The GAS2–KLF4 axis regulates mitochondrial apoptosis and therapeutic responsiveness in colorectal cancer

The GAS2–KLF4 axis regulates mitochondrial apoptosis and therapeutic responsiveness in colorectal cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The GAS2–KLF4 axis regulates mitochondrial apoptosis and therapeutic responsiveness in colorectal cancer Chi-Jung Huang, Ming-Hung Shen, Heng-Hui Lien, Ching-Long Lai, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9004103/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Impaired intrinsic apoptosis contributes to colorectal cancer (CRC) progression, yet the upstream regulators governing mitochondrial integrity remain incompletely defined. Growth arrest-specific protein 2 (GAS2) has been implicated in CRC malignancy, whereas Krüppel-like factor 4 (KLF4) functions as a tumor suppressor; however, their functional relationship in apoptotic regulation is unclear. Here, we demonstrate that GAS2 expression is elevated while KLF4 is reduced in advanced CRC tissues, metastatic CRC cell lines, and The Cancer Genome Atlas datasets, exhibiting a significant inverse correlation. Genetic suppression of GAS2 restored KLF4 expression and induced mitochondrial fragmentation, membrane depolarization, and apoptotic cell death in CRC cells. Silencing KLF4 attenuated mitochondrial depolarization following butyrate treatment, indicating that KLF4 is required for mitochondrial apoptotic responses downstream of GAS2 suppression. Ultrastructural analyses revealed that butyrate induces mitochondrial remodeling and reduces lysosomal density, changes that are consistent with activation of intrinsic apoptotic pathways. In vivo, administration of the butyrate-producing bacterium Butyricicoccus pullicaecorum mitigated tumor progression in a chemically induced CRC model and partially reversed the GAS2–KLF4 imbalance. Furthermore, GAS2 knockdown or idarubicin treatment independently reduced tumor burden and metabolic activity in xenograft models. Collectively, these findings identify the GAS2–KLF4 axis as a regulator of mitochondrial apoptosis in CRC and suggest that targeting GAS2 may restore apoptotic vulnerability and enhance therapeutic responsiveness. Health sciences/Diseases/Gastrointestinal diseases/Gastrointestinal cancer/Colorectal cancer/Colon cancer Biological sciences/Genetics/Gene regulation Colorectal cancer Mitochondrial apoptosis GAS2 KLF4 Butyrate Intrinsic cell death Therapeutic responsiveness Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION Colorectal cancer (CRC) remains a major cause of cancer-related mortality worldwide, largely due to tumor progression, metastasis, and resistance to therapy [ 1 , 2 ]. A hallmark of CRC progression is impaired intrinsic apoptosis, particularly dysregulation of mitochondrial-mediated cell death pathways [ 3 ]. Mitochondrial integrity and dynamics critically determine apoptotic commitment [ 3 , 4 , 5 ], yet the upstream regulatory networks governing these processes in CRC remain incompletely defined. Identifying molecular axes that regulate mitochondrial apoptosis may provide mechanistic insight and therapeutic opportunities to restore apoptotic vulnerability and suppress CRC progression [ 6 , 7 ]. Growth arrest-specific 2 (GAS2) has emerged as a regulator of cytoskeletal dynamics and apoptosis and is increasingly implicated in CRC tumorigenesis [ 8 ]. Elevated GAS2 expression has been reported in metastatic CRC cell lines, including SW620, and is associated with tumor aggressiveness, early relapse, and metastasis [ 8 , 9 , 10 ]. Its aberrant upregulation suggests a potential oncogenic role in CRC and positions GAS2 as a candidate therapeutic target [ 10 , 11 , 12 , 13 ]. However, the downstream pathways through which GAS2 influences apoptotic signaling in CRC remain incompletely understood. In contrast, Krüppel-like factor 4 (KLF4) functions as a tumor suppressor in CRC and other epithelial malignancies [ 14 , 15 ]. KLF4 regulates proliferation, differentiation, and apoptosis, and reduced KLF4 expression correlates with unfavorable clinical outcomes in CRC patients [ 16 , 17 ]. Notably, KLF4 has been implicated in mitochondrial stress responses and transcriptional regulation of genes governing cell fate decisions. Furthermore, KLF4 expression can be induced by butyrate, a short-chain fatty acid (SCFA) generated by gut microbial fermentation [ 18 , 19 ]. SCFAs, particularly butyrate, exert anti-inflammatory and antitumorigenic effects within the colonic microenvironment [ 20 , 21 ]. Reduced fecal concentrations of SCFAs have been associated with increased CRC risk and incidence [ 22 , 23 ]. Butyrate has been shown to induce apoptosis and suppress tumor growth through multiple mechanisms, including histone deacetylase inhibition and modulation of gene expression programs [ 24 , 25 , 26 ]. Whether microbiota-derived butyrate regulates mitochondrial apoptotic pathways through coordinated modulation of GAS2 and KLF4 in CRC, however, remains unclear. In this study, we investigated the hypothesis that a GAS2–KLF4 regulatory axis governs mitochondrial apoptotic signaling in CRC and that microbiota-derived butyrate or butyrate-producing probiotics can modulate this pathway to suppress tumor progression. Using in vitro and in vivo CRC models, we examined the impact of GAS2 suppression, KLF4 regulation, and butyrate exposure on mitochondrial integrity, apoptotic responses, and therapeutic sensitivity, including responsiveness to the topoisomerase II inhibitor idarubicin (IDA). MATERIALS AND METHODS Participants, animals, and Butyricicoccus pullicaecorum Formalin-fixed paraffin-embedded tissue samples from CRC patients with different AJCC stages were obtained from the Cathay General Hospital Biobank (Taipei, Taiwan) with institutional approval (approval no. HBKEC-20230313-1). The Institutional Review Board of Cathay General Hospital waived the requirement for informed consent for tissue collection, as all samples were anonymized and unlinked (approval no. CGH-P111088). BALB/cByJNarl mice (4–6 weeks old) were obtained from the National Laboratory Animal Center (National Applied Research Laboratories, Taipei, Taiwan). DMH and DSS were used to induce colon tumor development, as described in our previous study [ 27 ]. In brief, a small group of mice (3–5 per plastic cage) was housed in an individually ventilated cage rack system (Tecniplast, Varese, Italy) under controlled conditions: humidity at 50% ± 10%, 12/12-hour light/dark cycle, and temperature of 23°C ± 2°C. The study included three groups: (1) Control Group (CG) ( n = 4) – no DMH/DSS treatment and no Butyricicoccus pullicaecorum ( B. pullicaecorum ) administration; (2) DMH/DSS Group ( n = 8) – received DMH via intraperitoneal injection and DSS in drinking water, without B. pullicaecorum administration; (3) DMH/DSS/BP Group ( n = 8) – received DMH/DSS treatment combined with B. pullicaecorum administration. To assess whether GAS2 retains its tumorigenic effect in vivo under IDA treatment, we employed a xenograft model using severe combined immunodeficient (SCID) mice, as previously described [ 25 ]. Twelve male SCID mice (CB17/Icr-Prkdcscid/IcrIcoCrlBltw) from BioLasco Taiwan Co., Ltd (Taipei, Taiwan) were housed under specific pathogen-free conditions in an individually ventilated cage system (Tecniplast) at the Animal Research Center of Cathay General Hospital. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Cathay General Hospital under protocols IACUC 107-009 (BALB/cByJNarl mice) and IACUC 109 − 024 (SCID mice). These animal experiments complied with Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines, adhering to the principles of Reduction, Refinement, and Replacement. All efforts were made to minimize both the number of animals used and their suffering. To investigate its molecular effects on colon tumor development, the gut bacterium B. pullicaecorum (3.125 × 10⁷ colony-forming units [CFUs] in 100 µL broth) was administered via oral gavage. The strain used ( B. pullicaecorum BCRC 81109) was obtained from the Bioresource Collection and Research Center (Hsinchu, Taiwan). Bacterial cultures were grown in modified peptone-yeast extract broth under anaerobic conditions at 37°C for 3 days, in accordance with our previously established protocol [ 27 ]. Cell lines and lentiviral knockdown of target genes Two CRC cell lines (SW480, ATCC CCL-228 and SW620, ATCC CCL-227; American Type Culture Collection [ATCC], Manassas, VA, USA) were used in this study. The negative expression relationship of GAS2 and KLF4 was also verified in the SW480 cells, originating from primary CRC, and SW620 cells, derived from a lymph node metastatic site of the same CRC patient 1 year later [ 28 ]. These cell lines were cultured in Leibovitz’s L-15 Medium and maintained in a CO 2 -free incubator. The culture medium contained 10% fetal bovine serum. The clinical characteristics of the cell lines were obtained from the ATCC website ( http://www.atcc.org ). The lentiviral construct pLKO_TRC005-GAS2 (clone ID: TRCN0000420792), containing short hairpin (sh) RNA targeting GAS2 (shGAS2), was employed to reduce GAS2 expression in SW620 cells (SW620-shGAS2). As a negative control for shGAS2, the vector pLKO_TRC005-luciferase (Luc) (clone ID: TRCN0000231719), targeting LUC was used (SW620-shLuc). Similarly, the construct pLKO_TRC2-KLF4 (clone ID: TRCN0000231078) was used to knock down KLF4 (shKLF4) expression in SW620 cells (SW620-shKLF4), with pLKO-TRC2.Void (VOID; clone ID: ASN0000000001) served as a negative control (SW620-VOID). All lentiviral constructs were obtained from the RNA Technology Platform and Gene Manipulation Core (Sinica, Taiwan). A total of 1.25 x 10 5 cells/well were cultured in a 6-well plate for 24 h, and subsequent lentiviral infections (multiplicity of infection = 3) were performed to knock down the expression of the target gene in cells. Subsequently, a medium containing 2 mg/mL puromycin (Thermo Fisher Scientific, Waltham, MA, USA) was used to select for and maintain stable clones. Following incubation for 48 h, the infection efficiency was determined using quantitative polymerase chain reaction. Cignal 45-pathway reporter array SW620-shLuc and SW620-shGAS2 cells were incubated for 48 h in a CO 2 -free incubator. Analysis of signaling pathways in the cells was then carried out using the Cignal 45-Pathway Reporter Array Kit (Cat. No. CCA-901L; Qiagen, Germantown, MD, USA) by quantifying the luminescence signal according to the manufacturer’s instructions. Expression values were normalized by establishing a sample ratio value to discriminate between genuine cellular responses (firefly luminescence signal) and nonspecific responses (Renilla luminescence signal) and plotted as log 2 fold change comparing SW620-shGAS2 with SW620-shLuc. RNA isolation, cDNA synthesis, and gene quantitation Total RNA was extracted from cells using the Easy Pure Total RNA Mini Kit (Bioman Scientific Co. Ltd, Taipei, Taiwan). Single-stranded cDNA was synthesized from 1 g total RNA using oligo(dT)12 primers with the High-Capacity cDNA Reverse Transcriptase Kit (Cat. No. 4368813; Thermo Fisher Scientific), following the manufacturer’s protocol. The relative quantification of GAS2 was conducted as described in our previous report [ 8 ]. Primers and TaqMan probes for KLF4, nuclear respiratory factor 1, nuclear factor erythroid 2-like 2, and SP1 were customized based on the sequences listed in Table 1 . Gene expression levels were analyzed using the 2–∆∆Cq method and normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression. All gene expression experiments were performed in triplicate, yielding consistent results. Table 1 Sequences of primers and TaqMan probes in quantifying gene expressions Gene 1 Accession no. Comment Sequence (5’ to 3”) KLF4 NM_004235 sense ttggggttttgggttttg antisense cgtggagaaagatgggag probe ccatgtcagactcgccaggt NRF1 NM_005011 sense cttatccaggttggtacggg antisense catctcacctccctgtaacg probe tgccgtggctgatggagaggtggaa NRF2 NM_006164 sense gtccacattttcttaatgc antisense gagtgaatggcttaaagtag probe tccttcagcagcatcctctcc SP1 NM_138473 sense cacaaacgtacacacacagg antisense ggcctcccttcttattctgg probe tgcctgccctgagtgtcctaagcgctt GAPDH NM_002046 sense acaacgaatttggctacagc antisense agtgagggtctctctcttcc probe accaccagccccagcaagagcacaa 1 KLF4, Krüppel-like factor 4; NRF1, nuclear respiratory factor 1: NRF2, nuclear factor erythroid 2-like 2; SP1, Sp1 transcription factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. Protein extraction and Western blot analysis Protein extraction and Western blot analysis To investigate the relationship between GAS2 and KLF4 expression levels, SW620 cells were treated with the KLF4-inducer troglitazone (TGZ) (Cat. No. HY-50935; MedChemExpress, Monmouth Junction, NJ, USA) at concentrations of 0, 10, and 50 M for 6 h [ 29 ], or subjected to GAS2 knockdown. Then, changes in their respective protein expression levels were analyzed. Extracts from SW620, SW620-shLuc, and SW620-shGAS2 cells were prepared using the PRO-PREP Protein Extraction Solution (Intron Biotechnology, Inc., Seongnam, Kyonggi-do, South Korea) in the presence of protease inhibitor (Cat. No. P8340; Merck KGaA, Inc., Darmstadt, Germany), following the manufacturer’s instructions. Protein concentration in the cell lysate was quantified using Bio-Rad Protein Assay Reagent (Cat. No. 500-0006; Bio-Rad Laboratories, Inc., Hercules, CA, USA). For sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), 15 g protein per lane was denatured at 95C for 10 min, separated on 12% SDS–PAGE in 1 NuPAGE LDS sample buffer (Thermo Fisher Scientific), and transferred to the PolyScreen 2 PVDF Transfer membrane (0.2 m; PerkinElmer, Inc., Waltham, MA, USA). Membranes were blocked in 3% bovine serum albumin (Cat. No. ALB001.100; BioShop Canada Inc., Ontario, Canada) for 1 h at room temperature and subsequently incubated with the following primary antibodies for 1 h at room temperature: anti-KLF4 (1:500, Cat. No. 11880-1-AP; Proteintech, Rosemont, IL, USA), anti-GAS2 (1:1000, Cat. No. ab55076; Abcam, Cambridge, MA, USA), and anti-GAPDH (1:10,000, Cat. No. 60004-1-Ig; Proteintech). GAPDH served as a loading control for housekeeping gene expression. After incubation with primary antibody, membranes were incubated with a biotin-conjugated goat anti-rabbit IgG antibody (H + L) (1:1,000, Cat. No. BA-1000; Vector Laboratories, Burlingame, CA, USA) or biotin-conjugated goat anti-mouse IgG antibody (H + L) (1:1,000, Cat. No. BA-9200; Vector Laboratories) for 60 min at room temperature. Target signals were amplified using the VECTASTAIN ABC-AmP Kit (Cat. No. AK-6602; Vector Laboratories) according to the manufacturer’s protocol and using the FluorChem FC2 Imaging System (Cell Biosciences, Inc., Santa Clara, CA, USA). MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay SW620 cells (50,000 cells per well) were seeded in 100 L media in a 96-well plate. Following treatment with 5 mM butyrate for 24 h or TGZ (0, 10, 50 M) for 6 h, the cells were incubated with 10 L MTT reagent (Cat. No. M5655; Sigma, St. Louis, MO, USA) for approximately 4 h. A detergent solution was subsequently added to lyse the cells and solubilize the resulting formazan crystals. Absorbance was measured colorimetrically at a wavelength of 570 nm. In vivo imaging system detection and positron emission tomography of xenograft tumor induced by SW620 cells under IDA treatment As in our previous publication [ 25 ], 1 x 10 6 SW620 cells/0.2 mL phosphate-buffered saline (PBS) with or without GAS2 knockdown co-expressing the luciferase gene from the pGL3-Basic vector were inoculated subcutaneously on the right side of the back. Experimental groups received IDA (1.5 mg/kg) or vehicle (PBS) once a week via intraperitoneal injection for 28 days, and body weight was recorded weekly. The xenograft tumors were monitored using an in vivo imaging system (IVIS) luciferase imaging. Briefly, mice were injected intraperitoneally with 150 mg/kg luciferin (VivoGlo Luciferin In Vivo Grade; Promega, Madison, WI, USA) for 10 min before being anesthetized with 2.5% isoflurane (Attane; Panion & BF Biotech Inc., Taipei, Taiwan) and allowed to rest for 10 min before being anesthetized with 2.5% isoflurane (Attane; Panion & BF Biotech Inc.) combined with 100% oxygen. Tumor imaging was performed using the IVIS Lumina XRMS In Vivo Imaging System (PerkinElmer) at an emission wavelength of 680 nm using a Cy5 filter. The acquired images were analyzed using the IVIS software suite, through region of interest (ROI) analysis of selected specific regions, providing critical insights into the localization and distribution of fluorescence within the tumors. 