Analysis of proteoglycan 4 mRNA expression on pain improvement and functional ability in knee osteoarthritis patients after high-intensity laser administration | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Analysis of proteoglycan 4 mRNA expression on pain improvement and functional ability in knee osteoarthritis patients after high-intensity laser administration Mohammad Adib Khumaidi, Idrus Andi Paturusi, Andi Asadul Islam, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7226444/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Knee osteoarthritis (KOA) is the most common type of arthritis and is the main cause of chronic musculoskeletal pain. High-intensity laser therapy (HILT) is a potential method for the management of KOA. This study aims to determine the PRG4 mRNA expression in patients with KOA by administering HILT to observe the changes in the PRG4 gene expression and followed by clinically assessing the pain and functional ability. Methods This study was a quasi-experimental research with pre- and post-intervention group designs. A total of 60 patients (aged 45–65 years) diagnosed with KOA based on the criteria of the American College of Rheumatology (clinical and radiologist) and the Kellgren-Lawrence II criterion were involved in the study. The samples were divided into two groups, the intervention group (30 patients) and the control group (30 patients). In the intervention group, each patient was given HILT (using BTL-6000) with biostimulation mode on the lateral and medial sides of the knee for 10 minutes. Therapy was carried out twice a week for a total of 7 times. Results There was an increase in mRNA expression of the PRG4 gene which occurred significantly higher in the intervention group. Similarly, for pain, a significant decrease in pain scores was obtained in both subject groups (p < 0.001). Functional abilities covering aspects of pain, stiffness, and physical function also improved significantly in both groups after one month (p < 0.001), with better improvements in the group of subjects who received HILT with an average of 4.33 (p < 0.001). Conclusions This study showed that HILT can reduce the pain of grade II KOA based on Kellgren-Lawrence, improving the functional ability of KOA patients. HILT also significantly improves the expression of the proteoglycan mRNA (PRG4) gene. Finally, HILT can be the method of choice in the treatment of osteoarthritis. osteoarthritis knee osteoarthritis High-intensity laser therapy PRG4 gene proteoglycan 4 pain improvement functional ability physical function Figures Figure 1 Introduction Osteoarthritis (OA) is the most common type of disease of arthritis and the leading cause of chronic musculoskeletal pain, especially in the elderly ( 1 ). OA is often called a degenerative disease of the joints ( 1 ). One of the most occurring OA is knee OA (KOA) since the knee is the largest synovial joint in humans that is frequently affected by painful conditions ( 2 ). KOA condition is linked to inflammation that causes pain, functional limitations, and a decreased quality of life ( 3 ). On the other hand, pain has also been linked to increased inflammatory activity, albeit the strength of the association varies ( 4 ). Furthermore, in the pathogenesis of KOA, inflammation is associated with the downregulation of proteoglycan-4 (PRG4), a protective glycoprotein and biomarker of cartilage degradation ( 5 ). In Indonesia in 2013, the prevalence of KOA was 5% at the age of 60 years ( 6 , 7 ). Laser therapy is one of the non-invasive, painless therapies that can be easily administered and significantly reduces acute as well as chronic pain ( 8 ). Previously, low-level laser therapy (LLLT) was a widely known treatment for KOA and has been carried out in many studies ( 9 , 10 ). A relatively new method of physical therapy application today is high-intensity laser therapy (HILT), which differs in mechanism and action compared to LLLT ( 11 ). LLLT is commonly known as a 'cold laser', it has very low power and for that reason does not generate heat on the skin. In contrast to LLT, HILT is known as a 'heat laser' and is 100 times more powerful than LLLT. HILT can reach and stimulate large and/or deep joints which is difficult to reach with LLLT ( 11 , 12 ). In recent years, modern medical rehabilitation therapy techniques, especially the use of HILT, have been applied in medical practice, especially KOA management ( 13 ). HILT has been considered effective in reducing pain and improving function ( 14 ). However, until now, the research on the use of HILT in KOA patients in Indonesia is still limited. To the best of our knowledge, no research has determined the effect of HILT on the expression of PRG4, which is supposedly decreased due to KOA. Therefore, this study was intrigued to determine how HILT affects the mRNA PRG4 gene expression and its implication on pain and functional ability of KOA patients in Orthopaedic and Medical Rehabilitation Polyclinic of Cengkareng Hospital, West Jakarta, which are measured by Numeric Pain Rating Scale (NPRS) and Western Ontario and McMaster Universities Arthritis Index (WOMAC) ( 15 ). Methods Participants This research was an experimental study with KOA patients in the Orthopaedic Polyclinic and Medical Rehabilitation Polyclinic of Cengkareng Hospital, West Jakarta as its subjects. The study was conducted from October to November 2022. The patients were given verbal and written information regarding the offer to become the subjects of study. The sample size was estimated as follows. With a ratio of 1:1 between the sample sizes of the two groups, it was calculated that the high-intensity laser intervention's efficacy was 90% and the control group's effectiveness was 50%. We obtained a minimum sample size of 20 patients for each group, using a 95% confidence level (P > 0.05) and an 80% power. Three more individuals were added to each group, bringing the sample size to a minimum of 23 per treatment because losses were predicted to be 15% of the total. The subjects were chosen based on consecutive sampling and those who fulfilled the inclusion criteria. The inclusion criteria are as follows: (i) subjects diagnosed with unilateral or bilateral degree II Kellgren Lawrence KOA, (ii) 45–65 years old, and (iii) be able to understand the provided inspection instructions and sign the informed consent. The exclusion criteria are as follows: (i) suffer from other knee joint diseases besides OA (gout and pseudogout, rheumatic arthritis, reactive arthritis), (ii) have severe comorbid systemic diseases, such as congestive heart failure or using a pacemaker, kidney failure (acute or chronic renal failure), uncontrolled diabetes mellitus with neurological disorders, uncontrolled hypertension (TD > 160/100 mmHg), (iii) showed contraindications of HILT, namely psychological diseases, pregnancy, photosensitivity, bleeding disorders in the area to be treated, history of cancer, febrile conditions, epilepsy, and (iv) receiving treatment with other pharmacological or nonpharmacological therapies for the past 2 weeks (e.g. oral or parenteral NSAIDs, opioids, oral corticosteroids or injections), except the use of paracetamol for standard pain therapy. Lastly, the dropout criteria were as follows: (i) patients do not follow the full research program and do not adhere to the therapy schedule, (ii) patients who experience skin reactions after being treated, and (iii) the patient decides he does not want to continue participating in the study. In conducting the study we collected a total sampling of 30 for each group. Ethical considerations Before conducting the study, the researcher applied for ethical clearance and approval on January 31st, 2023 from the Ethics Commission of the Faculty of Medicine, Hasanuddin University (No. 77/UN4.6.4.5.31/PP36/2023) and the trials registry number UH23010004 in Hasanuddin University Hospital Health Research Trial Committee (January 31st, 2023) . Approval for participation in this study was then submitted to patients and families in the form of informed consent. All costs used for this study were funded by the researcher himself, and the respondent was not burdened with any additional costs. The confidentiality of the data is guaranteed. Procedure BTL High-Intensity Laser Machine (BTL-6000, Indonesia), Numeric Pain Rating Scale (NPRS) form ( 16 ), and WOMAC form ( 17 ) were utilized for this study. The subjects of this study were divided into two groups, control (n = 30; receiving analgesic only) and treatment (n = 30; receiving analgesic + HILT) groups. The participants were assigned to each group in a randomized manner. A venipuncture was performed on each patient before and after receiving the entire HILT intervention using a 10 mL syringe. Body weight is measured by body scales and recorded in units of kilogram (kg). The patient wears thin clothing during the measurement of weight gain and removing used footwear; while height is measured using a tape measure and recorded in units centimeters (cm). The body mass index (BMI) is derived from weight and height. The biostimulation effect was given as HILT on the lateral and medial sides of the knee with an energy density (dose) of 120 J/cm 2 and treatment area of 25 cm 2 with an administration time of 10 minutes. The treatment was carried out 2 times per week with 7 sessions of administration. Data was collected through anamnesis and physical check-ups with the patients to fill in the NPRS and WOMAC forms. The practitioners collecting the data were isolated from the information regarding the assignment to intervention. Outcomes Biomedical analysis The mRNA expression of the PRG4 gene and the degree of pain and physical function were evaluated before and after the HILT. Measurement of mRNA expression of the blood PRG-4 refers to previous research ( 18 ). The primer used in this study were PRG4 human forward primer (TCCCATGCTTTCCGATGAGAC) and PRG4 reverse (ATTCTGCGAGGAGGAGATGG) while the amplification utilized specific oligonucleotide primers such as GAPDH primer (CACCATCTTCCAGGAGCGAG), and GAPDH reverse (GACTCCACGACGTACTCAGC) (Macrogen Inc, Seoul, Korea). The qPCR condition started with an initial reverse transcriptase temperature of 51 o C for 30 minutes and continued with PCR activation with a temperature of 95 o C for 6 minutes, followed by a temperature of 95 o C for 20 seconds and 58 o C for 60 seconds for 40 cycles. qRT PCR uses a one-stage SYBR Green qRT-PCR Master Mix Kit and is paired with Bio-Rad Thermal Cyclers (PTC Tempo Thermal Cycler, Bio-Rad, USA). This protocol is optimized for real-time PCR CFX Connect System (USA) instruments with Ct values of 35. Furthermore, an experimental reaction was prepared by preparing a reagent mixture by taking a final volume of 25 µL including sample mRNA extracted as per the protocols of Hatta et al., 2017 ( 19 ). A total of 12.5 µL of SYBR Green QRT-PCR Master Mix was added with initial primer (concentration optimized), PCR-free nuclease (concentration optimized), 0.375 µL of reference dye solution from stage 1 (optional), as well as 1 µL of block enzyme mixture with 25 µL of total reaction volume. The reaction is mixed slowly so that bubbles