Impact of Exogenous Direct Electric Current on the expression of mRNA related to OPG, in SaOS-2 Cells using quantitative reverse transcription polymerase chain reaction: A Qualitative and quantitative analysis.

Impact of Exogenous Direct Electric Current on the expression of mRNA related to OPG, in SaOS-2 Cells using quantitative reverse transcription polymerase chain reaction: A Qualitative and quantitative analysis. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of Exogenous Direct Electric Current on the expression of mRNA related to OPG, in SaOS-2 Cells using quantitative reverse transcription polymerase chain reaction: A Qualitative and quantitative analysis. Dr. Aparajita Pandey, Dr. Ashish Agrawal, Dr. Parimal Das, Ritu Dixit, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6773193/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective To evaluate OPG gene expression in SaOS-2 cells following exposure to pulsed direct current (30 µA/10 sec, square wave) using qRT-PCR at various time points (5,7,12 and 24 hours). Materials and Methods The study investigated the effects of direct current (DC) electrical stimulation on SaOS-2 cells by exposing experimental groups to DC (30 µA, 10 sec pulses) for 5, 7, 12, and 24 hours, while control groups received no stimulation. Stainless steel electrodes were used, and both groups were cultured under identical conditions. Qualitative assessments included cell morphology via phase contrast microscopy, and quantitative evaluations involved MTT assays for viability and Quantitative Reverse Transcription Polymerase Chain Reaction(qRT-PCR) for osteoprotegerin (OPG) gene expression. RNA was isolated post-stimulation, followed by complementary DNA (cDNA ) synthesis for gene analysis. Data were analyzed to assess stimulation-induced cellular and genetic responses. Results Direct current stimulation caused time-dependent cytotoxicity in SaOS-2 cells, with cell death rising from ~ 10% at 5 hours to ~ 52% at 24 hours. qRT-PCR showed significant downregulation of OPG expression, nearly suppressed by 12–24 hours (p < 0.0001), indicating strong inhibitory effects on cell viability and gene expression. Conclusion Direct electrical stimulation downregulated OPG expression in SaOS-2 cells in a time-dependent manner, with a significant drop observed as early as 5 hours.MTT assay revealed time-dependent cytotoxicity from DC stimulation.Reduced OPG expression suggests potential enhancement of osteoclastic activity, indicating a possible role of DC stimulation in bone remodeling, warranting further investigation. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 1. INTRODUCTION For ages, the duration of orthodontic treatment has been a significant concern, often spanning from a few months to several years. It demands considerable patience and dedication from the patient. Orthodontic procedures to accelerate tooth movement and reduce treatment duration are categorized as surgical (e.g., corticotomy,, piezoincision) and non-surgical (e.g., laser radiation, vibration, electromagnetic waves, pharmacological methods)[ 31 , 10 ]. Converse piezoelectricity is one such non invasive method which can reduce duration of orthodontic tooth movement. It occurs when an external electric current is applied on a crystalline material which generates a voltage and triggers a biochemical response[ 8 ].Carter et al in his review concluded the potential of converse piezoelectricity to increase bone formation and decrease bone resorption[ 8 ]. Rachmat et al evaluated the effect of electric fields on osteosarcoma cells(MG 63) and concluded that the number of cells decreased each day which indicated that the electric fields affect the proliferation of osteosarcoma cells[ 24 ]. Bones possess piezoelectric properties, due to the organized and patterned structure of collagen and hydroxyapatite crystals allowing them to generate electrical and biochemical signals in response to mechanical activity, which in turn stimulates bone remodelling[ 8 ]. Various osteosarcoma cell lines include MG-63, Saos-2 and U-2 OS UMR 106 and the ROS 17/2[ 13 , 28 , 21 ]. Christoph et al compared three osteosarcoma cell lines (MG-63, Saos-2 and U-2 OS) with normal human osteoblasts by immunocytochemistry in which Saos-2 cells revealed the most mature osteoblastic labelling profile[ 21 ].In 2004, Sahm et al. studied the voltage-dependent effects of alternating current on human osteoblast morphology, gene expression, and protein accumulation[ 28 ]. Osteogenic differentiation genes COL1A1, ALP, and BGLAP were investigated[ 28 ]. These cells can be fully differentiated to mimic the natural behaviour of osteoblastic cells. Hence Saos2 cells capable of full differentiation, mimic osteoblastic behaviour and closely resemble human bone cells, making them suitable for experimentation[ 14 , 26 ]. Biomarkers are potential tool to assess the bone remodelling capacity[ 10 ]. The Receptor Activator of Nuclear Factor kappa B (RANK)/RANK ligand (RANKL)/osteoprotegerin (OPG) system, along with the more recently identified leucine-rich repeat-containing G protein-coupled receptor 4 (LGR4), are crucial in both bone and vascular mineralization[ 11 ]. OPG expression in osteoblasts is influenced by various cytokines, hormones, growth factors and is triggered by various signalling pathway such as Wnt/b- catenin pathway[ 4 ]. The canonical Wnt pathway regulates mesenchymal stem cells and osteoblast progenitor proliferation and differentiation, while also modulating osteoclast-driven bone resorption[ 4 ]. Jagged1/Notch1 signalling indirectly regulates the OPG/RANKL ratio in stromal cells, while noncanonical Wnt, JAK/STAT, and Hedgehog pathways interact with Wnt/β-catenin, collectively maintaining bone homeostasis[ 30 , 17 ]. The human OPG gene (gene symbol: TNFRSF11B), located on chromosome 8 (8q24.12), encodes a receptor composed of 401 amino acids[ 4 ]. Human and mouse OPG share 85% similarity in their amino acid sequences[ 4 ]. Additionally, OPG is a member of the TNF receptor superfamily[ 11 ].The Tumour Necrosis Factor superfamily of ligands (TNFSF) and receptors (TNFRSF) communicates between different cell types during development, particularly in the skin, bone, and lymphoid organs[ 33 , 3 ]. Real-time PCR (Polymerase Chain Reaction), also known as quantitative PCR (qPCR), is a widely used and powerful technique for analyzing gene expression. This method enables the quantification of specific nucleic acid sequences in real time during the amplification process. By using fluorescent dyes or probes that bind to the DNA, researchers can monitor the accumulation of the target sequence after each PCR cycle. The use of qRT-PCR in this method is significant as it provides a sensitive and reliable approach to quantitatively and qualitatively analyze mRNA expression, enabling precise evaluation of OPG gene regulation in response to direct electric current in SaOS-2 cells[ 25 ]. Literature remained silent on the alteration in gene expression in relation to direct electric current stimulation. Therefore, an original study was conducted to find out the effect of external electrical stimulation on TNFRSF11B gene, which encodes the OPG gene to the receptor for OPG synthesis. 2. MATERIALS AND METHODS 2.1 Saos2 cells culturing: Saos2 cells were purchased from National Centre for Cell Culture. The cells were cultured in Dulbecco’s Modified Eagles Medium (DMEM) which contain four time greater concentration of vitamins, amino acids and supplementary components with L-Glutamine and 4.5 g/l of Glucose and 15% v/v Fetal Bovine Serum (FBS) and 1% Penicillin/Streptomycin (10.00U/ml). Proliferative culture was maintained at 37⁰C in a humified incubator with 5% CO 2 (Thermo Scientific).Subculturing was done by washing the cell monolayers twice with calcium and magnesium free phosphate buffered saline after aspirating the old medium. Cells were trypsinized with 200 µl of trypsin-EDTA (0.25%) to detach the cells. Cells were incubated at 37⁰C for 2–3 min until the cells detach from the surface. The trypsin was then neutralised by adding fresh media. Saos2 cells were passaged in a ratio of 1:2. Regular maintenance includes replacing the medium every 2–3 days and monitoring cell health and confluency under a phase contrast microscope (Leica Microsystems). 2.2 Experimental Design: Saos2 cells were seeded in six-well plates (1 × 10⁵ cells/well) and incubated at 37°C for 12 hours. Stainless steel electrodes (18 − 8/304 grade) were sterilized with 70% ethanol, phosphate-buffered saline, and UV light overnight. Cells were electrically stimulated (30µA, 10s intervals), with experimental groups divided by duration: E1 (5h), E2 (7h), E3 (12h), E4 (24h). Control groups received no stimulation but had electrodes connected under identical culture conditions. 2.3 Cell morphology: Cellular morphology and viability of experimental and control groups were documented at 5 ,7 ,12 and 24 hrs using phase contrast microscopy(Leica Microsystems). 2.4 RNA Isolation and Quantification: Cells were washed with cold PBS, lysed with 1 mL TRIZOL, and homogenized. 0.2 mL chloroform was added, mixed, and incubated (2–3 min), followed by centrifugation (12,000 rpm, 15 min, 4°C) to separate phases. The RNA-containing aqueous phase was transferred, mixed with 0.5 mL isopropanol, incubated (10 min), and centrifuged (12,000 rpm, 10 min, 4°C) to form an RNA pellet. The pellet was washed with 75% ethanol, centrifuged (7,500 rpm, 5 min, 4°C), air-dried (5–10 min), and resuspended in 25 µL RNase-free water. 