18 F-fluorodeoxyglucose ( 18 F-FDG) was procured from a commercial manufacturer (Global Medical Solutions Taiwan, Ltd, Taipei, Taiwan). Quality control was performed using radio-high-performance liquid chromatography and radio-thin-layer chromatography. Immediately after preparation, the radiopharmaceutical was transported to the PET Imaging Laboratory (Animal Imaging Center, Taipei Medical University, Taipei, Taiwan) for nano positron emission tomography (NanoPET) imaging, which was performed using the NanoPET SuperArgus System (Sedecal, Madrid, Spain). Before the emission scan, a 30-min transmission scan was performed using a [Ge-68] pin source (18.5 MBq; Siemens Medical Systems, Malvern, PA, USA) for attenuation correction. Mice were anesthetized with isoflurane gas (3% isoflurane in 50% oxygen, 1 mL/min; Benson Medical Industries, Markham, Ontario, Canada). 18 F-FDG was administered as a bolus injection (100 L in PBS) with an activity of approximately 18.5 MBq via manual tail vein injection. The mice were placed in a stereotactic head holder in a prone position on the PET scanner bed. Serial static PET images were acquired 60 to 75 min post-injection. The NanoPET system applied scatter correction, random correction, and attenuation correction, providing an effective axial/transaxial field of view (FOV) of 4.8/6.7 cm, spatial resolution under 2 mm, and sensitivity exceeding 2.5% across the entire FOV. Images were reconstructed using the 2-D ordered subset expectation maximization algorithm (GE Healthcare, Buc, France) into voxels measuring 0.3875 x 0.3875 x 0.775 mm³. Co-registered PET images were analyzed using PMOD image analysis software, version 4.0 (PMOD Technologies Ltd, Zurich, Switzerland). Decay-corrected time–activity curves were presented in standardized uptake value units, normalized by body weight (g) to account for differences in mouse weights and administered doses. In addition, tumor regions were selected and analyzed using PMOD software. The analysis was conducted by an experienced technologist to minimize inter- and intra-reader variability. Hematoxylin and eosin staining, immunohistochemistry, and interpretation Thin sections, 5 µm thick, were stained with hematoxylin and eosin (H&E) and immunostained using the avidin–biotin immunoperoxidase method. H&E staining was performed using the Tissue-Tek DRS™ 2000 Automated Slide Stainer (Sakura Finetek USA, Inc., Torrance, CA, USA) following a standardized protocol at room temperature. The process included: (1) deparaffinization, two consecutive xylene washes (5 min each) followed by a 7-min xylene change; (2) rehydration, sequential alcohol immersions (100% alcohol for 60 s, 100% alcohol for 90 s, 95% alcohol for 60 s, 75% alcohol for 60 s), followed by a 3-min rinse in running water; and (3) staining, hematoxylin staining for 5 min, followed by five dips in 1% acid alcohol (1% hydrochloric acid in 70% alcohol). After staining, the slides were rinsed, counterstained with eosin for 3 min at room temperature, dehydrated through graded alcohol solutions, and cleared in xylene before mounting. Immunohistochemistry (IHC) assays were performed using the BenchMark XT automated staining system (Roche Diagnostics, Basel, Switzerland). Immunosignals were visualized with the OptiView DAB IHC Detection Kit (Roche). Briefly, the automated protocol included deparaffinization, antigen retrieval, and incubation with either anti-GAS2 antibody (1:400, ab55076; Abcam) or anti-KLF4 antibody (1:500, 11880-1-AP; Proteintech). Image acquisition was carried out using the VENTANA DP 200 slide scanner (Roche). Apoptosis analysis in response to butyrate treatment Cellular apoptosis induced by butyrate treatment was assessed by measuring mitochondrial membrane potential loss. Briefly, SW620-shLuc and SW620-shKLF4 cells were seeded at a density of 1.0 x 10⁶ cells per well in 1.5 mL culture medium in a 6-well plate and treated with 5 mM butyrate for 24 h. Apoptosis was evaluated using the JC-1 mitochondrial membrane potential assay (Solution 7, Cat. No. 910–3007; ChemoMetec, Allerod, Denmark) according to the manufacturer’s instructions. Fluorescence intensity, indicating green and red signals, was visualized in the treated cells. In addition, fluorescence images were captured using the Olympus IX70 fluorescence microscope (Olympus, Tokyo, Japan). Transmission electron microscopy analysis SW620 cells were seeded in 10 cm dishes overnight and then cultured for an additional 24 h in the presence or absence of 5 mM butyrate. Cells were subsequently collected using trypsin treatment and washed three times with cold PBS. Then, the cells were fixed in fixative buffer containing 4% paraformaldehyde (Cat. No. 15710; Electron Microscopy Sciences, Hatfield, PA, USA) and 2.5% glutaraldehyde (Cat. No. 16220; Electron Microscopy Sciences), followed by post-fixation in 1% osmium tetroxide (Cat. No. 19190; Electron Microscopy Sciences) for 2 h. The fixed cells were gradually dehydrated using increasing concentrations of ethanol. Once fully dehydrated in 100% ethanol, the cells were infiltrated with a plastic monomer using the Spurr Resin Kit (Cat. No. 14300; Electron Microscopy Sciences). Ultra-thin sections (70 nm) were cut using an ultramicrotome (EM-UC7; Leica Microsystems, Wetzlar, Germany). Images were captured using a JEOL JEM-1400 electron microscope (JEOL, Tokyo, Japan) at 100 kVA. TCGA-based gene expression and correlation analysis To investigate the expression profiles and correlation of GAS2 and KLF4 in CRC, transcriptomic data were retrieved from The Cancer Genome Atlas (TCGA) database through the GEPIA2 web server ( http://gepia2.cancer-pku.cn/ ), which integrates TCGA and GTEx RNA sequencing datasets using a standardized processing pipeline. Differential expression analysis was performed to compare GAS2 and KLF4 expression levels between normal colorectal and tumor tissues. Expression values were normalized in transcripts per million (TPM), and results were presented as log 2 (TPM + 1). Median expression levels were used to illustrate group-wise differences. To assess the association between GAS2 and KLF4, Spearman correlation analysis was conducted on the TCGA CRC dataset. The correlation coefficient (r) and P-value were reported. Survival analysis was also performed, and patients were stratified into low- and high-expression groups based on the median expression cutoff for GAS2 and KLF4. Overall survival was plotted using Kaplan–Meier curves and assessed with log-rank tests, applying a P -value < 0.05 as the threshold for statistical significance. Statistical analyses The unpaired Student’s t test was used to compare the means between two groups, whereas analysis of variance was used to compare the means among three or more groups, followed by Tukey’s post hoc test. P < 0.05 was considered statistically significant. RESULTS Upregulation of KLF4 signaling following GAS2 suppression in metastatic CRC cells To investigate the role of GAS2 in CRC tumorigenesis, we first confirmed its expression profile in metastatic CRC cells. We generated SW620 cells with GAS2 knockdown (only 23% of baseline expression) to explore downstream signaling alterations and functional outcomes (Fig. 1 A). Notably, pathway analysis showed that KLF4 signaling was among the most significantly upregulated, prompting further validation. As shown in Fig. 1 B, five signaling pathways (SP1, KLF4, heavy metals, endoplasmic reticulum stress, and amino acid deprivation) increased following GAS2 knockdown, whereas only the antioxidant response pathway showed reduced gene expression. Notably, the pathway of antioxidant response expression remarkably decreased (log 2 value, − 3.0), whereas SP1 (log 2 value, 1.4) and KLF4 (log 2 value, 1.0) pathways increased by at least twofold. However, these six pathways comprising 11 genes exhibited varying responses to GAS2 knockdown in SW620 cells (Table 1 ). Among these, four genes (SP1, NRF1, NRF2, and KLF4) in the pathways of SP1 and KLF4 were selected for comparison in SW620 cells with different GAS2 expression levels (SW620-shLuc vs SW620-shGAS2) (Fig. 1 C-F). Only KLF4 showed similar results in the Cignal 45-pathway reporter array. shGAS2-SW620 cells exhibited significantly higher levels of KLF4 (4.08-fold, P < 0.01) than shLuc-SW620 cells (Student’s t test). However, KLF4 gene expression showed a negative correlation trend with GAS2 expression in SW620 cells. This difference in expression at the mRNA level also appeared at the protein level. As shown in Fig. 1 G, in SW620-shGAS2 cells, the protein expression of KLF4 was increased. Stage-dependent and inversely correlated expression of GAS2 and KLF4 in CRC tissues The opposing expression patterns of GAS2 and KLF4 correlate with CRC progression and histological severity. In Fig. 2 A, histological assessment of H&E-stained tissue sections reveals a continuum of epithelial alterations across two CRC samples. In CRC01, the left region displays preserved glandular structures consistent with non-neoplastic colonic mucosa, while the right region exhibits increased epithelial cellularity and mild nuclear atypia, indicative of early dysplastic changes. In CRC02, more advanced pathology is observed: the left side shows moderate to high-grade dysplasia with glandular disorganization and nuclear hyperchromasia, whereas the right side is characterized by infiltrative nests of pleomorphic epithelial cells with prominent nuclear enlargement and hyperchromasia, diagnostic of invasive moderately differentiated adenocarcinoma. Corresponding immunohistochemical staining demonstrates a stage-dependent expression pattern, with GAS2 expression progressively upregulated from dysplasia to carcinoma, supporting its role in malignant progression. In contrast, KLF4 expression is progressively diminished, consistent with loss of differentiation and attenuation of its tumor-suppressive function. This trend is further corroborated in an additional CRC patient sample shown in Fig. 2 B. The H&E-stained section reveals non-neoplastic mucosa on the left and moderately differentiated adenocarcinoma on the right (black arrows), with features of architectural distortion and cytological atypia. GAS2 staining is markedly increased in the tumor region (red arrows), while nearly absent in the adjacent non-tumor tissue. Although KLF4 expression was detectable (blue arrow), it was predominantly localized in the cytoplasm and appeared reduced in regions with high GAS2 expression (red arrows), with no evident nuclear staining even in non-neoplastic epithelium. Notably, in the tumor compartment, KLF4 remains cytoplasmic, reinforcing the notion of functional mislocalization rather than complete loss. This subcellular redistribution may reflect impaired transcriptional activity and further supports the involvement of KLF4 inactivation and GAS2 upregulation in CRC pathogenesis. An association with unfavorable patient prognosis was also observed in relation to these expression patterns, as supported by TCGA meta-analysis data. Specifically, GAS2 was significantly upregulated in CRC tissues compared to normal controls, as reflected by higher median TPM values in tumors (Fig. 2 C), while KLF4 was consistently downregulated, aligning with its tumor-suppressive role (Fig. 2 D). A moderate inverse correlation between GAS2 and KLF4 expression was identified (r = − 0.3, P < 0.001; Fig. 2 E). Although not statistically significant, high GAS2 expression trended toward poorer prognosis, whereas elevated KLF4 expression was associated with improved survival outcomes (Fig. 2 F and G). Inverse regulation of GAS2 and KLF4 in CRC cells and synergistic anti-proliferative effects of butyrate and troglitazone Isogenic CRC cell lines SW480 and SW620, which possess different metastatic potentials, were used to assess the expression levels of GAS2 and KLF4. Briefly, the relative expression level of GAS2 in SW620 cells was 403.10 times higher than that in SW480 cells (Fig. 3 A, P = 0.010), whereas the relative level of KLF4 in SW620 cells was only 0.17 times higher than that in SW480 cells (Fig. 3 B, P = 0.013). In addition, we observed that, similar to the peroxisome proliferator-activated receptor gamma agonist TGZ [ 29 ], the SCFA butyrate could upregulate KLF4 expression. Treatment with 5 mM butyrate for 24 h reduced GAS2 expression by 0.68-fold (Fig. 3 C, P = 0.015) and increased KLF4 expression by 2.84-fold in SW620 cells (Fig. 3 D, P = 0.038). Furthermore, treating SW620 cells with 50 µM troglitazone (TGZ), a PPARγ agonist, has been found to upregulate KLF4 expression for 6 h significantly elevated KLF4 expression by at least 7.98-fold, compared with the changes in GAS2 expression (Fig. 3 E, P < 0.000001). Immunoblot analysis also demonstrated the differential expression of TGZ-induced KLF4 and GAS2 at the protein level (Fig. 3 F). The altered expression of these two genes influenced the proliferation of SW620 cells. As shown in Fig. 3 G, both 5 mM butyrate and 50 µM TGZ significantly inhibited the proliferation of SW620 cells compared to untreated controls (all P < 0.001). Moreover, 50 µM TGZ exhibited a stronger inhibitory effect compared to 10 µM TGZ, which may correspond to the findings in Fig. 3 E, where 50 µM TGZ induced a higher expression level of KLF4 in SW620 cells. Compared to cells treated with 50 µM TGZ alone, the combined treatment with 5 mM butyrate and 50 µM TGZ was also found to further enhance the inhibition of cell proliferation ( P = 0.002). Comprehensively, under co-treatment with 5 mM butyrate and 50 µM TGZ, the growth rate of SW620 cells was reduced to only 0.42 folds of that in the untreated control group, representing the most pronounced inhibition of cancer cell growth observed in this study ( P < 0.001). B . pullicaecorum attenuates CRC progression and reverses GAS2–KLF4 expression patterns in a mouse model To extend the findings from human CRC tissues, we next evaluated the impact of the butyrate-producing gut microbe B . pullicaecorum on CRC progression using a DMH/DSS-induced mouse model (Fig. 4 ). As shown in Fig. 4 A, the colonic inner surfaces of control mice appeared smooth with no visible nodules. In contrast, mice treated with DMH/DSS developed prominent nodular formations and multiple large lumps, indicative of advanced CRC. However, B . pullicaecorum administration markedly mitigated these changes, resulting in relatively smooth colonic mucosa with only faint or minor nodular growths. These macroscopic findings suggest that B . pullicaecorum attenuates tumor progression in this experimental model. Histological analysis further supported this effect. Figure 4 B shows that the total tumor burden in the distal colon (approximately 1.5 cm from the anus) of B . pullicaecorum -treated mice was visibly reduced compared to untreated DMH/DSS-induced CRC mice. Colon sections from control mice were histologically normal, with no signs of epithelial disorganization, fibrosis, inflammation, or hyperplasia. In contrast, pronounced epithelial dysplasia was observed in CRC-bearing mice (Fig. 4 C), which appeared attenuated following B . pullicaecorum administration. Quantitative analysis revealed a reduction in dysplastic area percentage (from 81% to 64%) and a decrease in the tumor-stromal ratio (TSR) (from 4.0 to 2.3) upon B . pullicaecorum treatment (Fig. 4 D). Extended group-based statistical comparisons confirmed these effects: compared to untreated CRC mice (dysplastic area: 75.8%; TSR: 3.2), B . pullicaecorum -treated mice exhibited a significantly lower dysplastic area (64.9%, P = 0.001; Fig. 4 E) and reduced TSR (2.2, P = 0.021; Fig. 4 F). To determine whether these morphological improvements were associated with molecular changes, we performed immunohistochemical staining for GAS2 and KLF4 in colonic tissue sections. As shown in Fig. 4 G, both proteins