do not form (not rotated), then distribute the mixture to the test tube by adding 0.5 µg of experimental RNA to each test tube. The reaction is concisely centrifuged (Hettich EBA200) at 1500x g for 1 minute and the reaction is placed in an instrument and the PCR program is ready to run using a Real-Time PCR Machine (CFX Connect system, Biorad Laboratories, Real-Time PCR 96 Well 0.1 mL, USA). Data management and analysis The Statistical Program for Social Science (SPSS) version 25 was used to analyze the data. Patient characteristics were analyzed descriptively while the normality of the data was determined using the Shapiro-Wilk test. The inferential or comparative analysis between groups pre- and post-intervention utilized paired t-test or Wilcoxon signed-rank test based on the normality of the data. Results The subject of the study was grade 2 KOA patients who came to the orthopedic polyclinic at Cengkareng Hospital, West Jakarta from October to November 2022. The number of subjects who met the inclusion criteria and were willing to participate in this study was 60 people, consisting of 30 people as controls and 30 people who received HILT treatment 7 times within 4 weeks. All subjects completed the entirety of the therapy none of which were declared dropped out. Furthermore, no adverse effects were observed during the intervention. Table 1 Subject characteristics ( n = 60) Characteristics n (%) Sex Male Female 10 (16.7) 50 (83.3) Age 57.98 ± 5.71 Height 155.72 ± 8.43 Weight 65.02 ± 12.28 BMI 26.73 ± 4.16 Group Control (HILT) Treatment (Standard Therapy) 30 (50) 30 (50) Table 1 showed that the majority (83.3%) of subjects were female, with an average age of 57.98 ± 5.71 years. In general, subjects had an average BMI of 26.73 ± 4.16 kg/m 2 which means they were overweight up to obese. The subjects were divided into two groups, namely the treatment group with the administration of HILT and the control group with standard therapy (without the administration of HILT). Table 2 Comparison of mRNA, NPRS, and WOMAC Values at Week 1 and Week 4 Pre Post p Mean Difference (CI 95%) Treatment Group ( n = 30) mRNA 1.08 ± 0.43 5.59 ± 1.69 < 0.001 a * -4.50 (-5.15–(-3.86)) NPRS 5.00 (3.00–7.00) 4.00 (2.00–6.00) < 0.001 b * WOMAC 48.20 ± 12.80 43.87 ± 13.47 < 0.001 a * 4.33 (3.44–5.23) Control Group ( n = 30) mRNA 1.06 (0.50–2.05) 3.88 (0.86–8.65) < 0.001 b * NPRS 6.00 (3.00–8.00) 5.30 (2.00–8.00) < 0.002 b * WOMAC 36.97 ± 18.11 35.00 ± 19.44 < 0.001 a * 1.97 (0.91–3.02) * Significant; a Paired T-Test; b Wilcoxon Signed-Rank Test. WOMAC: Western Ontario and McMaster Universities Arthritis Index. NPRS: Numeric Pain Rating Scale. Table 3 Comparison of Changes in mRNA, NPRS, and WOMAC Values between Groups Treatment Group ( n = 30) Control Group ( n = 30) p mRNA 4.75 (0.74–7.40) 2.74 (0.32–7.88) 0.004 a* NPRS 0.00 (0.00–(-3.00)) 0.00 (0.00–(-3.00) < 0.001 a* WOMAC -1.00 (-12.00–0.00) -4.00 (-9.00–(-1.00)) < 0.001 a* * Significant; a Mann-Whitney Test Tables 2 and 3 illustrated that before HILT was given to the treatment group, mRNA expression of the PRG4 gene was obtained by 1.08 ± 0.43 which increased significantly after one month (p < 0.001). Similarly, the control group also experienced a significant increase in mRNA expression of the PRG4 gene after one month (p < 0.001). However, the increase in mRNA expression of the PRG4 gene that occurred after one month was significantly higher in the treatment group compared to the control group (p = 0.004). Similarly, for pain, a significant decrease in pain scores was obtained in both subject groups (p < 0.001) with the same mean change value of 0.00 (0.00–(-3.00). Functional abilities that include aspects of pain, stiffness, and physical function also improved significantly in both groups after one month (p < 0.001), with better improvements in the group of subjects who received HILT with an average of 4.33 (3.44–5.23) (p < 0.001). Table 4 Comparison of WOMAC Values at Week 1 and Week 4 Pre Post p Mean Difference (CI 95%) Treatment Group ( n = 30) Pain 9.63 ± 4.37 9.17 ± 4.80 0.046 a * 0.467 (0.01–0.92) Stiffness 5.00 (0.00–7.00) 5.00 (0.00–7.00) 0.063 b Physical Function 23.20 ± 12.88 21.90 ± 13.63 < 0.001 a * 1,300 (0.73–1.87) Control Group ( n = 30) Pain 10.33 ± 3.04 8.47 ± 3.40 < 0.001 a * 1.867 (1.350–2.383) Stiffness 3.00 (1.00–5.00) 3.00 (0.00–5.00) < 0.008* Physical Function 35.00 ± 8.91 32.77 ± 9.45 < 0.001 a * 2.233 (1.717–2.749) * Significant; a Paired T-Test; b Wilcoxon Signed-Rank Test Table 5 Comparison of Change in WOMAC Values between Groups Treatment Group ( n = 30) Control Group ( n = 30) p Pain -2.00 (-5.00–0.00) 0.00 (-6.00–0.00) < 0.001* Stiffness 0.00 (-1.00–0.00) 0.00 (-2.00–0.00) 0.403 Physical Function -2.00 (-5.00–0.00) -1.00 (-6.00–0.00) 0.003* From Tables 4 and 5 , results in the functional ability review assessment were further assessed in the group that received HILT assessed for aspects of pain, stiffness, and physical function. After getting HILT, significant improvements were obtained in the aspects of pain (p < 0.001) and physical function (p = 0.003). Table 6 Linear regression on WOMAC stiffness score difference Parameters Parameter Estimation Standard Error 95% CI p Intercept -3.708 0.422 -4.573–(- 2.843) < 0.001 Sex -3.125 0.944 -5.059–(- 1.191) 0.003 Table 6 shows the multivariate analysis that was carried out on factors that are suspected to affect the improvement of functional abilities in the subject group. Based on bivariate analysis, 3 variables are eligible for a multivariate test (p < 0.25), namely gender, weight, and BMI. After a linear regression test, it was found that only sex had a 53% effect on changes in the functional ability of knee OA patients who received HIL therapy, with the following equation: Changes in Functional Ability = -3,708–3,125 x (Sex) . Discussion From the characteristics of the subject, it was found that most of the subjects were women. In the studies of Šifta and Danilov, the female sex was a risk factor for OA ( 20 ). The prevalence of OA in men 50 years, the prevalence of women suffering from OA is higher than that of men. The difference became less and less after turning 80 years old, which is estimated due to a significant reduction in estrogen in older women ( 21 ). The age of the subjects who participated in the study was 45–65 years old, with an average age of 57.98 ± 5.71 years. Age is the most important risk factor for KOA since its prevalence gets higher with age ( 22 ). KOA is obtained at about 5% at the age of < 40 years, 30% at the age of 40–60 years, and about 65% at the age of more than 60 years. The aging process is considered to be the cause of increased muscle weakness around the joints, calcification of cartilage, and decreased chondrocyte function, all of which favor the occurrence of KOA. With age, biological changes in the knee joint such as cartilage depletion result in greater pressure on the basal lining, increasing the risk of more severe cartilage damage ( 23 ). In general, subjects who experienced KOA had an average BMI of 26.73 ± 4.16 kg/m 2 which means they were overweight or obese. This is a risk factor for KOA since it causes an increased mechanical load on the knee joint leading to damage to the synovial joint and other structures (24). People with overweight are at three times greater risk of suffering from KOA while those with obesity (BMI ≥ 30) are seven times more at risk of suffering from KOA, even though obesity is the strongest modifiable risk factor ( 25 ). During walking, half the body weight rests on the knee joint. Increased body weight doubles the load on the knee joint when walking ( 26 ). It was also mentioned that patients with BMI > 30 kg/m 2 are 2.81 to 7.48 times more vulnerable to KOA ( 25 ). Similarly, for pain, a significant decrease in pain scores was obtained in both subject groups (p < 0.001) with the same mean change value of 0.00 (0.00–-3.00). Functional abilities that include aspects of pain, stiffness, and physical function also improved significantly in both groups after one month (p < 0.001), with better improvements in the group of subjects who received HILT with an average of 4.33 (3.44–5.23) (p < 0.001). This is in line with the research of Angelova et al. where patients that received HILT have a decrease in pain from the beginning of therapy until after the seventh time of HILT (p < 0.001) ( 11 ). This suggests that HILT lowers pain in KOA patients. HILT is a powerful laser therapy that shows encouraging results in the pain treatment of patients with KOA. Pathogenesis is characterized by a combination of phlogistic and degenerative aspects that clinically occur during the acute phase and continuous pain in the chronic phase due to degeneration ( 27 ). The results of this study also support that the laser effect – which can alter the functioning of cells and tissues – depends on the characteristics of the laser itself such as wavelength and coherence. With specific characteristics of a laser with wavelength 1,064 nm, peak power up to 3,000 W, pulsed emission, regular peak elevated amplitude value with a very short time, and interval time lag to reduce thermal accumulation in tissues, it can quickly induce deep tissue photochemistry and photothermal effects. These features result in greater radiation propagation in tissues with very low histological risk, leading to possible deep treatments of tissues and structures (28). Furthermore, HILT with an excellent wavelength of 1064 nm in KOA is absorbed in liquid-based structures, where laser light when it reaches the skin creates specific photomechanical waves in the tissues that will stimulate free nerve endings and pain receptors by blocking pain pathways in the nervous system through the activation of Melzack's gate control mechanism and inhibition of pain perception to instantly relieve pain ( 11 , 28 ). In addition, HILT also stimulates the intracellular activity of enzymes by increasing the production of pain-relieving chemicals such as endorphins and enkephalins from the brain and adrenal glands ( 29 , 30 ). The instrument that is often used for measuring functional capabilities in OA is WOMAC since it has good validity. This WOMAC index is a multidimensional measurement that measures functional capabilities ( 20 , 28 ). Functional abilities that include aspects of pain, stiffness, and physical function also improved significantly in both groups after one month (p < 0.001), with better improvements in the group of subjects who received HILT with an average of 4.33 (3.44–5.23) (p < 0.001). This suggests that HILT improves the functional abilities of KOA patients. In accordance with the results of the study of Viliani T et al (2010) which evaluated functional abilities in three groups of KOA patients by providing HILT 5 times, 10 times, and injection of hyaluronic acid, it was found that HILT significantly improve functional ability in all three groups ( 31 ). However, it was noted that the improvement of functional ability in the HILT group was as effective as the group given a hyaluronic acid injection, and could last up to 4 months after therapy. This study showed that HILT has a very significant increase in functional