2.5 RNA quantification : After complete resuspension of RNA, RNA quality was checked in 1% agarose gel. The gel was then loaded and electrophorese at 5–6 V/cm until the bromophenol blue migrated 2–3 mm into the gel .Then the gel was visualized on UV transilluminator. Afterwards RNA was quantified using a NanoDrop1000 spectrophotometer (Thermo Scientific). 2.6 cDNA preparation : 2.6(a) Removal of genomic DNA from RNA preparations 2 µg RNA was DNase I-treated (2.5 U DNase I, 37°C, 30 min) to remove genomic DNA. The reaction was stopped with 2.5 µL 50 mM EDTA and incubated at 65°C for 10 min. cDNA was synthesized using SuperScript™ III First-Strand Synthesis System with random hexamers following the manufacturer’s protocol. RNA hydrolysis occurred during heating, and the processed RNA was used as a reverse transcription template as given in Table I. Table I: Component of removing genomic DNA from RNA Volume RNA 1µL 10×Reaction Buffer with MgCl 2 1µL DNase I, RNase-free 1µL Water, nuclease-free To 10µL 2.6(b)First Strand cDNA synthesis After thawing, the components were mixed and centrifuged. Then the following reagents were added into sterile nuclease free tube as given in Table 2 . Table 2 Components of cDNA synthesis Volume Template RNA 0.1ng-5µg Oligo(dT) 18 primer 1µL Water, nuclease-free 12 µL Total Volume 12µL Then following components were added in following order as given in Table 3 .The components were mixed gently and centrifuged gently. For oligo(Dt) 18 cDNA synthesis, it was incubated for 60 min at 42°C. Then the reaction was terminated by heating at 70°C for 5 minutes. Table 3 Components of cDNA synthesis Volume 5×Reaction Buffer 4µL Ribo Lock RNase Inhibitor(20U/µL) 1µL 10Mm DNTP Mix 2µL RevertAid M-MuL V RT 1µL Total Volume 20µL 2.7 Quantitative Real Time PCR (qRT-PCR) The effect of electrical stimulation on the expression of Osteoprotegerin was determined through Quantitative Real Time PCR assays using OPG specific primers as mentioned in Table 4 .Sequence of primers used in qRT-PCR is tabulated in following table.The experiment was performed for all experimental (5, 7, 12 and 24 hr) and their respective untreated controls in triplicate using Sybr green (Puregene) in 7500 Real-Time RT-PCR System (Applied Biosystems). β-actin was used as an internal control for normalizing expression data. Table 4 Primer name Seq (5’-3’) Length OPG ACTCTATCTCAAGGTAGCGCC 21bp β-actin AGGTCTTTGCGGATGTCCACGT 22bp 2.7(a)Data analysis of RT-PCR Data was presented as fold change of expression of mutant compared to wild-type with standard error of mean. To determine the expression level of transcripts comparative C t (ΔΔCt) based fold change calculations were done. One way Anova test was used to determine significant mean differences in mRNA levels between control and experimental groups. p value < 0.05 was considered statistically significant. 2.8 MTT Assay Cell viability after direct current (DC) stimulation was assessed using the MTT assay. Cells were seeded in 6-well plates at 1 × 10⁵ cells/well and stimulated for 5, 7, 12, or 24 hours at 37°C in a CO₂ incubator. Post-treatment, media were removed and 200 µL of MTT solution (5 mg/mL in PBS) was added to each well. Plates were incubated for 4 hours in the dark at 37°C.After incubation, 100 µL from each well was transferred to a 96-well plate, followed by 100 µL of DMSO to dissolve formazan crystals. Plates were shaken for 10 minutes, and absorbance was measured at 570 nm. Absorbance, proportional to cell viability, was recorded for control, treated, DMSO, and media-only groups. Percentage viability was then calculated by comparing the absorbance of treated wells to the control wells by following formula Cell Viability (%)=(Absorbance of treated cells ÷ Absorbance of control cells)×100 2.8(a) Data analysis of MTT Assay The absorbance values were normalized with DMSO and media only controls. After normalization, the percentage of viable cells was calculated using the formula given below. The % viable cells in experimental and control group was plotted and compared to visualize the effects of electrical stimulation for different time points on cell viability. Student t test was done to determine the statistical significance and p value < 0.05 was considered statistically significant. 3. RESULTS 3.(a)Cell Culture Maintenance and Subculturing SaOS-2 cells were received in a confluent state from NCCS Pune (Fig. 2 ), quarantined, and maintained in the lab. Subculturing was done at a 1:2 ratio with weekly media changes. Cells appeared healthy by day 4 and 6 (Fig. 4 A, 4 B), reaching ~ 90% confluency by day 10 (Fig. 5 ), suitable for passaging and experiments. 4.(b)Effect of stimulation on cell morphology SaOS-2 cells, widely used in bone cancer research, were observed under phase contrast microscopy (Nikon Eclipse, 20x). Prior to experimentation, cells appeared predominantly spindle-shaped with some round cells, measuring 15–20 µm in length. They were mostly isolated with occasional small clusters, displaying a spread-out morphology and visible central nuclei. Cytoplasmic granules and vacuoles were also noted (Fig. 6 A).After 5 hours of direct current stimulation, cells appeared more elongated, though overall morphology remained unchanged. Cell death was observed near the stainless steel electrode sites (Fig. 6 B). After 7 hours of direct current electrical stimulation, SaOS-2 cells appeared shrunken as seen in Fig. 7 B. Cell death was also observed after 7 hours of treatment (Fig. 7 B). Similar results were obtained after 12 hours of direct current stimulation. Morphologically, cells showed shrinking and reduced size compared to the untreated control. We have also observed a remarkable cell death after 12 hours of stimulation as clearly visible in Fig. 8 . After 24 hours of direct current stimulation, we have observed a remarkable amount of cell death in cells around the electrode. Overall cell death was observed in the cell in Fig. 9 (B). Cell showed shrinkage. 4. (c ).MTT Assay MTT assay results showed a clear time-dependent cytotoxic effect of direct electrical stimulation on SaOS-2 cells (Fig. 17). Absorbance at 570 nm was normalized against cell-free medium and DMSO blanks, with measurements taken in triplicate.Control samples showed minimal cell death. After 5 hours of stimulation, cell death reached ~ 10%, increasing to ~ 17–18% at 7 hours. A sharp rise occurred by 12 hours (~ 50% cell death), indicating a critical threshold. At 24 hours, cell death plateaued at ~ 51–52%, suggesting maximum cytotoxicity was reached by 12 hours. 4.(d)RNA quality and quantity RNA was extracted from all experimental and controls cultures after their treatment periods were over. The RNA quality was determined using agarose gel electrophoresis and visualizing the ethidium bromide stained gel on a UV transilluminator. Intact total RNA run was observed with sharp 28S, 18S and a small 5.8s rRNA bands. The 28S rRNA band was approximately twice as intensity as the 18S rRNA band (Fig. 11 ). The RNA quantity was determined using nanodrop. RNA concentrations are given in Table 5 . Table 5 Nanodrop quantification and concentration of RNA samples Sample ID Concentration (ng/ul) A260/280 A260/230 Control-5hr 356.24 1.92 2.12 Saos2-5hr 540.26 2.02 2.54 Control-7hr 289.34 1.97 2.59 Saos2-7hr 411.84 1.99 2.92 Control-12 hr 209.84 2.22 2.86 Saos2-12 hr 200.11 2.23 2.76 Control-24 hr 189.12 2.67 2.89 Saos2-24 hr 210.84 1.89 2.11 6. (e )Expression analysis of OPG by qRT-PCR: The graph displays the fold change in OPG expression across different time points after electrical stimulation treatment. The no treatment control (NTC) shows the highest expression level with a fold change of approximately 3.8, with visible error bars indicating some variability in the measurements. As the duration of electrical stimulation increases, there is a clear down regulation of OPG expression. In No treatment control, at 5 hours post-treatment (NTC5h), the fold change decreases to approximately 3.8. By 12 hours (NTC12h), the expression drops significantly to about 0.9-fold, indicating a substantial reduction compared to the baseline. At 24 hours (NTC24h), the expression decreases further to approximately 0.3-fold. The treated samples at 5 hours (T5h), 7 hours (T7h), 12 hours (T12h), and 24 hours (T24h) all show significantly reduced OPG expression, with fold changes close to zero. It indicates a statistically significant difference between these treated samples and their respective controls, suggesting the electrical stimulation has a highly significant effect (p<0.0001) on suppressing OPG expression. DISCUSSION Large bone defects, non-unions, and open fractures remain major challenges in orthopaedics, while prolonged treatment time is a key concern in orthodontics. Tissue engineering strategies that deliver osteoprogenitor cells with osteoconductive and osteoinductive scaffolds offer potential for faster bone remodelling.Direct current (DC)[ 1 ] stimulation has been widely studied in tissue engineering, especially for cardiac[ 5 ] and nerve tissues[ 18 ], and shows promise in bone regeneration due to the piezoelectric nature of bone. DC can influence cell proliferation and differentiation, but its exact role in bone remodelling is not yet fully understood[ 1 , 2 ]. Since the 1980s, studies have highlighted the potential of direct current (DC) in bone cell stimulation. Ferrier et al.