were barely detectable in the control group. In DMH/DSS-induced CRC tissues, GAS2 was strongly expressed, while KLF4 was weak and cytoplasmic, consistent with the patterns observed in human CRC tissues (Fig. 2 ). Importantly, B . pullicaecorum treatment led to a marked reduction in GAS2 expression and restoration of KLF4 levels, suggesting that probiotic administration reverses the GAS2–KLF4 imbalance associated with tumor progression. These findings collectively demonstrate that the expression dynamics of GAS2 and KLF4 in the mouse CRC model parallel those observed in human CRC tissues, and further highlight the potential of B . pullicaecorum in modulating the molecular and pathological features of CRC. Butyrate induces KLF4-dependent mitochondrial apoptotic responses in CRC cells Previous results suggested that butyrate (5 mM, in vitro ) or B. pullicaecorum (10⁷ CFU/mL, in vivo ) may suppress CRC progression by modulating GAS2 and KLF4 expression. To further explore the mechanistic link between these molecular changes and organelle integrity, we examined mitochondrial morphology, lysosomal abundance, and mitochondrial membrane potential in SW620 cells following butyrate treatment (Fig. 5 ). Transmission electron microscopy (TEM) provided high-magnification images of untreated (Fig. 5 A) and butyrate-treated (Fig. 5 B) SW620 cells. In untreated cells, oval mitochondria with visible cristae were observed alongside numerous cytoplasmic vesicles and electron-dense lysosomes, hallmarks of metabolically active cancer cells. In contrast, cells treated with 5 mM butyrate exhibited mitochondria with altered morphology, including more elongated or rounded profiles and cristae loss. Additionally, mitochondrial fission events (indicated by white arrowheads) were frequently detected in the butyrate-treated group, suggesting the activation of mitochondrial remodeling and apoptotic signaling. Notably, the number and density of lysosomes were visibly reduced in butyrate-treated cells compared to controls, implying suppression of lysosomal or autophagic flux in response to butyrate. Because mitochondrial dynamics are tightly linked to intrinsic apoptosis, we next evaluated changes in mitochondrial membrane potential using the JC-1 assay (Fig. 5 C). In control SW620-shLuc cells expressing endogenous KLF4, butyrate induced a shift in JC-1 fluorescence from red (aggregated form) to green (monomeric form), indicating mitochondrial membrane depolarization. However, this shift was absent in SW620-shKLF4 cells, suggesting that KLF4 is essential for butyrate-induced mitochondrial dysfunction and apoptosis. Together, these findings indicate that butyrate promotes mitochondrial fission and membrane depolarization while reducing lysosomal density. Together, these organelle alterations accompany KLF4-dependent activation of intrinsic apoptotic pathways and may contribute to the anti-tumor effects of butyrate in CRC cells. GAS2 silencing and idarubicin additively reduce tumor burden and metabolism in vivo To further explore therapeutic strategies targeting the GAS2–KLF4 axis, we investigated whether silencing GAS2 or treating with idarubicin (IDA), a topoisomerase II inhibitor, could suppress tumor growth in vivo (Fig. 6 ). Xenograft tumors were established on the dorsal flank of SCID mice using SW620 cells with GAS2 knockdown (SW620-shGAS2) or control vector (SW620-shLuc), with or without IDA treatment. In vivo bioluminescence imaging revealed significant reductions in ROI luminescence in mice bearing SW620-shGAS2 tumors or receiving IDA treatment (SW620-shLuc/IDA), compared to untreated controls (SW620-shLuc) (Fig. 6 A). Quantitative analysis confirmed that IDA significantly reduced ROI values ( P = 0.038), while GAS2 knockdown alone also led to a substantial decline. However, combining GAS2 silencing with IDA (SW620-shGAS2/IDA) did not produce further additive effects (Fig. 6 B). Tumor volume and glucose metabolism were further assessed via 18 F-FDG PET imaging (Fig. 6 C–E). Tumors formed by SW620-shLuc cells were larger and exhibited higher 18 F-FDG uptake (SUVmean) compared to those in other groups. IDA treatment alone reduced tumor size with borderline statistical significance ( P = 0.059), whereas GAS2 knockdown resulted in a significant size reduction ( P = 0.026) (Fig. 6 D). Importantly, 18 F-FDG uptake was also attenuated in tumors from mice treated with IDA or bearing GAS2-silenced tumors (Fig. 6 E), reflecting reduced metabolic activity. Collectively, these data demonstrate that both GAS2 suppression and IDA treatment can independently inhibit CRC tumor growth and metabolism in vivo, supporting further investigation of therapeutic strategies targeting the GAS2–KLF4 axis. DISCUSSION The present study identifies the GAS2–KLF4 axis as a regulator of mitochondrial apoptosis in CRC. Our data demonstrate that GAS2 expression is elevated whereas KLF4 is reduced in advanced CRC tissues and metastatic cell models, with an inverse correlation observed in patient samples and TCGA datasets. Functionally, suppression of GAS2 restored KLF4 expression and promoted mitochondrial depolarization and apoptotic responses, supporting a role for this axis in governing intrinsic cell death susceptibility. Although GAS2 was initially characterized as a cytoskeletal-associated protein involved in growth arrest, accumulating evidence suggests context-dependent functions in cancer [ 30 , 31 , 32 ]. In CRC, GAS2 overexpression has been associated with tumor aggressiveness and metastasis [ 8 , 10 , 11 ]. Our findings extend these observations by linking GAS2 suppression to restoration of KLF4 and mitochondrial apoptotic signaling. While the precise molecular mechanism connecting GAS2 to KLF4 regulation requires further clarification, the consistent inverse relationship across experimental systems supports a functional interaction influencing apoptotic vulnerability. KLF4 is a well-established tumor suppressor with roles in differentiation, cell-cycle regulation, and apoptosis [ 33 , 34 ]. Here, KLF4 was required for mitochondrial depolarization following butyrate exposure, indicating that KLF4 contributes to intrinsic apoptotic responses in CRC cells. Ultrastructural analyses revealed mitochondrial remodeling and reduced lysosomal density following butyrate treatment. These structural alterations are consistent with activation of intrinsic apoptotic pathways and reflect coordinated organelle remodeling during apoptotic commitment. Together with mitochondrial depolarization data, these findings support a role for KLF4 in regulating mitochondrial integrity during cell death induction. Butyrate, a microbiota-derived short-chain fatty acid, has been widely recognized for its anti-tumorigenic properties [ 25 , 35 , 36 ]. Beyond its role as a histone deacetylase inhibitor, our data suggest that butyrate modulates the GAS2–KLF4 axis and promotes mitochondrial apoptotic signaling. Consistently, administration of the butyrate-producing bacterium Butyricicoccus pullicaecorum attenuated tumor development in a DMH/DSS mouse model and partially restored the GAS2–KLF4 balance in vivo. Although this study focused on a single bacterial strain, the findings support a broader role for butyrate-producing microbiota in modulating intrinsic apoptotic pathways and maintaining intestinal homeostasis. These findings support a link between microbial metabolites and regulation of intrinsic cell death pathways in CRC. Therapeutically, both GAS2 IDA treatment reduced tumor burden and metabolic activity in xenograft models. The absence of additive effects when combined suggests potential convergence on shared apoptotic mechanisms. Given previous reports linking GAS2 to responsiveness to DNA-damaging agents [ 37 , 38 ], GAS2 expression may influence sensitivity to topoisomerase II inhibition in CRC. At the tissue level, probiotic treatment reduced dysplasia and tumor–stroma ratio, parameters associated with CRC progression [ 39 , 40 , 41 ]. Modulation of the tumor microenvironment through microbial metabolites may therefore complement intrinsic apoptotic activation, providing a dual mechanism of tumor suppression. Several limitations should be acknowledged. Although inverse GAS2–KLF4 expression was observed in clinical datasets, survival associations were modest and require validation in larger cohorts. Furthermore, while mitochondrial depolarization and ultrastructural changes support activation of intrinsic apoptotic pathways, additional molecular dissection of the regulatory mechanism linking GAS2 to KLF4 will be important in future studies. Differences between murine and human microbiota compositions should also be considered when translating probiotic findings to clinical settings. Collectively, our findings support a model in which suppression of GAS2 restores KLF4-dependent mitochondrial apoptotic signaling, thereby limiting CRC progression and enhancing therapeutic responsiveness. Modulation of this axis through genetic suppression, butyrate-producing microbiota, or chemotherapeutic intervention with IDA highlights the GAS2–KLF4 pathway as a regulatory node influencing apoptotic vulnerability. Targeting this signaling axis may therefore represent a strategy to re-establish intrinsic cell death sensitivity in CRC, particularly in tumors characterized by elevated GAS2 expression. Abbreviations CRC colorectal cancer GAS2 growth arrest-specific 2 KLF4 krüppel-like factor 4 SCFAs short-chain fatty acids B . pullicaecorum Butyricicoccus pullicaecorum HCC hepatocellular carcinoma sh short hairpin Luc luciferase TGZ troglitazone IDA idarubicin GAPDH glyceraldehyde 3-phosphate dehydrogenase DSS dextran sodium sulfate SDS–PAGE sodium dodecyl sulfate–polyacrylamide gel electrophoresis SCID severe combined immunodeficient PBS phosphate-buffered saline ROI region of interest 18 F-FDG 18F-fluorodeoxyglucose NanoPET nano positron emission tomography H&E hematoxylin and eosin IHC immunohistochemistry TCGA the Cancer Genome Atlas. Declarations ACKNOWLEDGEMENTS We are grateful to Professor Rwei-Fen S. Huang of the Department of Nutritional Science, College of Human Ecology, Fu Jen Catholic University, for her expert guidance in interpreting the electron microscopy data, and to Dr. Chih-Yi Liu (Exquisite Biotechnology Company, Taipei, Taiwan) for her assistance with pathological analyses. We also extend our appreciation to Mr. Yen-Sheng Wu for his technical support at the Electron Microscope Laboratory, Tsung Cho Chang School of Medicine, Fu Jen Catholic University. AUTHOR CONTRIBUTIONS Y.C.W., H.H.L., C.J.H., and M.H.S. conceived the study and supervised the research. Y.C.W., C.L.L., C.J.H., W.C.K., and Y.H.S. acquired and analyzed the data, with support from H.H.L. and M.H.S. K.W.C. and S.Y.L. performed molecular imaging experiments, including PET and IVIS analyses. Y.C.W., C.L.L., C.J.H., S.C.C., I.T.C., H.H.L., and M.H.S. drafted and revised the manuscript. C.L.L., M.H.S., C.J.H., and S.C.C. secured funding. All authors reviewed and approved the final manuscript. FUNDING This work was supported by the Fu Jen Catholic University Hospital and Fu Jen Catholic University (PL-202308014-V and PL-202408007-V), Cathay General Hospital (CGH-MR-A11216, CGH-MR-D11102, and CGH-MR-B11221), Chang Gung University of Science and Technology (EZRPF3P0111 and EZRPF3Q0221), and National Science and Technology Council (113-2314-B-281-004-). DATA AVAILABILITY Data and materials are available from the corresponding authors upon reasonable request. DECLARATION OF COMPETING INTEREST The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper References Almeida MPP, Condinho MSL. Biological Therapies for Metastatic Colorectal Cancer: Literature Review. Curr Pharm Biotechnol. 2026. Czescik U, Gryglas M, Szterk A, Flis S. Evolution or Revolution in Colorectal Cancer Treatment: Present and Future of New Therapeutic Options. A Narrative Review. Oncol Res. 2026;34:2. Che H, Li ZJ, Xu L, Du YB, Zhang SO, Ying XJ. Advances in mitochondrial-targeted colorectal cancer therapy: Mechanistic insights and clinical translation. iScience. 2026;29:114511. Awad A, Abdul Karim N. Dysregulation of Mitochondrial Function in Cancer Cells. Int J Mol Sci. 2025;26. Shi J, Wu L, Tian C, Chen H. Unraveling the role of mitochondrial unfolded protein response in colorectal cancer. Biochem Biophys Rep. 2026;45:102359. Nelson VK, Nuli MV, Mastanaiah J, Saleem TSM, Birudala G, Jamous YF, et al. Reactive oxygen species mediated apoptotic death of colon cancer cells: therapeutic potential of plant derived alkaloids. Front Endocrinol (Lausanne). 2023;14:1201198. Sofi FA, Tabassum N. Natural product inspired leads in the discovery of anticancer agents: an update. J Biomol Struct Dyn. 2023;41:8605–28. Lee CL, Huang CJ, Yang SH, Chang CC, Huang CC, Chien CC, et al. Discovery of genes from feces correlated with colorectal cancer progression. Oncol Lett. 2016;12:3378–84. Ma W, Lin J, Ma R, Bai Y, Wu D, Zhang X, et al. Insights into Structure and Function of Growth Arrest Specific 2 (GAS2). J Cancer. 2025;16:146–56. Huang CJ, Lee CL, Yang SH, Chien CC, Huang CC, Yang RN, et al. Upregulation of the growth arrest-specific-2 in recurrent colorectal cancers, and its susceptibility to chemotherapy in a model cell system. Biochim Biophys Acta. 2016;1862:1345–53. Chang CC, Huang CC, Yang SH, Chien CC, Lee CL, Huang CJ. Data on clinical significance of GAS2 in colorectal cancer cells. Data Brief. 2016;8:82–6. Zhou H, Ge Y, Sun L, Ma W, Wu J, Zhang X, et al. Growth arrest specific 2 is up-regulated in chronic myeloid leukemia cells and required for their growth. PLoS One. 2014;9:e86195. Fu T, Amoah K, Chan TW, Bahn JH, Lee JH, Terrazas S, et al. Massively parallel screen uncovers many rare 3' UTR variants regulating mRNA abundance of cancer driver genes. Nat Commun. 2024;15:3335. Choi BJ, Cho YG, Song JW, Kim CJ, Kim SY, Nam SW, et al. Altered expression of the KLF4 in colorectal cancers. Pathol Res Pract. 2006;202:585–9. Yu M, Hao B, Zhan Y, Luo G. Kruppel-like factor 4 expression in solid tumor prognosis: A meta-analysis. Clin Chim Acta. 2018;485:50–9. Xiu DH, Chen Y, Liu L, Yang HS, Liu GF. Tumor-suppressive role of Kruppel-like factor 4 (KLF-4) in colorectal cancer. Genet Mol Res. 2017;16:gmr1601927. Yang VW, Liu Y, Kim J, Shroyer KR, Bialkowska AB. Increased Genetic Instability and Accelerated Progression of Colitis-Associated Colorectal Cancer through Intestinal Epithelium-specific Deletion of Klf4. Mol Cancer Res. 2019;17:165–76. Chen ZY, Rex S, Tseng CC. Kruppel-like factor 4 is transactivated by butyrate in colon cancer cells. J Nutr. 2004;134:792–8. Flandez M, Guilmeau S, Blache P, Augenlicht LH. KLF4 regulation in intestinal epithelial cell maturation. Exp Cell Res. 2008;314:3712–23. Alvandi E, Wong WKM, Joglekar MV, Spring KJ, Hardikar AA. Short-chain fatty acid concentrations in the incidence and risk-stratification of colorectal cancer: a systematic review and meta-analysis. BMC Med. 2022;20:323. Liu G, Tang J, Zhou J, Dong M. Short-chain fatty acids play a positive role in colorectal cancer. Discov Oncol. 2024;15:425. Gomes S, Baltazar F, Silva E, Preto A. Microbiota-Derived Short-Chain Fatty Acids: New Road in Colorectal Cancer Therapy. Pharmaceutics. 2022;14:2359. Gomes S, Rodrigues AC, Pazienza V, Preto A. Modulation of the Tumor Microenvironment by Microbiota-Derived Short-Chain Fatty Acids: Impact in Colorectal Cancer Therapy. Int J Mol Sci. 2023;24:5069. Bach Knudsen KE, Laerke HN, Hedemann MS, Nielsen TS, Ingerslev AK, Gundelund Nielsen DS, et al. Impact of Diet-Modulated Butyrate Production on Intestinal Barrier Function and Inflammation. Nutrients. 2018;10:1499. Huang CC, Shen MH, Chen SK, Yang SH, Liu CY, Guo JW, et al. Gut butyrate-producing organisms correlate to Placenta Specific 8 protein: Importance to colorectal cancer progression. J Adv Res. 2020;22:7–20. Wang G, Yu Y, Wang YZ, Wang JJ, Guan R, Sun Y, et al. Role of SCFAs in gut microbiome and glycolysis for colorectal cancer therapy. J Cell Physiol. 