ability as illustrated in Tables 4 and 5 . Tables 2 , 3 , 4 , and 5 imply that a higher WOMAC score indicates lower functional ability while on the contrary, a lower WOMAC score will result in better functional ability. The decrease in the functional ability of KOA patients can be caused by pain in the knee in addition to anatomical factors and pathological changes by affecting the ability to carry out daily functional activities. HILT – in addition to an analgesic effect – also has a biostimulating effect, that is, the ability to grow and repair tissues at the cellular level. Cellular mitochondria specifically can absorb the wavelength of laser radiation and cause the release of signal molecules (NO, cytokinins, growth factors) that play a role in increasing ATP formation, increasing the metabolic rate of cells that produce tissue regeneration and healing ( 31 ). In addition, laser radiation can increase fibroblastic activity, collagen synthesis, and angiogenesis due to the proliferation of endothelial cells in tissues ( 11 , 12 , 27 ). From this study, before HILT was given to the treatment group, mRNA expression of the PRG4 gene was obtained by 1.08 ± 0.43 which increased significantly after one month (p < 0.001). Similarly, the control group also experienced a significant increase in mRNA expression of the PRG4 gene after a period of one month (p < 0.001). However, the increase in mRNA expression of the PRG4 gene that occurred after one month was significantly higher in the treatment group compared to the control group (p = 0.004). Lubricin, a product of the proteoglycan gene 4 (PRG4) is a major component of synovial fluid and participates in the lubrication of the surface of synovial joints. Here, we use "lubricin" when referring to protein products expressed by cells in joints ( 32 ). From the results of the study, it was found that the expression of the PRG4 mRNA gene differed significantly between those who received HILT and the group who did not (Fig. 1 ). In the treatment group, mRNA expression of the PRG4 gene was 1.08 ± 0.43 which increased significantly after one month (p < 0.001). Table 6 showed the result of a multivariate analysis carried out on factors that are suspected to affect the improvement of functional abilities in the subject group. Based on bivariate analysis, 3 variables are eligible for a multivariate test (p < 0.25), namely gender, weight, and BMI. After a linear regression test, it was found that only sex had a 53% effect on changes in the functional ability of KOA patients who received HILT with the following equation: Changes in Functional Ability = -3,708–3,125 x (Sex) . This is an important effect in providing improvements related to improved functional ability in KOA patients. Results showing that sex has a major effect on changes in functional ability can also be influenced by dominant sampling in women (83.3%). The main idea of this study’s findings is presented in Fig. 1 . Conclusion Our findings conclude that the mRNA expression in grade 2 KOA patients at week 1 was similar between the two groups. However, the mRNA expression in grade 2 KOA patients at week 1 was higher in the group given HILT and analgesics compared to analgesics alone. On the other hand, there was a significant increase in mRNA expression and a decrease in WOMAC and NPRS scores at week 4, with greater changes in mRNA, WOMAC, and NPRS expression in the intervention group, with a significant difference in pain and WOMAC scores between the intervention group and the control group. Sex was a predictor of an increase in mRNA expression in week 4 in the intervention group with an influence of 28.1%. KOA occurs a lot, especially in old age due to various causative factors including articular cartilage damage. Further research on risk factors that aggravate the course of KOA disease is recommended such as by continuing this study with different osteoarthritis degrees according to Kellgren Lawrence as well as a larger number of samples with the same number between men and women. It is also recommended that the study uses the cohort method with a longer period of HILT administration to further evaluate the mRNA expression of the PRG4 gene as well as improvements in pain and functional ability. Declarations Data availability Underlying data Figshare: RAW DATA for Analysis of Proteoglycan 4 mRNA Expression on Pain Improvement and Functional Ability in Knee Osteoarthritis Patients After High-Intensity Laser Administration. https://doi.org/10.6084/m9.figshare.22337593.v1 (Khumaidi and Nurkolis, 2023) (28) Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication). Reporting guidelines Consort Checklist for study: https://doi.org/10.6084/m9.figshare.23300609.v1 (33). Grant information This research received no external funding. Acknowledgments The 1st author would like to thank all the authors who were also the supervisors of this research to obtain a doctoral degree, also to Hasanuddin University School of Medicine and the Faculty of Medicine and Health, University of Muhammadiyah Jakarta. Competing Interests The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Author Contribution MK and IP: designed the research, investigation, project administration, writing and revising the original draft. IP, AI, NN, ID, MH, MM, AB, MU, AM, and AZ: supervision, validation, and writing–review and editing. LM, YS, NT, and FN: Assisting in the processing of data on food intake, drinking, and physical activity as well as helping to write–review and editing, Visualization and Software. All authors contributed to the article and approved the submitted version. References Hussain SM, Neilly DW, Baliga S, Patil S, Meek R. Knee osteoarthritis: a review of management options. Scott Med J. 2016 Feb;61(1):7–16. Mora JC, Przkora R, Cruz-Almeida Y. Knee osteoarthritis: pathophysiology and current treatment modalities. J Pain Res. 2018 Dec 31;11:2189–96. Vitaloni M, Botto-van Bemden A, Sciortino Contreras RM, Scotton D, Bibas M, Quintero M, et al. Global management of patients with knee osteoarthritis begins with quality of life assessment: a systematic review. BMC Musculoskelet Disord. 2019;20(1):493. Dainese P, Wyngaert K V, De Mits S, Wittoek R, Van Ginckel A, Calders P. Association between knee inflammation and knee pain in patients with knee osteoarthritis: a systematic review. Osteoarthr Cartil. 2022 Apr 1;30(4):516–34. Slovacek H, Khanna R, Poredos P, Poredos P, Jezovnik M, Hoppensteadt D, et al. Interrelationship of MMP-9, Proteoglycan-4, and Inflammation in Osteoarthritis Patients Undergoing Total Hip Arthroplasty. Clin Appl Thromb. 2021;27:1076029621995569. Soeryadi A, Gesal J, Sengkey LS. Gambaran Faktor Risiko Penderita Osteoartritis Lutut di Instalasi Rehabilitasi Medik RSUP Prof. Dr. R. D. Kandou Manado Periode Januari –Juni 2017. e-CliniC. 2017;5(2). Kementerian Kesehatan Republik Indonesia. Riset Kesehatan Dasar 2013. Jakarta; 2013. Fulop AM, Dhimmer S, Deluca JR, Johanson DD, Lenz R V, Patel KB, et al. A meta-analysis of the efficacy of laser phototherapy on pain relief. Clin J Pain. 2010 Oct;26(8):729–36. Dima R, Tieppo Francio V, Towery C, Davani S. Review of Literature on Low-level Laser Therapy Benefits for Nonpharmacological Pain Control in Chronic Pain and Osteoarthritis. Altern Ther Health Med. 2018 Sep;24(5):8–10. Ganjeh S, Rezaeian ZS, Mostamand J. Low Level Laser Therapy in Knee Osteoarthritis: A Narrative Review. Adv Ther. 2020 Aug;37(8):3433–49. Angelova A, Ilieva EM. Effectiveness of High Intensity Laser Therapy for Reduction of Pain in Knee Osteoarthritis. Brighina F, editor. Pain Res Manag. 2016;2016:9163618. Alayat MSM, Abdel-Kafy EM, Elsoudany AM, Helal OF, Alshehri MA. Efficacy of high intensity laser therapy in the treatment of male with osteopenia or osteoporosis: a randomized placebo-controlled trial. J Phys Ther Sci. 2017 Sep;29(9):1675–9. Akaltun MS, Altindag O, Turan N, Gursoy S, Gur A. Efficacy of high intensity laser therapy in knee osteoarthritis: a double-blind controlled randomized study. Clin Rheumatol. 2021 May;40(5):1989–95. Kim G-J, Choi J, Lee S, Jeon C, Lee K. The effects of high intensity laser therapy on pain and function in patients with knee osteoarthritis. J Phys Ther Sci. 2016 Nov;28(11):3197–9. Ornetti P, Dougados M, Paternotte S, Logeart I, Gossec L. Validation of a numerical rating scale to assess functional impairment in hip and knee osteoarthritis: comparison with the WOMAC function scale. Ann Rheum Dis. 2011 May;70(5):740–6. Krebs EE, Carey TS, Weinberger M. Accuracy of the Pain Numeric Rating Scale as a Screening Test in Primary Care. J Gen Intern Med. 2007;22(10):1453–8. Ponkilainen VT, Häkkinen AH, Uimonen MM, Tukiainen E, Sandelin H, Repo JP. Validation of the Western Ontario and McMaster Universities Osteoarthritis Index in Patients Having Undergone Ankle Fracture Surgery. J Foot Ankle Surg. 2019 Nov 1;58(6):1100–7. Ruan MZC, Erez A, Guse K, Dawson B, Bertin T, Chen Y, et al. Proteoglycan 4 expression protects against the development of osteoarthritis. Sci Transl Med. 2013 Mar;5(176):176ra34. Hatta M, Surachmanto EE, Islam AA, Wahid S. Expression of mRNA IL-17F and sIL-17F in atopic asthma patients. BMC Res Notes. 2017;10(1):202. Šifta P, Danilov D. Effects of high-intensity laser on gonarthrosis. Int J Inf Sci CCulture. 2015;14:18–22. Watts NB. Postmenopausal Osteoporosis: A Clinical Review. J Womens Health (Larchmt). 2018 Sep;27(9):1093–6. Cui A, Li H, Wang D, Zhong J, Chen Y, Lu H. Global, regional prevalence, incidence and risk factors of knee osteoarthritis in population-based studies. EClinicalMedicine. 2020 Dec;29–30:100587. Magnusson K, Kumm J, Turkiewicz A, Englund M. A naturally aging knee, or development of early knee osteoarthritis? Osteoarthr Cartil. 2018 Nov;26(11):1447–52. Al Khatib F, Gouissem A, Mbarki R, Adouni M. Biomechanical Characteristics of the Knee Joint during Gait in Obese versus Normal Subjects. Vol. 19, International Journal of Environmental Research and Public Health. 2022. Lee R, Kean WF. Obesity and knee osteoarthritis. Inflammopharmacology. 2012 Apr;20(2):53–8. Chen L, Zheng JJY, Li G, Yuan J, Ebert JR, Li H, et al. Pathogenesis and clinical management of obesity-related knee osteoarthritis: Impact of mechanical loading. J Orthop Transl [Internet]. 2020;24:66–75. Available from: https://www.sciencedirect.com/science/article/pii/S2214031X2030067X Sobol E, Shekhter A, Guller A, Baum O, Baskov A. Laser-induced regeneration of cartilage. J Biomed Opt. 2011 Aug;16(8):80902. Kheshie AR, Alayat MSM, Ali MME. High-intensity versus low-level laser therapy in the treatment of patients with knee osteoarthritis: a randomized controlled trial. Lasers Med Sci. 2014 Jul;29(4):1371–6. Kulchitskaya DB, Konchugova TV, Fedorova NE. Comparative evaluation of the effects of high-intensity and low-intensity laser radiation on microcirculation among patients with knee arthritis. In: Journal of Physics: Conference Series. 2017. p. 012015. Stiglić-Rogoznica N, Stamenković D, Frlan-Vrgoc L, Avancini-Dobrović V, Vrbanić TS-L. Analgesic effect of high intensity laser therapy in knee osteoarthritis. Coll Antropol. 