[ 12 ] showed enhanced cell migration under DC, while Zhuang et al. [ 34 ] reported changes in TGF-β, BMP-2, and mRNA expression. In this study, we examined the effect of DC on osteoprotegerin (OPG) gene expression (TNFRSF11B) in SaOS-2 cells. OPG is key to bone remodelling, inhibiting osteoclast activity by interacting with RANKL. SaOS-2, a widely used osteoblast-like cell line, was chosen for its reliability in bone-related research[ 4 ]. Initially, cells displayed spindle-shaped morphology with occasional round cells, consistent with Rodan et al.[ 26 ] After 5 hours of direct current (DC) stimulation, cells became more elongated without major changes, aligning with Mobini et al[ 20 ]. However, by 7 hours, signs of shrinkage and cell death appeared, particularly near electrodes—indicative of early apoptosis, as also noted by Genovese et al[ 15 ]. Prolonged exposure (12–24 hours) led to marked cell death and irreversible damage, consistent with Caputo et al[ 7 ].Localized damage near electrodes suggests that current density gradients influence cellular response. MTT assay results supported this, showing minimal cytotoxicity at 5 hours, a sharp rise by 12 hours, and a plateau at ~ 51–52% by 24 hours. This pattern mirrors findings by Chaudhari et al. [ 9 ]and Caputo et al.[ 7 ], emphasizing a critical threshold between 7–12 hours where cytotoxicity rapidly escalates. TNFRSF11B is a member of the tumour necrosis factor receptor (TNF) superfamily and is a key regulator of bone homeostasis[ 32 ].Upregulation was seen in the study done by Cancel et al[ 6 ] who demonstrated the effect of DC stimulation on neuroactive genes in isolated astrocytes. However, mixed findings have been reported regarding TNFRSF11B expression by Hirai et al.[ 16 ], he demonstrated that α1B-adrenergic receptor signalling regulates the circadian expression of Tnfrsf11b in osteoblasts, indicating that its expression is time-dependent and influenced by circadian rhythms.Their findings support the idea that up regulation of TNFRSF11B plays a crucial role in bone remodelling. The transcriptional and translational efficiency of TNFRSF11B is influenced by secondary structures of mRNA, such as hairpins, pseudoknots, and G-quadruplexes, which affect ribosome movement and mRNA stability[ 29 ].This may be probable reasons to our findings where cDNA obtained during RT-PCR, exhibited down regulation of OPG protein expression. Other reasons for decreased OPG protein expression could be reduced half life of mRNA which could have encoded less cDNA and thus reduced expression of OPG ,as also concluded by Mauger et al.[ 19 ] who emphasized that RNA quality plays a pivotal role in downstream gene expression studies, ensuring reliable results in qRT-PCR analysis. qRT-PCR analysis revealed a significant, time-dependent downregulation of OPG expression, with the steepest decline between 5 and 12 hours of DC stimulation. By 24 hours, OPG levels were markedly suppressed (p ≤ 0.0001), indicating that prolonged electrical stimulation strongly affects gene regulation. These findings align with Mobini et al.[ 20 ] and Chaudhari et al.[ 9 ], who also reported altered gene expression and reduced OPG mRNA under DC stimulation. As Presnyk et al.[ 22 ] suggested, non-optimal coding may reduce mRNA stability and protein output. This downregulation may disrupt the RANK/RANKL/OPG axis and impact osteoblast-to-osteocyte differentiation, as highlighted by Prideaux et al[ 23 ]. The observed down-regulation of OPG expression highlights potential applications in orthodontics. Bone is a dynamic and metabolically active tissue that constantly undergoes re-modelling. This process involves the breakdown of old bone by osteoclasts, followed by the creation of new bone by osteoblasts, primarily through the mechanisms of resorption and formation[ 4 ].Modulating OPG expression can influence osteoclastogenesis and bone resorption.The finding of this study opens avenues for using DC stimulation to alter bone remodelling in clinical scenarios, potentially enhancing orthodontic treatment efficiency by facilitating controlled bone resorption and promoting faster tooth movement. It also aims to enhance patient outcomes by alleviating stress, boosting compliance, and shortening treatment durations in orthodontic procedures. However, further research is warranted to explore gene-level alterations in RANKL and other proteins involved in osteoclast differentiation, to fully harness the therapeutic potential of bioelectric stimulation in orthodontic and bone remodelling treatments. CONCLUSION The direct electrical stimulation progressively downregulates the OPG expression in SaOS-2 cells, with the effect becoming more pronounced as the duration of stimulation increases. The most significant reduction is observed between the control group and the earliest treatment time point (5 hours), indicating that electrical stimulation greatly influences OPG gene expression in these osteosarcoma cells. Qualitative analysis with phase contrast microscopy showed threshold level of 5 hours with minimum changes in morphological appearance of SaOS-2 cells. MTT assay results demonstrated time dependent cytotoxic impact of direct electric stimulation of SaOS-2 cells. DC stimulation had positive role in bioengineered bone remodelling as the study shows down regulation of OPG protein expression which indirectly indicates enhanced osteoclastic activity which requires further investigation. Declarations Ethics approval and consent to participate: All procedures performed in studies were in accordance with the ethical standards of the institutional and/or national research committee.Approval was obtained from the Ethics Committee of the Banaras Hindu University. Funding: Not applicable. Author Contribution A.P. and A.A wrote the main manuscript text.P.D. and R.D. prepared all figures and tables .P.R. did experimentation.S.K.S edited the main manuscript text.All authors reviewed the manuscript References Tseng YC. Department of Orthodontics, Kaohsiung Medical University Hospital. Taiwanese Journal of Orthodontics. 2020;32(2). DOI: 10.38209/2708-2636.1004. El-Angbawi A, McIntyre GT, Fleming PS, Bearn DR. Non-surgical adjunctive interventions for accelerating tooth movement in patients undergoing fixed orthodontic treatment. Cochrane Database Syst Rev. 2015;11:CD010887. DOI: 10.1002/14651858.CD010887.pub2 Carter A, Popowski K, Cheng K, Greenbaum A, et al. Enhancement of Bone regeneration Through the Converse Piezoelectric Effect: A Novel Approach for Applying mechanical Stimulation. Bioelectricity. 2021;3(4):1-9. DOI: 10.1089/bioe.2021.0019. Rachmat O, Fiddiyanti I, Sutedja E,Ismone D,Hidajat N. Effect of electric field on osteosarcoma(Mg-63) cells. Int J Sci Res & Edu. 2017 June;vol5(6):6513-6516. Fidan M Camsari C, Coban M Cetinkaya A, Kline E. In vitro effects of direct and alternate electric fields on saos2 cell line. World Cancer Research Journal, 2019. Sahm F, Ziebert J, Jonitz-Heincke A, Hansmann D, Dauben T, Bader R.Alternating electric fields modify the function of human osteoblasts growing on and in the surroundings of titanium electrodes. International Journal pf Molecular Sciences,2020 Sep22;21(18):6944. Pautke C, Schieker M, Tischer T, Kolk A, Neth P, Mutschler W, Milz S. Characterization of osteosarcoma cell lines MG-63, Saos-2 and U-2 OS in comparison to human osteoblasts. Anticancer Res. 2004;24:3743-3748. Fogh J, Fogh JM, Orfeo T. One Hundred and Twenty-Seven Cultured Human Tumor Cell Lines Producing Tumors in Nude Mice. J Natl Cancer Inst. 1977;58(3):623-7. Rodan GA, Wesolowski G, Thomas KA, et al. Characterization of a human osteosarcoma cell line (Saos-2) with osteoblastic properties. PMID: 3040234. Fernández-Villabrille S, Martín-Carro B, Martín-Vírgala J, Rodríguez-Santamaria MDM, Baena-Huerta F, Muñoz-Castañeda JR, Fernández-Martín JL, Alonso-Montes C, Naves-Díaz M, Carrillo-López N, Panizo S. Novel Biomarkers of Bone Metabolism. Nutrients. 2024 Feb 22;16(5):605. doi: 10.3390/nu16050605. PMID: 38474734; PMCID: PMC10935093. Boyce BF, Xing L. Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res Ther. 2007;9(Suppl 1):S1. Takehito T, et al. RANKL biology: bone metabolism, the immune system, and beyond. Inflamm Regen. 2020. Liu J, Xiao Q, Xiao J, Niu C, Li Y, Zhang X, Zhou Z, Shu G, Yin G. Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct Target Ther. 2022;7(1):3. doi:10.1038/s41392-021-00762-6. Ward-Kavanagh L, Lin WW, Šedý JS, Ware CF. The TNF Receptor Superfamily in Costimulating and Coinhibitory Responses. Immunity. 2016 May 17;44(5):1005-1019. doi:10.1016/j.immuni.2016.04.019. Bodmer JL, Schneider P, Tschopp J. The molecular architecture of the TNF superfamily. Trends Biochem Sci. 2002; 27:19–26. [PubMed: 11796220] Rocha AJ, Miranda RS, Sousa AJ, Silva AL. Guidelines for Successful Quantitative Gene Expression in Real-Time qPCR Assays. IntechOpen. 2016;14(12):65850. DOI: 10.5772/65850 Agrawal A, Dwivedi P, Chaturvedi TP, Mittal N. Effect of electrical stimulation on orthodontic tooth movement: A systematic review. Int J Orthod. 2019;30(3):51-56. Bravo-Olín J, Martínez-Carreón SA, Francisco-Solano E, Lara AR, Beltran-Vargas NE. Analysis of the role of perfusion, mechanical, and electrical stimulation in bioreactors for cardiac tissue engineering. Bioprocess Biosyst Eng. 2024;47:767–839. Martín D, Bocio-Nuñez J, Scagliusi SF, Pérez P, Huertas G, Yúfera A, Giner M, Daza P. DC electrical stimulation enhances proliferation and differentiation on N2a and MC3T3 cell lines. J Biol Eng. 2022;16:27. Agrawal A, Chou TM. Impact of vibration on the levels of biomarkers: a systematic review. J Indian Orthod Soc. 2021;55(3):230-242. Ferrier J, Ross SM, Kanehisa J, Aubin JE. Osteoclast migration and direct current electric fields. J Cell Biol. 1986;102(6):2482-90. Zhuang H, Wang W, Seldes R, Tahernia D, Fan H, Brighton CT. Electrical stimulation alters gene expression in bone cells. J Orthop Res. 1997;15(4):573-80. Boyce BF, Xing L. Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res Ther. 2007;9(Suppl 1):S1. Rodan GA, Wesolowski G, Thomas KA, et al. Characterization of a human osteosarcoma cell line (Saos-2) with osteoblastic properties. PMID: 3040234. Mobini S, Leppik L, Parameswaran VT, Barker JH. In vitro effect of direct current electrical stimulation on rat mesenchymal stem cells. PeerJ. 2017;5:e2821. doi:10.7717/peerj.2821. Genovese, J.A., Spadaccio, C., Langer, J., Habe, J., Jackson, J., Patel, A.N., 2008. Electrostimulation induces cardiomyocyte predifferentiation of fibroblasts. Biochem. Biophys. Res. Commun. 370 (3), 450–455. Caputo, M., Zirpoli, H., De Rosa, M.C., Rescigno, T., Chiadini, F., Scaglione, A., Stellato, C., Giurato, G., Weisz, A., Tecce, M.F., et al., 2014. Effect of low frequency (lf) electric fields on gene expression of a bone human cell line. Electromagn. Biol. Med. 33 (4), 289–295. Chaudhari SD, Sharma KK, Marchetto JJ, Hydren JR, Burton BM, Moreno AP. Modulating OPG and TGF-β1 mRNA expression via bioelectrical stimulation. Bone Reports. 2021;15:101141. doi:10.1016/j.bonr.2021.101141. Van den Bosch MH, Blom AB, van Lent PL, van der Kraan PM, van den Berg WB. The role of TNFRSF11B in development of osteoarthritic cartilage. Rheumatology (Oxford). 2021 May 14;60(5):2340-2350. doi: 10.1093/rheumatology/keaa809. Cancel LM, Tarbell JM. The role of astrocytes in neurovascular coupling: A review. Front Cell Neurosci. 2015;9:310. doi:10.3389/fncel.2015.00310. Hirai T, Tanaka K, Togari A. α1B-Adrenergic receptor signaling controls circadian expression of Tnfrsf11b by regulating clock genes in osteoblasts. Biol Open. 2015;4(11):1400-1409. Smith R, Johnson T, Lee K. Influence of mRNA secondary structures on transcriptional and translational efficiency. J Mol Biol. 2025;12(4):123-130. Mauger DM, Cabral BJ, Presnyak V, Su SV, Reid DW, Goodman B, Link K, Khatwani N, Reynders J, Moore MJ, McFadyen IJ. mRNA structure regulates protein expression through changes in functional half-life. Proc Natl Acad Sci U S A. 2019;116(48):24075–24083. doi:10.1073/pnas.1908057116. Presnyak V, Alhusaini N, Chen YH, Martin S, Morris N, Kline N, et al. Codon optimality is a major determinant of mRNA stability. Cell. 2015;160(6):1111-1124. Prideaux M, Loveridge N, Pitsillides AA, Farquharson C. Extracellular matrix mineralization promotes E11/gp38 glycoprotein expression and drives osteocytic differentiation in Saos-2 cells. Bone. 2012;50(1):78–86 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6773193","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":468187443,"identity":"13de0e9e-a19c-449b-91d2-1b23cd5f8268","order_by":0,"name":"Dr. Aparajita Pandey","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYNACHgkGBvbmgw9ATD5itUgw8BxLNgAx2Yi1R4JBIkdNAsQiqIV/dvOzDz9kLOr4Z+SwVX7NsZNhY2B++OgGPtPvHDOe2QN0mMSZt8duy25LBjqMzdg4B581NxKMGXhAfjmel3ZbchszUAsPmzQ+LfI30j8z/gFqkT+QY1Ysua2esBaDGznGzCBbDE7kmDF+3HaYsBbDO2eKmWV4JCQ3njmWLM247TgPGzMBv8jdbt/M+Lanjl/uePPBjz+3Vdvzszc/fIzX+6C4YOyBsJl5wCQ+5TAtDD8gbMYfhFSPglEwCkbBiAQANAtDdNN2c8kAAAAASUVORK5CYII=","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":true,"prefix":"Dr.","firstName":"Aparajita","middleName":"","lastName":"Pandey","suffix":""},{"id":468187444,"identity":"12b26c83-11d1-49d0-bbfe-67aeadf17859","order_by":1,"name":"Dr. Ashish Agrawal","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"Dr.","firstName":"Ashish","middleName":"","lastName":"Agrawal","suffix":""},{"id":468187446,"identity":"92a9f87b-0181-4d1a-a7c1-4f659828d3b5","order_by":2,"name":"Dr. Parimal Das","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"Dr.","firstName":"Parimal","middleName":"","lastName":"Das","suffix":""},{"id":468187448,"identity":"114438c1-ef46-44b5-9cb3-b4e2fa155ad3","order_by":3,"name":"Ritu Dixit","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"","firstName":"Ritu","middleName":"","lastName":"Dixit","suffix":""},{"id":468187450,"identity":"b31baffe-7af0-4090-b75d-431808875258","order_by":4,"name":"Prashant Ranjan","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"","firstName":"Prashant","middleName":"","lastName":"Ranjan","suffix":""},{"id":468187453,"identity":"0cb6f823-6ccf-4a70-b696-3f13fffbea31","order_by":5,"name":"Sushit Kumar Sonu","email":"","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":false,"prefix":"","firstName":"Sushit","middleName":"Kumar","lastName":"Sonu","suffix":""}],"badges":[],"createdAt":"2025-05-29 06:08:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6773193/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6773193/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":85480008,"identity":"e41bdf19-aae5-4541-9d43-c555434eb5f3","added_by":"auto","created_at":"2025-06-26 10:48:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":114184,"visible":true,"origin":"","legend":"\u003cp\u003eResearch Design\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/1acb7534fbdb4eaf2c558afb.png"},{"id":85480010,"identity":"a9ef62d6-b1e8-459e-9eaa-2b20b7064e94","added_by":"auto","created_at":"2025-06-26 10:48:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":205069,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSaOS-2 cells when delivered from NCCS, Pune, Maharashtra at P29\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/c4b3ca785402eef72617f5f2.png"},{"id":85479503,"identity":"aad248af-75f0-4568-8a44-e8ff024aa4c6","added_by":"auto","created_at":"2025-06-26 10:40:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":254541,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSaOS-2 cells after first passage\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/c50a104331d01c7b2de433ce.png"},{"id":85479497,"identity":"61cdccdc-ff5b-4aec-987c-dc86d251c48a","added_by":"auto","created_at":"2025-06-26 10:40:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":386073,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A) SaOS- 2 cells 4 days after first passaging, media replaced at this stage\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB) SaoS-2 cells 6 days after passaging\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/e5fe1c6241c46da1ec926461.png"},{"id":85479495,"identity":"c326b82b-dbeb-4e93-adc6-2873bb996de4","added_by":"auto","created_at":"2025-06-26 10:40:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":289256,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eConfluent SaOS-2 cells ready for subculturing at day 10.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/f77833b17b2132120e992fd0.png"},{"id":85480009,"identity":"2be8b47c-4c0a-4ac1-9590-3092e360991c","added_by":"auto","created_at":"2025-06-26 10:48:31","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":268356,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003e(A) SaOS-2 cells before intervention (B) SaOS-2 cells after 5hours of DC electrical stimulation\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/f13201a56b343d6db3a7fb0d.png"},{"id":85480004,"identity":"a44e7fa7-5d14-4878-a7ac-606106ecb2af","added_by":"auto","created_at":"2025-06-26 10:48:31","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":296447,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003e(A) SaOS-2 cells before intervention (B) (E2) SaOS-2 cells after 7 hours of DC electrical stimulation\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/996f04ca7a6db65ed8c7076f.png"},{"id":85481224,"identity":"9d8efc00-1e9c-4219-ac06-cc317ad4c438","added_by":"auto","created_at":"2025-06-26 11:04:31","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":300508,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003e(A) SaOS-2 cells before intervention (B) (E3) SaOS-2 cells after 12 hours of DC electrical stimulation\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/b44105fb3354c9e8a76132db.png"},{"id":85480941,"identity":"6302845e-b91c-47de-b410-275131822bf2","added_by":"auto","created_at":"2025-06-26 10:56:31","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":289711,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003e(A) SaOS-2 cells before intervention (B) SaOS-2 cells after 24 hours of DC electrical stimulation\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/a4c66b6375a63ae05e09d535.png"},{"id":85479504,"identity":"0043b01b-37a6-45eb-b1ca-75f068bada43","added_by":"auto","created_at":"2025-06-26 10:40:31","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":33260,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eGraph depicting the cell viability assay (MTT assay) after direct electric stimulation of 5hr, 7hr, 12 hr and 24 hr. X-axis shows the percentage of cell death and on y axis time duration for electrical stimulation are depicted.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/a8939e150bb20a19c3fd4937.png"},{"id":85482101,"identity":"5aa4b936-7586-4cec-b961-3d4e6da5c149","added_by":"auto","created_at":"2025-06-26 11:12:31","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":92320,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eQuality check of RNA on 1.8 % agarose gel. Lane 1-8 represents Control-5hr, Saos2- 5hr Control-7 hr, Saos2- 7 hr Control-12 hr, Saos2- 12 hr Control-24 hr, Saos2- 24 hr.