2019;234:17023–49. Chang SC, Shen MH, Liu CY, Pu CM, Hu JM, Huang CJ. A gut butyrate-producing bacterium Butyricicoccus pullicaecorum regulates short-chain fatty acid transporter and receptor to reduce the progression of 1,2-dimethylhydrazine-associated colorectal cancer. Oncol Lett. 2020;20:327. Siekmann W, Tina E, Von Sydow AK, Gupta A. Effect of lidocaine and ropivacaine on primary (SW480) and metastatic (SW620) colon cancer cell lines. Oncol Lett. 2019;18:395–401. Li S, Zhou Q, He H, Zhao Y, Liu Z. Peroxisome proliferator-activated receptor gamma agonists induce cell cycle arrest through transcriptional regulation of Kruppel-like factor 4 (KLF4). J Biol Chem. 2013;288:4076–84. Allegrucci C, Rushton MD, Dixon JE, Sottile V, Shah M, Kumari R, et al. Epigenetic reprogramming of breast cancer cells with oocyte extracts. Mol Cancer. 2011;10:7. Zhu R, Mok MT, Kang W, Lau SS, Yip WK, Chen Y, et al. Truncated HBx-dependent silencing of GAS2 promotes hepatocarcinogenesis through deregulation of cell cycle, senescence and p53-mediated apoptosis. J Pathol. 2015;237:38–49. Zhu RX, Cheng ASL, Chan HLY, Yang DY, Seto WK. Growth arrest-specific gene 2 suppresses hepatocarcinogenesis by intervention of cell cycle and p53-dependent apoptosis. World J Gastroenterol. 2019;25:4715–26. Lee E, Cheung J, Bialkowska AB. Kruppel-like Factors 4 and 5 in Colorectal Tumorigenesis. Cancers (Basel). 2023;15:2430. Xu H, Liu L, Li W, Zou D, Yu J, Wang L, et al. Transcription factors in colorectal cancer: molecular mechanism and therapeutic implications. Oncogene. 2021;40:1555–69. Chen Y, Fang Y, Lyu Z, Tian Y, Niu S, Li YR, et al. Microbiome modulation of tumorigenesis and immune responses. J Biomed Sci. 2026;33:4. Jeong J, Baines KJ, Maleki Vareki S. Microbial-Derived Metabolites and Their Impact on Cancer Immunotherapy. Cancer Immunol Res. 2026;14:194–204. Ghanemi M, Pourshohod A, Zeinali M, Barzegari E, Akbari A, Absalan F, et al. Potential Advantages of Idarubicin-Loaded Trastuzumab-Coated Liposomes for Combating Head and Neck Squamous Cancer Cells. Cell J. 2024;26:436–45. Ramirez-Guzman LA, Huang W, Cole JJ, Jørgensen HG. GAS2 Upregulation Is a Targetable Vulnerability in Chronic Myeloid Leukemia. Int J Transl Med. 2024;4:354–68. Shang A, Yu P, Li L, He G, Xu J. Tumor–stroma ratio as a clinical prognostic factor in colorectal carcinoma: A meta–analysis of 7,934 patients. Oncol Lett. 2025;29:190. Shi L, Zhang Y, Wang H. Prognostic prediction based on histopathologic features of tumor microenvironment in colorectal cancer. Front Med (Lausanne). 2023;10:1154077. Strous MTA, Faes TKE, Gubbels A, van der Linden RLA, Mesker WE, Bosscha K, et al. A high tumour-stroma ratio (TSR) in colon tumours and its metastatic lymph nodes predicts poor cancer-free survival and chemo resistance. Clin Transl Oncol. 2022;24:1047–58. Additional Declarations There is no conflict of interest Supplementary Files Graphicalabstract.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9004103","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":607447844,"identity":"8b8aaaf2-2792-4301-a294-165683b231a3","order_by":0,"name":"Chi-Jung Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYFACxgY468EHIMnGToIWZsMZIC3MJNjHJs0D1klAmXz74cbHBTU2DLrtZw9I2/zaJs/HzMD44WMObi0GZxKbjWccS2MwO5OXYJzbd9uwjZmBWXLmNjxaJBjbpHkbDjOYHcgxSM7tuc0I1MLGzItHi/wMxvbfvA3/GczOvzE4bNlz256gFoYbQGN5Gw4wmN3IMWxm+HE7kaAWkF+keY4l85jdeGPM2NtwO7mNmbEZr1/k248//MxTYydndj7H/MePP7dt57c3H/zwEZ/DoAAcIwyMbWCygbB6BPhDiuJRMApGwSgYKQAA4YBNHz9XtT4AAAAASUVORK5CYII=","orcid":"","institution":"Cathay General Hospital","correspondingAuthor":true,"prefix":"","firstName":"Chi-Jung","middleName":"","lastName":"Huang","suffix":""},{"id":607447845,"identity":"21cdf83b-14f8-456a-b360-db1f72e96519","order_by":1,"name":"Ming-Hung Shen","email":"","orcid":"","institution":"School of Medicine, College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ming-Hung","middleName":"","lastName":"Shen","suffix":""},{"id":607447846,"identity":"eeb18dca-636d-4c5f-83af-dd0465eea0c2","order_by":2,"name":"Heng-Hui Lien","email":"","orcid":"","institution":"Division of General Surgery, Department of Surgery","correspondingAuthor":false,"prefix":"","firstName":"Heng-Hui","middleName":"","lastName":"Lien","suffix":""},{"id":607447847,"identity":"9b10bf7f-8a18-4f81-811a-f6d4f61f6538","order_by":3,"name":"Ching-Long Lai","email":"","orcid":"","institution":"Division of Basic Medical Sciences, Department of Nursing","correspondingAuthor":false,"prefix":"","firstName":"Ching-Long","middleName":"","lastName":"Lai","suffix":""},{"id":607447848,"identity":"fb204d63-144b-4338-9ddb-0118840f4dc0","order_by":4,"name":"Kang-Wei Chang","email":"","orcid":"","institution":"Taipei Neuroscience Institute","correspondingAuthor":false,"prefix":"","firstName":"Kang-Wei","middleName":"","lastName":"Chang","suffix":""},{"id":607447849,"identity":"8b6ad1ad-4860-4671-81ad-f2a457f36892","order_by":5,"name":"Wei-Chi Ku","email":"","orcid":"","institution":"School of Medicine, College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wei-Chi","middleName":"","lastName":"Ku","suffix":""},{"id":607447850,"identity":"a5e3efbd-6ddb-4502-848b-22f8e75aa929","order_by":6,"name":"I-Tsu Chyuan","email":"","orcid":"","institution":"Department of Medical Research","correspondingAuthor":false,"prefix":"","firstName":"I-Tsu","middleName":"","lastName":"Chyuan","suffix":""},{"id":607447851,"identity":"c26a108d-ebce-419a-88ac-97a103e1a4fc","order_by":7,"name":"Shih-Chang Chang","email":"","orcid":"","institution":"Division of Colorectal Surgery, Department of Surgery","correspondingAuthor":false,"prefix":"","firstName":"Shih-Chang","middleName":"","lastName":"Chang","suffix":""},{"id":607447852,"identity":"089e4f02-33e1-44a7-a0ad-379588c9472c","order_by":8,"name":"Yu-Hao Shih","email":"","orcid":"","institution":"Department and graduate institute of Biochemistry, College of Biomedical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yu-Hao","middleName":"","lastName":"Shih","suffix":""},{"id":607447853,"identity":"b6f9326b-e382-4307-b08e-35acdf6f9b37","order_by":9,"name":"Shih-Ying Lee","email":"","orcid":"","institution":"National Atomic Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Shih-Ying","middleName":"","lastName":"Lee","suffix":""},{"id":607447854,"identity":"a27b1cc6-1089-44bd-be67-584a0eb77e26","order_by":10,"name":"Yen-Chieh Wang","email":"","orcid":"","institution":"Division of Urology, Department of Surgery","correspondingAuthor":false,"prefix":"","firstName":"Yen-Chieh","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2026-03-01 22:45:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9004103/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9004103/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105187227,"identity":"dd922c39-43aa-4a69-ba8f-c3ae2d949969","added_by":"auto","created_at":"2026-03-23 08:43:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1145609,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGAS2 suppression is associated with increased KLF4 expression in metastatic CRC cells.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e Quantitative RT–PCR confirming efficient GAS2 knockdown in SW620-shGAS2 cells relative to SW620-shLuc controls. \u003cstrong\u003eB\u003c/strong\u003e Cignal 45-pathway reporter analysis following GAS2 silencing. SP1 and KLF4 pathways were upregulated, whereas the antioxidant response pathway was reduced. \u003cstrong\u003eC–F\u003c/strong\u003eRelative mRNA expression of SP1, NRF1, NRF2, and KLF4 in SW620-shLuc and SW620-shGAS2 cells. KLF4 showed consistent upregulation. \u003cstrong\u003eG\u003c/strong\u003e Immunoblot analysis confirming increased KLF4 protein levels in GAS2-silenced cells. Data are presented as mean ± SD. CRC, colorectal cancer; sh, short hairpin; Luc, luciferase. Statistical significance was evaluated using Student’s \u003cem\u003et\u003c/em\u003etest. *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ****, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"Figure1one.png","url":"https://assets-eu.researchsquare.com/files/rs-9004103/v1/062209005cd87bc3a06437f8.png"},{"id":105187307,"identity":"6e66934d-a404-411f-9d80-c35d7d7ef625","added_by":"auto","created_at":"2026-03-23 08:43:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":11106433,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInverse expression pattern of GAS2 and KLF4 in CRC tissues and TCGA datasets.\u003c/strong\u003e \u003cstrong\u003eA–B\u003c/strong\u003eRepresentative H\u0026amp;E and immunohistochemical staining of CRC specimens showing progressive epithelial dysplasia and carcinoma. GAS2 expression increases, whereas KLF4 expression decreases in tumor regions. \u003cstrong\u003eC–D\u003c/strong\u003e Box plots of GAS2 and KLF4 mRNA levels in tumor versus normal tissues from TCGA/GTEx datasets. \u003cstrong\u003eE\u003c/strong\u003e Scatter plot demonstrating inverse correlation between GAS2 and KLF4 expression in CRC tumors. \u003cstrong\u003eF–G\u003c/strong\u003e Kaplan–Meier survival analysis stratified by GAS2 or KLF4 expression. Data derived from GEPIA2 (TCGA and GTEx datasets). CRC, colorectal cancer; GAS2, growth arrest-specific 2; KLF4, Krüppel-like factor 4; H\u0026amp;E, hematoxylin and eosin; IHC, immunohistochemistry; TCGA, The Cancer Genome Atlas; GTEx, Genotype-Tissue Expression; TPM, transcripts per million.\u003c/p\u003e","description":"","filename":"Figure2tissuesandTCGAone.png","url":"https://assets-eu.researchsquare.com/files/rs-9004103/v1/b723fdd7e19b97245514c174.png"},{"id":105187221,"identity":"02ee1783-679c-4995-84b2-631d0a1f4290","added_by":"auto","created_at":"2026-03-23 08:43:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1361676,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eButyrate and troglitazone modulate the GAS2–KLF4 axis and suppress CRC cell proliferation.\u003c/strong\u003e \u003cstrong\u003eA–B\u003c/strong\u003e Relative GAS2 and KLF4 mRNA expression in SW480 and SW620 CRC cells. \u003cstrong\u003eC–D\u003c/strong\u003e Sodium butyrate (NaB, 5 mM) treatment reduces GAS2 and increases KLF4 expression. \u003cstrong\u003eE–F\u003c/strong\u003e Troglitazone (TGZ) induces KLF4 expression in a dose-dependent manner. \u003cstrong\u003eG\u003c/strong\u003e MTT assay showing reduced proliferation following NaB or TGZ treatment, with enhanced suppression upon combination treatment. Statistical significance was determined using Student’s \u003cem\u003et\u003c/em\u003e test or ANOVA with Bonferroni post hoc test. CRC, colorectal cancer; GAS2, growth arrest-specific 2; KLF4, krüppel-like factor 4; NaB, sodium butyrate; TGZ, troglitazone; MTT, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure3onecorrect.png","url":"https://assets-eu.researchsquare.com/files/rs-9004103/v1/30b7e33bc86a50624abeb3d5.png"},{"id":105187225,"identity":"ef11db66-bf2f-4e14-b144-89e7b0837b2d","added_by":"auto","created_at":"2026-03-23 08:43:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":8601405,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eButyrate-producing \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eB\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003epullicaecorum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e attenuates tumor progression and modulates GAS2–KLF4 expression in a DMH/DSS-induced CRC model.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e Representative gross colonic images from control, CRC (DMH/DSS), and BP-treated mice. \u003cstrong\u003eB–C\u003c/strong\u003e H\u0026amp;E staining showing reduced tumor burden and dysplasia in BP-treated animals. \u003cstrong\u003eD–F\u003c/strong\u003e Quantification of dysplastic area and tumor–stroma ratio. \u003cstrong\u003eG\u003c/strong\u003e Immunohistochemistry showing elevated GAS2 and reduced KLF4 in CRC mice, partially reversed following BP administration. Statistical significance was determined using Student’s \u003cem\u003et\u003c/em\u003e test. CRC, colorectal cancer; GAS2, growth arrest-specific 2; KLF4, krüppel-like factor 4; BP, \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e; DMH, 1,2-dimethylhydrazine; DSS, dextran sodium sulfate; TSR, tumor-stroma ratio; *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure4newone.png","url":"https://assets-eu.researchsquare.com/files/rs-9004103/v1/6f86fbf4c0d0f8d543881a31.png"},{"id":105187191,"identity":"80792d3d-b13b-4946-a1fa-4e561969ea01","added_by":"auto","created_at":"2026-03-23 08:43:28","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":10481976,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eButyrate induces mitochondrial remodeling and intrinsic apoptotic responses in a KLF4-dependent manner.\u003c/strong\u003e \u003cstrong\u003eA–B\u003c/strong\u003e Transmission electron microscopy of untreated and butyrate-treated SW620 cells. Butyrate exposure is associated with altered mitochondrial morphology and reduced lysosomal density. \u003cstrong\u003eC\u003c/strong\u003e JC-1 assay demonstrating mitochondrial membrane depolarization following butyrate treatment in control cells, which is attenuated in KLF4-silenced cells. These findings indicate that KLF4 contributes to butyrate-associated mitochondrial depolarization and intrinsic apoptotic activation. CRC, colorectal cancer; GAS2, growth arrest-specific 2; KLF4, krüppel-like factor 4; sh, short hairpin; Luc, luciferase; NaB, sodium butyrate; JC-1, 5,5',6,6'-tetrachloro-1,1',3,3'- tetraethylbenzimidazolylcarbocyanine iodide; Fis, fission site; Lyso, lysosome. Scale bars, as indicated in panels.\u003c/p\u003e","description":"","filename":"Figure5one.png","url":"https://assets-eu.researchsquare.com/files/rs-9004103/v1/57806832487a4c1ae3b1fdb7.png"},{"id":105187231,"identity":"b3bb5c85-bc6d-4bd7-bca3-3b2714c8526e","added_by":"auto","created_at":"2026-03-23 08:43:35","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":7533545,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGAS2 knockdown and idarubicin independently reduce tumor burden and metabolic activity in CRC xenografts.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e Bioluminescent imaging of SCID mice implanted with SW620 cells under indicated treatments. \u003cstrong\u003eB\u003c/strong\u003e Quantification of luminescent signal intensity. \u003cstrong\u003eC–D\u003c/strong\u003e Representative \u003csup\u003e18\u003c/sup\u003eF-FDG PET images and tumor volume analysis. \u003cstrong\u003eE\u003c/strong\u003e SUVmean values indicating reduced metabolic activity in GAS2-silenced or IDA-treated tumors. GAS2 knockdown and IDA treatment each suppress tumor growth and metabolic activity, without additive effects when combined. Statistical significance was determined using ANOVA with Bonferroni post hoc test. GAS2, growth arrest-specific 2; IVIS, \u003cem\u003ein vivo\u003c/em\u003e imaging system; ROI, region of interest;\u003csup\u003e18\u003c/sup\u003eF-FDG, \u003csup\u003e18\u003c/sup\u003eF-fluorodeoxyglucose; sh, short hairpin; Luc, luciferase; IDA, idarubicin.\u003c/p\u003e","description":"","filename":"Figure6one.png","url":"https://assets-eu.researchsquare.com/files/rs-9004103/v1/47a92c7cbbe2c3933ba6a4ae.png"},{"id":107062466,"identity":"f202e251-9ce9-4b05-b53c-73473bec1cf6","added_by":"auto","created_at":"2026-04-16 10:31:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":40266753,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9004103/v1/a8cd982c-97f6-4e56-ab85-0929bba49287.pdf"},{"id":105187185,"identity":"8e654ff5-9d23-4d1c-9ea3-f6ed80df89af","added_by":"auto","created_at":"2026-03-23 08:43:22","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16115,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-9004103/v1/fa76c77345bb8a07a0355d81.docx"}],"financialInterests":"There is no conflict of interest","formattedTitle":"The GAS2–KLF4 axis regulates mitochondrial apoptosis and therapeutic responsiveness in colorectal cancer","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eColorectal cancer (CRC) remains a major cause of cancer-related mortality worldwide, largely due to tumor progression, metastasis, and resistance to therapy [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. A hallmark of CRC progression is impaired intrinsic apoptosis, particularly dysregulation of mitochondrial-mediated cell death pathways [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Mitochondrial integrity and dynamics critically determine apoptotic commitment [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], yet the upstream regulatory networks governing these processes in CRC remain incompletely defined. Identifying molecular axes that regulate mitochondrial apoptosis may provide mechanistic insight and therapeutic opportunities to restore apoptotic vulnerability and suppress CRC progression [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGrowth arrest-specific 2 (GAS2) has emerged as a regulator of cytoskeletal dynamics and apoptosis and is increasingly implicated in CRC tumorigenesis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Elevated GAS2 expression has been reported in metastatic CRC cell lines, including SW620, and is associated with tumor aggressiveness, early relapse, and metastasis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Its aberrant upregulation suggests a potential oncogenic role in CRC and positions GAS2 as a candidate therapeutic target [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, the downstream pathways through which GAS2 influences apoptotic signaling in CRC remain incompletely understood.