2011 Sep;35 Suppl 2:183–5. Viliani T, Martini C, Mangone G, Pasquetti P. High intensity laser therapy in knee osteoarthritis: comparison between two different pulsed-laser treatment protocols. Energy Heal. 2010;05:26–9. Rhee DK, Marcelino J, Baker M, Gong Y, Smits P, Lefebvre V, et al. The secreted glycoprotein lubricin protects cartilage surfaces and inhibits synovial cell overgrowth. J Clin Invest. 2005 Mar;115(3):622–31. Nurkolis, Fahrul (2023). CONSORT 2010 Checklist for Analysis of proteoglycan 4 mRNA expression on pain improvement and functional ability in knee osteoarthritis patients after high-intensity laser administration. figshare. Journal contribution. https://doi.org/10.6084/m9.figshare.23300609.v1 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7226444","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":492746759,"identity":"2b9119cb-68d0-423d-b55f-3d4dd91796d6","order_by":0,"name":"Mohammad Adib Khumaidi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5klEQVRIiWNgGAWjYFCCxDbGxgYgzcxgcOADA0MCaVoOziBOSwIbRAsDgwEzDzFa+NuT2x7O3HE4mr+deeNh2za7PH72BsYPH3Nwa5E487DdcOOZw7kzDrMVHM5tSy6W7DnALDlzGx5rbiS2ST5sO5zbcJjHAKiFOXHDjQQ2Zl48WuRhWuaDtFi21RPWYgDSshGoZQNIC2PbYcJaDEF+mdmWnrsR6JeDPeeOJ87sOdiM1y9yx9OfPexts86dd/7w5g8/yqoT+9mbD374iM/7KICRDUw2EKseBP6QongUjIJRMApGCgAASHdhNMg0Dy0AAAAASUVORK5CYII=","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Mohammad","middleName":"Adib","lastName":"Khumaidi","suffix":""},{"id":492746761,"identity":"716cb231-e2d0-44e7-b85d-4f8fcbb75623","order_by":1,"name":"Idrus Andi Paturusi","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Idrus","middleName":"Andi","lastName":"Paturusi","suffix":""},{"id":492746762,"identity":"a48922c4-a572-4985-9ed9-02f211d8093c","order_by":2,"name":"Andi Asadul Islam","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Andi","middleName":"Asadul","lastName":"Islam","suffix":""},{"id":492746764,"identity":"68aa07b3-a951-4608-987f-cf272868c50a","order_by":3,"name":"Nury Nusdwinuringtyas","email":"","orcid":"","institution":"Universitas Indonesia, Cipto Mangunkusumo Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Nury","middleName":"","lastName":"Nusdwinuringtyas","suffix":""},{"id":492746766,"identity":"300b5908-bc58-4030-8935-dcbcce4488f9","order_by":4,"name":"Ismail Hadisoebroto Dilogo","email":"","orcid":"","institution":"Universitas Indonesia, Cipto Mangunkusumo Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ismail","middleName":"Hadisoebroto","lastName":"Dilogo","suffix":""},{"id":492746768,"identity":"830dd09b-4011-4ebd-97dd-70dea7054fb2","order_by":5,"name":"Mochammad Hatta","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Mochammad","middleName":"","lastName":"Hatta","suffix":""},{"id":492746771,"identity":"bc075d4a-11c4-4be0-9346-96bb98fb978a","order_by":6,"name":"Muhammad Nasrum Massi","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Nasrum","lastName":"Massi","suffix":""},{"id":492746772,"identity":"da1e0674-62a6-47c4-8edd-3a975200d5aa","order_by":7,"name":"Agussalim Bukhari","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Agussalim","middleName":"","lastName":"Bukhari","suffix":""},{"id":492746773,"identity":"c04d2d48-9f90-4ee2-bfbe-840806c580fd","order_by":8,"name":"Muhammad Andry Usman","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Andry","lastName":"Usman","suffix":""},{"id":492746774,"identity":"26dd0997-5312-4681-9ee5-934eca55eecb","order_by":9,"name":"Andi Takdir Musba","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Andi","middleName":"Takdir","lastName":"Musba","suffix":""},{"id":492746775,"identity":"54f9182e-cc96-4d3b-80ab-1b6d67eb809e","order_by":10,"name":"Andi Alfian Zainuddin","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Andi","middleName":"Alfian","lastName":"Zainuddin","suffix":""},{"id":492746776,"identity":"305d4b67-6a52-4b81-b5e3-0f89fd6a3e41","order_by":11,"name":"Listya Tresnanti Mirtha","email":"","orcid":"","institution":"Universitas Indonesia","correspondingAuthor":false,"prefix":"","firstName":"Listya","middleName":"Tresnanti","lastName":"Mirtha","suffix":""},{"id":492746777,"identity":"902ff017-2336-47b3-b1cc-b5f1defaee30","order_by":12,"name":"Yuli Suciati","email":"","orcid":"","institution":"Universitas Pembangunan Nasional (UPN) Veteran Jakarta","correspondingAuthor":false,"prefix":"","firstName":"Yuli","middleName":"","lastName":"Suciati","suffix":""},{"id":492746778,"identity":"0c36973a-0b99-44eb-a4e2-a9268a58cdbc","order_by":13,"name":"Fahrul Nurkolis","email":"","orcid":"","institution":"Sunan Kalijaga State Islamic University","correspondingAuthor":false,"prefix":"","firstName":"Fahrul","middleName":"","lastName":"Nurkolis","suffix":""},{"id":492746779,"identity":"4c86b35b-a4f9-4dd9-98d9-8f9f9a4ad842","order_by":14,"name":"Nurpudji Astuti Taslim","email":"","orcid":"","institution":"Hasanuddin University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Nurpudji","middleName":"Astuti","lastName":"Taslim","suffix":""}],"badges":[],"createdAt":"2025-07-27 13:23:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7226444/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7226444/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88349274,"identity":"3be87db2-3deb-4883-b68e-2bddbda8b21c","added_by":"auto","created_at":"2025-08-05 14:03:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":369825,"visible":true,"origin":"","legend":"The main idea of the impact of HILT on proteoglycan-4 (PRG4) gene expression, pain, and functional ability in KOA patients. HILT: High-Intensity Laser Therapy. WOMAC: Western Ontario and McMaster Universities Arthritis Index. NPRS: Numeric Pain Rating Scale. This figure is an original figure produced by the authors for this article (Created with Biorender Premium License by Fahrul Nurkolis0.","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7226444/v1/4eff357f492a219b7cea7ce0.png"},{"id":88472953,"identity":"29e66e00-b2b0-4296-9ee3-50252534cd74","added_by":"auto","created_at":"2025-08-06 19:53:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1140926,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7226444/v1/7ba96a0d-09ea-4155-9bae-9a260cfc40ae.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Analysis of proteoglycan 4 mRNA expression on pain improvement and functional ability in knee osteoarthritis patients after high-intensity laser administration","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOsteoarthritis (OA) is the most common type of disease of arthritis and the leading cause of chronic musculoskeletal pain, especially in the elderly (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). OA is often called a degenerative disease of the joints (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). One of the most occurring OA is knee OA (KOA) since the knee is the largest synovial joint in humans that is frequently affected by painful conditions (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). KOA condition is linked to inflammation that causes pain, functional limitations, and a decreased quality of life (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). On the other hand, pain has also been linked to increased inflammatory activity, albeit the strength of the association varies (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Furthermore, in the pathogenesis of KOA, inflammation is associated with the downregulation of proteoglycan-4 (PRG4), a protective glycoprotein and biomarker of cartilage degradation (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). In Indonesia in 2013, the prevalence of KOA was 5% at the age of \u0026lt;\u0026thinsp;40 years, 30% at the age of 40\u0026ndash;60 years, and 65% at the age of 5.6\u0026thinsp;\u0026gt;\u0026thinsp;60 years (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eLaser therapy is one of the non-invasive, painless therapies that can be easily administered and significantly reduces acute as well as chronic pain (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Previously, low-level laser therapy (LLLT) was a widely known treatment for KOA and has been carried out in many studies (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). A relatively new method of physical therapy application today is high-intensity laser therapy (HILT), which differs in mechanism and action compared to LLLT (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). LLLT is commonly known as a 'cold laser', it has very low power and for that reason does not generate heat on the skin. In contrast to LLT, HILT is known as a 'heat laser' and is 100 times more powerful than LLLT. HILT can reach and stimulate large and/or deep joints which is difficult to reach with LLLT (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn recent years, modern medical rehabilitation therapy techniques, especially the use of HILT, have been applied in medical practice, especially KOA management (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). HILT has been considered effective in reducing pain and improving function (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). However, until now, the research on the use of HILT in KOA patients in Indonesia is still limited. To the best of our knowledge, no research has determined the effect of HILT on the expression of PRG4, which is supposedly decreased due to KOA. Therefore, this study was intrigued to determine how HILT affects the mRNA PRG4 gene expression and its implication on pain and functional ability of KOA patients in Orthopaedic and Medical Rehabilitation Polyclinic of Cengkareng Hospital, West Jakarta, which are measured by Numeric Pain Rating Scale (NPRS) and Western Ontario and McMaster Universities Arthritis Index (WOMAC) (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e).\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eParticipants\u003c/p\u003e\u003cp\u003eThis research was an experimental study with KOA patients in the Orthopaedic Polyclinic and Medical Rehabilitation Polyclinic of Cengkareng Hospital, West Jakarta as its subjects. The study was conducted from October to November 2022. The patients were given verbal and written information regarding the offer to become the subjects of study.\u003c/p\u003e\u003cp\u003eThe sample size was estimated as follows. With a ratio of 1:1 between the sample sizes of the two groups, it was calculated that the high-intensity laser intervention's efficacy was 90% and the control group's effectiveness was 50%. We obtained a minimum sample size of 20 patients for each group, using a 95% confidence level (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) and an 80% power. Three more individuals were added to each group, bringing the sample size to a minimum of 23 per treatment because losses were predicted to be 15% of the total.\u003c/p\u003e\u003cp\u003eThe subjects were chosen based on consecutive sampling and those who fulfilled the inclusion criteria. The inclusion criteria are as follows: (i) subjects diagnosed with unilateral or bilateral degree II Kellgren Lawrence KOA, (ii) 45\u0026ndash;65 years old, and (iii) be able to understand the provided inspection instructions and sign the informed consent.