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/0aac23f8fe47d7825275dd30.png"},{"id":85479505,"identity":"013198b8-b8f0-43dd-bb62-a6739f95c3a9","added_by":"auto","created_at":"2025-06-26 10:40:31","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":56683,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eOPG expression in Saos2 cells at different time points\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/97065204dad52f5a48b0904d.png"},{"id":94089340,"identity":"019fd3ad-9648-4662-88f7-3c338f9799db","added_by":"auto","created_at":"2025-10-22 08:51:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4193684,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6773193/v1/493bb440-6ba3-472c-96ba-22eecfe6477d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of Exogenous Direct Electric Current on the expression of mRNA related to OPG, in SaOS-2 Cells using quantitative reverse transcription polymerase chain reaction: A Qualitative and quantitative analysis.","fulltext":[{"header":"1. INTRODUCTION","content":"\u003cp\u003eFor ages, the duration of orthodontic treatment has been a significant concern, often spanning from a few months to several years. It demands considerable patience and dedication from the patient. Orthodontic procedures to accelerate tooth movement and reduce treatment duration are categorized as surgical (e.g., corticotomy,, piezoincision) and non-surgical (e.g., laser radiation, vibration, electromagnetic waves, pharmacological methods)[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConverse piezoelectricity is one such non invasive method which can reduce duration of orthodontic tooth movement. It occurs when an external electric current is applied on a crystalline material which generates a voltage and triggers a biochemical response[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].Carter et al in his review concluded the potential of converse piezoelectricity to increase bone formation and decrease bone resorption[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Rachmat et al evaluated the effect of electric fields on osteosarcoma cells(MG 63) and concluded that the number of cells decreased each day which indicated that the electric fields affect the proliferation of osteosarcoma cells[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Bones possess piezoelectric properties, due to the organized and patterned structure of collagen and hydroxyapatite crystals allowing them to generate electrical and biochemical signals in response to mechanical activity, which in turn stimulates bone remodelling[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eVarious osteosarcoma cell lines include MG-63, Saos-2 and U-2 OS UMR 106 and the ROS 17/2[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Christoph et al compared three osteosarcoma cell lines (MG-63, Saos-2 and U-2 OS) with normal human osteoblasts by immunocytochemistry in which Saos-2 cells revealed the most mature osteoblastic labelling profile[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].In 2004, Sahm et al. studied the voltage-dependent effects of alternating current on human osteoblast morphology, gene expression, and protein accumulation[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Osteogenic differentiation genes COL1A1, ALP, and BGLAP were investigated[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. These cells can be fully differentiated to mimic the natural behaviour of osteoblastic cells. Hence Saos2 cells capable of full differentiation, mimic osteoblastic behaviour and closely resemble human bone cells, making them suitable for experimentation[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBiomarkers are potential tool to assess the bone remodelling capacity[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The Receptor Activator of Nuclear Factor kappa B (RANK)/RANK ligand (RANKL)/osteoprotegerin (OPG) system, along with the more recently identified leucine-rich repeat-containing G protein-coupled receptor 4 (LGR4), are crucial in both bone and vascular mineralization[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. OPG expression in osteoblasts is influenced by various cytokines, hormones, growth factors and is triggered by various signalling pathway such as Wnt/b- catenin pathway[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The canonical Wnt pathway regulates mesenchymal stem cells and osteoblast progenitor proliferation and differentiation, while also modulating osteoclast-driven bone resorption[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Jagged1/Notch1 signalling indirectly regulates the OPG/RANKL ratio in stromal cells, while noncanonical Wnt, JAK/STAT, and Hedgehog pathways interact with Wnt/β-catenin, collectively maintaining bone homeostasis[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The human OPG gene (gene symbol: TNFRSF11B), located on chromosome 8 (8q24.12), encodes a receptor composed of 401 amino acids[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Human and mouse OPG share 85% similarity in their amino acid sequences[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Additionally, OPG is a member of the TNF receptor superfamily[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].The Tumour Necrosis Factor superfamily of ligands (TNFSF) and receptors (TNFRSF) communicates between different cell types during development, particularly in the skin, bone, and lymphoid organs[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eReal-time PCR (Polymerase Chain Reaction), also known as quantitative PCR (qPCR), is a widely used and powerful technique for analyzing gene expression. This method enables the quantification of specific nucleic acid sequences in real time during the amplification process. By using fluorescent dyes or probes that bind to the DNA, researchers can monitor the accumulation of the target sequence after each PCR cycle. The use of qRT-PCR in this method is significant as it provides a sensitive and reliable approach to quantitatively and qualitatively analyze mRNA expression, enabling precise evaluation of OPG gene regulation in response to direct electric current in SaOS-2 cells[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLiterature remained silent on the alteration in gene expression in relation to direct electric current stimulation. Therefore, an original study was conducted to find out the effect of external electrical stimulation on TNFRSF11B gene, which encodes the OPG gene to the receptor for OPG synthesis.\u003c/p\u003e"},{"header":"2. MATERIALS AND METHODS","content":"\u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Saos2 cells culturing:\u003c/h2\u003e \u003cp\u003eSaos2 cells were purchased from National Centre for Cell Culture. The cells were cultured in Dulbecco\u0026rsquo;s Modified Eagles Medium (DMEM) which contain four time greater concentration of vitamins, amino acids and supplementary components with L-Glutamine and 4.5 g/l of Glucose and 15% v/v Fetal Bovine Serum (FBS) and 1% Penicillin/Streptomycin (10.00U/ml). Proliferative culture was maintained at 37⁰C in a humified incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e (Thermo Scientific).Subculturing was done by washing the cell monolayers twice with calcium and magnesium free phosphate buffered saline after aspirating the old medium. Cells were trypsinized with 200 \u0026micro;l of trypsin-EDTA (0.25%) to detach the cells. Cells were incubated at 37⁰C for 2\u0026ndash;3 min until the cells detach from the surface. The trypsin was then neutralised by adding fresh media. Saos2 cells were passaged in a ratio of 1:2. Regular maintenance includes replacing the medium every 2\u0026ndash;3 days and monitoring cell health and confluency under a phase contrast microscope (Leica Microsystems).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Experimental Design:\u003c/h2\u003e \u003cp\u003eSaos2 cells were seeded in six-well plates (1 \u0026times; 10⁵ cells/well) and incubated at 37\u0026deg;C for 12 hours. Stainless steel electrodes (18\u0026thinsp;\u0026minus;\u0026thinsp;8/304 grade) were sterilized with 70% ethanol, phosphate-buffered saline, and UV light overnight. Cells were electrically stimulated (30\u0026micro;A, 10s intervals), with experimental groups divided by duration: E1 (5h), E2 (7h), E3 (12h), E4 (24h). Control groups received no stimulation but had electrodes connected under identical culture conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Cell morphology:\u003c/h2\u003e \u003cp\u003eCellular morphology and viability of experimental and control groups were documented at 5 ,7 ,12 and 24 hrs using phase contrast microscopy(Leica Microsystems).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 RNA Isolation and Quantification:\u003c/h2\u003e \u003cp\u003eCells were washed with cold PBS, lysed with 1 mL TRIZOL, and homogenized. 0.2 mL chloroform was added, mixed, and incubated (2\u0026ndash;3 min), followed by centrifugation (12,000 rpm, 15 min, 4\u0026deg;C) to separate phases. The RNA-containing aqueous phase was transferred, mixed with 0.5 mL isopropanol, incubated (10 min), and centrifuged (12,000 rpm, 10 min, 4\u0026deg;C) to form an RNA pellet. The pellet was washed with 75% ethanol, centrifuged (7,500 rpm, 5 min, 4\u0026deg;C), air-dried (5\u0026ndash;10 min), and resuspended in 25 \u0026micro;L RNase-free water.