereby impeding plant growth, as highlighted by Myers et al. (2014). Consequently, the residue should undergo a maturation phase, as suggested by Lohri et al. (2017). Benefits and opportunities Prepupae present a viable alternative for animal feed, while larvae contribute to biodiesel production and serve as compost for agriculture, offering the potential for job creation and additional income. The waste reduction achieved is swifter than traditional composting methods, mitigating odor issues. Larvae exhibit a versatile capacity to digest various residues and display heightened resilience to environmental fluctuations compared to worms. Additionally, they can be employed as an alternative for sludge (faecal) treatment. Black soldier flies, being non-pathogenic and naturally occurring, show promise in reducing salmonella, viruses, and pharmaceutical substances in waste. Their application extends to the management of animal manure, reducing organic waste in public markets, and consequently prolonging landfill lifetimes. Furthermore, they aid in diminishing nitrogen and phosphorus levels in waste, thereby minimizing environmental pollution . Limitations and challenges The existing market status of the product remains uncertain, necessitating a thorough assessment. Full implementation of source segregation is imperative. Exploration of potential regulations governing the products is essential. Continuous monitoring of environmental conditions and breeding parameters is a prerequisite. There is a demand for further research to ascertain market value and enhance production. The possibility of heavy metal accumulation in prepupae intended for animal feeding requires consideration, potentially involving a significant initial investment. Conclusion The black soldier fly (BSF) demonstrates adaptability to a wide range of environmental conditions, and the adult fly does not act as a disease vector. BSF larvae exhibit the ability to consume various organic materials, including the abundant organic wastes generated in urban areas. This consumption not only reduces waste volume but also allows the larvae to develop into a protein-rich biomass, leaving behind a nutrient-rich residue. The harvested larvae can be utilized in formulating feed for monogastric animals such as poultry, fish, and pigs. Due to their high-fat content, they may also be processed into high-quality biodiesel. The waste residue, in turn, has the potential to serve as a valuable soil conditioner. Consequently, BSF-based technology is considered one of the most promising methods for processing organic waste. Declarations Authors’ contributions SS, SV & SAS - Wrote the manuscript. AAK - Designed the review article and helped with revisions of the article. All authors read and approved the final manuscript. Data availability The datasets analyzed during the current study are available from the corresponding author upon reasonable request. Ethics approval and consent to participate The study reviewed the occurrence of the pest in a region that does not use any human and animal subjects and connotes no ethics approval. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interest References Banks, Ian J, Walter T Gibson, and Mary M Cameron (2014). "Growth rates of black soldier fly larvae fed on fresh human faeces and their implication for improving sanitation." Tropical medicine & international health, 19 (1) :14-22. Barragan-Fonseca, Karol B, Marcel Dicke, and Joop JA van Loon (2017). "Nutritional value of the black soldier fly ( Hermetia illucens L.) and its suitability as animal feed–a review." Journal of Insects as Food and Feed 3 (2) :105-120. Bin Kamari, Azlan (2021). Biodiesel from black soldier fly larvae grown on restaurant kitchen waste. Caruso, Domenico, Emilie Devic, I. W Subamia, Pascale Talamond, and Etienne Baras (2014). Technical handbook of domestication and production of Diptera black soldier fly (BSF), Hermetia illucens , Stratiomyidae. Cheng, J. Y. K., S. L. H. Chiu, and I. M. C. Lo (2017). Effects of moisture content of food waste on residue separation, larval growth and larval survival in black soldier fly bioconversion." Waste Management 67 :315-323. Diener and Stefan (2010). Valorisation of organic solid waste using the black soldier fly, Hermetia illucens , in low and middle-income countries. ETH Zurich. Diener, Stefan, Christian Zurbrügg, and Klement Tockner. 2009. "Conversion of organic material by black soldier fly larvae: establishing optimal feeding rates." Waste Management & Research 27 (6) :603-610. Dzepe, Daniel, Paulin Nana, Hervé Mube Kuietche, Janaina Mitsue Kimpara, Ornela Magatsing, Timoléon Tchuinkam, and Rousseau Djouaka (2021). Feeding strategies for small-scale rearing black soldier fly larvae (I) as organic waste recycler." SN Applied Sciences 3 (2) :1-9. Egnew, Nathan, Nicholas Romano, Hayden Fischer, and Amit Kumar Sinha (2021). Purging black solider fly larvae ( Hermetia illucens ) compromises their nutritive value as a feedstuff. International Journal of Tropical Insect Science . 1-8. Elsayed, Mahdy, Yi Ran, Ping Ai, Maha Azab, Abdelaziz Mansour, Keda Jin, Yanlin Zhang, and Abd El-Fatah Abomohra (2020). Innovative integrated approach of biofuel production from agricultural wastes by anaerobic digestion and black soldier fly larvae. Journal of cleaner production. 263 :121495. Fischer, H, and N Romano (2021). Fruit, vegetable, and starch mixtures on the nutritional quality of black soldier fly ( Hermetia illucens ) larvae and resulting frass. Journal of Insects as Food and Feed 7 (3 ):319-327. Gold, Moritz, Cecille Marie Cassar, Christian Zurbrugg, Michael Kreuzer, Samy Boulos, Stefan Diener, and Alexander Mathys (2020). Biowaste treatment with black soldier fly larvae: increasing performance through the formulation of biowastes based on protein and carbohydrates. Waste Management. 102 :319-329. Gold, Moritz, Jeffery K Tomberlin, Stefan Diener, Christian Zurbrugg, and Alexander Mathys. 2018. "Decomposition of biowaste macronutrients, microbes, and chemicals in black soldier fly larval treatment: A review." Waste Management. 82 :302-318. Irawan, Andri Cahya, Dewi Apri Astuti, I Wayan Teguh Wibawan, Widya Hermana, and Departemen Teknologi Nutrisi dan Makanan (2020). Supplementation of black soldier fly ( Hermetia illucens ) on productivity and blood hematology." Jurnal Ilmu-Ilmu Peternakan 30 (1) :50-68. Jucker, Costanza, Daniela Lupi, Christopher Douglas Moore, Maria Giovanna Leonardi, and Sara Savoldelli (2020). Nutrient recapture from insect farm waste: bioconversion with Hermetia illucens L. (Diptera: Stratiomyidae). Sustainability 12 (1) :362. Kaza, S., Yao, L., Bhada-Tata, P. and Van Woerden, F. (2018). What a waste 2.0: a global snapshot of solid waste management to 2050 . World Bank Publications. Kim, Yoo Bhin, Da-Hye Kim, Su-Been Jeong, Jeong-Woo Lee, Tae-Hoon Kim, Hong-Gu Lee, and Kyung-Woo Lee (2020). Black soldier fly larvae oil as an alternative fat source in broiler nutrition. Poultry Science. 99 (6) :3133-3143. Klammsteiner, Thomas, Andreas Walter, Tajda Bogataj, Carina D Heussler, Blaž Stres, Florian M Steiner, Birgit C Schlick-Steiner, Wolfgang Arthofer, and Heribert Insam (2020). The core gut microbiome of black soldier fly ( Hermetia illucens ) larvae raised on low- bioburden diets." Frontiers in Microbiology. 11 :993. Kumar, Akhilesh, and Avlokita Agrawal (2020). Recent trends in solid waste management status, challenges, and potential for the future Indian cities–A review. Current Research in Environmental Sustainability. 2 :1011. Kumar, Sunil, Stephen R Smith, Geoff Fowler, Costas Velis, S Jyoti Kumar, Shashi Arya, Rena, Rakesh Kumar, and Christopher Cheeseman (2017). Challenges and opportunities associated with waste management in India. Royal Society open science 4 (3) :160764. Lalander, C, S Diener, C Zurbrügg, and B Vinneras (2019). Effects of feedstock on larval development and process efficiency in waste treatment with black soldier fly ( Hermetia illucens )." Journal of cleaner production 208 :211-219. Lalander, Cecilia, Evgheni Ermolaev, Viktoria Wiklicky, and Björn Vinneras (2020). Process efficiency and ventilation requirement in black soldier fly larvae composting of substrates with high water content. Science of The Total Environment 729 :1389. Li, Yanxian, Trond M Kortner, Elvis M Chikwati, Ikram Belghit, Erik-Jan Lock, and Åshild Krogdahl (2020). Total replacement of fish meal with black soldier fly ( Hermetia illucens ) larvae meal does not compromise the gut health of Atlantic salmon (Salmo salar). Aquaculture 520 :734967. Liland, Nina S, Irene Biancarosa, Pedro Araujo, Daan Biemans, Christian G Bruckner, Rune Waagbø, Bente E Torstensen, and Erik-Jan Lock (2017). Modulation of nutrient composition of black soldier fly ( Hermetia illucens ) larvae by feeding seaweed- enriched media." PLoS One 12 (8) : 0183188. Liu, Xiu, Xuan Chen, Hui Wang, Qinqin Yang, Kashif ur Rehman, Wu Li, Minmin Cai, Qing Li, Lorenzo Mazza, and Jibin Zhang (2017). Dynamic changes of nutrient composition throughout the entire life cycle of black soldier fly. PLoS One 12 (8) : 0182601. Lohri, Christian Riuji, Stefan Diener, Imanol Zabaleta, Adeline Mertenat, and Christian Zurbrügg (2017). Treatment technologies for urban solid biowaste to create value products: a review with focus on low-and middle-income settings. Reviews in Environmental Science and Bio Technology 16 (1) :81-130. Makkar, Harinder PS, Gilles Tran, Valérie Heuzé, and Philippe Ankers (2014). State-of-the- art on use of insects as animal feed. Animal Feed Science and Technology 197 :1-33. Marco, A, Remondah R Ramzy, and Hong Ji (2021). Influence of substrate inclusion of quail manure on the growth performance, body composition, fatty acid and amino acid profiles of black soldier fly larvae ( Hermetia illucens ). Science of The Total Environment. 772 :145528. Meneguz, M., Schiavone, A., Gai, F., Dama, A., Lussiana, C., Renna, M. and Gasco, L. (2018). Effect of rearing substrate on growth performance, waste reduction efficiency and chemical composition of black soldier fly (Hermetia illucens) larvae. Journal of the Science of Food and Agriculture , 98 (15) : 5776-5784. Myers, Heidi M, Jeffery K Tomberlin, Barry D Lambert, and David Kattes (2014). "Development of black soldier fly (Diptera: Stratiomyidae) larvae fed dairy manure." Environmental entomology 37 (1) :11-15. Newton, G.L., Sheppard, D.C., Watson, D, W., Burtle, G, J., Dove, C, R., Tomberlin, J, K. and Thelen, E, E. (2005). The black soldier fly Hermetia illucens L, as a manure management/resource recovery tool In. Symposium on the state of science of animal manure and waste management, (ed.), Nowak, P. San Antonio, Texas. Nguyen, T. T., Tomberlin, J. K. and Vanlaerhoven, S. (2015). Ability of black soldier fly (Diptera: Stratiomyidae) larvae to recycle food waste. Environmental entomology , 44 (2) : 406-410. Pang, Wancheng, Dejia Hou, Jingwen Ke, Jiangshan Chen, Mark T Holtzapple, Jeffery K Tomberlin, Huanchun Chen, Jibin Zhang, and Qing Li (2020). Production of biodiesel from CO2 and organic wastes by fermentation and black soldier fly. Renewable Energy. 149 :1174-1181. Paz, Angela Sofía Parra, Nancy Soraya Carrejo, and Carlos Humberto Gómez Rodríguez. (2015). Effects of larval density and feeding rates on the bioconversion of vegetable waste using black soldier fly larvae Hermetia illucens L. (Diptera: Stratiomyidae)." Waste and biomass valorization. 6 (6) :1059-1065. Raksasat, Ratchaprapa, Kunlanan Kiatkittipong, Worapon Kiatkittipong, Chung Yiin Wong, Man Kee Lam, Yeek Chia Ho, Wen Da Oh, I Suryawan, and Jun Wei Lim (2021). Blended Sewage Sludge–Palm Kernel Expeller to Enhance the Palatability of Black Soldier Fly Larvae for Biodiesel Production. Processes. 9 (2) :297. Saragi, E. S. and Bagastyo, A. Y. (2015, November). Reduction of organic solid waste by black soldier fly (Hermetia illucens) larvae. In The 5th Environmental Technology and Management Conference “Green Technology towards Sustainable Environment” November (Vol. 23, No. 24, p. 2015). Shelomi, M. (2020). Nutrient composition of black soldier fly (Hermetia illucens). African edible insects as alternative source of food, oil, protein and bioactive components , 195-212. Sheppard, D Craig, Jeffery K Tomberlin, John A Joyce, Barbara C Kiser, and Sonya M Sumner. ( 2002). Rearing methods for the black soldier fly (Diptera: Stratiomyidae)." Journal of medical entomology 39 (4) :695-698. Singh, Anshika, and Kanchan Kumari (2019). An inclusive approach for organic waste treatment and valorisation using Black Soldier Fly larvae: A review. Journal of environmental management 251 :109569. Spranghers, Thomas, Matteo Ottoboni, Cindy Klootwijk, Anneke Ovyn, Stefaan Deboosere, Bruno De Meulenaer, Joris Michiels, Mia Eeckhout, Patrick De Clercq, and Stefaan De Smet (2017). Nutritional composition of black soldier fly ( Hermetia illucens ) prepupae reared on different organic waste substrates. Journal of the Science of Food and Agriculture. 97 (8) :2594-2600. Tomberlin, J. K., Sheppard, D. C. and Joyce, J. A. (2002). Susceptibility of black soldier fly (Diptera: Stratiomyidae) larvae and adults to four insecticides. Journal of economic entomology , 95( 3) : 598-602. Wang, Huarui, Kashif ur Rehman, Weijian Feng, Dan Yang, Rashid ur Rehman, Minmin Cai, Jibin Zhang, Ziniu Yu, and Longyu Zheng (2020). Physicochemical structure of chitin in the developing stages of black soldier fly. International journal of biological macromolecules. 