\u003c/p\u003e\u003cp\u003eThe exclusion criteria are as follows: (i) suffer from other knee joint diseases besides OA (gout and pseudogout, rheumatic arthritis, reactive arthritis), (ii) have severe comorbid systemic diseases, such as congestive heart failure or using a pacemaker, kidney failure (acute or chronic renal failure), uncontrolled diabetes mellitus with neurological disorders, uncontrolled hypertension (TD\u0026thinsp;\u0026gt;\u0026thinsp;160/100 mmHg), (iii) showed contraindications of HILT, namely psychological diseases, pregnancy, photosensitivity, bleeding disorders in the area to be treated, history of cancer, febrile conditions, epilepsy, and (iv) receiving treatment with other pharmacological or nonpharmacological therapies for the past 2 weeks (e.g. oral or parenteral NSAIDs, opioids, oral corticosteroids or injections), except the use of paracetamol for standard pain therapy.\u003c/p\u003e\u003cp\u003eLastly, the dropout criteria were as follows: (i) patients do not follow the full research program and do not adhere to the therapy schedule, (ii) patients who experience skin reactions after being treated, and (iii) the patient decides he does not want to continue participating in the study. In conducting the study we collected a total sampling of 30 for each group.\u003c/p\u003e\u003cp\u003eEthical considerations\u003c/p\u003e\u003cp\u003eBefore conducting the study, the researcher applied for ethical clearance and approval on \u003cb\u003eJanuary 31st, 2023\u003c/b\u003e from the Ethics Commission of the Faculty of Medicine, Hasanuddin University (No. 77/UN4.6.4.5.31/PP36/2023) and \u003cb\u003ethe trials registry number UH23010004 in Hasanuddin University Hospital Health Research Trial Committee (January 31st, 2023)\u003c/b\u003e. Approval for participation in this study was then submitted to patients and families in the form of informed consent. All costs used for this study were funded by the researcher himself, and the respondent was not burdened with any additional costs. The confidentiality of the data is guaranteed.\u003c/p\u003e\u003cp\u003eProcedure\u003c/p\u003e\u003cp\u003eBTL High-Intensity Laser Machine (BTL-6000, Indonesia), Numeric Pain Rating Scale (NPRS) form (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e), and WOMAC form (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e) were utilized for this study. The subjects of this study were divided into two groups, control (n\u0026thinsp;=\u0026thinsp;30; receiving analgesic only) and treatment (n\u0026thinsp;=\u0026thinsp;30; receiving analgesic\u0026thinsp;+\u0026thinsp;HILT) groups. The participants were assigned to each group in a randomized manner.\u003c/p\u003e\u003cp\u003eA venipuncture was performed on each patient before and after receiving the entire HILT intervention using a 10 mL syringe. Body weight is measured by body scales and recorded in units of kilogram (kg). The patient wears thin clothing during the measurement of weight gain and removing used footwear; while height is measured using a tape measure and recorded in units centimeters (cm). The body mass index (BMI) is derived from weight and height.\u003c/p\u003e\u003cp\u003eThe biostimulation effect was given as HILT on the lateral and medial sides of the knee with an energy density (dose) of 120 J/cm\u003csup\u003e2\u003c/sup\u003e and treatment area of 25 cm\u003csup\u003e2\u003c/sup\u003e with an administration time of 10 minutes. The treatment was carried out 2 times per week with 7 sessions of administration. Data was collected through anamnesis and physical check-ups with the patients to fill in the NPRS and WOMAC forms. The practitioners collecting the data were isolated from the information regarding the assignment to intervention.\u003c/p\u003e\u003cp\u003eOutcomes\u003c/p\u003e\u003cp\u003eBiomedical analysis\u003c/p\u003e\u003cp\u003eThe mRNA expression of the PRG4 gene and the degree of pain and physical function were evaluated before and after the HILT.\u003c/p\u003e\u003cp\u003eMeasurement of mRNA expression of the blood PRG-4 refers to previous research (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). The primer used in this study were PRG4 human forward primer (TCCCATGCTTTCCGATGAGAC) and PRG4 reverse (ATTCTGCGAGGAGGAGATGG) while the amplification utilized specific oligonucleotide primers such as GAPDH primer (CACCATCTTCCAGGAGCGAG), and GAPDH reverse (GACTCCACGACGTACTCAGC) (Macrogen Inc, Seoul, Korea). The qPCR condition started with an initial reverse transcriptase temperature of 51 \u003csup\u003eo\u003c/sup\u003eC for 30 minutes and continued with PCR activation with a temperature of 95 \u003csup\u003eo\u003c/sup\u003eC for 6 minutes, followed by a temperature of 95 \u003csup\u003eo\u003c/sup\u003eC for 20 seconds and 58 \u003csup\u003eo\u003c/sup\u003eC for 60 seconds for 40 cycles. qRT PCR uses a one-stage SYBR Green qRT-PCR Master Mix Kit and is paired with Bio-Rad Thermal Cyclers (PTC Tempo Thermal Cycler, Bio-Rad, USA). This protocol is optimized for real-time PCR CFX Connect System (USA) instruments with Ct values of 35.\u003c/p\u003e\u003cp\u003eFurthermore, an experimental reaction was prepared by preparing a reagent mixture by taking a final volume of 25 \u0026micro;L including sample mRNA extracted as per the protocols of Hatta et al., 2017 (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). A total of 12.5 \u0026micro;L of SYBR Green QRT-PCR Master Mix was added with initial primer (concentration optimized), PCR-free nuclease (concentration optimized), 0.375 \u0026micro;L of reference dye solution from stage 1 (optional), as well as 1 \u0026micro;L of block enzyme mixture with 25 \u0026micro;L of total reaction volume. The reaction is mixed slowly so that bubbles do not form (not rotated), then distribute the mixture to the test tube by adding 0.5 \u0026micro;g of experimental RNA to each test tube. The reaction is concisely centrifuged (Hettich EBA200) at 1500x\u003cem\u003eg\u003c/em\u003e for 1 minute and the reaction is placed in an instrument and the PCR program is ready to run using a Real-Time PCR Machine (CFX Connect system, Biorad Laboratories, Real-Time PCR 96 Well 0.1 mL, USA).\u003c/p\u003e\u003cp\u003eData management and analysis\u003c/p\u003e\u003cp\u003eThe Statistical Program for Social Science (SPSS) version 25 was used to analyze the data. Patient characteristics were analyzed descriptively while the normality of the data was determined using the Shapiro-Wilk test. The inferential or comparative analysis between groups pre- and post-intervention utilized paired t-test or Wilcoxon signed-rank test based on the normality of the data.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eThe subject of the study was grade 2 KOA patients who came to the orthopedic polyclinic at Cengkareng Hospital, West Jakarta from October to November 2022. The number of subjects who met the inclusion criteria and were willing to participate in this study was 60 people, consisting of 30 people as controls and 30 people who received HILT treatment 7 times within 4 weeks. All subjects completed the entirety of the therapy none of which were declared dropped out. Furthermore, no adverse effects were observed during the intervention.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eSubject characteristics (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;60)\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCharacteristics\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003en\u003c/em\u003e (%)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSex\u003c/p\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e10 (16.7)\u003c/p\u003e\n \u003cp\u003e50 (83.3)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e57.98\u0026thinsp;\u0026plusmn;\u0026thinsp;5.71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e155.72\u0026thinsp;\u0026plusmn;\u0026thinsp;8.43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWeight\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e65.02\u0026thinsp;\u0026plusmn;\u0026thinsp;12.28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBMI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e26.73\u0026thinsp;\u0026plusmn;\u0026thinsp;4.16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroup\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eControl (HILT)\u003c/p\u003e\n \u003cp\u003eTreatment (Standard Therapy)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e30 (50)\u003c/p\u003e\n \u003cp\u003e30 (50)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\u003c/br\u003e\n\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e showed that the majority (83.3%) of subjects were female, with an average age of 57.98\u0026thinsp;\u0026plusmn;\u0026thinsp;5.71 years. In general, subjects had an average BMI of 26.73\u0026thinsp;\u0026plusmn;\u0026thinsp;4.16 kg/m\u003csup\u003e2\u003c/sup\u003e which means they were overweight up to obese. The subjects were divided into two groups, namely the treatment group with the administration of HILT and the control group with standard therapy (without the administration of HILT).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComparison of mRNA, NPRS, and WOMAC Values at Week 1 and Week 4\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePre\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePost\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ep\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMean Difference (CI 95%)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e\u003cp\u003eTreatment Group (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5.59\u0026thinsp;\u0026plusmn;\u0026thinsp;1.69\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-4.50 (-5.15\u0026ndash;(-3.86))\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNPRS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5.00 (3.00\u0026ndash;7.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.00 (2.00\u0026ndash;6.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003eb\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWOMAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e48.20\u0026thinsp;\u0026plusmn;\u0026thinsp;12.80\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e43.87\u0026thinsp;\u0026plusmn;\u0026thinsp;13.47\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e4.33 (3.44\u0026ndash;5.23)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e\u003cp\u003e\u003cb\u003eControl Group (\u003c/b\u003e\u003cb\u003en\u003c/b\u003e\u0026thinsp;\u003cb\u003e=\u0026thinsp;30)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1.06 (0.50\u0026ndash;2.05)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3.88 (0.86\u0026ndash;8.65)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003eb\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNPRS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e6.00 (3.00\u0026ndash;8.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5.30 (2.00\u0026ndash;8.