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 RNA quantification :\u003c/h2\u003e \u003cp\u003eAfter complete resuspension of RNA, RNA quality was checked in 1% agarose gel. The gel was then loaded and electrophorese at 5\u0026ndash;6 V/cm until the bromophenol blue migrated 2\u0026ndash;3 mm into the gel .Then the gel was visualized on UV transilluminator. Afterwards RNA was quantified using a NanoDrop1000 spectrophotometer (Thermo Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 cDNA preparation :\u003c/h2\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.6(a) Removal of genomic DNA from RNA preparations\u003c/h2\u003e \u003cp\u003e2 \u0026micro;g RNA was DNase I-treated (2.5 U DNase I, 37\u0026deg;C, 30 min) to remove genomic DNA. The reaction was stopped with 2.5 \u0026micro;L 50 mM EDTA and incubated at 65\u0026deg;C for 10 min. cDNA was synthesized using SuperScript\u0026trade; III First-Strand Synthesis System with random hexamers following the manufacturer\u0026rsquo;s protocol. RNA hydrolysis occurred during heating, and the processed RNA was used as a reverse transcription template as given in Table I.\u003c/p\u003e \u003cp\u003eTable I:\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eComponent of removing genomic DNA from RNA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVolume\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRNA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u0026times;Reaction Buffer with MgCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDNase I, RNase-free\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWater, nuclease-free\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTo 10\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.6(b)First Strand cDNA synthesis\u003c/h2\u003e \u003cp\u003eAfter thawing, the components were mixed and centrifuged. Then the following reagents were added into sterile nuclease free tube as given in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e\u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eComponents of cDNA synthesis\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVolume\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTemplate RNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.1ng-5\u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOligo(dT)\u003csub\u003e18\u003c/sub\u003e primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWater, nuclease-free\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal Volume\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThen following components were added in following order as given in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e3\u003c/span\u003e.The components were mixed gently and centrifuged gently. For oligo(Dt)\u003csub\u003e18\u003c/sub\u003e cDNA synthesis, it was incubated for 60 min at 42\u0026deg;C. Then the reaction was terminated by heating at 70\u0026deg;C for 5 minutes.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e\u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eComponents of cDNA synthesis\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVolume\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u0026times;Reaction Buffer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRibo Lock RNase Inhibitor(20U/\u0026micro;L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10Mm DNTP Mix\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRevertAid M-MuL V RT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal Volume\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20\u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Quantitative Real Time PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eThe effect of electrical stimulation on the expression of \u003cem\u003eOsteoprotegerin\u003c/em\u003e was determined through Quantitative Real Time PCR assays using \u003cem\u003eOPG\u003c/em\u003e specific primers as mentioned in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e .Sequence of primers used in qRT-PCR is tabulated in following table.The experiment was performed for all experimental (5, 7, 12 and 24 hr) and their respective untreated controls in triplicate using Sybr green (Puregene) in 7500 Real-Time RT-PCR System (Applied Biosystems). β-actin was used as an internal control for normalizing expression data.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e\u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSeq (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLength\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOPG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTCTATCTCAAGGTAGCGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTCTTTGCGGATGTCCACGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.7(a)Data analysis of RT-PCR\u003c/h2\u003e \u003cp\u003eData was presented as fold change of expression of mutant compared to wild-type with standard error of mean. To determine the expression level of transcripts comparative C\u003csub\u003et\u003c/sub\u003e (ΔΔCt) based fold change calculations were done. One way Anova test was used to determine significant mean differences in mRNA levels between control and experimental groups. p value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.8 MTT Assay\u003c/h2\u003e \u003cp\u003eCell viability after direct current (DC) stimulation was assessed using the MTT assay. Cells were seeded in 6-well plates at 1 \u0026times; 10⁵ cells/well and stimulated for 5, 7, 12, or 24 hours at 37\u0026deg;C in a CO₂ incubator. Post-treatment, media were removed and 200 \u0026micro;L of MTT solution (5 mg/mL in PBS) was added to each well. Plates were incubated for 4 hours in the dark at 37\u0026deg;C.After incubation, 100 \u0026micro;L from each well was transferred to a 96-well plate, followed by 100 \u0026micro;L of DMSO to dissolve formazan crystals. Plates were shaken for 10 minutes, and absorbance was measured at 570 nm. Absorbance, proportional to cell viability, was recorded for control, treated, DMSO, and media-only groups. Percentage viability was then calculated by comparing the absorbance of treated wells to the control wells by following formula\u003c/p\u003e \u003cp\u003eCell Viability (%)=(Absorbance of treated cells\u0026thinsp;\u0026divide;\u0026thinsp;Absorbance of control cells)\u0026times;100\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.8(a) Data analysis of MTT Assay\u003c/h2\u003e \u003cp\u003eThe absorbance values were normalized with DMSO and media only controls. After normalization, the percentage of viable cells was calculated using the formula given below. The % viable cells in experimental and control group was plotted and compared to visualize the effects of electrical stimulation for different time points on cell viability. Student t test was done to determine the statistical significance and p value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. RESULTS","content":"\u003ch3\u003e3.(a)Cell Culture Maintenance and Subculturing\u003c/h3\u003e\n\u003cp\u003eSaOS-2 cells were received in a confluent state from NCCS Pune (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), quarantined, and maintained in the lab. Subculturing was done at a 1:2 ratio with weekly media changes. Cells appeared healthy by day 4 and 6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), reaching\u0026thinsp;~\u0026thinsp;90% confluency by day 10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), suitable for passaging and experiments.\u003c/p\u003e \n\u003ch3\u003e4.(b)Effect of stimulation on cell morphology\u003c/h3\u003e\n\u003cp\u003eSaOS-2 cells, widely used in bone cancer research, were observed under phase contrast microscopy (Nikon Eclipse, 20x). Prior to experimentation, cells appeared predominantly spindle-shaped with some round cells, measuring 15\u0026ndash;20 \u0026micro;m in length. They were mostly isolated with occasional small clusters, displaying a spread-out morphology and visible central nuclei. Cytoplasmic granules and vacuoles were also noted (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).After 5 hours of direct current stimulation, cells appeared more elongated, though overall morphology remained unchanged. Cell death was observed near the stainless steel electrode sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAfter 7 hours of direct current electrical stimulation, SaOS-2 cells appeared shrunken as seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB. Cell death was also observed after 7 hours of treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eSimilar results were obtained after 12 hours of direct current stimulation. Morphologically, cells showed shrinking and reduced size compared to the untreated control. We have also observed a remarkable cell death after 12 hours of stimulation as clearly visible in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eAfter 24 hours of direct current stimulation, we have observed a remarkable amount of cell death in cells around the electrode. Overall cell death was observed in the cell in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e(B). Cell showed shrinkage.\u003c/p\u003e\n\u003ch3\u003e4. (c ).MTT Assay\u003c/h3\u003e \u003cp\u003eMTT assay results showed a clear time-dependent cytotoxic effect of direct electrical stimulation on SaOS-2 cells (Fig.\u0026nbsp;17). Absorbance at 570 nm was normalized against cell-free medium and DMSO blanks, with measurements taken in triplicate.Control samples showed minimal cell death. After 5 hours of stimulation, cell death reached\u0026thinsp;~\u0026thinsp;10%, increasing to ~\u0026thinsp;17\u0026ndash;18% at 7 hours. A sharp rise occurred by 12 hours (~\u0026thinsp;50% cell death), indicating a critical threshold. At 24 hours, cell death plateaued at ~\u0026thinsp;51\u0026ndash;52%, suggesting maximum cytotoxicity was reached by 12 hours.