149 :901-907. Wong, Chung Yiin, Kunlanan Kiatkittipong, Worapon Kiatkittipong, Seteno Ntwampe, Man Kee Lam, Pei Sean Goh, Chin Kui Cheng, Mohammed JK Bashir, and Jun Wei Lim (2021). Black Soldier Fly Larval Valorization Benefitting from Ex-Situ Fungal Fermentation in Reducing Coconut Endosperm Waste. Processes 9 (2) :275. Xiao, X., Jin, P., Zheng, L., Cai, M., Yu, Z., Yu, J. and Zhang, J. (2018). Effects of black soldier fly (Hermetia illucens) larvae meal protein as a fishmeal replacement on the growth and immune index of yellow catfish (Pelteobagrus fulvidraco). Aquaculture research , 49 (4) :1569-1577. Zhang, J. B., J. K. Tomberlin, M.M. Cai, X.P. Xiao, L.Y. Zheng and Z.N. Yu (2020). Research and industrialisation of Hermetia illucens L. in China. Journal of Insects as Food and Feed 6 (1) :5-12. Zurbrügg, C., Dortmans, B., Fadhila, A., Verstappen, B. and Diener, S. (2018). From pilot to full scale operation of a waste-to-protein treatment facility. Detritus , 1 (0) : 18-22. Supplementary Files floatimage1.jpeg Graphical representation of Hermetia illucens in brief Cite Share Download PDF Status: Under Review Version 1 posted Editor invited by journal 31 Oct, 2024 Editor assigned by journal 18 Feb, 2024 First submitted to journal 13 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3957149","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":319051478,"identity":"f59e42b5-9e39-45aa-8feb-c4649172cea3","order_by":0,"name":"Suriya S","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYJCCAxCK+fCDD0CKjZ1YLTwMbGmGM0BamIm1ioeBx0CaB2wbAZXyM3IfHuapscmzZ28wMLb5tU2ej5mB8cPHHNxaDG6kGxzmOZZWzMNzIOFxbt9twzZmBmbJmdvwaJFIYzjMw3Y4sUci4YBxbs9tRqAWNmZePFrkZ4C0/PsP1JLYIG3Zc9ueoBaGG0AtvG0HgFqSGaQZftxOJKjF4MwzhoNz+5ITe84cYzPsbbid3MbM2IzXL/Ltacwf3nyzS2xv7//84Mef27bz25sPfviIz2FAwMQDYzG2gckG/OpBSn7AmX8IKh4Fo2AUjIIRCABGQ1GFt9LkQAAAAABJRU5ErkJggg==","orcid":"","institution":"SKUAST Kashmir: Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir","correspondingAuthor":true,"prefix":"","firstName":"Suriya","middleName":"","lastName":"S","suffix":""},{"id":319051479,"identity":"338d8abe-a6d9-4f5e-a7d6-8827757f70f7","order_by":1,"name":"Akhtar Ali Khan","email":"","orcid":"","institution":"SKUAST Kashmir: Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir","correspondingAuthor":false,"prefix":"","firstName":"Akhtar","middleName":"Ali","lastName":"Khan","suffix":""},{"id":319051480,"identity":"0d6cda1f-25a8-4c38-9b79-29b2b52520a0","order_by":2,"name":"Sadhana Veeramani","email":"","orcid":"","institution":"TNAU: Tamil Nadu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Sadhana","middleName":"","lastName":"Veeramani","suffix":""},{"id":319051481,"identity":"0eeaef9b-5baa-41e9-8ab3-3eb16754fc95","order_by":3,"name":"Showkat Ahmad Shiek","email":"","orcid":"","institution":"SKUAST Kashmir: Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir","correspondingAuthor":false,"prefix":"","firstName":"Showkat","middleName":"Ahmad","lastName":"Shiek","suffix":""}],"badges":[],"createdAt":"2024-02-14 23:17:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3957149/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3957149/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60463072,"identity":"dd0694ee-e578-4f58-b8eb-b719714522e1","added_by":"auto","created_at":"2024-07-17 04:22:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":451002,"visible":true,"origin":"","legend":"\u003cp\u003eUnnumbered image in the Introduction section.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3957149/v1/84123239805561b37f20249e.png"},{"id":60463074,"identity":"dfb2cb68-916e-45a2-bfe6-06db7f9fb640","added_by":"auto","created_at":"2024-07-17 04:22:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":888448,"visible":true,"origin":"","legend":"\u003cp\u003eUnnumbered image in the Introduction section.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3957149/v1/a56661fbe258a8f97baa37ad.png"},{"id":60463694,"identity":"cc02e436-7415-4986-824b-51aa9e65342c","added_by":"auto","created_at":"2024-07-17 04:30:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":262482,"visible":true,"origin":"","legend":"\u003cp\u003eUnnumbered image in the Introduction section.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3957149/v1/ff0413345ff56cf3f2439282.png"},{"id":60463073,"identity":"6eb466ed-faf0-45dc-88c9-ccb5d8390977","added_by":"auto","created_at":"2024-07-17 04:22:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":282374,"visible":true,"origin":"","legend":"\u003cp\u003eUnnumbered image in the Introduction section.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-3957149/v1/872621ca31c66cb3f4165bbc.png"},{"id":60464551,"identity":"ced4530e-9d8c-4553-bccc-f368fbd62317","added_by":"auto","created_at":"2024-07-17 04:46:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3111703,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3957149/v1/f81eedfd-b9dc-4274-af86-2b8ae1ddf2df.pdf"},{"id":60464203,"identity":"9cea9cde-72ae-4809-a285-27ceedb4cf1a","added_by":"auto","created_at":"2024-07-17 04:38:40","extension":"jpeg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":526023,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical representation of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHermetia illucens \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein brief\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3957149/v1/efbdc35cdc58e479618bb3ff.jpeg"}],"financialInterests":"","formattedTitle":"The Enigmatic Journey of Black Soldier Fly: Revolutionizing Solid Waste Management","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBlack soldier fly is a viable candidate for managing solid waste Introduction Municipal solid waste (MSW) management is still a difficult and underappreciated problem in low- and middle-income countries. According to Kumar and Agrawal (2020), India produces roughly 143,449 MT of MSW per day, of which approximately 1,11,000 MT are collected and 35,602 MT are processed. Household waste frequently goes uncollected on streets and drains, particularly in metropolitan and peri-urban regions, drawing disease vectors and clogging waterways. The organic portion typically makes up 80% of all municipal waste, which is a significant amount when compared to other waste components including glass, metal, and paper (Kumar \u003cem\u003eet al\u003c/em\u003e., 2017). Any effective waste management system must include adequate solid waste management. Alternatives to traditional methods of recovering nutrients from organic waste, such as vermicomposting and the treatment of faeces-containing sludge by the aquatic worm \u003cem\u003eLumbriculus variegatus\u003c/em\u003e, are called CORS technologies (Conversion of Organic Refuse by Saprophages). Another CORS solution that combines revenue generation and nutrient recovery is the larval stage of the black soldier fly (BSF), \u003cem\u003eHermetia illucens\u003c/em\u003e L., which digests organic waste.\u003c/p\u003e\n\u003cp\u003eA fly belonging to the Stratiomyidae family that is regularly observed in tropical regions is the black soldier fly, \u003cem\u003eHermetia illucens\u003c/em\u003e L. (1758). Adults drink water, stay away from people, don\u0026apos;t sting or bite, and don\u0026apos;t spread any particular diseases. The larvae of this non-pest fly consume and destroy several types of organic material. According to Singh and Kumari (2019), domestic trash, animal waste (chicken, pig, and cow manure), and even human excreta were found to be efficiently digested by the larvae. Prepupa, the sixth instar, migrates away from the feed source to pupate, making it simple to gather. The black soldier fly prepupae produced during the waste reduction procedure can be fed to animals. Black soldier fly larvae (BSFL) have been used in small-scale waste management projects using substrates like manure, rice straw, food waste, distillers\u0026apos; grains, fecal sludge, animal waste, kitchen waste, and so on because they are reported to feed on a wide range of organic material (Spranghers \u003cem\u003eet al\u003c/em\u003e., 2017). They may be the most efficient flies in terms of the variety of substrates they can handle as well as processing speed. They have a longer larval stage than flies like house and carrion flies, lasting over three weeks. In comparison to mealworms and crickets, their feed conversion ratios are well recognized to be superior. In more and more places throughout the world, organic waste is being treated using black soldier fly (BSF) larvae.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"217\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.825688073394495%\" valign=\"top\"\u003e\n \u003cp\u003eKingdom\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.174311926605505%\" valign=\"top\"\u003e\n \u003cp\u003e: Animalia \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.825688073394495%\" valign=\"top\"\u003e\n \u003cp\u003ePhylum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.174311926605505%\" valign=\"top\"\u003e\n \u003cp\u003e: Arthropoda\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.825688073394495%\" valign=\"top\"\u003e\n \u003cp\u003eClass\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.174311926605505%\" valign=\"top\"\u003e\n \u003cp\u003e: Insecta\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.825688073394495%\" valign=\"top\"\u003e\n \u003cp\u003eOrder\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.174311926605505%\" valign=\"top\"\u003e\n \u003cp\u003e: Diptera\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.825688073394495%\" valign=\"top\"\u003e\n \u003cp\u003eFamily\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.174311926605505%\" valign=\"top\"\u003e\n \u003cp\u003e: Stratiomyidae\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.825688073394495%\" valign=\"top\"\u003e\n \u003cp\u003eGenus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.174311926605505%\" valign=\"top\"\u003e\n \u003cp\u003e: Hermetia\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.825688073394495%\" valign=\"top\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.174311926605505%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003e\u003cem\u003eH.\u0026nbsp;illucens\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eDistribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Black Soldier Fly can be found across tropical and temperate regions worldwide, as documented by Tomberlin et al. (2002). North America is home to 260 recognized species within the Stratiomyidae family, as reported by (Triplehorn, 2005). During late spring and early fall in the southeastern United States, the black soldier fly thrives, boasting three generations annually in Georgia according to Tomberlin et al. (2002). This fly, widespread throughout the Western Hemisphere, is commonly found in the continental United States. Black soldier flies inhabit every continent except Antarctica. They are native to the tropical and warm temperate regions of the Western Hemisphere, spreading to Eastern Hemisphere continents through human interactions, as noted by May (1961) and Rozkosny (1982).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHabitat\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBlack soldier flies are adaptable to various environments, including urban, rural, and forested areas. Adults are frequently observed resting on house walls, windows, tree trunks, and garden plants in residential and farm settings with livestock and poultry. These flies lay their eggs on decomposing organic matter and in the crevices of beehives, with larvae hatching in front of beehives after 4-6 days. The larvae feed on honey and waste materials from the hives, undergoing pupation for 2-20 days if they manage to survive potential bee attacks. They can even dismantle weak beehives. Thriving in a diverse range of decaying plant and animal materials, the larvae are terrestrial scavengers. The robust nature of \u003cem\u003eH. illucens\u003c/em\u003e is exemplified by reports of a population exploiting resources from tuna remains preserved in 10% formaldehyde (May, 1961; Rozkosny, 1982). The black soldier fly, known for its eurythermal nature, can withstand a broad spectrum of temperature variations. These flies become active when morning temperatures reach 25 degrees Celsius. Mating takes place midair during the day when temperatures reach 27 degrees Celsius, and females lay their eggs in the early to mid-afternoon when temperatures range from 27.5 to 37.5 degrees Celsius. The ideal humidity for mating and oviposition is between 30% and 90%. While eggs and larvae develop optimally at 27 degrees Celsius, they can tolerate a moderate range of conditions during egg-laying. The development of \u003cem\u003eH. illucens\u003c/em\u003e is notably inhibited at 20 degrees Celsius. High temperatures expedite the duration of each life stage compared to lower temperatures (Li et al., 2016; Lord et al., 1994; Sheppard et al., 2002).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTaxonomical identification of BSF\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSexual dimorphism is evident in black soldier flies, with females generally surpassing males in size. The variability in the white pattern extent on the female head and the size of white spots on the female abdomen adds to the distinctiveness. The male black soldier fly\u0026apos;s genitalia, known as the aedeagal complex, is characterized by its slender form and dilation in the basal portion. In contrast, the females possess mostly internal genitalia but feature external structures known as Terminalia. The female Terminalia is of the long type, with long and segmented cerci. The genital furca is subtriangular, pointed proximally, exhibiting a large median aperture and remarkably broad, leaf-shaped posterolateral projections (Oliveira et al., 2016; Rozkosny, 1982).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe male black soldier fly is characterized by a plate-like structure on its posterior end, while the female features a scissor-like structure at its tail end, serving as the female sexual organ for mating and oviposition. When a female extends its tail, it indicates readiness for mating, serving as a signal for males to initiate the mating process. The significance of a light source in successful mating might be attributed to aiding the visual recognition of this signal by the males, as suggested by (Yang, 2013).