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.002\u003csup\u003eb\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWOMAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e36.97\u0026thinsp;\u0026plusmn;\u0026thinsp;18.11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e35.00\u0026thinsp;\u0026plusmn;\u0026thinsp;19.44\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1.97 (0.91\u0026ndash;3.02)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e* Significant; \u003csup\u003ea\u003c/sup\u003e Paired T-Test; \u003csup\u003eb\u003c/sup\u003e Wilcoxon Signed-Rank Test. WOMAC: Western Ontario and McMaster Universities Arthritis Index. NPRS: Numeric Pain Rating Scale.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComparison of Changes in mRNA, NPRS, and WOMAC Values between Groups\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTreatment Group (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eControl Group (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ep\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e4.75 (0.74\u0026ndash;7.40)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e2.74 (0.32\u0026ndash;7.88)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.004\u003csup\u003ea*\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNPRS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e0.00 (0.00\u0026ndash;(-3.00))\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.00 (0.00\u0026ndash;(-3.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003ea*\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWOMAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e-1.00 (-12.00\u0026ndash;0.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e-4.00 (-9.00\u0026ndash;(-1.00))\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003ea*\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e* Significant; \u003csup\u003ea\u003c/sup\u003e Mann-Whitney Test\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTables\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e illustrated that before HILT was given to the treatment group, mRNA expression of the PRG4 gene was obtained by 1.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43 which increased significantly after one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Similarly, the control group also experienced a significant increase in mRNA expression of the PRG4 gene after one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). However, the increase in mRNA expression of the PRG4 gene that occurred after one month was significantly higher in the treatment group compared to the control group (p\u0026thinsp;=\u0026thinsp;0.004).\u003c/p\u003e\u003cp\u003eSimilarly, for pain, a significant decrease in pain scores was obtained in both subject groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) with the same mean change value of 0.00 (0.00\u0026ndash;(-3.00). Functional abilities that include aspects of pain, stiffness, and physical function also improved significantly in both groups after one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), with better improvements in the group of subjects who received HILT with an average of 4.33 (3.44\u0026ndash;5.23) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComparison of WOMAC Values at Week 1 and Week 4\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePre\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePost\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ep\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMean Difference (CI 95%)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e\u003cp\u003eTreatment Group (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePain\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e9.63\u0026thinsp;\u0026plusmn;\u0026thinsp;4.37\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9.17\u0026thinsp;\u0026plusmn;\u0026thinsp;4.80\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.046\u003csup\u003ea\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.467 (0.01\u0026ndash;0.92)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStiffness\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5.00 (0.00\u0026ndash;7.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5.00 (0.00\u0026ndash;7.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.063\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePhysical Function\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e23.20\u0026thinsp;\u0026plusmn;\u0026thinsp;12.88\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e21.90\u0026thinsp;\u0026plusmn;\u0026thinsp;13.63\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1,300 (0.73\u0026ndash;1.87)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e\u003cp\u003e\u003cb\u003eControl Group (\u003c/b\u003e\u003cb\u003en\u003c/b\u003e\u0026thinsp;\u003cb\u003e=\u0026thinsp;30)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePain\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10.33\u0026thinsp;\u0026plusmn;\u0026thinsp;3.04\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e8.47\u0026thinsp;\u0026plusmn;\u0026thinsp;3.40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1.867 (1.350\u0026ndash;2.383)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStiffness\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3.00 (1.00\u0026ndash;5.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3.00 (0.00\u0026ndash;5.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.008*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePhysical Function\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e35.00\u0026thinsp;\u0026plusmn;\u0026thinsp;8.91\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e32.77\u0026thinsp;\u0026plusmn;\u0026thinsp;9.45\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003csup\u003ea\u003c/sup\u003e*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2.233 (1.717\u0026ndash;2.749)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003e* Significant; \u003csup\u003ea\u003c/sup\u003e Paired T-Test; \u003csup\u003eb\u003c/sup\u003e Wilcoxon Signed-Rank Test\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eComparison of Change in WOMAC Values between Groups\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026minus;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026minus;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTreatment Group\u003c/p\u003e\u003cp\u003e(\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eControl Group\u003c/p\u003e\u003cp\u003e(\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ep\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePain\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c2\"\u003e\u003cp\u003e-2.00 (-5.00\u0026ndash;0.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c3\"\u003e\u003cp\u003e0.00 (-6.00\u0026ndash;0.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStiffness\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c2\"\u003e\u003cp\u003e0.00 (-1.00\u0026ndash;0.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c3\"\u003e\u003cp\u003e0.00 (-2.00\u0026ndash;0.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.403\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePhysical Function\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c2\"\u003e\u003cp\u003e-2.00 (-5.00\u0026ndash;0.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c3\"\u003e\u003cp\u003e-1.00 (-6.00\u0026ndash;0.00)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.003*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eFrom Tables\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, results in the functional ability review assessment were further assessed in the group that received HILT assessed for aspects of pain, stiffness, and physical function. After getting HILT, significant improvements were obtained in the aspects of pain (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and physical function (p\u0026thinsp;=\u0026thinsp;0.003).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eLinear regression on WOMAC stiffness score difference\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eParameters\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eParameter Estimation\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eStandard Error\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e95% CI\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003ep\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIntercept\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e-3.708\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.422\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-4.573\u0026ndash;(-\u003c/p\u003e\u003cp\u003e2.843)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSex\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e-3.125\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.944\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-5.059\u0026ndash;(-\u003c/p\u003e\u003cp\u003e1.191)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.003\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e shows the multivariate analysis that was carried out on factors that are suspected to affect the improvement of functional abilities in the subject group. Based on bivariate analysis, 3 variables are eligible for a multivariate test (p\u0026thinsp;\u0026lt;\u0026thinsp;0.25), namely gender, weight, and BMI. After a linear regression test, it was found that only sex had a 53% effect on changes in the functional ability of knee OA patients who received HIL therapy, with the following equation: \u003cem\u003eChanges in Functional Ability = -3,708\u0026ndash;3,125 x (Sex)\u003c/em\u003e.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFrom the characteristics of the subject, it was found that most of the subjects were women. In the studies of Šifta and Danilov, the female sex was a risk factor for OA (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). The prevalence of OA in men\u0026thinsp;\u0026lt;\u0026thinsp;50 years is higher than that of women, but after the age of \u0026gt;\u0026thinsp;50 years, the prevalence of women suffering from OA is higher than that of men. The difference became less and less after turning 80 years old, which is estimated due to a significant reduction in estrogen in older women (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe age of the subjects who participated in the study was 45\u0026ndash;65 years old, with an average age of 57.98\u0026thinsp;\u0026plusmn;\u0026thinsp;5.71 years. Age is the most important risk factor for KOA since its prevalence gets higher with age (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). KOA is obtained at about 5% at the age of \u0026lt;\u0026thinsp;40 years, 30% at the age of 40\u0026ndash;60 years, and about 65% at the age of more than 60 years. The aging process is considered to be the cause of increased muscle weakness around the joints, calcification of cartilage, and decreased chondrocyte function, all of which favor the occurrence of KOA. With age, biological changes in the knee joint such as cartilage depletion result in greater pressure on the basal lining, increasing the risk of more severe cartilage damage (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn general, subjects who experienced KOA had an average BMI of 26.73\u0026thinsp;\u0026plusmn;\u0026thinsp;4.16 kg/m\u003csup\u003e2\u003c/sup\u003e which means they were overweight or obese. This is a risk factor for KOA since it causes an increased