\u003c/p\u003e \u003cp\u003eIn contrast, Kr\u0026uuml;ppel-like factor 4 (KLF4) functions as a tumor suppressor in CRC and other epithelial malignancies [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. KLF4 regulates proliferation, differentiation, and apoptosis, and reduced KLF4 expression correlates with unfavorable clinical outcomes in CRC patients [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Notably, KLF4 has been implicated in mitochondrial stress responses and transcriptional regulation of genes governing cell fate decisions. Furthermore, KLF4 expression can be induced by butyrate, a short-chain fatty acid (SCFA) generated by gut microbial fermentation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSCFAs, particularly butyrate, exert anti-inflammatory and antitumorigenic effects within the colonic microenvironment [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Reduced fecal concentrations of SCFAs have been associated with increased CRC risk and incidence [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Butyrate has been shown to induce apoptosis and suppress tumor growth through multiple mechanisms, including histone deacetylase inhibition and modulation of gene expression programs [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Whether microbiota-derived butyrate regulates mitochondrial apoptotic pathways through coordinated modulation of GAS2 and KLF4 in CRC, however, remains unclear.\u003c/p\u003e \u003cp\u003eIn this study, we investigated the hypothesis that a GAS2\u0026ndash;KLF4 regulatory axis governs mitochondrial apoptotic signaling in CRC and that microbiota-derived butyrate or butyrate-producing probiotics can modulate this pathway to suppress tumor progression. Using \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e CRC models, we examined the impact of GAS2 suppression, KLF4 regulation, and butyrate exposure on mitochondrial integrity, apoptotic responses, and therapeutic sensitivity, including responsiveness to the topoisomerase II inhibitor idarubicin (IDA).\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e \u003cb\u003eParticipants, animals, and\u003c/b\u003e \u003cb\u003eButyricicoccus pullicaecorum\u003c/b\u003e\u003c/p\u003e \u003cp\u003e Formalin-fixed paraffin-embedded tissue samples from CRC patients with different AJCC stages were obtained from the Cathay General Hospital Biobank (Taipei, Taiwan) with institutional approval (approval no. HBKEC-20230313-1). The Institutional Review Board of Cathay General Hospital waived the requirement for informed consent for tissue collection, as all samples were anonymized and unlinked (approval no. CGH-P111088).\u003c/p\u003e \u003cp\u003eBALB/cByJNarl mice (4\u0026ndash;6 weeks old) were obtained from the National Laboratory Animal Center (National Applied Research Laboratories, Taipei, Taiwan). DMH and DSS were used to induce colon tumor development, as described in our previous study [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In brief, a small group of mice (3\u0026ndash;5 per plastic cage) was housed in an individually ventilated cage rack system (Tecniplast, Varese, Italy) under controlled conditions: humidity at 50% \u0026plusmn; 10%, 12/12-hour light/dark cycle, and temperature of 23\u0026deg;C \u0026plusmn; 2\u0026deg;C. The study included three groups: (1) Control Group (CG) (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;4) \u0026ndash; no DMH/DSS treatment and no \u003cem\u003eButyricicoccus pullicaecorum\u003c/em\u003e (\u003cem\u003eB. pullicaecorum\u003c/em\u003e) administration; (2) DMH/DSS Group (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;8) \u0026ndash; received DMH via intraperitoneal injection and DSS in drinking water, without \u003cem\u003eB. pullicaecorum\u003c/em\u003e administration; (3) DMH/DSS/BP Group (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;8) \u0026ndash; received DMH/DSS treatment combined with \u003cem\u003eB. pullicaecorum\u003c/em\u003e administration. To assess whether GAS2 retains its tumorigenic effect in vivo under IDA treatment, we employed a xenograft model using severe combined immunodeficient (SCID) mice, as previously described [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Twelve male SCID mice (CB17/Icr-Prkdcscid/IcrIcoCrlBltw) from BioLasco Taiwan Co., Ltd (Taipei, Taiwan) were housed under specific pathogen-free conditions in an individually ventilated cage system (Tecniplast) at the Animal Research Center of Cathay General Hospital. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Cathay General Hospital under protocols IACUC 107-009 (BALB/cByJNarl mice) and IACUC 109\u0026thinsp;\u0026minus;\u0026thinsp;024 (SCID mice). These animal experiments complied with Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines, adhering to the principles of Reduction, Refinement, and Replacement. All efforts were made to minimize both the number of animals used and their suffering.\u003c/p\u003e \u003cp\u003eTo investigate its molecular effects on colon tumor development, the gut bacterium \u003cem\u003eB. pullicaecorum\u003c/em\u003e (3.125 \u0026times; 10⁷ colony-forming units [CFUs] in 100 \u0026micro;L broth) was administered via oral gavage. The strain used (\u003cem\u003eB. pullicaecorum\u003c/em\u003e BCRC 81109) was obtained from the Bioresource Collection and Research Center (Hsinchu, Taiwan). Bacterial cultures were grown in modified peptone-yeast extract broth under anaerobic conditions at 37\u0026deg;C for 3 days, in accordance with our previously established protocol [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and lentiviral knockdown of target genes\u003c/h2\u003e \u003cp\u003eTwo CRC cell lines (SW480, ATCC CCL-228 and SW620, ATCC CCL-227; American Type Culture Collection [ATCC], Manassas, VA, USA) were used in this study. The negative expression relationship of GAS2 and KLF4 was also verified in the SW480 cells, originating from primary CRC, and SW620 cells, derived from a lymph node metastatic site of the same CRC patient 1 year later [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. These cell lines were cultured in Leibovitz\u0026rsquo;s L-15 Medium and maintained in a CO\u003csub\u003e2\u003c/sub\u003e-free incubator. The culture medium contained 10% fetal bovine serum. The clinical characteristics of the cell lines were obtained from the ATCC website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.atcc.org\u003c/span\u003e\u003cspan address=\"http://www.atcc.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe lentiviral construct pLKO_TRC005-GAS2 (clone ID: TRCN0000420792), containing short hairpin (sh) RNA targeting GAS2 (shGAS2), was employed to reduce GAS2 expression in SW620 cells (SW620-shGAS2). As a negative control for shGAS2, the vector pLKO_TRC005-luciferase (Luc) (clone ID: TRCN0000231719), targeting LUC was used (SW620-shLuc). Similarly, the construct pLKO_TRC2-KLF4 (clone ID: TRCN0000231078) was used to knock down KLF4 (shKLF4) expression in SW620 cells (SW620-shKLF4), with pLKO-TRC2.Void (VOID; clone ID: ASN0000000001) served as a negative control (SW620-VOID). All lentiviral constructs were obtained from the RNA Technology Platform and Gene Manipulation Core (Sinica, Taiwan). A total of 1.25 x 10\u003csup\u003e5\u003c/sup\u003e cells/well were cultured in a 6-well plate for 24 h, and subsequent lentiviral infections (multiplicity of infection\u0026thinsp;=\u0026thinsp;3) were performed to knock down the expression of the target gene in cells. Subsequently, a medium containing 2 mg/mL puromycin (Thermo Fisher Scientific, Waltham, MA, USA) was used to select for and maintain stable clones. Following incubation for 48 h, the infection efficiency was determined using quantitative polymerase chain reaction.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCignal 45-pathway reporter array\u003c/h3\u003e\n\u003cp\u003eSW620-shLuc and SW620-shGAS2 cells were incubated for 48 h in a CO\u003csub\u003e2\u003c/sub\u003e-free incubator. Analysis of signaling pathways in the cells was then carried out using the Cignal 45-Pathway Reporter Array Kit (Cat. No. CCA-901L; Qiagen, Germantown, MD, USA) by quantifying the luminescence signal according to the manufacturer\u0026rsquo;s instructions. Expression values were normalized by establishing a sample ratio value to discriminate between genuine cellular responses (firefly luminescence signal) and nonspecific responses (Renilla luminescence signal) and plotted as log\u003csub\u003e2\u003c/sub\u003e fold change comparing SW620-shGAS2 with SW620-shLuc.\u003c/p\u003e\n\u003ch3\u003eRNA isolation, cDNA synthesis, and gene quantitation\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from cells using the Easy Pure Total RNA Mini Kit (Bioman Scientific Co. Ltd, Taipei, Taiwan). Single-stranded cDNA was synthesized from 1 g total RNA using oligo(dT)12 primers with the High-Capacity cDNA Reverse Transcriptase Kit (Cat. No. 4368813; Thermo Fisher Scientific), following the manufacturer\u0026rsquo;s protocol. The relative quantification of GAS2 was conducted as described in our previous report [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Primers and TaqMan probes for KLF4, nuclear respiratory factor 1, nuclear factor erythroid 2-like 2, and SP1 were customized based on the sequences listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Gene expression levels were analyzed using the 2\u0026ndash;∆∆Cq method and normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression. All gene expression experiments were performed in triplicate, yielding consistent results.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers and TaqMan probes in quantifying gene expressions\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession no.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eComment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence (5\u0026rsquo; to 3\u0026rdquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKLF4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_004235\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003esense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ettggggttttgggttttg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eantisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ecgtggagaaagatgggag\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eprobe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eccatgtcagactcgccaggt\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNRF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_005011\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003esense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ecttatccaggttggtacggg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eantisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ecatctcacctccctgtaacg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eprobe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003etgccgtggctgatggagaggtggaa\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNRF2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_006164\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003esense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003egtccacattttcttaatgc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eantisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003egagtgaatggcttaaagtag\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eprobe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003etccttcagcagcatcctctcc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSP1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_138473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003esense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ecacaaacgtacacacacagg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eantisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eggcctcccttcttattctgg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eprobe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003etgcctgccctgagtgtcctaagcgctt\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_002046\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003esense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eacaacgaatttggctacagc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eantisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eagtgagggtctctctcttcc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eprobe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eaccaccagccccagcaagagcacaa\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003e1\u003c/sup\u003eKLF4, Kr\u0026uuml;ppel-like factor 4; NRF1, nuclear respiratory factor 1: NRF2, nuclear factor erythroid 2-like 2; SP1, Sp1 transcription factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eProtein extraction and Western blot analysis\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eProtein extraction and Western blot analysis\u003c/div\u003e \u003cp\u003eTo investigate the relationship between GAS2 and KLF4 expression levels, SW620 cells were treated with the KLF4-inducer troglitazone (TGZ) (Cat. No. HY-50935; MedChemExpress, Monmouth Junction, NJ, USA) at concentrations of 0, 10, and 50 M for 6 h [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], or subjected to GAS2 knockdown. Then, changes in their respective protein expression levels were analyzed. Extracts from SW620, SW620-shLuc, and SW620-shGAS2 cells were prepared using the PRO-PREP Protein Extraction Solution (Intron Biotechnology, Inc., Seongnam, Kyonggi-do, South Korea) in the presence of protease inhibitor (Cat. No. P8340; Merck KGaA, Inc., Darmstadt, Germany), following the manufacturer\u0026rsquo;s instructions. Protein concentration in the cell lysate was quantified using Bio-Rad Protein Assay Reagent (Cat. No. 500-0006; Bio-Rad Laboratories, Inc., Hercules, CA, USA). For sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis (SDS\u0026ndash;PAGE), 15 g protein per lane was denatured at 95C for 10 min, separated on 12% SDS\u0026ndash;PAGE in 1 NuPAGE LDS sample buffer (Thermo Fisher Scientific), and transferred to the PolyScreen 2 PVDF Transfer membrane (0.2 m; PerkinElmer, Inc., Waltham, MA, USA). Membranes were blocked in 3% bovine serum albumin (Cat. No. ALB001.100; BioShop Canada Inc., Ontario, Canada) for 1 h at room temperature and subsequently incubated with the following primary antibodies for 1 h at room temperature: anti-KLF4 (1:500, Cat. No. 11880-1-AP; Proteintech, Rosemont, IL, USA), anti-GAS2 (1:1000, Cat. No. ab55076; Abcam, Cambridge, MA, USA), and anti-GAPDH (1:10,000, Cat. No. 60004-1-Ig; Proteintech). GAPDH served as a loading control for housekeeping gene expression. After incubation with primary antibody, membranes were incubated with a biotin-conjugated goat anti-rabbit IgG antibody (H\u0026thinsp;+\u0026thinsp;L) (1:1,000, Cat. No. BA-1000; Vector Laboratories, Burlingame, CA, USA) or biotin-conjugated goat anti-mouse IgG antibody (H\u0026thinsp;+\u0026thinsp;L) (1:1,000, Cat. No. BA-9200; Vector Laboratories) for 60 min at room temperature. Target signals were amplified using the VECTASTAIN ABC-AmP Kit (Cat. No. AK-6602; Vector Laboratories) according to the manufacturer\u0026rsquo;s protocol and using the FluorChem FC2 Imaging System (Cell Biosciences, Inc., Santa Clara, CA, USA).