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular characterization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA isolation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenomic DNA from a single fly was isolated using the HotSHOT technique as described by Montero-Pau et al. (2008) and Sadhana et al. (2021). Each fly was transferred into an Eppendorf tube using a camel hair brush, and ethanol within their bodies was removed before homogenization. Subsequently, 20 \u0026micro;l of tissue lysis buffer (10 N NaOH and 0.5 M NaEDTA; pH 8.0) was added to the sample, which was finely ground using a sterile plastic micro pestle and homogenized. The lysate was vortexed and then incubated for 20 minutes at 65\u0026deg;C. Following this, an equal volume of neutralizing buffer (10 mM Tris-HCL, pH 5.0) was added to the homogenate, which was further incubated for 15 minutes at 95 \u0026deg;C, followed by centrifugation for 5 minutes at 12,000 rpm. Finally, the DNA was resuspended in 20 \u0026micro;l of sterile water. The DNA concentration was measured at A260 nm using a spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) prior to polymerase chain reaction (PCR) analysis, with five microliters of the supernatant being used for extraction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePolymerase Chain Reaction (PCR) and Sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePolymerase chain reaction (PCR) was employed to amplify the 658 bp mitochondrial cytochrome c oxidase subunit I (mtCOI) gene using universal primers (forward primer LCO 1490 - 5 GGTCAACAAATCATAAAGATATTGG 3 and reverse primer HCO 2198 - 5 TAAACTTCAGGGTGACCAAAAAATCA 3) as described by Vrijenhoek (1994). The PCR was conducted in a thermal cycler (Eppendorf MastercyclerTM, Hamburg, Germany) with a total reaction volume of 20 \u0026micro;l, following the protocol outlined by Sambrook and Russell (2001). After amplification, the DNA products were separated using a 1.0% agarose gel, stained with ethidium bromide (10 mg/ml), and quantified using NanodropOneTM at A260/280 nm. Subsequently, the PCR product underwent purification utilizing the PureLinkTM PCR Purification Kit. Biokart India Pvt. Ltd. (Bengaluru, India) conducted double-pass Sanger dideoxy DNA sequencing to sequence the designated mtCOI forward and reverse primers in both directions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhylogenetic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo construct the phylogenetic tree, all Black Soldier Fly (BSF) mtCOI sequences from both the NCBI GenBank and this study were utilized. Sequences were aligned using the sequence alignment editor BioEdit (version 7.0.5.3), and MEGA-X Clustal W (Thompson et al. 1994) was employed to generate multiple sequence alignments and identify a similarity region. Subsequently, a dendrogram was produced in MEGA-X using the maximum likelihood approach with 1000 iterations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiology and Life Cycle\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe BSF, commonly referred to as a latrine larva, is a dipteran belonging to the Stratiomyidae family (Diener, 2010). The tropical regions of Central and South America are where it originally originated. The length of an adult \u003cem\u003eH. illucens\u003c/em\u003e is around 16 mm (5/8 in). These medium-sized flies have a body that is mostly black, with metallic reflections on the thorax that range from blue to green, and occasionally have a crimson finish to the abdomen. A transparent region is present in the second abdominal tergite. Wide eyes and a broad head are present. The length of the antennae is roughly equal to that of the head. The tarsi are pale and have black legs. The membranous wings are folded and overlapped horizontally on the abdomen during the period when the animal is resting.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA mature female can produce anywhere from 206 to 639 eggs at once. These eggs normally hatch in 4 days and are laid in cracks, on surfaces above or beside decaying material, such as manure or compost. Larvae that have just emerged are only 1.0 millimeters (0.04 in) long, but they can grow to be 25 millimeters (1 in) long and weigh between 0.10 and 0.22 grams (1.5 to 3.4 gr) by the time they reach the end of the larval stage. The larvae may consume a wide range of organic substances and can adjust to diets with various nutrient contents. Depending on the food substrates available to the larvae, the larval stage can last anywhere between 18 and 36 days, with the post-feeding (prepupal) stage lasting roughly 7 days (Lohri \u003cem\u003eet al\u003c/em\u003e., 2017). Due to low temperatures or a shortage of food, the length of the larval stage can be extended by months. One to two weeks pass during the pupal stage. When given water and food, such as sugar in captivity or nectar in the wild, adults can normally live 47 to 73 days. They can also survive for around 8 to 10 days on fat stores accumulated during the larval stage when water is given.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBSF mass production\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBSF\u0026nbsp;rearing unit\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis guarantees that a steady supply of small larvae, or 5-DOL, is constantly available to inoculate the daily volume of biowaste brought into the treatment facility for processing (Sheppard \u003cem\u003eet al\u003c/em\u003e., 2002). But to maintain a steady breeding population, a certain number of larvae hatchlings are kept in the rearing unit. The rearing unit must supply a specific number of 5-DOL, or five-day-old larvae, each day to guarantee the regular treatment of a specified amount of trash. Therefore, it\u0026apos;s crucial to manage the individual production phases during raising and to keep an eye on how each one is doing. It is possible and simple to regulate the amount of prepupae that are permitted to pupate in a well-designed BSF nursery. The colony\u0026apos;s overall performance is tracked by keeping track of the survival rates at each stage of this cycle, which also highlights any difficulties at a specific stage. Various nurseries may have different survival rates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEgg deposition and egg harvest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe placement of all egg packets in one particular area is crucial. This will make it much easier to collect the eggs. To achieve this, provide the cages with an appropriate medium that satisfies the fly\u0026apos;s needs for a safe area (i.e., sheltered cavities) for egg deposition and an \u0026quot;attractant\u0026quot; that encourages the female to lay eggs nearby and mimics decomposing organic waste. Before any larvae hatch, the egg packets are harvested after being deposited. It\u0026apos;s crucial to keep handling of egg bundles and individual eggs to a minimum because every movement or touch lowers the survival percentage of the eggs. Weighing the entire mass of the eggs and the egg-laying equipment is one way to reduce egg handling.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEgg hatching and larvae feeding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe harvested egg-laying apparatus is arranged over an open \u0026quot;hatchling container\u0026quot; with a premium food source, along with those harvested the day before. Several days will pass before the larvae hatch. A consistent \u0026quot;shower\u0026quot; of hatchlings into the nursery container is ensured by combining recently harvested egg-laying apparatus with the older egg-laying apparatus. Larvae drop from the egg-laying equipment into the hatchling container below after hatching, where they begin feeding right away. The starter chicken feed and water are the high-quality food supply in the hatchling container. This combination contains 70% or more water. With consistent (same age and size) larvae, BSF waste management is made easier. Better waste intake, conversion rate, and harvesting time planning are now possible. The number and age of young larvae in a hatchling container can be managed and determined by using the hatchling shower. The batch of larvae\u0026apos;s homogeneity depends on how often the hatchling container is changed. The homogeneity of the young larvae increases with replacement frequency. Five days after hatching, larvae continue to feed in the same hatchling container. After being removed from the hatchling containers, the 5-DOL are tallied, and a majority of them are subsequently sent to the BSF treatment facility where they are mixed with the garbage.\u003c/p\u003e\n\u003cp\u003eDepending on how much waste needs to be handled and how well the nursery is doing, a tiny portion of the 5-DOL (2\u0026ndash;5%) is maintained in the rearing unit. Less 5-DOL will need to be kept in the rearing unit due to high survival rates and several eggs per female. These retained larvae are put into a nursery container where they are continuously given a specific diet mixture for about two weeks, during which time they develop into prepupae. When all larvae in a nursery container reach the same age, they will all change at roughly the same time. To find a better, dryer place to pupate, the prepupae will attempt to flee the food supply.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePupation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrepupae are harvested and moved into a pupation container after they are wriggled into the transfer container. The containers include a moist substrate (compost) that the prepupae can burrow into as they are disturbed by large masses of other prepupae. The pupation containers are put inside pupation cages, sometimes known as \u0026quot;dark cages,\u0026quot; which are completely dark inside to aid in the pupation process. The pupae are adequately protected in this cage from changing outdoor environmental factors, such as moisture, temperature, air movement, etc., in addition to the gloomy environment.\u003c/p\u003e\n\u003cp\u003eThe pupation material has slightly dried out after two to three weeks, making it simpler for the flies to emerge from the pupal skin, climb to the top of the material, and leave the pupation containers while remaining confined inside the dark cage. The newly emerged flies won\u0026apos;t mate since it is so dark inside the cage; instead, they will just stand still. As a result, the flies in the dark cage provide a steady supply of new adult flies, who, if released into the light, will begin to reproduce. Ten days after being placed in the pupation box, the adults begin to emerge. They then follow a bell-shaped curve and terminate with a few latecomers after 25 days.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMating\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEmerging flies are removed from the dark cage as needed. This is accomplished by creating a tunnel that connects the dark cage with the unlit cage that is dangling from the mobile frame. It is known as the \u0026quot;love-cage\u0026quot; since this is where mating will occur. The flies will be drawn by the light at the end of the tunnel to fly from the dark cage into the love-cage. To gather the most recently emerged flies, a love cage is sequentially connected to three to four dark cages. With the help of this technique, the fly density inside the love cages may be kept steady and constant. The gathered flies are also all fairly similar in age. A significant advantage of using similar-aged flies in the love-cage is that they are predictable and will copulate and lay eggs at roughly the same time, making it possible to run a nursery business more effectively. The fly hydration gear, egg-laying equipment, and a box with an offensive attractant are all included in the love cages. Thus, the raising cycle has come to an end.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"601\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.166666666666668%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMunicipal\u0026nbsp;waste\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAgro-industrial\u0026nbsp;waste\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.833333333333336%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eManure\u0026nbsp;and\u0026nbsp;faeces\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.166666666666668%\" valign=\"top\"\u003e\n \u003cp\u003eMunicipal\u0026nbsp;organic\u0026nbsp;waste\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003eFood\u0026nbsp;processing\u0026nbsp;waste\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.833333333333336%\" valign=\"top\"\u003e\n \u003cp\u003ePoultry\u0026nbsp;manure\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.166666666666668%\" valign=\"top\"\u003e\n \u003cp\u003eFood\u0026nbsp;and restaurant\u0026nbsp;waste\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003eSpent\u0026nbsp;grains\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.833333333333336%\" valign=\"top\"\u003e\n \u003cp\u003ePig\u0026nbsp;manure\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.166666666666668%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eMarket\u0026nbsp;waste\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eSlaughterhouse\u0026nbsp;waste\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.833333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eHuman\u0026nbsp;faeces\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"top\"\u003e\n \u003cp\u003eFaecal\u0026nbsp;sludge\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe garbage brought into the facility must be fit for the larvae to eat. The trash must first be controlled to make sure it doesn\u0026apos;t include any inorganic or hazardous compounds (Lalander \u003cem\u003eet al\u003c/em\u003e., 2019). The next stage is to reduce the trash\u0026apos;s particle size, dewater it if it has a high moisture content, and/or mix it with other forms of organic waste to give the\u0026nbsp;\u003c/p\u003e\n\u003cp\u003elarvae a balanced diet and enough moisture (70\u0026ndash;80%). The majority of the time, larvae are quite tolerant of the substrates they are fed on. However, it\u0026apos;s crucial that the biowaste the facility receives is acceptable for use as larval food. Most organic materials will be handled in one way or another if they have a water content of between 60% and 90% and a particular particle size. The symbiotic microbes that the larvae rely on heavily break down cell structures and make nutrients accessible for the larvae to absorb. However, with little nutrition, development may take longer and the eventual weight of the larva would be smaller.