\u003c/p\u003e \n\u003ch3\u003e4.(d)RNA quality and quantity\u003c/h3\u003e\n\u003cp\u003eRNA was extracted from all experimental and controls cultures after their treatment periods were over. The RNA quality was determined using agarose gel electrophoresis and visualizing the ethidium bromide stained gel on a UV transilluminator. Intact total RNA run was observed with sharp 28S, 18S and a small 5.8s rRNA bands. The 28S rRNA band was approximately twice as intensity as the 18S rRNA band (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e). The RNA quantity was determined using nanodrop. RNA concentrations are given in Table \u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNanodrop quantification and concentration of RNA samples\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eConcentration (ng/ul)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA260/280\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eA260/230\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl-5hr\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e356.24\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.92\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.12\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSaos2-5hr\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e540.26\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.02\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.54\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eControl-7hr\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e289.34\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e1.97\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e2.59\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSaos2-7hr\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e411.84\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e1.99\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e2.92\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eControl-12 hr\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e209.84\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e2.22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e2.86\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSaos2-12 hr\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e200.11\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e2.23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e2.76\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eControl-24 hr\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e189.12\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e2.67\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e2.89\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSaos2-24 hr\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e210.84\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e1.89\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e2.11\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \n\u003ch3\u003e6. (e )Expression analysis of OPG by qRT-PCR:\u003c/h3\u003e\n\u003cp\u003eThe graph displays the fold change in OPG expression across different time points after electrical stimulation treatment. The no treatment control (NTC) shows the highest expression level with a fold change of approximately 3.8, with visible error bars indicating some variability in the measurements. As the duration of electrical stimulation increases, there is a clear down regulation of OPG expression.\u003c/p\u003e \u003cp\u003eIn No treatment control, at 5 hours post-treatment (NTC5h), the fold change decreases to approximately 3.8. By 12 hours (NTC12h), the expression drops significantly to about 0.9-fold, indicating a substantial reduction compared to the baseline. At 24 hours (NTC24h), the expression decreases further to approximately 0.3-fold.\u003c/p\u003e \u003cp\u003eThe treated samples at 5 hours (T5h), 7 hours (T7h), 12 hours (T12h), and 24 hours (T24h) all show significantly reduced OPG expression, with fold changes close to zero. It indicates a statistically significant difference between these treated samples and their respective controls, suggesting the electrical stimulation has a highly significant effect (p\u0026lt;0.0001) on suppressing \u003cem\u003eOPG\u003c/em\u003e expression. \u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eLarge bone defects, non-unions, and open fractures remain major challenges in orthopaedics, while prolonged treatment time is a key concern in orthodontics. Tissue engineering strategies that deliver osteoprogenitor cells with osteoconductive and osteoinductive scaffolds offer potential for faster bone remodelling.Direct current (DC)[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] stimulation has been widely studied in tissue engineering, especially for cardiac[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] and nerve tissues[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], and shows promise in bone regeneration due to the piezoelectric nature of bone. DC can influence cell proliferation and differentiation, but its exact role in bone remodelling is not yet fully understood[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSince the 1980s, studies have highlighted the potential of direct current (DC) in bone cell stimulation. Ferrier et al.[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] showed enhanced cell migration under DC, while Zhuang et al. [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] reported changes in TGF-β, BMP-2, and mRNA expression. In this study, we examined the effect of DC on osteoprotegerin (OPG) gene expression (TNFRSF11B) in SaOS-2 cells. OPG is key to bone remodelling, inhibiting osteoclast activity by interacting with RANKL.\u003c/p\u003e \u003cp\u003eSaOS-2, a widely used osteoblast-like cell line, was chosen for its reliability in bone-related research[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Initially, cells displayed spindle-shaped morphology with occasional round cells, consistent with Rodan et al.[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] After 5 hours of direct current (DC) stimulation, cells became more elongated without major changes, aligning with Mobini et al[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. However, by 7 hours, signs of shrinkage and cell death appeared, particularly near electrodes\u0026mdash;indicative of early apoptosis, as also noted by Genovese et al[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Prolonged exposure (12\u0026ndash;24 hours) led to marked cell death and irreversible damage, consistent with Caputo et al[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].Localized damage near electrodes suggests that current density gradients influence cellular response. MTT assay results supported this, showing minimal cytotoxicity at 5 hours, a sharp rise by 12 hours, and a plateau at ~\u0026thinsp;51\u0026ndash;52% by 24 hours. This pattern mirrors findings by Chaudhari et al. [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]and Caputo et al.[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], emphasizing a critical threshold between 7\u0026ndash;12 hours where cytotoxicity rapidly escalates.\u003c/p\u003e \u003cp\u003eTNFRSF11B is a member of the tumour necrosis factor receptor (TNF) superfamily and is a key regulator of bone homeostasis[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].Upregulation was seen in the study done by Cancel et al[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] who demonstrated the effect of DC stimulation on neuroactive genes in isolated astrocytes. However, mixed findings have been reported regarding TNFRSF11B expression by Hirai et al.[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], he demonstrated that α1B-adrenergic receptor signalling regulates the circadian expression of Tnfrsf11b in osteoblasts, indicating that its expression is time-dependent and influenced by circadian rhythms.Their findings support the idea that up regulation of TNFRSF11B plays a crucial role in bone remodelling.\u003c/p\u003e \u003cp\u003eThe transcriptional and translational efficiency of TNFRSF11B is influenced by secondary structures of mRNA, such as hairpins, pseudoknots, and G-quadruplexes, which affect ribosome movement and mRNA stability[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].This may be probable reasons to our findings where cDNA obtained during RT-PCR, exhibited down regulation of OPG protein expression. Other reasons for decreased OPG protein expression could be reduced half life of mRNA which could have encoded less cDNA and thus reduced expression of OPG ,as also concluded by Mauger et al.[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] who emphasized that RNA quality plays a pivotal role in downstream gene expression studies, ensuring reliable results in qRT-PCR analysis.\u003c/p\u003e \u003cp\u003eqRT-PCR analysis revealed a significant, time-dependent downregulation of OPG expression, with the steepest decline between 5 and 12 hours of DC stimulation. By 24 hours, OPG levels were markedly suppressed (p\u0026thinsp;\u0026le;\u0026thinsp;0.0001), indicating that prolonged electrical stimulation strongly affects gene regulation. These findings align with Mobini et al.[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] and Chaudhari et al.[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], who also reported altered gene expression and reduced OPG mRNA under DC stimulation. As Presnyk et al.