\u003c/p\u003e\n\u003ch3\u003eMTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay\u003c/h3\u003e\n\u003cp\u003eSW620 cells (50,000 cells per well) were seeded in 100 L media in a 96-well plate. Following treatment with 5 mM butyrate for 24 h or TGZ (0, 10, 50 M) for 6 h, the cells were incubated with 10 L MTT reagent (Cat. No. M5655; Sigma, St. Louis, MO, USA) for approximately 4 h. A detergent solution was subsequently added to lyse the cells and solubilize the resulting formazan crystals. Absorbance was measured colorimetrically at a wavelength of 570 nm.\u003c/p\u003e \u003cp\u003e \u003cem\u003eIn vivo imaging system detection and positron emission tomography of xenograft tumor induced by SW620 cells under IDA treatment\u003c/em\u003e \u003c/p\u003e \u003cp\u003eAs in our previous publication [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], 1 x 10\u003csup\u003e6\u003c/sup\u003e SW620 cells/0.2 mL phosphate-buffered saline (PBS) with or without GAS2 knockdown co-expressing the luciferase gene from the pGL3-Basic vector were inoculated subcutaneously on the right side of the back. Experimental groups received IDA (1.5 mg/kg) or vehicle (PBS) once a week via intraperitoneal injection for 28 days, and body weight was recorded weekly. The xenograft tumors were monitored using an in vivo imaging system (IVIS) luciferase imaging. Briefly, mice were injected intraperitoneally with 150 mg/kg luciferin (VivoGlo Luciferin In Vivo Grade; Promega, Madison, WI, USA) for 10 min before being anesthetized with 2.5% isoflurane (Attane; Panion \u0026amp; BF Biotech Inc., Taipei, Taiwan) and allowed to rest for 10 min before being anesthetized with 2.5% isoflurane (Attane; Panion \u0026amp; BF Biotech Inc.) combined with 100% oxygen. Tumor imaging was performed using the IVIS Lumina XRMS In Vivo Imaging System (PerkinElmer) at an emission wavelength of 680 nm using a Cy5 filter. The acquired images were analyzed using the IVIS software suite, through region of interest (ROI) analysis of selected specific regions, providing critical insights into the localization and distribution of fluorescence within the tumors.\u003c/p\u003e \u003cp\u003e \u003csup\u003e18\u003c/sup\u003eF-fluorodeoxyglucose (\u003csup\u003e18\u003c/sup\u003eF-FDG) was procured from a commercial manufacturer (Global Medical Solutions Taiwan, Ltd, Taipei, Taiwan). Quality control was performed using radio-high-performance liquid chromatography and radio-thin-layer chromatography. Immediately after preparation, the radiopharmaceutical was transported to the PET Imaging Laboratory (Animal Imaging Center, Taipei Medical University, Taipei, Taiwan) for nano positron emission tomography (NanoPET) imaging, which was performed using the NanoPET SuperArgus System (Sedecal, Madrid, Spain). Before the emission scan, a 30-min transmission scan was performed using a [Ge-68] pin source (18.5 MBq; Siemens Medical Systems, Malvern, PA, USA) for attenuation correction. Mice were anesthetized with isoflurane gas (3% isoflurane in 50% oxygen, 1 mL/min; Benson Medical Industries, Markham, Ontario, Canada). \u003csup\u003e18\u003c/sup\u003eF-FDG was administered as a bolus injection (100 L in PBS) with an activity of approximately 18.5 MBq via manual tail vein injection. The mice were placed in a stereotactic head holder in a prone position on the PET scanner bed. Serial static PET images were acquired 60 to 75 min post-injection. The NanoPET system applied scatter correction, random correction, and attenuation correction, providing an effective axial/transaxial field of view (FOV) of 4.8/6.7 cm, spatial resolution under 2 mm, and sensitivity exceeding 2.5% across the entire FOV. Images were reconstructed using the 2-D ordered subset expectation maximization algorithm (GE Healthcare, Buc, France) into voxels measuring 0.3875 x 0.3875 x 0.775 mm\u0026sup3;.\u003c/p\u003e \u003cp\u003eCo-registered PET images were analyzed using PMOD image analysis software, version 4.0 (PMOD Technologies Ltd, Zurich, Switzerland). Decay-corrected time\u0026ndash;activity curves were presented in standardized uptake value units, normalized by body weight (g) to account for differences in mouse weights and administered doses. In addition, tumor regions were selected and analyzed using PMOD software. The analysis was conducted by an experienced technologist to minimize inter- and intra-reader variability.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin and eosin staining, immunohistochemistry, and interpretation\u003c/h2\u003e \u003cp\u003eThin sections, 5 \u0026micro;m thick, were stained with hematoxylin and eosin (H\u0026amp;E) and immunostained using the avidin\u0026ndash;biotin immunoperoxidase method. H\u0026amp;E staining was performed using the Tissue-Tek DRS\u0026trade; 2000 Automated Slide Stainer (Sakura Finetek USA, Inc., Torrance, CA, USA) following a standardized protocol at room temperature. The process included: (1) deparaffinization, two consecutive xylene washes (5 min each) followed by a 7-min xylene change; (2) rehydration, sequential alcohol immersions (100% alcohol for 60 s, 100% alcohol for 90 s, 95% alcohol for 60 s, 75% alcohol for 60 s), followed by a 3-min rinse in running water; and (3) staining, hematoxylin staining for 5 min, followed by five dips in 1% acid alcohol (1% hydrochloric acid in 70% alcohol). After staining, the slides were rinsed, counterstained with eosin for 3 min at room temperature, dehydrated through graded alcohol solutions, and cleared in xylene before mounting.\u003c/p\u003e \u003cp\u003eImmunohistochemistry (IHC) assays were performed using the BenchMark XT automated staining system (Roche Diagnostics, Basel, Switzerland). Immunosignals were visualized with the OptiView DAB IHC Detection Kit (Roche). Briefly, the automated protocol included deparaffinization, antigen retrieval, and incubation with either anti-GAS2 antibody (1:400, ab55076; Abcam) or anti-KLF4 antibody (1:500, 11880-1-AP; Proteintech). Image acquisition was carried out using the VENTANA DP 200 slide scanner (Roche).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eApoptosis analysis in response to butyrate treatment\u003c/h3\u003e\n\u003cp\u003eCellular apoptosis induced by butyrate treatment was assessed by measuring mitochondrial membrane potential loss. Briefly, SW620-shLuc and SW620-shKLF4 cells were seeded at a density of 1.0 x 10⁶ cells per well in 1.5 mL culture medium in a 6-well plate and treated with 5 mM butyrate for 24 h. Apoptosis was evaluated using the JC-1 mitochondrial membrane potential assay (Solution 7, Cat. No. 910\u0026ndash;3007; ChemoMetec, Allerod, Denmark) according to the manufacturer\u0026rsquo;s instructions. Fluorescence intensity, indicating green and red signals, was visualized in the treated cells. In addition, fluorescence images were captured using the Olympus IX70 fluorescence microscope (Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003ch3\u003eTransmission electron microscopy analysis\u003c/h3\u003e\n\u003cp\u003eSW620 cells were seeded in 10 cm dishes overnight and then cultured for an additional 24 h in the presence or absence of 5 mM butyrate. Cells were subsequently collected using trypsin treatment and washed three times with cold PBS. Then, the cells were fixed in fixative buffer containing 4% paraformaldehyde (Cat. No. 15710; Electron Microscopy Sciences, Hatfield, PA, USA) and 2.5% glutaraldehyde (Cat. No. 16220; Electron Microscopy Sciences), followed by post-fixation in 1% osmium tetroxide (Cat. No. 19190; Electron Microscopy Sciences) for 2 h. The fixed cells were gradually dehydrated using increasing concentrations of ethanol. Once fully dehydrated in 100% ethanol, the cells were infiltrated with a plastic monomer using the Spurr Resin Kit (Cat. No. 14300; Electron Microscopy Sciences). Ultra-thin sections (70 nm) were cut using an ultramicrotome (EM-UC7; Leica Microsystems, Wetzlar, Germany). Images were captured using a JEOL JEM-1400 electron microscope (JEOL, Tokyo, Japan) at 100 kVA.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTCGA-based gene expression and correlation analysis\u003c/h2\u003e \u003cp\u003eTo investigate the expression profiles and correlation of GAS2 and KLF4 in CRC, transcriptomic data were retrieved from The Cancer Genome Atlas (TCGA) database through the GEPIA2 web server (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia2.cancer-pku.cn/\u003c/span\u003e\u003cspan address=\"http://gepia2.cancer-pku.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), which integrates TCGA and GTEx RNA sequencing datasets using a standardized processing pipeline.\u003c/p\u003e \u003cp\u003eDifferential expression analysis was performed to compare GAS2 and KLF4 expression levels between normal colorectal and tumor tissues. Expression values were normalized in transcripts per million (TPM), and results were presented as log\u003csub\u003e2\u003c/sub\u003e(TPM\u0026thinsp;+\u0026thinsp;1). Median expression levels were used to illustrate group-wise differences. To assess the association between GAS2 and KLF4, Spearman correlation analysis was conducted on the TCGA CRC dataset. The correlation coefficient (r) and P-value were reported. Survival analysis was also performed, and patients were stratified into low- and high-expression groups based on the median expression cutoff for GAS2 and KLF4. Overall survival was plotted using Kaplan\u0026ndash;Meier curves and assessed with log-rank tests, applying a \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 as the threshold for statistical significance.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eThe unpaired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test was used to compare the means between two groups, whereas analysis of variance was used to compare the means among three or more groups, followed by Tukey\u0026rsquo;s post hoc test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eUpregulation of KLF4 signaling following GAS2 suppression in metastatic CRC cells\u003c/h2\u003e \u003cp\u003eTo investigate the role of GAS2 in CRC tumorigenesis, we first confirmed its expression profile in metastatic CRC cells. We generated SW620 cells with GAS2 knockdown (only 23% of baseline expression) to explore downstream signaling alterations and functional outcomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Notably, pathway analysis showed that KLF4 signaling was among the most significantly upregulated, prompting further validation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, five signaling pathways (SP1, KLF4, heavy metals, endoplasmic reticulum stress, and amino acid deprivation) increased following GAS2 knockdown, whereas only the antioxidant response pathway showed reduced gene expression. Notably, the pathway of antioxidant response expression remarkably decreased (log\u003csub\u003e2\u003c/sub\u003e value, \u0026minus;\u0026thinsp;3.0), whereas SP1 (log\u003csub\u003e2\u003c/sub\u003e value, 1.4) and KLF4 (log\u003csub\u003e2\u003c/sub\u003e value, 1.0) pathways increased by at least twofold. However, these six pathways comprising 11 genes exhibited varying responses to GAS2 knockdown in SW620 cells (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Among these, four genes (SP1, NRF1, NRF2, and KLF4) in the pathways of SP1 and KLF4 were selected for comparison in SW620 cells with different GAS2 expression levels (SW620-shLuc vs SW620-shGAS2) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-F). Only KLF4 showed similar results in the Cignal 45-pathway reporter array. shGAS2-SW620 cells exhibited significantly higher levels of KLF4 (4.08-fold, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) than shLuc-SW620 cells (Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e test). However, KLF4 gene expression showed a negative correlation trend with GAS2 expression in SW620 cells. This difference in expression at the mRNA level also appeared at the protein level. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG, in SW620-shGAS2 cells, the protein expression of KLF4 was increased.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStage-dependent and\u003c/b\u003e \u003cb\u003einversely\u003c/b\u003e \u003cb\u003ecorrelated expression of GAS2 and KLF4 in CRC tissues\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe opposing expression patterns of GAS2 and KLF4 correlate with CRC progression and histological severity. In Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, histological assessment of H\u0026amp;E-stained tissue sections reveals a continuum of epithelial alterations across two CRC samples. In CRC01, the left region displays preserved glandular structures consistent with non-neoplastic colonic mucosa, while the right region exhibits increased epithelial cellularity and mild nuclear atypia, indicative of early dysplastic changes. In CRC02, more advanced pathology is observed: the left side shows moderate to high-grade dysplasia with glandular disorganization and nuclear hyperchromasia, whereas the right side is characterized by infiltrative nests of pleomorphic epithelial cells with prominent nuclear enlargement and hyperchromasia, diagnostic of invasive moderately differentiated adenocarcinoma. Corresponding immunohistochemical staining demonstrates a stage-dependent expression pattern, with GAS2 expression progressively upregulated from dysplasia to carcinoma, supporting its role in malignant progression. In contrast, KLF4 expression is progressively diminished, consistent with loss of differentiation and attenuation of its tumor-suppressive function.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThis trend is further corroborated in an additional CRC patient sample shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB. The H\u0026amp;E-stained section reveals non-neoplastic mucosa on the left and moderately differentiated adenocarcinoma on the right (black arrows), with features of architectural distortion and cytological atypia. GAS2 staining is markedly increased in the tumor region (red arrows), while nearly absent in the adjacent non-tumor tissue. Although KLF4 expression was detectable (blue arrow), it was predominantly localized in the cytoplasm and appeared reduced in regions with high GAS2 expression (red arrows), with no evident nuclear staining even in non-neoplastic epithelium. Notably, in the tumor compartment, KLF4 remains cytoplasmic, reinforcing the notion of functional mislocalization rather than complete loss. This subcellular redistribution may reflect impaired transcriptional activity and further supports the involvement of KLF4 inactivation and GAS2 upregulation in CRC pathogenesis.\u003c/p\u003e \u003cp\u003eAn association with unfavorable patient prognosis was also observed in relation to these expression patterns, as supported by TCGA meta-analysis data. Specifically, GAS2 was significantly upregulated in CRC tissues compared to normal controls, as reflected by higher median TPM values in tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), while KLF4 was consistently downregulated, aligning with its tumor-suppressive role (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). A moderate inverse correlation between GAS2 and KLF4 expression was identified (r = \u0026minus;\u0026thinsp;0.3, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Although not statistically significant, high GAS2 expression trended toward poorer prognosis, whereas elevated KLF4 expression was associated with improved survival outcomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF and G).