\u003c/p\u003e\n\u003cp\u003eTrash quality control is performed as soon as the waste arrives to make sure it is free of hazardous and inorganic contaminants. The debris can be manually sorted and discarded, and a few plastic bags may not be much of an issue. However, dangerous contaminants must be kept out because they may harm every living thing present, including the workers as well as the associated bacteria and larvae (Lalander \u003cem\u003eet al\u003c/em\u003e., 2020). These substances include acids, solvents, insecticides, detergents, and heavy metals. It\u0026apos;s crucial to keep these substances out of the waste stream when they\u0026apos;re liquid or dissolved since they can readily contaminate the entire batch. Waste should be rejected if this kind of contamination is detected. Reducing the size of the waste particle is the next necessary step once the waste quality has been guaranteed. The use of a shredder or hammer mill will accomplish this. Whatever the technology, it should be able to reduce trash to particles no larger than 1-2 cm in diameter (Singh and Kumari, 2019). As BSF larvae lack the proper mouthparts to break up huge chunks of trash, this aids in speeding up BSF processing. Increasing the surface area also encourages the growth of the related bacteria. The trash must be dewatered or combined with another, more dry waste source to reduce moisture content if the shredded waste has a water content above 80% (waste at this moisture will have a slurry-like texture, comparable to a fruit mix when ground in a kitchen blender). Water must be added if the water content is less than 70%. Squeezing a handful of waste will show you if it is too dry or not by seeing how much water appears between your fingers when you squeeze the trash. Water that is used for wet and dry waste must be safe to use, which means it must be free of pathogens, heavy metals, and other anti-nutritional components.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.333333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eParameters \u0026nbsp; \u0026nbsp; about the feedstock\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.666666666666664%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eOptimal\u0026nbsp;values\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSuggested \u0026nbsp; \u0026nbsp; \u0026nbsp; pre-processing methods for optimization\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.333333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNutrient\u0026nbsp;content\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.666666666666664%\" valign=\"top\"\u003e\n \u003cp\u003e21% \u0026nbsp; \u0026nbsp;protein \u0026nbsp; \u0026nbsp;and \u0026nbsp; \u0026nbsp;21% carbohydrate;\u003c/p\u003e\n \u003cp\u003eC/N \u0026nbsp; ratio: \u0026nbsp; \u0026nbsp;10-40; \u0026nbsp; \u0026nbsp;High contents of volatile solids\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003eMixing\u0026nbsp;different\u0026nbsp;waste\u0026nbsp;types\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.333333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFibre\u0026nbsp;content\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.666666666666664%\" valign=\"top\"\u003e\n \u003cp\u003eNot\u0026nbsp;too high\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003ePre-fermentation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.333333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMoisture\u0026nbsp;content\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.666666666666664%\" valign=\"top\"\u003e\n \u003cp\u003e70-80%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003eDewatering,\u0026nbsp;water\u0026nbsp;addition,\u0026nbsp;and/or mixing different waste\u0026nbsp;types\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.333333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eParticle\u0026nbsp;size\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.666666666666664%\" valign=\"top\"\u003e\n \u003cp\u003e1-2\u0026nbsp;cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003eShredding\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.333333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eStructure\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.666666666666664%\" valign=\"top\"\u003e\n \u003cp\u003eSufficient\u0026nbsp;for\u0026nbsp;larvae\u0026nbsp;to\u0026nbsp;move\u0026nbsp;through\u0026nbsp;the\u0026nbsp;feedstock, consume it, and\u0026nbsp;breathe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003eAddition\u0026nbsp;of\u0026nbsp;matrix\u0026nbsp;material\u0026nbsp;such\u0026nbsp;as\u0026nbsp;pine\u0026nbsp;shavings\u0026nbsp;or\u0026nbsp;crushed\u0026nbsp;charcoal\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"31.333333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003epH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.666666666666664%\" valign=\"top\"\u003e\n \u003cp\u003e5-8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36%\" valign=\"top\"\u003e\n \u003cp\u003eMixing\u0026nbsp;different\u0026nbsp;waste\u0026nbsp;types\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eSolid waste degradation by \u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBoth the larvae and the adults are not regarded as pests or vectors. Instead, black soldier fly larvae function as crucial decomposers in the same way that redworms do, consuming organic substrates and redistributing nutrients to the soil (Gold \u003cem\u003eet al\u003c/em\u003e., 2018). The larvae can be utilized to compost food scraps from homes and farms because they have ravenous appetites. In addition, black soldier fly larvae (BSFL) are a different source of protein for human nutrition, pet food, animal feed, and aquaculture.\u003c/p\u003e\n\u003cp\u003eTo create energy-dense larvae and organic fertilizer, the BSF treats garbage by feeding it to its larvae. This bug is highly appealing for valorizing organic waste due to several BSF traits:\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003eThe effective conversion of a wide variety of organic waste materials is made possible by the BSF larvae\u0026apos;s insatiable appetite for decomposing organic substances;\u003c/li\u003e\n \u003cli\u003eDue to the BSF\u0026apos;s brief life cycle and propensity for frequent reproduction, there is always a ready supply of both energy-rich larvae that can be utilized as animal feed and larvae to convert organic waste.\u003c/li\u003e\n \u003cli\u003eBecause of its toughness, the BSF is easier to raise and less restrictive to employ in waste treatment;\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eThe prepupae can finally be easily gathered because they spontaneously crawl out of the excrement.\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003e\u003cstrong\u003eBSF waste treatment unit\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDaily transfers of a predetermined quantity of 5-DOL are made from the BSF raising unit to the BSF treatment units holding the waste. The quantity of biowaste contained in a certain volume and surface area will determine how many 5-DOL are added. The 5-DOL from the raising unit is fed here using containers of biowaste. The biowaste is fed to the immature larvae, which develop into giant larvae and process and minimize the waste. On days five and eight, more garbage is placed in the same container while the 5-DOL feeds and grows. This process is repeated until the larvae have grown big enough to be harvested after 12 days of feeding, or on the 13th day. Here are some potential operational parameters for the BSF treatment unit: 60kg of biowaste is fed over 12 days to 40,000 5-DOL per 1m2 treatment area. The nutrients are metabolized into larval biomass as the waste is consumed by the larvae, which also decomposes the organic material. A layer of unprocessed waste can build up heat from bacterial activity if too much trash is consumed, which will render the environment hostile for the larvae. Other scum flies will be drawn to the unattended feed as\u003c/p\u003e\n\u003cp\u003ewell. Insufficient trash provision will starve the larvae, slowing both their rate of development and the facility\u0026apos;s capacity for waste treatment.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"604\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.768595041322314%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eOperating\u0026nbsp;parameter\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.23140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eOptimal\u0026nbsp;values\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.768595041322314%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFeeding\u0026nbsp;rate\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.23140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e20-130\u0026nbsp;(mg waste)\u0026nbsp;larva\u003csup\u003e-1\u003c/sup\u003e day\u003csup\u003e-1\u003c/sup\u003e for high biomass production\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.768595041322314%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eLarval\u0026nbsp;density\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.23140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e1.2-5\u0026nbsp;larvae\u0026nbsp;cm\u003csup\u003e-\u003c/sup\u003e\u0026sup2;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.768595041322314%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eWaste\u0026nbsp;layer\u0026nbsp;thickness\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"72.23140495867769%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026lt;\u0026nbsp;7.5 cm\u0026nbsp;or \u0026lt;\u0026nbsp;15\u0026nbsp;cm if\u0026nbsp;matrix materials are\u0026nbsp;added\u0026nbsp;to\u0026nbsp;the waste\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eOptimal feeding rate for varying feedstocks\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.462562396006657%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eFeedstock\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.91181364392679%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eOptimal\u0026nbsp;feeding\u0026nbsp;rate\u0026nbsp;(mg\u0026nbsp;larva\u003c/strong\u003e\u003cstrong\u003e-1\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eday\u003c/strong\u003e\u003cstrong\u003e-1\u003c/strong\u003e\u003cstrong\u003e)\u0026nbsp;in\u0026nbsp;terms\u0026nbsp;of\u0026hellip;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.625623960066555%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"28.84012539184953%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026hellip;biomass\u0026nbsp;production\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.645768025078368%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026hellip;waste\u0026nbsp;reduction\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.5141065830721%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026hellip;both biomass\u0026nbsp;production and\u0026nbsp;waste\u0026nbsp;reduction\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.425249169435215%\" valign=\"top\"\u003e\n \u003cp\u003eChicken\u0026nbsp;feed\u0026nbsp;(60%\u0026nbsp;moisture\u0026nbsp;content)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.282392026578073%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026ge;200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.119601328903654%\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.588039867109636%\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.58471760797342%\" valign=\"top\"\u003e\n \u003cp\u003e(Diener \u003cem\u003eet al.,\u0026nbsp;\u003c/em\u003e2009)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.425249169435215%\" valign=\"top\"\u003e\n \u003cp\u003eVegetable \u0026nbsp; \u0026nbsp; \u0026nbsp; and fruit waste\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.282392026578073%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026ge;130\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.119601328903654%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026le;20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.588039867109636%\" valign=\"top\"\u003e\n \u003cp\u003e163\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.58471760797342%\" valign=\"top\"\u003e\n \u003cp\u003e(Paz \u003cem\u003eet al.,\u0026nbsp;\u003c/em\u003e2015,\u0026nbsp;Saragi and\u003c/p\u003e\n \u003cp\u003eBagastyo\u0026nbsp;2015)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.425249169435215%\" valign=\"top\"\u003e\n \u003cp\u003eDairy\u0026nbsp;manure\u0026nbsp;(~\u0026nbsp;70%\u0026nbsp;moisture\u0026nbsp;content)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.282392026578073%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026ge;70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.119601328903654%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026le;27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.588039867109636%\" valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.58471760797342%\" valign=\"top\"\u003e\n \u003cp\u003e(Myers \u003cem\u003eet al.,\u0026nbsp;\u003c/em\u003e2014)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.425249169435215%\" valign=\"top\"\u003e\n \u003cp\u003eHuman\u0026nbsp;feces\u0026nbsp;(65-\u003c/p\u003e\n \u003cp\u003e85% \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;moisture content)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.282392026578073%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026ge;200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.119601328903654%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026le;50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.588039867109636%\" valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.58471760797342%\" valign=\"top\"\u003e\n \u003cp\u003e(Banks \u003cem\u003eet al.,\u0026nbsp;\u003c/em\u003e2014)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.425249169435215%\" valign=\"top\"\u003e\n \u003cp\u003ePalm\u0026nbsp;kernel\u0026nbsp;meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.282392026578073%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026ge;64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.119601328903654%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026le;4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.588039867109636%\" valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.58471760797342%\" valign=\"top\"\u003e\n \u003cp\u003e(Caruso \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003cem\u003eet \u0026nbsp; \u0026nbsp; \u0026nbsp;al.,\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e2014)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eProduct harvesting unit\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe larvae are removed from the jars just before they develop into prepupae. The waste residue alone is a valuable product. Unit following therapy If necessary, owing to local market demand, both products, larvae, and leftovers, may be further processed. Killing the larvae is usually the first step. Larvae can also be refined by drying them out or freezing them, or by separating the protein from the oil in the larvae. Composting or putting the residue into a biogas digester to make fuel are two usual refinement steps for residue. Each container is harvested after garbage has been treated by BSF larvae for 12 days. The larvae have grown to their maximum weight at this point but have not yet developed into prepupae. Thus, their nutritional worth is at its highest. The procedure of harvesting involves separating the larvae from the waste. A manual or automatic shaking sieve can be used for this, making it simple to separate the larvae from the waste. The sieve\u0026apos;s mesh size can be larger with a higher shaking frequency. This is because when there is a high shaking frequency, the larvae find it difficult to orient themselves and are unable to crawl through the mesh. To attain higher shaking frequencies than hand sieves, automated shaking sieves are preferred. For human sieving, a sieve mesh size of around 3 mm is recommended, and for automated sieving, a mesh size of about 5 mm. The container\u0026apos;s contents are dumped onto the sieve, which is then tilted. The debris falls through the sieve into recipients as it shakes, but the larvae stay on top of the sieve. Due to the sieve\u0026apos;s angle, the larvae are directed to the lower angle, which is joined to a bucket into which they fall.\u003c/p\u003e\n\u003cp\u003eIn rare cases, where the initial water content of the trash was higher than optimal (\u0026gt;80%), the container at the time of harvesting will include larvae and a liquid slurry of processed waste with some undigested chunks (instead of a crumbly waste residue). In such a situation, a different harvesting technique using flat, non-shaking screens with a 5 mm mesh size is advised. Under the flat screen that is not moving is a container. Then, the flat screen is covered with the contents of the container. Since the larvae desire to stay out of the sunlight, the liquid will flow through it as well as the larvae, eventually falling into the container below. To be eliminated, larger residue chunks will stay on top of the screen. With a sizable strainer spoon, the primarily floating larvae in the container beneath the flat screen can be taken out, rinsed, and then put into a drying container with coco peat or another type of dry material (such as sawdust) to dry. For roughly one day, the larvae are in the drying container. The quality of the final product is improved by giving the animals time to empty their stomachs while also cleaning their skin as they move about in this material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePost-treatment of the larvae and residue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLarvae may be harvested and then sold alive to clients (at reptile farms or bird markets, for example). Utilizing them to make feed pellets is an additional strategy. To create a mixture that fits the nutritional needs of the intended animal (broiler chickens, layer hens, various fish species, etc.), freshly caught larvae can be combined with other components (such as soy meal, sorghum, maize, etc.). It is possible to put this combination directly into a pelletizer, which will compress it into feed pellets. To guarantee that they can be easily sanitized, stored, and transported to the appropriate clients, larvae will typically require some sort of post-processing. Sanitizing entails eliminating any bacteria that may stick to the skin of the larvae and making sure that the larvae empty their intestines, which contain only partially digested waste. For this, we advise using boiling water. The larvae are instantaneously killed and the product is sanitized by dipping them into a big pan of hot water for roughly two minutes. The crumbly waste needs to be post-processed to create stable, mature compost. To achieve this, a variety of measures can be considered. The easiest method is to compost the leftover material for two months. This will produce a mature, stable product that can be marketed similarly to compost. Another choice is to feed the leftovers into a vermicomposting facility to raise (and sell) worms and produce a stable and mature vermicompost. Feeding the residue into an anaerobic digester (biogas reactor) is the third alternative presented here, which is appropriate when the residue is moist slurry-like, and high in moisture.\u003c/p\u003e\n\u003ch3\u003ePRODUCTS: PROPERTIES AND APPLICATIONS\u003c/h3\u003e\n\u003cp\u003e\u003cstrong\u003eEconomic importance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe adult black soldier fly is generally not considered a pest, as highlighted by Newton et al. (2005). Leveraging the efficient recycling capabilities of the larvae, a \u0026quot;Black Soldier Fly Manure Management System\u0026quot; has been proposed to address livestock waste reduction while simultaneously providing a valuable food source for fish and other animals. In a program outlined by Newton et al. (2005), black soldier fly larvae were fed swine manure, resulting in a significant reduction in waste material. The manure, loaded with larvae, was placed in a basin where, as the larvae matured, they decreased the manure volume by 50%. An estimated 45,000 larvae could consume 24 kg of swine manure in just 14 days. As the larvae reach maturity, they naturally crawl out of the basin, facilitating a self-harvesting process, and become readily available as livestock feed. Apart from being a rich source of oil and protein for animal feed, black soldier fly larvae exhibit the potential to transform organic waste into a nutrient-dense fertilizer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBSF\u0026nbsp;Larvae\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDepending on the kind of garbage used as a food source and the stage at which they are taken, BSF larvae have different chemical compositions (Spranghers \u003cem\u003eet al\u003c/em\u003e., 2017). BSF larvae are said to have high protein and fat levels regardless of the feedstock (Lalander \u003cem\u003eet al\u003c/em\u003e., 2019). According to Liu et al. (2017), they contain 35 to 44% DM: Dry Matter of crude protein. Depending on the trash fed to the larvae and its lipid profile, the lipid content varies greatly, ranging from 14 to 49% DM (Liland \u003cem\u003eet al\u003c/em\u003e., 2017). The average ash concentration is considerable (12% DM), but the range is wide (3 to 26% DM) (Caruso \u003cem\u003eet al\u003c/em\u003e., 2014; Spranghers \u003cem\u003eet al\u003c/em\u003e., 2017). According to Wang et al. (2020), the fatty acid profile of the feedstock affects the fatty acid profile of BSF larvae. According to (Spranghers \u003cem\u003eet al\u003c/em\u003e., 2017), depending on the feedstock, the proportion of saturated fatty acids in the fatty acid profile of BSF larvae ranges from 65 to 90% in weight (DM basis). Additionally, lauric acid (C12:0), palmitic acid (C16:0), and oleic acid (C18:1n9c) are said to be the three most prevalent fatty acids in the BSF lipid profile (Kim \u003cem\u003eet al\u003c/em\u003e., 2020).\u003c/p\u003e\n\u003cp\u003eAccording to Barragan-Fonseca et al. (2017), BSF larvae have rather high levels of calcium (9 to 86 g kg-1 DM), phosphorus (4 to 5 g kg-1 DM), and potassium (5 to 6 g kg-1 DM). In terms of the essential amino acid profile, lysine, valine, and leucine are notably abundant in BSF larvae (Liland \u003cem\u003eet al\u003c/em\u003e., 2017). The nutritional value of BSF larvae can be increased by altering their diet, according to several scientists. In this context, it was found by (Diener \u003cem\u003eet al\u003c/em\u003e., 2009) that adding fish offal to the diet of BSF larvae results in the production of larvae that are higher in omega-3 fatty acids than those fed exclusively dairy manure. Additionally, it was found by (Liland \u003cem\u003eet al\u003c/em\u003e., 2017) that incorporating seaweed in the larvae\u0026apos;s diet increases the biomass\u0026apos;s content of beneficial elements such as EPA (omega-3 fatty acid), iodine, and vitamin E. Additionally, (Raksasat \u003cem\u003eet al\u003c/em\u003e., 2021) noted that BSF larvae had higher protein and fat levels after fermenting the leftovers after coconut milk extraction for four weeks.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBlack Soldier Fly Larvae as Animal Feed Source\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBSF larvae are an intriguing replacement for fishmeal and soybean meal, which are typically used as feed in animal production but are unsustainable and getting more and more expensive (Jucker \u003cem\u003eet al\u003c/em\u003e., 2020). This is because BSF larvae have a high protein and fat content, which suggests that they may be utilized as animal feed. Substituting conventional feed, either partially or entirely, with black soldier fly (BSF) larvae has proven to be effective in promoting growth and enhancing the quality of various monogastric animal species. This includes fish, such as channel catfish (\u003cem\u003eIctalurus punctatus\u003c/em\u003e) (Spranghers \u003cem\u003eet al\u003c/em\u003e., 2017), blue tilapia (\u003cem\u003eOreochromis aureus\u003c/em\u003e), Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) (Li \u003cem\u003eet al\u003c/em\u003e., 2020), rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) (Jucker \u003cem\u003eet al\u003c/em\u003e., 2020), Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) (Pang \u003cem\u003eet al\u003c/em\u003e., 2020), as well as crustaceans like Pacific white shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e). Moreover, positive outcomes were observed in livestock, including pigs and chickens. Nevertheless, Makkar et al. (2014) advised further feeding experiments, considering that certain studies have indicated decreased growth performance. This recommendation stems from the variability in results attributed to the type of feedstock used to nourish the larvae, as highlighted by Myers et al. (2014). Addressing the need for refining larvae-based feed formulations, particularly the protein, fat, and fiber ratio, is crucial, as emphasized by Wong et al. (2021). To achieve a more balanced diet and enhance digestibility and feeding value, some authors propose separating protein from fat and chitin. Defatted larvae, for instance, exhibit a higher protein content of approximately 60% compared to whole larvae, as noted by Gold et al. (2020), Kim et al. (2020), and Klammsteiner et al. (2020). Additionally, the optimal stage for harvesting larvae to produce high-value animal feed is a subject of consideration. Some authors argue that harvesting larvae before reaching the prepupal stage may result in a more valuable feed product, as suggested by Gold et al. (2020) and Myers et al. (2014). In their examination of the nutritional evolution of black soldier fly (BSF) throughout its lifecycle, Liu et al. (2017) discovered that crude protein and fat contents peak during the early prepupal stage. However, this heightened nutritional value comes at the expense of digestibility. Notably, prepupae possess a higher chitin content compared to larvae, rendering them less digestible for chickens and fish, as observed by Caruso et al. (2014). Consequently, some researchers, such as Marco et al. (2021), opted to use mature larvae that had not yet reached the prepupal stage in their feeding trials, while others, like Singh and Kumari (2019), employed prepupae in their experiments. In their exploration of the chemical safety of employing BSF larvae as a protein source