mechanical load on the knee joint leading to damage to the synovial joint and other structures (24). People with overweight are at three times greater risk of suffering from KOA while those with obesity (BMI\u0026thinsp;\u0026ge;\u0026thinsp;30) are seven times more at risk of suffering from KOA, even though obesity is the strongest modifiable risk factor (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). During walking, half the body weight rests on the knee joint. Increased body weight doubles the load on the knee joint when walking (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). It was also mentioned that patients with BMI\u0026thinsp;\u0026gt;\u0026thinsp;30 kg/m\u003csup\u003e2\u003c/sup\u003e are 2.81 to 7.48 times more vulnerable to KOA (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSimilarly, for pain, a significant decrease in pain scores was obtained in both subject groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) with the same mean change value of 0.00 (0.00\u0026ndash;-3.00). Functional abilities that include aspects of pain, stiffness, and physical function also improved significantly in both groups after one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), with better improvements in the group of subjects who received HILT with an average of 4.33 (3.44\u0026ndash;5.23) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). This is in line with the research of Angelova et al. where patients that received HILT have a decrease in pain from the beginning of therapy until after the seventh time of HILT (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). This suggests that HILT lowers pain in KOA patients. HILT is a powerful laser therapy that shows encouraging results in the pain treatment of patients with KOA. Pathogenesis is characterized by a combination of phlogistic and degenerative aspects that clinically occur during the acute phase and continuous pain in the chronic phase due to degeneration (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). The results of this study also support that the laser effect \u0026ndash; which can alter the functioning of cells and tissues \u0026ndash; depends on the characteristics of the laser itself such as wavelength and coherence.\u003c/p\u003e\u003cp\u003eWith specific characteristics of a laser with wavelength 1,064 nm, peak power up to 3,000 W, pulsed emission, regular peak elevated amplitude value with a very short time, and interval time lag to reduce thermal accumulation in tissues, it can quickly induce deep tissue photochemistry and photothermal effects. These features result in greater radiation propagation in tissues with very low histological risk, leading to possible deep treatments of tissues and structures (28). Furthermore, HILT with an excellent wavelength of 1064 nm in KOA is absorbed in liquid-based structures, where laser light when it reaches the skin creates specific photomechanical waves in the tissues that will stimulate free nerve endings and pain receptors by blocking pain pathways in the nervous system through the activation of Melzack's gate control mechanism and inhibition of pain perception to instantly relieve pain (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). In addition, HILT also stimulates the intracellular activity of enzymes by increasing the production of pain-relieving chemicals such as endorphins and enkephalins from the brain and adrenal glands (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe instrument that is often used for measuring functional capabilities in OA is WOMAC since it has good validity. This WOMAC index is a multidimensional measurement that measures functional capabilities (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Functional abilities that include aspects of pain, stiffness, and physical function also improved significantly in both groups after one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), with better improvements in the group of subjects who received HILT with an average of 4.33 (3.44\u0026ndash;5.23) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). This suggests that HILT improves the functional abilities of KOA patients.\u003c/p\u003e\u003cp\u003eIn accordance with the results of the study of Viliani T et al (2010) which evaluated functional abilities in three groups of KOA patients by providing HILT 5 times, 10 times, and injection of hyaluronic acid, it was found that HILT significantly improve functional ability in all three groups (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). However, it was noted that the improvement of functional ability in the HILT group was as effective as the group given a hyaluronic acid injection, and could last up to 4 months after therapy. This study showed that HILT has a very significant increase in functional ability as illustrated in Tables\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. Tables\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, \u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, and \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e imply that a higher WOMAC score indicates lower functional ability while on the contrary, a lower WOMAC score will result in better functional ability.\u003c/p\u003e\u003cp\u003eThe decrease in the functional ability of KOA patients can be caused by pain in the knee in addition to anatomical factors and pathological changes by affecting the ability to carry out daily functional activities. HILT \u0026ndash; in addition to an analgesic effect \u0026ndash; also has a biostimulating effect, that is, the ability to grow and repair tissues at the cellular level. Cellular mitochondria specifically can absorb the wavelength of laser radiation and cause the release of signal molecules (NO, cytokinins, growth factors) that play a role in increasing ATP formation, increasing the metabolic rate of cells that produce tissue regeneration and healing (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). In addition, laser radiation can increase fibroblastic activity, collagen synthesis, and angiogenesis due to the proliferation of endothelial cells in tissues (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFrom this study, before HILT was given to the treatment group, mRNA expression of the PRG4 gene was obtained by 1.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43 which increased significantly after one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Similarly, the control group also experienced a significant increase in mRNA expression of the PRG4 gene after a period of one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). However, the increase in mRNA expression of the PRG4 gene that occurred after one month was significantly higher in the treatment group compared to the control group (p\u0026thinsp;=\u0026thinsp;0.004). Lubricin, a product of the proteoglycan gene 4 (PRG4) is a major component of synovial fluid and participates in the lubrication of the surface of synovial joints. Here, we use \"lubricin\" when referring to protein products expressed by cells in joints (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). From the results of the study, it was found that the expression of the PRG4 mRNA gene differed significantly between those who received HILT and the group who did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In the treatment group, mRNA expression of the PRG4 gene was 1.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43 which increased significantly after one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e showed the result of a multivariate analysis carried out on factors that are suspected to affect the improvement of functional abilities in the subject group. Based on bivariate analysis, 3 variables are eligible for a multivariate test (p\u0026thinsp;\u0026lt;\u0026thinsp;0.25), namely gender, weight, and BMI. After a linear regression test, it was found that only sex had a 53% effect on changes in the functional ability of KOA patients who received HILT with the following equation: \u003cem\u003eChanges in Functional Ability = -3,708\u0026ndash;3,125 x (Sex)\u003c/em\u003e. This is an important effect in providing improvements related to improved functional ability in KOA patients. Results showing that sex has a major effect on changes in functional ability can also be influenced by dominant sampling in women (83.3%). The main idea of this study\u0026rsquo;s findings is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur findings conclude that the mRNA expression in grade 2 KOA patients at week 1 was similar between the two groups. However, the mRNA expression in grade 2 KOA patients at week 1 was higher in the group given HILT and analgesics compared to analgesics alone. On the other hand, there was a significant increase in mRNA expression and a decrease in WOMAC and NPRS scores at week 4, with greater changes in mRNA, WOMAC, and NPRS expression in the intervention group, with a significant difference in pain and WOMAC scores between the intervention group and the control group. Sex was a predictor of an increase in mRNA expression in week 4 in the intervention group with an influence of 28.1%.\u003c/p\u003e\u003cp\u003eKOA occurs a lot, especially in old age due to various causative factors including articular cartilage damage. Further research on risk factors that aggravate the course of KOA disease is recommended such as by continuing this study with different osteoarthritis degrees according to Kellgren Lawrence as well as a larger number of samples with the same number between men and women. It is also recommended that the study uses the cohort method with a longer period of HILT administration to further evaluate the mRNA expression of the PRG4 gene as well as improvements in pain and functional ability.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eUnderlying data\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFigshare: RAW DATA for Analysis of Proteoglycan 4 mRNA Expression on Pain Improvement and Functional Ability in Knee Osteoarthritis Patients After High-Intensity Laser Administration. https://doi.org/10.6084/m9.figshare.22337593.v1 \u0026nbsp;(Khumaidi and Nurkolis, 2023) (28)\u003c/p\u003e\n\u003cp\u003eData are available under the terms of the\u0026nbsp;Creative Commons Zero \u0026ldquo;No rights reserved\u0026rdquo; data waiver\u0026nbsp;(CC0 1.0 Public domain dedication).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eReporting guidelines\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eConsort Checklist for study: https://doi.org/10.6084/m9.figshare.23300609.v1 (33).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGrant information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received no external funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe 1st author would like to thank all the authors who were also the supervisors of this research to obtain a doctoral degree, also to Hasanuddin University School of Medicine and the Faculty of Medicine and Health, University of Muhammadiyah Jakarta.