\u003c/p\u003e \u003cp\u003e \u003cb\u003eInverse regulation of GAS2 and KLF4 in CRC cells and synergistic anti-proliferative effects of butyrate and troglitazone\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIsogenic CRC cell lines SW480 and SW620, which possess different metastatic potentials, were used to assess the expression levels of GAS2 and KLF4. Briefly, the relative expression level of GAS2 in SW620 cells was 403.10 times higher than that in SW480 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, P\u0026thinsp;=\u0026thinsp;0.010), whereas the relative level of KLF4 in SW620 cells was only 0.17 times higher than that in SW480 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, P\u0026thinsp;=\u0026thinsp;0.013). In addition, we observed that, similar to the peroxisome proliferator-activated receptor gamma agonist TGZ [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], the SCFA butyrate could upregulate KLF4 expression. Treatment with 5 mM butyrate for 24 h reduced GAS2 expression by 0.68-fold (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, P\u0026thinsp;=\u0026thinsp;0.015) and increased KLF4 expression by 2.84-fold in SW620 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, P\u0026thinsp;=\u0026thinsp;0.038). Furthermore, treating SW620 cells with 50 \u0026micro;M troglitazone (TGZ), a PPARγ agonist, has been found to upregulate KLF4 expression for 6 h significantly elevated KLF4 expression by at least 7.98-fold, compared with the changes in GAS2 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, P\u0026thinsp;\u0026lt;\u0026thinsp;0.000001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eImmunoblot analysis also demonstrated the differential expression of TGZ-induced KLF4 and GAS2 at the protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). The altered expression of these two genes influenced the proliferation of SW620 cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, both 5 mM butyrate and 50 \u0026micro;M TGZ significantly inhibited the proliferation of SW620 cells compared to untreated controls (all \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Moreover, 50 \u0026micro;M TGZ exhibited a stronger inhibitory effect compared to 10 \u0026micro;M TGZ, which may correspond to the findings in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, where 50 \u0026micro;M TGZ induced a higher expression level of KLF4 in SW620 cells. Compared to cells treated with 50 \u0026micro;M TGZ alone, the combined treatment with 5 mM butyrate and 50 \u0026micro;M TGZ was also found to further enhance the inhibition of cell proliferation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.002). Comprehensively, under co-treatment with 5 mM butyrate and 50 \u0026micro;M TGZ, the growth rate of SW620 cells was reduced to only 0.42 folds of that in the untreated control group, representing the most pronounced inhibition of cancer cell growth observed in this study (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003cb\u003eB\u003c/b\u003e. \u003cb\u003epullicaecorum\u003c/b\u003e \u003cb\u003eattenuates CRC progression and reverses GAS2\u0026ndash;KLF4 expression patterns in a mouse model\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo extend the findings from human CRC tissues, we next evaluated the impact of the butyrate-producing gut microbe \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e on CRC progression using a DMH/DSS-induced mouse model (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, the colonic inner surfaces of control mice appeared smooth with no visible nodules. In contrast, mice treated with DMH/DSS developed prominent nodular formations and multiple large lumps, indicative of advanced CRC. However, \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e administration markedly mitigated these changes, resulting in relatively smooth colonic mucosa with only faint or minor nodular growths. These macroscopic findings suggest that \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e attenuates tumor progression in this experimental model. Histological analysis further supported this effect. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB shows that the total tumor burden in the distal colon (approximately 1.5 cm from the anus) of \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e-treated mice was visibly reduced compared to untreated DMH/DSS-induced CRC mice. Colon sections from control mice were histologically normal, with no signs of epithelial disorganization, fibrosis, inflammation, or hyperplasia. In contrast, pronounced epithelial dysplasia was observed in CRC-bearing mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), which appeared attenuated following \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e administration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eQuantitative analysis revealed a reduction in dysplastic area percentage (from 81% to 64%) and a decrease in the tumor-stromal ratio (TSR) (from 4.0 to 2.3) upon \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Extended group-based statistical comparisons confirmed these effects: compared to untreated CRC mice (dysplastic area: 75.8%; TSR: 3.2), \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e-treated mice exhibited a significantly lower dysplastic area (64.9%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE) and reduced TSR (2.2, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.021; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eTo determine whether these morphological improvements were associated with molecular changes, we performed immunohistochemical staining for GAS2 and KLF4 in colonic tissue sections. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, both proteins were barely detectable in the control group. In DMH/DSS-induced CRC tissues, GAS2 was strongly expressed, while KLF4 was weak and cytoplasmic, consistent with the patterns observed in human CRC tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Importantly, \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e treatment led to a marked reduction in GAS2 expression and restoration of KLF4 levels, suggesting that probiotic administration reverses the GAS2\u0026ndash;KLF4 imbalance associated with tumor progression.\u003c/p\u003e \u003cp\u003eThese findings collectively demonstrate that the expression dynamics of GAS2 and KLF4 in the mouse CRC model parallel those observed in human CRC tissues, and further highlight the potential of \u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e in modulating the molecular and pathological features of CRC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eButyrate induces KLF4-dependent mitochondrial apoptotic responses in CRC cells\u003c/h2\u003e \u003cp\u003ePrevious results suggested that butyrate (5 mM, \u003cem\u003ein vitro\u003c/em\u003e) or \u003cem\u003eB. pullicaecorum\u003c/em\u003e (10⁷ CFU/mL, \u003cem\u003ein vivo\u003c/em\u003e) may suppress CRC progression by modulating GAS2 and KLF4 expression. To further explore the mechanistic link between these molecular changes and organelle integrity, we examined mitochondrial morphology, lysosomal abundance, and mitochondrial membrane potential in SW620 cells following butyrate treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTransmission electron microscopy (TEM) provided high-magnification images of untreated (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) and butyrate-treated (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) SW620 cells. In untreated cells, oval mitochondria with visible cristae were observed alongside numerous cytoplasmic vesicles and electron-dense lysosomes, hallmarks of metabolically active cancer cells. In contrast, cells treated with 5 mM butyrate exhibited mitochondria with altered morphology, including more elongated or rounded profiles and cristae loss. Additionally, mitochondrial fission events (indicated by white arrowheads) were frequently detected in the butyrate-treated group, suggesting the activation of mitochondrial remodeling and apoptotic signaling. Notably, the number and density of lysosomes were visibly reduced in butyrate-treated cells compared to controls, implying suppression of lysosomal or autophagic flux in response to butyrate.\u003c/p\u003e \u003cp\u003eBecause mitochondrial dynamics are tightly linked to intrinsic apoptosis, we next evaluated changes in mitochondrial membrane potential using the JC-1 assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In control SW620-shLuc cells expressing endogenous KLF4, butyrate induced a shift in JC-1 fluorescence from red (aggregated form) to green (monomeric form), indicating mitochondrial membrane depolarization. However, this shift was absent in SW620-shKLF4 cells, suggesting that KLF4 is essential for butyrate-induced mitochondrial dysfunction and apoptosis.\u003c/p\u003e \u003cp\u003eTogether, these findings indicate that butyrate promotes mitochondrial fission and membrane depolarization while reducing lysosomal density. Together, these organelle alterations accompany KLF4-dependent activation of intrinsic apoptotic pathways and may contribute to the anti-tumor effects of butyrate in CRC cells.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGAS2 silencing and idarubicin additively reduce tumor burden and metabolism\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo further explore therapeutic strategies targeting the GAS2\u0026ndash;KLF4 axis, we investigated whether silencing GAS2 or treating with idarubicin (IDA), a topoisomerase II inhibitor, could suppress tumor growth in vivo (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Xenograft tumors were established on the dorsal flank of SCID mice using SW620 cells with GAS2 knockdown (SW620-shGAS2) or control vector (SW620-shLuc), with or without IDA treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eIn vivo\u003c/em\u003e bioluminescence imaging revealed significant reductions in ROI luminescence in mice bearing SW620-shGAS2 tumors or receiving IDA treatment (SW620-shLuc/IDA), compared to untreated controls (SW620-shLuc) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Quantitative analysis confirmed that IDA significantly reduced ROI values (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.038), while GAS2 knockdown alone also led to a substantial decline. However, combining GAS2 silencing with IDA (SW620-shGAS2/IDA) did not produce further additive effects (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eTumor volume and glucose metabolism were further assessed via \u003csup\u003e18\u003c/sup\u003eF-FDG PET imaging (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC\u0026ndash;E). Tumors formed by SW620-shLuc cells were larger and exhibited higher \u003csup\u003e18\u003c/sup\u003eF-FDG uptake (SUVmean) compared to those in other groups. IDA treatment alone reduced tumor size with borderline statistical significance (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.059), whereas GAS2 knockdown resulted in a significant size reduction (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.026) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Importantly, \u003csup\u003e18\u003c/sup\u003eF-FDG uptake was also attenuated in tumors from mice treated with IDA or bearing GAS2-silenced tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE), reflecting reduced metabolic activity.\u003c/p\u003e \u003cp\u003eCollectively, these data demonstrate that both GAS2 suppression and IDA treatment can independently inhibit CRC tumor growth and metabolism in vivo, supporting further investigation of therapeutic strategies targeting the GAS2\u0026ndash;KLF4 axis.\u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe present study identifies the GAS2\u0026ndash;KLF4 axis as a regulator of mitochondrial apoptosis in CRC. Our data demonstrate that GAS2 expression is elevated whereas KLF4 is reduced in advanced CRC tissues and metastatic cell models, with an inverse correlation observed in patient samples and TCGA datasets. Functionally, suppression of GAS2 restored KLF4 expression and promoted mitochondrial depolarization and apoptotic responses, supporting a role for this axis in governing intrinsic cell death susceptibility.\u003c/p\u003e \u003cp\u003eAlthough GAS2 was initially characterized as a cytoskeletal-associated protein involved in growth arrest, accumulating evidence suggests context-dependent functions in cancer [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In CRC, GAS2 overexpression has been associated with tumor aggressiveness and metastasis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Our findings extend these observations by linking GAS2 suppression to restoration of KLF4 and mitochondrial apoptotic signaling. While the precise molecular mechanism connecting GAS2 to KLF4 regulation requires further clarification, the consistent inverse relationship across experimental systems supports a functional interaction influencing apoptotic vulnerability.\u003c/p\u003e \u003cp\u003eKLF4 is a well-established tumor suppressor with roles in differentiation, cell-cycle regulation, and apoptosis [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Here, KLF4 was required for mitochondrial depolarization following butyrate exposure, indicating that KLF4 contributes to intrinsic apoptotic responses in CRC cells. Ultrastructural analyses revealed mitochondrial remodeling and reduced lysosomal density following butyrate treatment. These structural alterations are consistent with activation of intrinsic apoptotic pathways and reflect coordinated organelle remodeling during apoptotic commitment. Together with mitochondrial depolarization data, these findings support a role for KLF4 in regulating mitochondrial integrity during cell death induction.\u003c/p\u003e \u003cp\u003eButyrate, a microbiota-derived short-chain fatty acid, has been widely recognized for its anti-tumorigenic properties [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Beyond its role as a histone deacetylase inhibitor, our data suggest that butyrate modulates the GAS2\u0026ndash;KLF4 axis and promotes mitochondrial apoptotic signaling. Consistently, administration of the butyrate-producing bacterium \u003cem\u003eButyricicoccus pullicaecorum\u003c/em\u003e attenuated tumor development in a DMH/DSS mouse model and partially restored the GAS2\u0026ndash;KLF4 balance in vivo. Although this study focused on a single bacterial strain, the findings support a broader role for butyrate-producing microbiota in modulating intrinsic apoptotic pathways and maintaining intestinal homeostasis. These findings support a link between microbial metabolites and regulation of intrinsic cell death pathways in CRC.\u003c/p\u003e \u003cp\u003eTherapeutically, both GAS2 IDA treatment reduced tumor burden and metabolic activity in xenograft models. The absence of additive effects when combined suggests potential convergence on shared apoptotic mechanisms. Given previous reports linking GAS2 to responsiveness to DNA-damaging agents [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], GAS2 expression may influence sensitivity to topoisomerase II inhibition in CRC.\u003c/p\u003e \u003cp\u003eAt the tissue level, probiotic treatment reduced dysplasia and tumor\u0026ndash;stroma ratio, parameters associated with CRC progression [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Modulation of the tumor microenvironment through microbial metabolites may therefore complement intrinsic apoptotic activation, providing a dual mechanism of tumor suppression.\u003c/p\u003e \u003cp\u003eSeveral limitations should be acknowledged. Although inverse GAS2\u0026ndash;KLF4 expression was observed in clinical datasets, survival associations were modest and require validation in larger cohorts. Furthermore, while mitochondrial depolarization and ultrastructural changes support activation of intrinsic apoptotic pathways, additional molecular dissection of the regulatory mechanism linking GAS2 to KLF4 will be important in future studies. Differences between murine and human microbiota compositions should also be considered when translating probiotic findings to clinical settings.\u003c/p\u003e \u003cp\u003eCollectively, our findings support a model in which suppression of GAS2 restores KLF4-dependent mitochondrial apoptotic signaling, thereby limiting CRC progression and enhancing therapeutic responsiveness. Modulation of this axis through genetic suppression, butyrate-producing microbiota, or chemotherapeutic intervention with IDA highlights the GAS2\u0026ndash;KLF4 pathway as a regulatory node influencing apoptotic vulnerability. Targeting this signaling axis may therefore represent a strategy to re-establish intrinsic cell death sensitivity in CRC, particularly in tumors characterized by elevated GAS2 expression.