for animal feed, Raksasat et al. (2021) assessed the levels of an extensive array of chemical contaminants comprising 1,140 analyzed compounds, such as veterinary medicines, pesticides, heavy metals, dioxins, polychlorinated biphenyls, polyaromatic hydrocarbons, and mycotoxins in BSF larvae raised on agroindustrial waste. The findings indicated that all recorded concentrations were below the maximum levels recommended by reputable organizations, including the European Commission, the World Health Organization, and the Codex Alimentarius. Nevertheless, caution was raised regarding the potential risk of metal bioaccumulation in the larvae, particularly for cadmium. Various studies have demonstrated that heavy metals can accumulate in BSF larvae, displaying distinct accumulation patterns depending on the specific metal involved. When BSF larvae are fed with contaminated substrates, the concentrations of heavy metals in the larvae and prepupae bodies, in comparison to those in the initial feedstock, exhibit higher levels for cadmium, equivalent levels for zinc, reduced levels for chromium, and no detectable levels for lead, as reported by Gold et al. (2018). In light of these findings, Lohri et al. (2017) recommended refraining from using waste contaminated by heavy metals as feedstock in BSF waste treatment. Regarding pharmaceuticals and pesticides, the findings of Liu et al. (2017) support a study by Lalander et al. (2019), wherein no bioaccumulation was observed in BSF larvae fed with waste containing various pharmaceuticals and pesticides. In terms of microbiological risks, Zhang et al. (2020), who investigated bacterial diversity throughout the BSF lifecycle using pyrosequencing, noted the presence of bacteria from six different phyla, with Bacteroidetes and Proteobacteria being the most predominant, accounting for two-thirds of the identified bacteria. Among the bacteria present throughout the entire BSF lifecycle, \u003cem\u003eEnterobacterials\u003c/em\u003e and \u003cem\u003eXanthomonadales\u003c/em\u003e were identified as potential pathogens. Furthermore, it\u0026apos;s worth noting that BSF larvae can be contaminated by certain pathogens present in the processed waste. Specifically, Lalander et al. (2019) identified Salmonella spp. in larvae exposed to contaminated animal and human feces. Additionally, they noted the presence of Ascaris ova within both the larvae and prepupae. However, the concentration of these organisms was observed to be lower in the gut of the prepupae compared to the larvae, indicating that prepupae tend to empty their gut before migrating to their pupation site. Consequently, using prepupae instead of larvae as animal feed might be considered a safer option. On the topic of plant pathogens, Irawan et al. (2020) examined the antibacterial properties of larval extract from BSF and determined that larval extract plays a crucial role in defending against plant pathogens. Nevertheless, Klammsteiner et al. (2020), who did not delve into the microbiological risks associated with using BSF larvae as animal feed, highlighted that\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"601\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eType\u0026nbsp;of\u0026nbsp;Waste\u0026nbsp;Substrate\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.833333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eType\u0026nbsp;of\u0026nbsp;fuel\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.166666666666668%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmount\u0026nbsp;of\u0026nbsp;fuel (g)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.5%\" valign=\"top\"\u003e\n \u003cp\u003eDiary\u0026nbsp;manure (1248\u0026nbsp;g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.833333333333332%\" valign=\"top\"\u003e\n \u003cp\u003eBiodiesel\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.166666666666668%\" valign=\"top\"\u003e\n \u003cp\u003e15.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.5%\" valign=\"top\"\u003e\n \u003cp\u003e(Elsayed \u003cem\u003eet\u0026nbsp;al.,\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e2020)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eChicken\u0026nbsp;manure\u0026nbsp;(1000\u0026nbsp;g)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.833333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eBiodiesel\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.166666666666668%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e91.40\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.5%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(Shelomi\u0026nbsp;2020)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.94904458598726%\" valign=\"top\"\u003e\n \u003cp\u003eCattle\u0026nbsp;manure\u0026nbsp;(1000\u0026nbsp;g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.991507430997878%\" valign=\"top\"\u003e\n \u003cp\u003eBiodiesel\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.05944798301486%\" valign=\"top\"\u003e\n \u003cp\u003e35.50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"34.5%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePig\u0026nbsp;manure\u0026nbsp;(1000\u0026nbsp;g))\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.833333333333332%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eBiodiesel\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.166666666666668%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e57.80\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.5%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(Lalander \u003cem\u003eet\u0026nbsp;al.,\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e2019)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.94904458598726%\" valign=\"top\"\u003e\n \u003cp\u003eFaeces\u0026nbsp;(1\u0026nbsp;g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.991507430997878%\" valign=\"top\"\u003e\n \u003cp\u003eBiogas\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.05944798301486%\" valign=\"top\"\u003e\n \u003cp\u003e0.13\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"43.94904458598726%\" valign=\"top\"\u003e\n \u003cp\u003eFood\u0026nbsp;waste (1\u0026nbsp;g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.991507430997878%\" valign=\"top\"\u003e\n \u003cp\u003eBiogas\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.05944798301486%\" valign=\"top\"\u003e\n \u003cp\u003e0.22\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003esuch risks can be significantly minimized through appropriate post-processing techniques.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProduction of Biodiesel\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExploration into biodiesel production from the oil extracted from BSF larvae is underway. Several studies, examining the fatty acids profile, have indicated that lipids from BSF larvae, when fed with diverse substrates including food waste (Bin Kamari, 2021), fruit waste (Raksasat \u003cem\u003eet al\u003c/em\u003e., 2021), sewage sludge, cattle, chicken, and pig manure (Pang \u003cem\u003eet al\u003c/em\u003e., 2020), palm decanter cake from an oil palm mill (Leong et al., 2016), and rice straw (Zhang \u003cem\u003eet al\u003c/em\u003e., 2020), possess characteristics suitable for biodiesel production. Bin Kamari (2021) even proposed that producing biodiesel from the oil of BSF larvae fed on swine manure could yield as much energy as anaerobic digestion of the same manure. Additionally, the fuel properties of biodiesel derived from the lipids of BSF larvae fed on animal manure are comparable to those of other biodiesels, such as rapeseed oil-based biodiesel.\u0026nbsp;Furthermore, as per the findings of Kim et al. (2020), biodiesels derived from BSF larvae fed on rice straw and restaurant waste meet the majority of the criteria outlined in the European standard EN 14214.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProduction of Chitin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn addition to the notable protein and lipid content of BSF larvae, which can be harnessed for animal feeding and biodiesel production, another valuable extractable from BSF larvae is chitin, a major constituent of the larvae\u0026apos;s cuticle or exoskeleton. Chitin holds commercial significance due to its elevated nitrogen content (6.9%), surpassing that of synthetic cellulose, as highlighted by Caruso et al. (2014). This compound finds applications as a chelating agent in medicines, cosmetics, biotechnologies, phytosanitary products, and industrial items (Wang \u003cem\u003eet al\u003c/em\u003e., 2020). Exploring the extraction of chitin from BSF larvae and entering specific markets with this product could potentially enhance the economic value derived from the larvae. However, the economic feasibility of this chitin extraction process from BSF larvae remains an unexplored area.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWaste Residue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFew studies have delved into the properties of the waste residue compared to the research on larvae. Lalander et al. (2019) observed that processing a combination of pig manure, dog food, and human feces by the BSF led to a 45% increase in the concentration of total phosphorus per gram of total solids in the waste residue and an almost 160% increase in total ammonium nitrogen (NH4 +-N). This suggests the potential suitability of the waste residue for agricultural use as a soil amendment. The capability of BSF larvae to convert organic nitrogen into ammonium nitrogen was also noted by Egnew et al. (2021), who found that BSF feeding on vegetal and food waste significantly enhanced nitrogen mineralization. They reported a five to six-times increase in the concentration of ammonium in the leachate. The C/N ratio of the waste residue is contingent on the initial C/N ratio of the feedstock, with literature values ranging from 10 to 43 for the C/N ratio of the final waste residue, corresponding to the reported range for the C/N ratio of the feedstock (Saragi and Bagastyo 2015). The pH range of the waste residue typically falls between 7 to 8, as reported by Lalander et al. (2019), which aligns with the optimal range for plant growth as indicated by Spranghers et al. (2017). The moisture content of the waste residue is contingent on the initial moisture content of the waste. In the case of food waste, Cheng et al. (2017) observed that when the initial moisture content was 70% and 75%, the moisture content of the waste residue after the feeding period decreased to approximately 50%. Conversely, when the initial moisture content was 80%, it did not decrease and remained above 80% throughout the entire BSF waste treatment process.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eUse as Fertilizer\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLimited studies have explored the efficacy of BSF waste residue, whether in its raw or post-processed form, as a fertilizer for diverse crops. Fischer and Romano (2021) presented promising findings concerning the utilization of waste residue resulting from the bioconversion of food waste by BSF as an alternative to traditional fertilizer. Notably, they found no significant difference in the chemical composition between the BSF waste residue and an unspecified commercial fertilizer. Furthermore, the growth rate and chemical composition of Chinese cabbages cultivated on BSF residue mirrored those of cabbages grown using commercial fertilizer. Similarly, agricultural trials conducted in Ghana demonstrated that applying BSF biofertilizer (i.e., BSF waste residue composted for one to three weeks) at a rate of 10 tonnes per hectare, in conjunction with inorganic fertilizer, could boost crop yield by up to 55% compared to using inorganic fertilizer alone for various local short-cycle cash crops, particularly onions and maize. Additionally, the application of BSF biofertilizer alone yielded superior results compared to combining poultry manure with inorganic fertilizer (Gold \u003cem\u003eet al\u003c/em\u003e., 2020). Contrastingly, Newton et al. (2005) documented suboptimal outcomes concerning the growth of basil (\u003cem\u003eOcimum basilcum\u003c/em\u003e) and sudangrass (\u003cem\u003eSorghan sudanense\u003c/em\u003e) cultivated on swine manure processed by BSF larvae (without post-treatment) and mixed with either clay or sand. This subpar performance could be attributed to the immaturity of the waste residue derived from the BSF process, as noted by Lohri et al. (2017). This immaturity leads to oxygen depletion in the soil upon application, thereby impeding plant growth, as highlighted by Myers et al. (2014). Consequently, the residue should undergo a maturation phase, as suggested by Lohri et al. (2017).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBenefits and opportunities\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrepupae present a viable alternative for animal feed, while larvae contribute to biodiesel production and serve as compost for agriculture, offering the potential for job creation and additional income. The waste reduction achieved is swifter than traditional composting methods, mitigating odor issues. Larvae exhibit a versatile capacity to digest various residues and display heightened resilience to environmental fluctuations compared to worms. Additionally, they can be employed as an alternative for sludge (faecal) treatment. Black soldier flies, being non-pathogenic and naturally occurring, show promise in reducing salmonella, viruses, and pharmaceutical substances in waste. Their application extends to the management of animal manure, reducing organic waste in public markets, and consequently prolonging landfill lifetimes. Furthermore, they aid in diminishing nitrogen and phosphorus levels in waste, thereby minimizing environmental pollution\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLimitations and challenges\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe existing market status of the product remains uncertain, necessitating a thorough assessment. Full implementation of source segregation is imperative. Exploration of potential regulations governing the products is essential. Continuous monitoring of environmental conditions and breeding parameters is a prerequisite. There is a demand for further research to ascertain market value and enhance production. The possibility of heavy metal accumulation in prepupae intended for animal feeding requires consideration, potentially involving a significant initial investment.