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMK and IP: designed the research, investigation, project administration, writing and revising the original draft. IP, AI, NN, ID, MH, MM, AB, MU, AM, and AZ: supervision, validation, and writing\u0026ndash;review and editing. LM, YS, NT, and FN: Assisting in the processing of data on food intake, drinking, and physical activity as well as helping to write\u0026ndash;review and editing, Visualization and Software. All authors contributed to the article and approved the submitted version.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHussain SM, Neilly DW, Baliga S, Patil S, Meek R. Knee osteoarthritis: a review of management options. Scott Med J. 2016 Feb;61(1):7\u0026ndash;16. \u003c/li\u003e\n\u003cli\u003eMora JC, Przkora R, Cruz-Almeida Y. Knee osteoarthritis: pathophysiology and current treatment modalities. J Pain Res. 2018 Dec 31;11:2189\u0026ndash;96. \u003c/li\u003e\n\u003cli\u003eVitaloni M, Botto-van Bemden A, Sciortino Contreras RM, Scotton D, Bibas M, Quintero M, et al. Global management of patients with knee osteoarthritis begins with quality of life assessment: a systematic review. BMC Musculoskelet Disord. 2019;20(1):493. \u003c/li\u003e\n\u003cli\u003eDainese P, Wyngaert K V, De Mits S, Wittoek R, Van Ginckel A, Calders P. Association between knee inflammation and knee pain in patients with knee osteoarthritis: a systematic review. Osteoarthr Cartil. 2022 Apr 1;30(4):516\u0026ndash;34. \u003c/li\u003e\n\u003cli\u003eSlovacek H, Khanna R, Poredos P, Poredos P, Jezovnik M, Hoppensteadt D, et al. Interrelationship of MMP-9, Proteoglycan-4, and Inflammation in Osteoarthritis Patients Undergoing Total Hip Arthroplasty. Clin Appl Thromb. 2021;27:1076029621995569. \u003c/li\u003e\n\u003cli\u003eSoeryadi A, Gesal J, Sengkey LS. Gambaran Faktor Risiko Penderita Osteoartritis Lutut di Instalasi Rehabilitasi Medik RSUP Prof. Dr. R. D. Kandou Manado Periode Januari \u0026ndash;Juni 2017. e-CliniC. 2017;5(2). \u003c/li\u003e\n\u003cli\u003eKementerian Kesehatan Republik Indonesia. Riset Kesehatan Dasar 2013. Jakarta; 2013. \u003c/li\u003e\n\u003cli\u003eFulop AM, Dhimmer S, Deluca JR, Johanson DD, Lenz R V, Patel KB, et al. A meta-analysis of the efficacy of laser phototherapy on pain relief. Clin J Pain. 2010 Oct;26(8):729\u0026ndash;36. \u003c/li\u003e\n\u003cli\u003eDima R, Tieppo Francio V, Towery C, Davani S. Review of Literature on Low-level Laser Therapy Benefits for Nonpharmacological Pain Control in Chronic Pain and Osteoarthritis. Altern Ther Health Med. 2018 Sep;24(5):8\u0026ndash;10. \u003c/li\u003e\n\u003cli\u003eGanjeh S, Rezaeian ZS, Mostamand J. Low Level Laser Therapy in Knee Osteoarthritis: A Narrative Review. Adv Ther. 2020 Aug;37(8):3433\u0026ndash;49. \u003c/li\u003e\n\u003cli\u003eAngelova A, Ilieva EM. Effectiveness of High Intensity Laser Therapy for Reduction of Pain in Knee Osteoarthritis. Brighina F, editor. Pain Res Manag. 2016;2016:9163618. \u003c/li\u003e\n\u003cli\u003eAlayat MSM, Abdel-Kafy EM, Elsoudany AM, Helal OF, Alshehri MA. Efficacy of high intensity laser therapy in the treatment of male with osteopenia or osteoporosis: a randomized placebo-controlled trial. J Phys Ther Sci. 2017 Sep;29(9):1675\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eAkaltun MS, Altindag O, Turan N, Gursoy S, Gur A. Efficacy of high intensity laser therapy in knee osteoarthritis: a double-blind controlled randomized study. Clin Rheumatol. 2021 May;40(5):1989\u0026ndash;95. \u003c/li\u003e\n\u003cli\u003eKim G-J, Choi J, Lee S, Jeon C, Lee K. The effects of high intensity laser therapy on pain and function in patients with knee osteoarthritis. J Phys Ther Sci. 2016 Nov;28(11):3197\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eOrnetti P, Dougados M, Paternotte S, Logeart I, Gossec L. Validation of a numerical rating scale to assess functional impairment in hip and knee osteoarthritis: comparison with the WOMAC function scale. Ann Rheum Dis. 2011 May;70(5):740\u0026ndash;6. \u003c/li\u003e\n\u003cli\u003eKrebs EE, Carey TS, Weinberger M. Accuracy of the Pain Numeric Rating Scale as a Screening Test in Primary Care. J Gen Intern Med. 2007;22(10):1453\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003ePonkilainen VT, H\u0026auml;kkinen AH, Uimonen MM, Tukiainen E, Sandelin H, Repo JP. Validation of the Western Ontario and McMaster Universities Osteoarthritis Index in Patients Having Undergone Ankle Fracture Surgery. J Foot Ankle Surg. 2019 Nov 1;58(6):1100\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eRuan MZC, Erez A, Guse K, Dawson B, Bertin T, Chen Y, et al. Proteoglycan 4 expression protects against the development of osteoarthritis. Sci Transl Med. 2013 Mar;5(176):176ra34. \u003c/li\u003e\n\u003cli\u003eHatta M, Surachmanto EE, Islam AA, Wahid S. Expression of mRNA IL-17F and sIL-17F in atopic asthma patients. BMC Res Notes. 2017;10(1):202. \u003c/li\u003e\n\u003cli\u003e\u0026Scaron;ifta P, Danilov D. Effects of high-intensity laser on gonarthrosis. Int J Inf Sci CCulture. 2015;14:18\u0026ndash;22. \u003c/li\u003e\n\u003cli\u003eWatts NB. Postmenopausal Osteoporosis: A Clinical Review. J Womens Health (Larchmt). 2018 Sep;27(9):1093\u0026ndash;6. \u003c/li\u003e\n\u003cli\u003eCui A, Li H, Wang D, Zhong J, Chen Y, Lu H. Global, regional prevalence, incidence and risk factors of knee osteoarthritis in population-based studies. EClinicalMedicine. 2020 Dec;29\u0026ndash;30:100587. \u003c/li\u003e\n\u003cli\u003eMagnusson K, Kumm J, Turkiewicz A, Englund M. A naturally aging knee, or development of early knee osteoarthritis? Osteoarthr Cartil. 2018 Nov;26(11):1447\u0026ndash;52. \u003c/li\u003e\n\u003cli\u003eAl Khatib F, Gouissem A, Mbarki R, Adouni M. Biomechanical Characteristics of the Knee Joint during Gait in Obese versus Normal Subjects. Vol. 19, International Journal of Environmental Research and Public Health. 2022. \u003c/li\u003e\n\u003cli\u003eLee R, Kean WF. Obesity and knee osteoarthritis. Inflammopharmacology. 2012 Apr;20(2):53\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eChen L, Zheng JJY, Li G, Yuan J, Ebert JR, Li H, et al. Pathogenesis and clinical management of obesity-related knee osteoarthritis: Impact of mechanical loading. J Orthop Transl [Internet]. 2020;24:66\u0026ndash;75. Available from: https://www.sciencedirect.com/science/article/pii/S2214031X2030067X\u003c/li\u003e\n\u003cli\u003eSobol E, Shekhter A, Guller A, Baum O, Baskov A. Laser-induced regeneration of cartilage. J Biomed Opt. 2011 Aug;16(8):80902. \u003c/li\u003e\n\u003cli\u003eKheshie AR, Alayat MSM, Ali MME. High-intensity versus low-level laser therapy in the treatment of patients with knee osteoarthritis: a randomized controlled trial. Lasers Med Sci. 2014 Jul;29(4):1371\u0026ndash;6. \u003c/li\u003e\n\u003cli\u003eKulchitskaya DB, Konchugova TV, Fedorova NE. Comparative evaluation of the effects of high-intensity and low-intensity laser radiation on microcirculation among patients with knee arthritis. In: Journal of Physics: Conference Series. 2017. p. 012015. \u003c/li\u003e\n\u003cli\u003eStiglić-Rogoznica N, Stamenković D, Frlan-Vrgoc L, Avancini-Dobrović V, Vrbanić TS-L. Analgesic effect of high intensity laser therapy in knee osteoarthritis. Coll Antropol. 2011 Sep;35 Suppl 2:183\u0026ndash;5. \u003c/li\u003e\n\u003cli\u003eViliani T, Martini C, Mangone G, Pasquetti P. High intensity laser therapy in knee osteoarthritis: comparison between two different pulsed-laser treatment protocols. Energy Heal. 2010;05:26\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eRhee DK, Marcelino J, Baker M, Gong Y, Smits P, Lefebvre V, et al. The secreted glycoprotein lubricin protects cartilage surfaces and inhibits synovial cell overgrowth. J Clin Invest. 2005 Mar;115(3):622\u0026ndash;31. \u003c/li\u003e\n\u003cli\u003eNurkolis, Fahrul (2023). CONSORT 2010 Checklist for Analysis of proteoglycan 4 mRNA expression on pain improvement and functional ability in knee osteoarthritis patients after high-intensity laser administration. figshare. Journal contribution. https://doi.org/10.6084/m9.figshare.23300609.v1\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"osteoarthritis, knee osteoarthritis, High-intensity laser therapy, PRG4 gene, proteoglycan 4, pain improvement, functional ability, physical function","lastPublishedDoi":"10.21203/rs.3.rs-7226444/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7226444/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eKnee osteoarthritis (KOA) is the most common type of arthritis and is the main cause of chronic musculoskeletal pain. High-intensity laser therapy (HILT) is a potential method for the management of KOA. This study aims to determine the PRG4 mRNA expression in patients with KOA by administering HILT to observe the changes in the PRG4 gene expression and followed by clinically assessing the pain and functional ability.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eThis study was a quasi-experimental research with pre- and post-intervention group designs. A total of 60 patients (aged 45\u0026ndash;65 years) diagnosed with KOA based on the criteria of the American College of Rheumatology (clinical and radiologist) and the Kellgren-Lawrence II criterion were involved in the study. The samples were divided into two groups, the intervention group (30 patients) and the control group (30 patients). In the intervention group, each patient was given HILT (using BTL-6000) with biostimulation mode on the lateral and medial sides of the knee for 10 minutes. Therapy was carried out twice a week for a total of 7 times.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eThere was an increase in mRNA expression of the PRG4 gene which occurred significantly higher in the intervention group. Similarly, for pain, a significant decrease in pain scores was obtained in both subject groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Functional abilities covering aspects of pain, stiffness, and physical function also improved significantly in both groups after one month (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), with better improvements in the group of subjects who received HILT with an average of 4.33 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThis study showed that HILT can reduce the pain of grade II KOA based on Kellgren-Lawrence, improving the functional ability of KOA patients. HILT also significantly improves the expression of the proteoglycan mRNA (PRG4) gene. Finally, HILT can be the method of choice in the treatment of osteoarthritis.\u003c/p\u003e","manuscriptTitle":"Analysis of proteoglycan 4 mRNA expression on pain improvement and functional ability in knee osteoarthritis patients after high-intensity laser administration","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-05 14:03:00","doi":"10.21203/rs.3.rs-7226444/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"91afbeb5-fa24-420d-b730-3c026a01abbd","owner":[],"postedDate":"August 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-08-08T11:38:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-05 14:03:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7226444","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7226444","identity":"rs-7226444","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.