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCRC\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;colorectal cancer\u003c/p\u003e\n\u003cp\u003eGAS2\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;growth arrest-specific 2\u003c/p\u003e\n\u003cp\u003eKLF4\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;krüppel-like factor 4\u003c/p\u003e\n\u003cp\u003eSCFAs\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;short-chain fatty acids\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eB\u003c/em\u003e. \u003cem\u003epullicaecorum\u003c/em\u003e \u003cem\u003eButyricicoccus pullicaecorum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHCC\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;hepatocellular carcinoma\u003c/p\u003e\n\u003cp\u003esh\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;short hairpin\u003c/p\u003e\n\u003cp\u003eLuc\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;luciferase\u003c/p\u003e\n\u003cp\u003eTGZ\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;troglitazone\u003c/p\u003e\n\u003cp\u003eIDA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;idarubicin\u003c/p\u003e\n\u003cp\u003eGAPDH\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;glyceraldehyde 3-phosphate dehydrogenase\u003c/p\u003e\n\u003cp\u003eDSS\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;dextran sodium sulfate\u003c/p\u003e\n\u003cp\u003eSDS–PAGE\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;sodium dodecyl sulfate–polyacrylamide gel electrophoresis\u003c/p\u003e\n\u003cp\u003eSCID\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;severe combined immunodeficient\u003c/p\u003e\n\u003cp\u003ePBS\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;phosphate-buffered saline\u003c/p\u003e\n\u003cp\u003eROI\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;region of interest\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e18\u003c/sup\u003eF-FDG\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;18F-fluorodeoxyglucose\u003c/p\u003e\n\u003cp\u003eNanoPET\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;nano positron emission tomography\u003c/p\u003e\n\u003cp\u003eH\u0026amp;E\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;hematoxylin and eosin\u003c/p\u003e\n\u003cp\u003eIHC\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;immunohistochemistry\u003c/p\u003e\n\u003cp\u003eTCGA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; the Cancer Genome Atlas.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to Professor Rwei-Fen S. Huang of the Department of Nutritional Science, College of Human Ecology, Fu Jen Catholic University, for her expert guidance in interpreting the electron microscopy data, and to Dr. Chih-Yi Liu (Exquisite Biotechnology Company, Taipei, Taiwan) for her assistance with pathological analyses. We also extend our appreciation to Mr. Yen-Sheng Wu for his technical support at the Electron Microscope Laboratory, Tsung Cho Chang School of Medicine, Fu Jen Catholic University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.C.W., H.H.L., C.J.H., and M.H.S. conceived the study and supervised the research. Y.C.W., C.L.L., C.J.H., W.C.K., and Y.H.S. acquired and analyzed the data, with support from H.H.L. and M.H.S. K.W.C. and S.Y.L. performed molecular imaging experiments, including PET and IVIS analyses. Y.C.W., C.L.L., C.J.H., S.C.C., I.T.C., H.H.L., and M.H.S. drafted and revised the manuscript. C.L.L., M.H.S., C.J.H., and S.C.C. secured funding. All authors reviewed and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis\u0026nbsp;work was supported by the Fu Jen Catholic University Hospital and Fu Jen Catholic University (PL-202308014-V and PL-202408007-V), Cathay General Hospital (CGH-MR-A11216, CGH-MR-D11102, and CGH-MR-B11221), Chang Gung University of Science and Technology (EZRPF3P0111 and EZRPF3Q0221), and National Science and Technology Council (113-2314-B-281-004-).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData and materials are available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDECLARATION OF COMPETING INTEREST\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlmeida MPP, Condinho MSL. Biological Therapies for Metastatic Colorectal Cancer: Literature Review. Curr Pharm Biotechnol. 2026.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCzescik U, Gryglas M, Szterk A, Flis S. Evolution or Revolution in Colorectal Cancer Treatment: Present and Future of New Therapeutic Options. A Narrative Review. Oncol Res. 2026;34:2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChe H, Li ZJ, Xu L, Du YB, Zhang SO, Ying XJ. Advances in mitochondrial-targeted colorectal cancer therapy: Mechanistic insights and clinical translation. iScience. 2026;29:114511.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAwad A, Abdul Karim N. Dysregulation of Mitochondrial Function in Cancer Cells. Int J Mol Sci. 2025;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi J, Wu L, Tian C, Chen H. Unraveling the role of mitochondrial unfolded protein response in colorectal cancer. Biochem Biophys Rep. 2026;45:102359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNelson VK, Nuli MV, Mastanaiah J, Saleem TSM, Birudala G, Jamous YF, et al. Reactive oxygen species mediated apoptotic death of colon cancer cells: therapeutic potential of plant derived alkaloids. Front Endocrinol (Lausanne). 2023;14:1201198.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSofi FA, Tabassum N. Natural product inspired leads in the discovery of anticancer agents: an update. J Biomol Struct Dyn. 2023;41:8605\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee CL, Huang CJ, Yang SH, Chang CC, Huang CC, Chien CC, et al. Discovery of genes from feces correlated with colorectal cancer progression. Oncol Lett. 2016;12:3378\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa W, Lin J, Ma R, Bai Y, Wu D, Zhang X, et al. Insights into Structure and Function of Growth Arrest Specific 2 (GAS2). J Cancer. 2025;16:146\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang CJ, Lee CL, Yang SH, Chien CC, Huang CC, Yang RN, et al. Upregulation of the growth arrest-specific-2 in recurrent colorectal cancers, and its susceptibility to chemotherapy in a model cell system. Biochim Biophys Acta. 2016;1862:1345\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang CC, Huang CC, Yang SH, Chien CC, Lee CL, Huang CJ. Data on clinical significance of GAS2 in colorectal cancer cells. Data Brief. 2016;8:82\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou H, Ge Y, Sun L, Ma W, Wu J, Zhang X, et al. Growth arrest specific 2 is up-regulated in chronic myeloid leukemia cells and required for their growth. PLoS One. 2014;9:e86195.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu T, Amoah K, Chan TW, Bahn JH, Lee JH, Terrazas S, et al. Massively parallel screen uncovers many rare 3' UTR variants regulating mRNA abundance of cancer driver genes. Nat Commun. 2024;15:3335.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi BJ, Cho YG, Song JW, Kim CJ, Kim SY, Nam SW, et al. Altered expression of the KLF4 in colorectal cancers. Pathol Res Pract. 2006;202:585\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu M, Hao B, Zhan Y, Luo G. Kruppel-like factor 4 expression in solid tumor prognosis: A meta-analysis. Clin Chim Acta. 2018;485:50\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiu DH, Chen Y, Liu L, Yang HS, Liu GF. Tumor-suppressive role of Kruppel-like factor 4 (KLF-4) in colorectal cancer. Genet Mol Res. 2017;16:gmr1601927.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang VW, Liu Y, Kim J, Shroyer KR, Bialkowska AB. Increased Genetic Instability and Accelerated Progression of Colitis-Associated Colorectal Cancer through Intestinal Epithelium-specific Deletion of Klf4. Mol Cancer Res. 2019;17:165\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen ZY, Rex S, Tseng CC. Kruppel-like factor 4 is transactivated by butyrate in colon cancer cells. J Nutr. 2004;134:792\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlandez M, Guilmeau S, Blache P, Augenlicht LH. KLF4 regulation in intestinal epithelial cell maturation. Exp Cell Res. 2008;314:3712\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlvandi E, Wong WKM, Joglekar MV, Spring KJ, Hardikar AA. Short-chain fatty acid concentrations in the incidence and risk-stratification of colorectal cancer: a systematic review and meta-analysis. BMC Med. 2022;20:323.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu G, Tang J, Zhou J, Dong M. Short-chain fatty acids play a positive role in colorectal cancer. Discov Oncol. 2024;15:425.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGomes S, Baltazar F, Silva E, Preto A. Microbiota-Derived Short-Chain Fatty Acids: New Road in Colorectal Cancer Therapy. Pharmaceutics. 2022;14:2359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGomes S, Rodrigues AC, Pazienza V, Preto A. Modulation of the Tumor Microenvironment by Microbiota-Derived Short-Chain Fatty Acids: Impact in Colorectal Cancer Therapy. Int J Mol Sci. 2023;24:5069.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBach Knudsen KE, Laerke HN, Hedemann MS, Nielsen TS, Ingerslev AK, Gundelund Nielsen DS, et al. Impact of Diet-Modulated Butyrate Production on Intestinal Barrier Function and Inflammation. Nutrients. 2018;10:1499.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang CC, Shen MH, Chen SK, Yang SH, Liu CY, Guo JW, et al. Gut butyrate-producing organisms correlate to Placenta Specific 8 protein: Importance to colorectal cancer progression. J Adv Res. 2020;22:7\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G, Yu Y, Wang YZ, Wang JJ, Guan R, Sun Y, et al. Role of SCFAs in gut microbiome and glycolysis for colorectal cancer therapy. J Cell Physiol. 2019;234:17023\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang SC, Shen MH, Liu CY, Pu CM, Hu JM, Huang CJ. A gut butyrate-producing bacterium Butyricicoccus pullicaecorum regulates short-chain fatty acid transporter and receptor to reduce the progression of 1,2-dimethylhydrazine-associated colorectal cancer. Oncol Lett. 2020;20:327.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiekmann W, Tina E, Von Sydow AK, Gupta A. Effect of lidocaine and ropivacaine on primary (SW480) and metastatic (SW620) colon cancer cell lines. Oncol Lett. 2019;18:395\u0026ndash;401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S, Zhou Q, He H, Zhao Y, Liu Z. Peroxisome proliferator-activated receptor gamma agonists induce cell cycle arrest through transcriptional regulation of Kruppel-like factor 4 (KLF4). J Biol Chem. 2013;288:4076\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllegrucci C, Rushton MD, Dixon JE, Sottile V, Shah M, Kumari R, et al. Epigenetic reprogramming of breast cancer cells with oocyte extracts. Mol Cancer. 2011;10:7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu R, Mok MT, Kang W, Lau SS, Yip WK, Chen Y, et al. Truncated HBx-dependent silencing of GAS2 promotes hepatocarcinogenesis through deregulation of cell cycle, senescence and p53-mediated apoptosis. J Pathol. 2015;237:38\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu RX, Cheng ASL, Chan HLY, Yang DY, Seto WK. Growth arrest-specific gene 2 suppresses hepatocarcinogenesis by intervention of cell cycle and p53-dependent apoptosis. World J Gastroenterol. 2019;25:4715\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee E, Cheung J, Bialkowska AB. Kruppel-like Factors 4 and 5 in Colorectal Tumorigenesis. Cancers (Basel). 2023;15:2430.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu H, Liu L, Li W, Zou D, Yu J, Wang L, et al. Transcription factors in colorectal cancer: molecular mechanism and therapeutic implications. Oncogene. 2021;40:1555\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Fang Y, Lyu Z, Tian Y, Niu S, Li YR, et al. Microbiome modulation of tumorigenesis and immune responses. J Biomed Sci. 2026;33:4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeong J, Baines KJ, Maleki Vareki S. Microbial-Derived Metabolites and Their Impact on Cancer Immunotherapy. Cancer Immunol Res. 2026;14:194\u0026ndash;204.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhanemi M, Pourshohod A, Zeinali M, Barzegari E, Akbari A, Absalan F, et al. Potential Advantages of Idarubicin-Loaded Trastuzumab-Coated Liposomes for Combating Head and Neck Squamous Cancer Cells. Cell J. 2024;26:436\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamirez-Guzman LA, Huang W, Cole JJ, J\u0026oslash;rgensen HG. GAS2 Upregulation Is a Targetable Vulnerability in Chronic Myeloid Leukemia. Int J Transl Med. 2024;4:354\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShang A, Yu P, Li L, He G, Xu J. Tumor\u0026ndash;stroma ratio as a clinical prognostic factor in colorectal carcinoma: A meta\u0026ndash;analysis of 7,934 patients. Oncol Lett. 2025;29:190.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi L, Zhang Y, Wang H. Prognostic prediction based on histopathologic features of tumor microenvironment in colorectal cancer. Front Med (Lausanne). 2023;10:1154077.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrous MTA, Faes TKE, Gubbels A, van der Linden RLA, Mesker WE, Bosscha K, et al. A high tumour-stroma ratio (TSR) in colon tumours and its metastatic lymph nodes predicts poor cancer-free survival and chemo resistance. Clin Transl Oncol. 2022;24:1047\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Colorectal cancer, Mitochondrial apoptosis, GAS2, KLF4, Butyrate, Intrinsic cell death, Therapeutic responsiveness","lastPublishedDoi":"10.21203/rs.3.rs-9004103/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9004103/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eImpaired intrinsic apoptosis contributes to colorectal cancer (CRC) progression, yet the upstream regulators governing mitochondrial integrity remain incompletely defined. Growth arrest-specific protein 2 (GAS2) has been implicated in CRC malignancy, whereas Kr\u0026uuml;ppel-like factor 4 (KLF4) functions as a tumor suppressor; however, their functional relationship in apoptotic regulation is unclear. Here, we demonstrate that GAS2 expression is elevated while KLF4 is reduced in advanced CRC tissues, metastatic CRC cell lines, and The Cancer Genome Atlas datasets, exhibiting a significant inverse correlation. Genetic suppression of GAS2 restored KLF4 expression and induced mitochondrial fragmentation, membrane depolarization, and apoptotic cell death in CRC cells. Silencing KLF4 attenuated mitochondrial depolarization following butyrate treatment, indicating that KLF4 is required for mitochondrial apoptotic responses downstream of GAS2 suppression. Ultrastructural analyses revealed that butyrate induces mitochondrial remodeling and reduces lysosomal density, changes that are consistent with activation of intrinsic apoptotic pathways. In vivo, administration of the butyrate-producing bacterium \u003cem\u003eButyricicoccus pullicaecorum\u003c/em\u003e mitigated tumor progression in a chemically induced CRC model and partially reversed the GAS2\u0026ndash;KLF4 imbalance. Furthermore, GAS2 knockdown or idarubicin treatment independently reduced tumor burden and metabolic activity in xenograft models. Collectively, these findings identify the GAS2\u0026ndash;KLF4 axis as a regulator of mitochondrial apoptosis in CRC and suggest that targeting GAS2 may restore apoptotic vulnerability and enhance therapeutic responsiveness.\u003c/p\u003e","manuscriptTitle":"The GAS2–KLF4 axis regulates mitochondrial apoptosis and therapeutic responsiveness in colorectal cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-23 08:41:49","doi":"10.21203/rs.3.rs-9004103/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"dada6e31-8ff9-4224-a8b1-34526465d5ec","owner":[],"postedDate":"March 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":64636743,"name":"Health sciences/Diseases/Gastrointestinal diseases/Gastrointestinal cancer/Colorectal cancer/Colon cancer"},{"id":64636744,"name":"Biological sciences/Genetics/Gene regulation"}],"tags":[],"updatedAt":"2026-04-16T10:30:40+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-23 08:41:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9004103","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9004103","identity":"rs-9004103","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}