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe black soldier fly (BSF) demonstrates adaptability to a wide range of environmental conditions, and the adult fly does not act as a disease vector. BSF larvae exhibit the ability to consume various organic materials, including the abundant organic wastes generated in urban areas. This consumption not only reduces waste volume but also allows the larvae to develop into a protein-rich biomass, leaving behind a nutrient-rich residue. The harvested larvae can be utilized in formulating feed for monogastric animals such as poultry, fish, and pigs. Due to their high-fat content, they may also be processed into high-quality biodiesel. The waste residue, in turn, has the potential to serve as a valuable soil conditioner. Consequently, BSF-based technology is considered one of the most promising methods for processing organic waste.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSS, SV \u0026amp; SAS - Wrote the manuscript. AAK - Designed the review article and helped with revisions of the article. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study reviewed the occurrence of the pest in a region that does not use any human and animal subjects and connotes no ethics approval.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBanks, Ian J, Walter T Gibson, and Mary M Cameron (2014). \u0026quot;Growth rates of black soldier fly larvae fed on fresh human faeces and their implication for improving sanitation.\u0026quot; \u003cem\u003eTropical\u0026nbsp;medicine\u0026nbsp;\u0026amp; international health,\u0026nbsp;\u003c/em\u003e19 \u003cstrong\u003e(1)\u003c/strong\u003e:14-22.\u003c/li\u003e\n \u003cli\u003eBarragan-Fonseca,\u0026nbsp;Karol\u0026nbsp;B,\u0026nbsp;Marcel\u0026nbsp;Dicke,\u0026nbsp;and\u0026nbsp;Joop\u0026nbsp;JA\u0026nbsp;van\u0026nbsp;Loon (2017).\u0026nbsp;\u0026quot;Nutritional\u0026nbsp;value\u0026nbsp;of\u0026nbsp;the\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;(\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e L.)\u0026nbsp;and\u0026nbsp;its\u0026nbsp;suitability\u0026nbsp;as\u0026nbsp;animal\u0026nbsp;feed\u0026ndash;a\u0026nbsp;review.\u0026quot;\u0026nbsp;\u003cem\u003eJournal\u0026nbsp;of Insects as Food and Feed\u0026nbsp;\u003c/em\u003e3 \u003cstrong\u003e(2)\u003c/strong\u003e:105-120.\u003c/li\u003e\n \u003cli\u003eBin\u0026nbsp;Kamari,\u0026nbsp;Azlan (2021).\u0026nbsp;Biodiesel\u0026nbsp;from\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;larvae\u0026nbsp;grown\u0026nbsp;on\u0026nbsp;restaurant\u0026nbsp;kitchen\u0026nbsp;waste.\u003c/li\u003e\n \u003cli\u003eCaruso, Domenico, Emilie Devic, I. W Subamia, Pascale Talamond, and Etienne Baras (2014).\u0026nbsp;Technical handbook of domestication and production of Diptera black soldier fly\u0026nbsp;(BSF),\u0026nbsp;\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e, Stratiomyidae.\u003c/li\u003e\n \u003cli\u003eCheng, J. Y. K., S. L. H. Chiu, and I. M. C. Lo (2017). Effects of moisture content of food\u0026nbsp;waste on residue separation, larval growth and larval survival in black soldier fly\u0026nbsp;bioconversion.\u0026quot;\u0026nbsp;\u003cem\u003eWaste Management\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e67\u003c/strong\u003e:315-323.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eDiener and Stefan (2010).\u0026nbsp;Valorisation\u0026nbsp;of\u0026nbsp;organic\u0026nbsp;solid\u0026nbsp;waste\u0026nbsp;using\u0026nbsp;the\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly,\u0026nbsp;\u003cem\u003eHermetia \u0026nbsp;illucens\u003c/em\u003e,\u0026nbsp;in low and middle-income\u0026nbsp;countries. ETH\u0026nbsp;Zurich.\u003c/li\u003e\n \u003cli\u003eDiener, Stefan, Christian Zurbr\u0026uuml;gg, and Klement Tockner. 2009. \u0026quot;Conversion of organic\u0026nbsp;material\u0026nbsp;by\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;larvae:\u0026nbsp;establishing\u0026nbsp;optimal\u0026nbsp;feeding\u0026nbsp;rates.\u0026quot;\u0026nbsp;\u003cem\u003eWaste\u0026nbsp;Management\u0026nbsp;\u0026amp; Research\u0026nbsp;\u003c/em\u003e27 \u003cstrong\u003e(6)\u003c/strong\u003e:603-610.\u003c/li\u003e\n \u003cli\u003eDzepe,\u0026nbsp;Daniel,\u0026nbsp;Paulin\u0026nbsp;Nana,\u0026nbsp;Herv\u0026eacute;\u0026nbsp;Mube\u0026nbsp;Kuietche,\u0026nbsp;Janaina\u0026nbsp;Mitsue\u0026nbsp;Kimpara,\u0026nbsp;Ornela\u0026nbsp;Magatsing, Timol\u0026eacute;on Tchuinkam, and Rousseau Djouaka (2021). Feeding strategies\u0026nbsp;for small-scale rearing black soldier fly larvae (I) as organic waste\u0026nbsp;recycler.\u0026quot;\u0026nbsp;\u003cem\u003eSN Applied Sciences\u0026nbsp;\u003c/em\u003e3 \u003cstrong\u003e(2)\u003c/strong\u003e:1-9.\u003c/li\u003e\n \u003cli\u003eEgnew, Nathan, Nicholas Romano, Hayden Fischer, and Amit Kumar Sinha (2021). Purging\u0026nbsp;black solider fly larvae (\u003cem\u003eHermetia illucens\u003c/em\u003e) compromises their nutritive value as a\u0026nbsp;feedstuff. \u0026nbsp;\u003cem\u003eInternational\u0026nbsp;Journal of Tropical Insect Science\u003c/em\u003e. 1-8.\u003c/li\u003e\n \u003cli\u003eElsayed, Mahdy, Yi Ran, Ping Ai, Maha Azab, Abdelaziz Mansour, Keda Jin, Yanlin Zhang,\u0026nbsp;and\u0026nbsp;Abd\u0026nbsp;El-Fatah\u0026nbsp;Abomohra (2020).\u0026nbsp;Innovative\u0026nbsp;integrated\u0026nbsp;approach\u0026nbsp;of\u0026nbsp;biofuel\u0026nbsp;production\u0026nbsp;from\u0026nbsp;agricultural\u0026nbsp;wastes\u0026nbsp;by\u0026nbsp;anaerobic\u0026nbsp;digestion\u0026nbsp;and\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;larvae.\u0026nbsp;\u003cem\u003eJournal of cleaner production.\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e263\u003c/strong\u003e:121495.\u003c/li\u003e\n \u003cli\u003eFischer, H, and N Romano (2021). Fruit, vegetable, and starch mixtures on the nutritional\u0026nbsp;quality of black soldier fly (\u003cem\u003eHermetia illucens\u003c/em\u003e) larvae and resulting frass.\u0026nbsp;\u003cem\u003eJournal of\u0026nbsp;Insects\u0026nbsp;as Food and Feed\u0026nbsp;\u003c/em\u003e7 \u003cstrong\u003e(3\u003c/strong\u003e):319-327.\u003c/li\u003e\n \u003cli\u003eGold, Moritz, Cecille Marie Cassar, Christian Zurbrugg, Michael Kreuzer, Samy Boulos,\u0026nbsp;Stefan\u0026nbsp;Diener,\u0026nbsp;and\u0026nbsp;Alexander\u0026nbsp;Mathys (2020).\u0026nbsp;Biowaste\u0026nbsp;treatment\u0026nbsp;with\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;larvae: increasing performance through the formulation of biowastes based on protein\u0026nbsp;and\u0026nbsp;carbohydrates.\u0026nbsp;\u003cem\u003eWaste Management.\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e102\u003c/strong\u003e:319-329.\u003c/li\u003e\n \u003cli\u003eGold,\u0026nbsp;Moritz,\u0026nbsp;Jeffery\u0026nbsp;K\u0026nbsp;Tomberlin,\u0026nbsp;Stefan\u0026nbsp;Diener,\u0026nbsp;Christian\u0026nbsp;Zurbrugg,\u0026nbsp;and\u0026nbsp;Alexander\u0026nbsp;Mathys.\u0026nbsp;2018. \u0026quot;Decomposition of biowaste macronutrients, microbes, and chemicals in black\u0026nbsp;soldier\u0026nbsp;fly larval\u0026nbsp;treatment: A\u0026nbsp;review.\u0026quot;\u0026nbsp;\u003cem\u003eWaste Management.\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e82\u003c/strong\u003e:302-318.\u003c/li\u003e\n \u003cli\u003eIrawan, Andri Cahya, Dewi Apri Astuti, I Wayan Teguh Wibawan, Widya Hermana, and\u0026nbsp;Departemen\u0026nbsp;Teknologi\u0026nbsp;Nutrisi\u0026nbsp;dan\u0026nbsp;Makanan (2020).\u0026nbsp;Supplementation\u0026nbsp;of\u0026nbsp;black\u0026nbsp;soldier fly (\u003cem\u003eHermetia illucens\u003c/em\u003e) on productivity and blood hematology.\u0026quot;\u0026nbsp;\u003cem\u003eJurnal Ilmu-Ilmu\u0026nbsp;Peternakan\u0026nbsp;\u003c/em\u003e30 \u003cstrong\u003e(1)\u003c/strong\u003e:50-68.\u003c/li\u003e\n \u003cli\u003eJucker, Costanza, Daniela Lupi, Christopher Douglas Moore, Maria Giovanna Leonardi, and\u0026nbsp;Sara Savoldelli (2020). Nutrient recapture from insect farm waste: bioconversion with\u0026nbsp;\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e L. (Diptera:\u0026nbsp;Stratiomyidae).\u0026nbsp;\u003cem\u003eSustainability\u0026nbsp;\u003c/em\u003e12\u0026nbsp;\u003cstrong\u003e(1)\u003c/strong\u003e:362.\u003c/li\u003e\n \u003cli\u003eKaza, S., Yao, L., Bhada-Tata, P. and Van Woerden, F. (2018). \u003cem\u003eWhat a waste 2.0: a global snapshot of solid waste management to 2050\u003c/em\u003e. World Bank Publications.\u003c/li\u003e\n \u003cli\u003eKim,\u0026nbsp;Yoo\u0026nbsp;Bhin,\u0026nbsp;Da-Hye\u0026nbsp;Kim,\u0026nbsp;Su-Been\u0026nbsp;Jeong,\u0026nbsp;Jeong-Woo\u0026nbsp;Lee,\u0026nbsp;Tae-Hoon\u0026nbsp;Kim,\u0026nbsp;Hong-Gu\u0026nbsp;Lee,\u0026nbsp;and Kyung-Woo Lee (2020). Black soldier fly larvae oil as an alternative fat source in\u0026nbsp;broiler\u0026nbsp;nutrition.\u0026nbsp;\u003cem\u003ePoultry\u0026nbsp;Science. \u0026nbsp;\u003c/em\u003e99 \u003cstrong\u003e(6)\u003c/strong\u003e:3133-3143.\u003c/li\u003e\n \u003cli\u003eKlammsteiner,\u0026nbsp;Thomas,\u0026nbsp;Andreas\u0026nbsp;Walter,\u0026nbsp;Tajda\u0026nbsp;Bogataj,\u0026nbsp;Carina\u0026nbsp;D\u0026nbsp;Heussler,\u0026nbsp;Blaž\u0026nbsp;Stres,\u0026nbsp;Florian\u0026nbsp;M Steiner, Birgit C Schlick-Steiner, Wolfgang Arthofer, and Heribert Insam (2020).\u0026nbsp;The\u0026nbsp;core\u0026nbsp;gut\u0026nbsp;microbiome\u0026nbsp;of\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;(\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e)\u0026nbsp;larvae\u0026nbsp;raised\u0026nbsp;on\u0026nbsp;low-\u0026nbsp;bioburden\u0026nbsp;diets.\u0026quot;\u0026nbsp;\u003cem\u003eFrontiers in Microbiology.\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e:993.\u003c/li\u003e\n \u003cli\u003eKumar, Akhilesh, and Avlokita Agrawal (2020). Recent trends in solid waste management\u0026nbsp;status,\u0026nbsp;challenges,\u0026nbsp;and\u0026nbsp;potential\u0026nbsp;for\u0026nbsp;the\u0026nbsp;future\u0026nbsp;Indian\u0026nbsp;cities\u0026ndash;A\u0026nbsp;review.\u0026nbsp;\u003cem\u003eCurrent\u0026nbsp;Research\u0026nbsp;in Environmental Sustainability. \u0026nbsp;\u003c/em\u003e\u003cstrong\u003e2\u003c/strong\u003e:1011.\u003c/li\u003e\n \u003cli\u003eKumar, Sunil, Stephen R Smith, Geoff Fowler, Costas Velis, S Jyoti Kumar, Shashi Arya,\u0026nbsp;Rena,\u0026nbsp;Rakesh\u0026nbsp;Kumar,\u0026nbsp;and\u0026nbsp;Christopher\u0026nbsp;Cheeseman (2017).\u0026nbsp;Challenges\u0026nbsp;and\u0026nbsp;opportunities\u0026nbsp;associated\u0026nbsp;with\u0026nbsp;waste\u0026nbsp;management\u0026nbsp;in\u0026nbsp;India.\u0026nbsp;\u003cem\u003eRoyal\u0026nbsp;Society\u0026nbsp;open\u0026nbsp;science\u0026nbsp;\u003c/em\u003e4\u0026nbsp;\u003cstrong\u003e(3)\u003c/strong\u003e:160764.\u003c/li\u003e\n \u003cli\u003eLalander, C, S Diener, C Zurbr\u0026uuml;gg, and B Vinneras (2019). Effects of feedstock on larval\u0026nbsp;development\u0026nbsp;and\u0026nbsp;process\u0026nbsp;efficiency\u0026nbsp;in\u0026nbsp;waste\u0026nbsp;treatment\u0026nbsp;with\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;(\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e).\u0026quot;\u0026nbsp;\u003cem\u003eJournal of cleaner production\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e208\u003c/strong\u003e:211-219.\u003c/li\u003e\n \u003cli\u003eLalander, Cecilia, Evgheni Ermolaev, Viktoria Wiklicky, and Bj\u0026ouml;rn Vinneras (2020). Process\u0026nbsp;efficiency\u0026nbsp;and\u0026nbsp;ventilation\u0026nbsp;requirement\u0026nbsp;in\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;larvae\u0026nbsp;composting\u0026nbsp;of\u0026nbsp;substrates\u0026nbsp;with\u0026nbsp;high water\u0026nbsp;content.\u0026nbsp;\u003cem\u003eScience\u0026nbsp;of\u0026nbsp;The\u0026nbsp;Total\u0026nbsp;Environment\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e729\u003c/strong\u003e:1389.\u003c/li\u003e\n \u003cli\u003eLi, Yanxian, Trond M Kortner, Elvis M Chikwati, Ikram Belghit, Erik-Jan Lock, and \u0026Aring;shild\u0026nbsp;Krogdahl (2020). Total replacement of fish meal with black soldier fly (\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e) larvae meal does not compromise the gut health of Atlantic salmon (Salmo\u0026nbsp;salar).\u0026nbsp;\u003cem\u003eAquaculture\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e520\u003c/strong\u003e:734967.\u003c/li\u003e\n \u003cli\u003eLiland, Nina S, Irene Biancarosa, Pedro Araujo, Daan Biemans, Christian G Bruckner, Rune\u0026nbsp;Waagb\u0026oslash;,\u0026nbsp;Bente\u0026nbsp;E\u0026nbsp;Torstensen,\u0026nbsp;and\u0026nbsp;Erik-Jan\u0026nbsp;Lock (2017).\u0026nbsp;Modulation\u0026nbsp;of\u0026nbsp;nutrient\u0026nbsp;composition\u0026nbsp;of\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;(\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e)\u0026nbsp;larvae\u0026nbsp;by\u0026nbsp;feeding\u0026nbsp;seaweed-\u0026nbsp;enriched\u0026nbsp;media.\u0026quot;\u0026nbsp;\u003cem\u003ePLoS One\u0026nbsp;\u003c/em\u003e12 \u003cstrong\u003e(8)\u003c/strong\u003e: 0183188.\u003c/li\u003e\n \u003cli\u003eLiu, Xiu, Xuan Chen, Hui Wang, Qinqin Yang, Kashif ur Rehman, Wu Li, Minmin Cai, Qing\u0026nbsp;Li,\u0026nbsp;Lorenzo\u0026nbsp;Mazza,\u0026nbsp;and\u0026nbsp;Jibin\u0026nbsp;Zhang (2017).\u0026nbsp;Dynamic\u0026nbsp;changes\u0026nbsp;of\u0026nbsp;nutrient\u0026nbsp;composition\u0026nbsp;throughout\u0026nbsp;the\u0026nbsp;entire\u0026nbsp;life cycle of\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly.\u0026nbsp;\u003cem\u003ePLoS One\u0026nbsp;\u003c/em\u003e12 \u003cstrong\u003e(8)\u003c/strong\u003e: 0182601.\u003c/li\u003e\n \u003cli\u003eLohri,\u0026nbsp;Christian\u0026nbsp;Riuji,\u0026nbsp;Stefan\u0026nbsp;Diener,\u0026nbsp;Imanol\u0026nbsp;Zabaleta,\u0026nbsp;Adeline\u0026nbsp;Mertenat,\u0026nbsp;and\u0026nbsp;Christian\u0026nbsp;Zurbr\u0026uuml;gg (2017). Treatment technologies for urban solid biowaste to create value\u0026nbsp;products:\u0026nbsp;a\u0026nbsp;review\u0026nbsp;with\u0026nbsp;focus\u0026nbsp;on\u0026nbsp;low-and\u0026nbsp;middle-income\u0026nbsp;settings.\u0026nbsp;\u003cem\u003eReviews\u0026nbsp;in\u0026nbsp;Environmental\u0026nbsp;Science\u0026nbsp;and Bio Technology\u0026nbsp;\u003c/em\u003e16 \u003cstrong\u003e(1)\u003c/strong\u003e:81-130.\u003c/li\u003e\n \u003cli\u003eMakkar, Harinder PS, Gilles Tran, Val\u0026eacute;rie Heuz\u0026eacute;, and Philippe Ankers (2014). State-of-the-\u0026nbsp;art\u0026nbsp;on\u0026nbsp;use\u0026nbsp;of\u0026nbsp;insects\u0026nbsp;as animal\u0026nbsp;feed.\u0026nbsp;\u003cem\u003eAnimal\u0026nbsp;Feed\u0026nbsp;Science\u0026nbsp;and Technology\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e197\u003c/strong\u003e:1-33.\u003c/li\u003e\n \u003cli\u003eMarco, A, Remondah R Ramzy, and Hong Ji (2021). Influence of substrate inclusion of quail\u0026nbsp;manure on the growth performance, body composition, fatty acid and amino acid\u0026nbsp;profiles\u0026nbsp;of\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;larvae\u0026nbsp;(\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e).\u0026nbsp;\u003cem\u003eScience\u0026nbsp;of\u0026nbsp;The\u0026nbsp;Total\u0026nbsp;Environment. \u0026nbsp;\u003c/em\u003e\u003cstrong\u003e772\u003c/strong\u003e:145528.\u003c/li\u003e\n \u003cli\u003eMeneguz, M., Schiavone, A., Gai, F., Dama, A., Lussiana, C., Renna, M. and Gasco, L. (2018). Effect of rearing substrate on growth performance, waste reduction efficiency and chemical composition of black soldier fly (Hermetia illucens) larvae. \u003cem\u003eJournal of the Science of Food and Agriculture\u003c/em\u003e, 98\u003cstrong\u003e(15)\u003c/strong\u003e: 5776-5784.\u003c/li\u003e\n \u003cli\u003eMyers,\u0026nbsp;Heidi\u0026nbsp;M,\u0026nbsp;Jeffery\u0026nbsp;K\u0026nbsp;Tomberlin,\u0026nbsp;Barry\u0026nbsp;D\u0026nbsp;Lambert,\u0026nbsp;and\u0026nbsp;David\u0026nbsp;Kattes (2014).\u0026nbsp;\u0026quot;Development of black soldier fly (Diptera: Stratiomyidae) larvae fed dairy manure.\u0026quot;\u0026nbsp;\u003cem\u003eEnvironmental\u0026nbsp;entomology\u0026nbsp;\u003c/em\u003e37 \u003cstrong\u003e(1)\u003c/strong\u003e:11-15.\u003c/li\u003e\n \u003cli\u003eNewton, G.L., Sheppard, D.C., Watson, D, W., Burtle, G, J., Dove, C, R., Tomberlin, J, K. and Thelen, E, E. (2005). The black soldier fly \u003cem\u003eHermetia illucens\u003c/em\u003e L, as a manure management/resource recovery tool In. Symposium on the state of science of animal manure and waste management, (ed.), Nowak, P. San Antonio, Texas.\u003c/li\u003e\n \u003cli\u003eNguyen, T. T., Tomberlin, J. K. and Vanlaerhoven, S. (2015). Ability of black soldier fly (Diptera: Stratiomyidae) larvae to recycle food waste. \u003cem\u003eEnvironmental entomology\u003c/em\u003e, 44\u003cstrong\u003e(2)\u003c/strong\u003e: 406-410.\u003c/li\u003e\n \u003cli\u003ePang, Wancheng, Dejia Hou, Jingwen Ke, Jiangshan Chen, Mark T Holtzapple, Jeffery K\u0026nbsp;Tomberlin, Huanchun Chen, Jibin Zhang, and Qing Li (2020). Production of biodiesel\u0026nbsp;from CO2 and organic wastes by fermentation and black soldier fly.\u0026nbsp;\u003cem\u003eRenewable\u0026nbsp;Energy. \u0026nbsp;\u003c/em\u003e\u003cstrong\u003e149\u003c/strong\u003e:1174-1181.\u003c/li\u003e\n \u003cli\u003ePaz,\u0026nbsp;Angela\u0026nbsp;Sof\u0026iacute;a\u0026nbsp;Parra,\u0026nbsp;Nancy\u0026nbsp;Soraya\u0026nbsp;Carrejo,\u0026nbsp;and\u0026nbsp;Carlos\u0026nbsp;Humberto\u0026nbsp;G\u0026oacute;mez\u0026nbsp;Rodr\u0026iacute;guez.\u0026nbsp;(2015).\u0026nbsp; Effects of larval density and feeding rates on the bioconversion of vegetable waste\u0026nbsp;using black soldier fly larvae \u003cem\u003eHermetia illucens\u003c/em\u003e L. (Diptera: Stratiomyidae).\u0026quot;\u0026nbsp;\u003cem\u003eWaste\u0026nbsp;and\u0026nbsp;biomass valorization.\u0026nbsp;\u003c/em\u003e6 \u003cstrong\u003e(6)\u003c/strong\u003e:1059-1065.\u003c/li\u003e\n \u003cli\u003eRaksasat, Ratchaprapa, Kunlanan Kiatkittipong, Worapon Kiatkittipong, Chung Yiin Wong,\u0026nbsp;Man Kee Lam, Yeek Chia Ho, Wen Da Oh, I Suryawan, and Jun Wei Lim (2021).\u0026nbsp;Blended Sewage Sludge\u0026ndash;Palm Kernel Expeller to Enhance the Palatability of Black\u0026nbsp;Soldier\u0026nbsp;Fly Larvae\u0026nbsp;for\u0026nbsp;Biodiesel Production.\u0026nbsp;\u003cem\u003eProcesses.\u0026nbsp;\u003c/em\u003e9 \u003cstrong\u003e(2)\u003c/strong\u003e:297.\u003c/li\u003e\n \u003cli\u003eSaragi, E. S. and Bagastyo, A. Y. (2015, November). Reduction of organic solid waste by black soldier fly (Hermetia illucens) larvae. In \u003cem\u003eThe 5th Environmental Technology and Management Conference \u0026ldquo;Green Technology towards Sustainable Environment\u0026rdquo; November\u003c/em\u003e (Vol. 23, No. 24, p. 2015).\u003c/li\u003e\n \u003cli\u003eShelomi, M. (2020). Nutrient composition of black soldier fly (Hermetia illucens). \u003cem\u003eAfrican edible insects as alternative source of food, oil, protein and bioactive components\u003c/em\u003e, 195-212.\u003c/li\u003e\n \u003cli\u003eSheppard,\u0026nbsp;D\u0026nbsp;Craig,\u0026nbsp;Jeffery\u0026nbsp;K\u0026nbsp;Tomberlin,\u0026nbsp;John\u0026nbsp;A\u0026nbsp;Joyce,\u0026nbsp;Barbara\u0026nbsp;C\u0026nbsp;Kiser,\u0026nbsp;and\u0026nbsp;Sonya\u0026nbsp;M\u0026nbsp;Sumner.\u0026nbsp;( \u0026nbsp; \u0026nbsp; \u0026nbsp;2002).\u0026nbsp; Rearing\u0026nbsp;methods\u0026nbsp;for\u0026nbsp;the\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;(Diptera:\u0026nbsp;Stratiomyidae).\u0026quot;\u0026nbsp;\u003cem\u003eJournal\u0026nbsp;of\u0026nbsp;medical\u0026nbsp;entomology\u0026nbsp;\u003c/em\u003e39 \u003cstrong\u003e(4)\u003c/strong\u003e:695-698.\u003c/li\u003e\n \u003cli\u003eSingh,\u0026nbsp;Anshika,\u0026nbsp;and\u0026nbsp;Kanchan\u0026nbsp;Kumari (2019).\u0026nbsp;An\u0026nbsp;inclusive\u0026nbsp;approach\u0026nbsp;for\u0026nbsp;organic\u0026nbsp;waste\u0026nbsp;treatment and valorisation using Black Soldier Fly larvae: A review.\u0026nbsp;\u003cem\u003eJournal of\u0026nbsp;environmental\u0026nbsp;management\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e251\u003c/strong\u003e:109569.\u003c/li\u003e\n \u003cli\u003eSpranghers, Thomas, Matteo Ottoboni, Cindy Klootwijk, Anneke Ovyn, Stefaan Deboosere,\u0026nbsp;Bruno\u0026nbsp;De\u0026nbsp;Meulenaer,\u0026nbsp;Joris\u0026nbsp;Michiels,\u0026nbsp;Mia\u0026nbsp;Eeckhout,\u0026nbsp;Patrick\u0026nbsp;De\u0026nbsp;Clercq,\u0026nbsp;and\u0026nbsp;Stefaan\u0026nbsp;De\u0026nbsp;Smet (2017).\u0026nbsp;Nutritional\u0026nbsp;composition\u0026nbsp;of\u0026nbsp;black\u0026nbsp;soldier\u0026nbsp;fly\u0026nbsp;(\u003cem\u003eHermetia\u0026nbsp;illucens\u003c/em\u003e)\u0026nbsp;prepupae\u0026nbsp;reared on different organic waste substrates.\u0026nbsp;\u003cem\u003eJournal of the Science of Food and\u0026nbsp;Agriculture.\u0026nbsp;\u003c/em\u003e97 \u003cstrong\u003e(8)\u003c/strong\u003e:2594-2600.\u003c/li\u003e\n \u003cli\u003eTomberlin, J. K., Sheppard, D. C. and Joyce, J. A. (2002). Susceptibility of black soldier fly (Diptera: Stratiomyidae) larvae and adults to four insecticides. \u003cem\u003eJournal of economic entomology\u003c/em\u003e,\u0026nbsp;95(\u003cstrong\u003e3)\u003c/strong\u003e: 598-602.\u003c/li\u003e\n \u003cli\u003eWang, Huarui, Kashif ur Rehman, Weijian Feng, Dan Yang, Rashid ur Rehman, Minmin Cai,\u0026nbsp;Jibin Zhang, Ziniu Yu, and Longyu Zheng (2020). Physicochemical structure of chitin\u0026nbsp;in the developing stages of black soldier fly.\u0026nbsp;\u003cem\u003eInternational journal of biological\u0026nbsp;macromolecules.\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e149\u003c/strong\u003e:901-907.\u003c/li\u003e\n \u003cli\u003eWong, Chung Yiin, Kunlanan Kiatkittipong, Worapon Kiatkittipong, Seteno Ntwampe,\u0026nbsp;Man Kee Lam, Pei Sean Goh, Chin Kui Cheng, Mohammed JK Bashir, and Jun Wei\u0026nbsp;Lim (2021). Black Soldier Fly Larval Valorization Benefitting from Ex-Situ Fungal\u0026nbsp;Fermentation\u0026nbsp;in Reducing\u0026nbsp;Coconut Endosperm\u0026nbsp;Waste.\u0026nbsp;\u003cem\u003eProcesses\u0026nbsp;\u003c/em\u003e9\u0026nbsp;\u003cstrong\u003e(2)\u003c/strong\u003e:275.\u003c/li\u003e\n \u003cli\u003eXiao, X., Jin, P., Zheng, L., Cai, M., Yu, Z., Yu, J. and Zhang, J. (2018). Effects of black soldier fly (Hermetia illucens) larvae meal protein as a fishmeal replacement on the growth and immune index of yellow catfish (Pelteobagrus fulvidraco). \u003cem\u003eAquaculture research\u003c/em\u003e, 49\u003cstrong\u003e(4)\u003c/strong\u003e:1569-1577.\u003c/li\u003e\n \u003cli\u003eZhang, J. B., J. K. Tomberlin, M.M. Cai, X.P. Xiao, L.Y. Zheng and Z.N. Yu (2020). Research and\u0026nbsp;industrialisation of \u003cem\u003eHermetia illucens\u003c/em\u003e L. in China.\u0026nbsp;\u003cem\u003eJournal of Insects as Food and\u0026nbsp;Feed\u0026nbsp;\u003c/em\u003e6 \u003cstrong\u003e(1)\u003c/strong\u003e:5-12.\u003c/li\u003e\n \u003cli\u003eZurbr\u0026uuml;gg, C., Dortmans, B., Fadhila, A., Verstappen, B. and Diener, S. (2018). From pilot to full scale operation of a waste-to-protein treatment facility. \u003cem\u003eDetritus\u003c/em\u003e, 1\u003cstrong\u003e(0)\u003c/strong\u003e: 18-22.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Black soldier fly, Population growth, Solid waste management, Fertilizer, Biodiesel","lastPublishedDoi":"10.21203/rs.3.rs-3957149/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3957149/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe rapid urbanization, demographic shifts, and consumer behavior that have resulted in the sector's negative social, economic, and environmental impacts have not only captured the public's attention but also presented municipalities and decision-makers, as well as the general public, with new obstacles to overcome to manage the sector in a way that is both environmentally responsible and economically viable (Diener, 2010). A higher level of life is required due to population growth at such a rapid rate, which greatly increases the production of solid waste, either directly or indirectly. Urban development, economic expansion, and a system's effectiveness in collecting and treating trash are the main determinants of the volume and complexity of waste produced. According to Kaza et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), global garbage production is predicted to rise from 2\u0026nbsp;billion tonnes in 2016 to 3.4\u0026nbsp;billion tonnes in 2050, with Asian and African nations making up the majority of the increase. Inadequate management of organic waste is one of the biggest issues in emerging nations, which could have catastrophic effects on both the environment and anthropogenic activity. Composting is a tried-and-true method for handling organic waste that can drastically cut down on trash generation. The efficacy of composting can be enhanced by the conversion of organic waste using saprophage (CORS) systems, which feed organisms (saprophages) with decomposing organic waste. As organic waste converters, the \u003cem\u003eHermetia illucens\u003c/em\u003e Linnaeus (Diptera: Stratiomyidae) black soldier fly (BSF) has been introduced. Researchers have concentrated on a BSF-based technique for treating organic waste that is very new (Zurbrugg \u003cem\u003eet al\u003c/em\u003e., 2018). BSF larvae (BSFL) eat organic-rich waste such as food scraps, agro-industrial byproducts, and dairy manure voraciously (Nguyen et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Meneguz et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). As a result, the nutrients in BSFL can be transformed into crucial proteins and lipids needed in animal feed (Liu et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), filling the gap left by the scarcity of conventional animal feed, whose cost has been rising over time. The waste from the BSFL bioconversion process can also be applied as fertilizer (Xiao et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e","manuscriptTitle":"The Enigmatic Journey of Black Soldier Fly: Revolutionizing Solid Waste Management","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-17 04:22:35","doi":"10.21203/rs.3.rs-3957149/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvited","content":"International Journal of Tropical Insect Science","date":"2024-10-31T17:49:02+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-18T22:47:27+00:00","index":"","fulltext":""},{"type":"submitted","content":"International Journal of Tropical Insect Science","date":"2024-02-13T23:52:51+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-tropical-insect-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtis","sideBox":"Learn more about [International Journal of Tropical Insect Science](http://link.springer.com/journal/42690)","snPcode":"42690","submissionUrl":"https://www.editorialmanager.com/jtis/default2.aspx","title":"International Journal of Tropical Insect Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"79eb861c-87fb-45fe-b0d6-4bb041e603f3","owner":[],"postedDate":"July 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-07-17T04:22:35+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-17 04:22:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3957149","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3957149","identity":"rs-3957149","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00