[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] suggested, non-optimal coding may reduce mRNA stability and protein output. This downregulation may disrupt the RANK/RANKL/OPG axis and impact osteoblast-to-osteocyte differentiation, as highlighted by Prideaux et al[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe observed down-regulation of OPG expression highlights potential applications in orthodontics. Bone is a dynamic and metabolically active tissue that constantly undergoes re-modelling. This process involves the breakdown of old bone by osteoclasts, followed by the creation of new bone by osteoblasts, primarily through the mechanisms of resorption and formation[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].Modulating OPG expression can influence osteoclastogenesis and bone resorption.The finding of this study opens avenues for using DC stimulation to alter bone remodelling in clinical scenarios, potentially enhancing orthodontic treatment efficiency by facilitating controlled bone resorption and promoting faster tooth movement. It also aims to enhance patient outcomes by alleviating stress, boosting compliance, and shortening treatment durations in orthodontic procedures. However, further research is warranted to explore gene-level alterations in RANKL and other proteins involved in osteoclast differentiation, to fully harness the therapeutic potential of bioelectric stimulation in orthodontic and bone remodelling treatments.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eThe direct electrical stimulation progressively downregulates the OPG expression in SaOS-2 cells, with the effect becoming more pronounced as the duration of stimulation increases. The most significant reduction is observed between the control group and the earliest treatment time point (5 hours), indicating that electrical stimulation greatly influences OPG gene expression in these osteosarcoma cells.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eQualitative analysis with phase contrast microscopy showed threshold level of 5 hours with minimum changes in morphological appearance of SaOS-2 cells.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eMTT assay results demonstrated time dependent cytotoxic impact of direct electric stimulation of SaOS-2 cells.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eDC stimulation had positive role in bioengineered bone remodelling as the study shows down regulation of OPG protein expression which indirectly indicates enhanced osteoclastic activity which requires further investigation.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate:\u003c/strong\u003e \u003cp\u003eAll procedures performed in studies were in accordance with the ethical standards of the institutional and/or national research committee.Approval was obtained from the Ethics Committee of the Banaras Hindu University.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eA.P. and A.A wrote the main manuscript text.P.D. and R.D. prepared all figures and tables .P.R. did experimentation.S.K.S edited the main manuscript text.All authors reviewed the manuscript\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTseng YC. Department of Orthodontics, Kaohsiung Medical University Hospital. Taiwanese Journal of Orthodontics. 2020;32(2). DOI: 10.38209/2708-2636.1004.\u003c/li\u003e\n\u003cli\u003eEl-Angbawi A, McIntyre GT, Fleming PS, Bearn DR. Non-surgical adjunctive interventions for accelerating tooth movement in patients undergoing fixed orthodontic treatment. Cochrane Database Syst Rev. 2015;11:CD010887. DOI: 10.1002/14651858.CD010887.pub2\u003c/li\u003e\n\u003cli\u003eCarter A, Popowski K, Cheng K, Greenbaum A, et al. Enhancement of Bone regeneration Through the Converse Piezoelectric Effect: A Novel Approach for Applying mechanical Stimulation. Bioelectricity. 2021;3(4):1-9. DOI: 10.1089/bioe.2021.0019.\u003c/li\u003e\n\u003cli\u003eRachmat O, Fiddiyanti I, Sutedja E,Ismone D,Hidajat N. Effect of electric field on osteosarcoma(Mg-63) cells. Int J Sci Res \u0026amp; Edu. 2017 June;vol5(6):6513-6516.\u003c/li\u003e\n\u003cli\u003eFidan M Camsari C, Coban M Cetinkaya A, Kline E. In vitro effects of direct and alternate electric fields on saos2 cell line. World Cancer Research Journal, 2019.\u003c/li\u003e\n\u003cli\u003eSahm F, Ziebert J, Jonitz-Heincke A, Hansmann D, Dauben T, Bader R.Alternating electric fields modify the function of human osteoblasts growing on and in the surroundings of titanium electrodes. International Journal pf Molecular Sciences,2020 Sep22;21(18):6944.\u003c/li\u003e\n\u003cli\u003ePautke C, Schieker M, Tischer T, Kolk A, Neth P, Mutschler W, Milz S. Characterization of osteosarcoma cell lines MG-63, Saos-2 and U-2 OS in comparison to human osteoblasts. Anticancer Res. 2004;24:3743-3748.\u003c/li\u003e\n\u003cli\u003eFogh J, Fogh JM, Orfeo T. One Hundred and Twenty-Seven Cultured Human Tumor Cell Lines Producing Tumors in Nude Mice. J Natl Cancer Inst. 1977;58(3):623-7.\u003c/li\u003e\n\u003cli\u003eRodan GA, Wesolowski G, Thomas KA, et al. Characterization of a human osteosarcoma cell line (Saos-2) with osteoblastic properties. PMID: 3040234. \u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez-Villabrille S, Mart\u0026iacute;n-Carro B, Mart\u0026iacute;n-V\u0026iacute;rgala J, Rodr\u0026iacute;guez-Santamaria MDM, Baena-Huerta F, Mu\u0026ntilde;oz-Casta\u0026ntilde;eda JR, Fern\u0026aacute;ndez-Mart\u0026iacute;n JL, Alonso-Montes C, Naves-D\u0026iacute;az M, Carrillo-L\u0026oacute;pez N, Panizo S. Novel Biomarkers of Bone Metabolism. Nutrients. 2024 Feb 22;16(5):605. doi: 10.3390/nu16050605. PMID: 38474734; PMCID: PMC10935093.\u003c/li\u003e\n\u003cli\u003eBoyce BF, Xing L. Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res Ther. 2007;9(Suppl 1):S1.\u003c/li\u003e\n\u003cli\u003eTakehito T, et al. RANKL biology: bone metabolism, the immune system, and beyond. Inflamm Regen. 2020.\u003c/li\u003e\n\u003cli\u003eLiu J, Xiao Q, Xiao J, Niu C, Li Y, Zhang X, Zhou Z, Shu G, Yin G. Wnt/\u0026beta;-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct Target Ther. 2022;7(1):3. doi:10.1038/s41392-021-00762-6.\u003c/li\u003e\n\u003cli\u003eWard-Kavanagh L, Lin WW, \u0026Scaron;ed\u0026yacute; JS, Ware CF. The TNF Receptor Superfamily in Costimulating and Coinhibitory Responses. Immunity. 2016 May 17;44(5):1005-1019. doi:10.1016/j.immuni.2016.04.019.\u003c/li\u003e\n\u003cli\u003eBodmer JL, Schneider P, Tschopp J. The molecular architecture of the TNF superfamily. Trends Biochem Sci. 2002; 27:19\u0026ndash;26. [PubMed: 11796220]\u003c/li\u003e\n\u003cli\u003eRocha AJ, Miranda RS, Sousa AJ, Silva AL. Guidelines for Successful Quantitative Gene Expression in Real-Time qPCR Assays. IntechOpen. 2016;14(12):65850. DOI: 10.5772/65850\u003c/li\u003e\n\u003cli\u003eAgrawal A, Dwivedi P, Chaturvedi TP, Mittal N. Effect of electrical stimulation on orthodontic tooth movement: A systematic review. Int J Orthod. 2019;30(3):51-56.\u003c/li\u003e\n\u003cli\u003eBravo-Ol\u0026iacute;n J, Mart\u0026iacute;nez-Carre\u0026oacute;n SA, Francisco-Solano E, Lara AR, Beltran-Vargas NE. Analysis of the role of perfusion, mechanical, and electrical stimulation in bioreactors for cardiac tissue engineering. Bioprocess Biosyst Eng. 2024;47:767\u0026ndash;839.\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;n D, Bocio-Nu\u0026ntilde;ez J, Scagliusi SF, P\u0026eacute;rez P, Huertas G, Y\u0026uacute;fera A, Giner M, Daza P. DC electrical stimulation enhances proliferation and differentiation on N2a and MC3T3 cell lines. J Biol Eng. 2022;16:27.\u003c/li\u003e\n\u003cli\u003eAgrawal A, Chou TM. Impact of vibration on the levels of biomarkers: a systematic review. J Indian Orthod Soc. 2021;55(3):230-242.\u003c/li\u003e\n\u003cli\u003eFerrier J, Ross SM, Kanehisa J, Aubin JE. Osteoclast migration and direct current electric fields. J Cell Biol. 1986;102(6):2482-90.\u003c/li\u003e\n\u003cli\u003eZhuang H, Wang W, Seldes R, Tahernia D, Fan H, Brighton CT. Electrical stimulation alters gene expression in bone cells. J Orthop Res. 1997;15(4):573-80.\u003c/li\u003e\n\u003cli\u003eBoyce BF, Xing L. Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res Ther. 2007;9(Suppl 1):S1.\u003c/li\u003e\n\u003cli\u003eRodan GA, Wesolowski G, Thomas KA, et al. Characterization of a human osteosarcoma cell line (Saos-2) with osteoblastic properties. PMID: 3040234. \u003c/li\u003e\n\u003cli\u003eMobini S, Leppik L, Parameswaran VT, Barker JH. In vitro effect of direct current electrical stimulation on rat mesenchymal stem cells. PeerJ. 2017;5:e2821. doi:10.7717/peerj.2821.\u003c/li\u003e\n\u003cli\u003eGenovese, J.A., Spadaccio, C., Langer, J., Habe, J., Jackson, J., Patel, A.N., 2008. Electrostimulation induces cardiomyocyte predifferentiation of fibroblasts. Biochem. Biophys. Res. Commun. 370 (3), 450\u0026ndash;455.\u003c/li\u003e\n\u003cli\u003eCaputo, M., Zirpoli, H., De Rosa, M.C., Rescigno, T., Chiadini, F., Scaglione, A., Stellato, C., Giurato, G., Weisz, A., Tecce, M.F., et al., 2014. Effect of low frequency (lf) electric fields on gene expression of a bone human cell line. Electromagn. Biol. Med. 33 (4), 289\u0026ndash;295.\u003c/li\u003e\n\u003cli\u003eChaudhari SD, Sharma KK, Marchetto JJ, Hydren JR, Burton BM, Moreno AP. Modulating OPG and TGF-\u0026beta;1 mRNA expression via bioelectrical stimulation. Bone Reports. 2021;15:101141. doi:10.1016/j.bonr.2021.101141.\u003c/li\u003e\n\u003cli\u003eVan den Bosch MH, Blom AB, van Lent PL, van der Kraan PM, van den Berg WB. The role of TNFRSF11B in development of osteoarthritic cartilage. Rheumatology (Oxford). 2021 May 14;60(5):2340-2350. doi: 10.1093/rheumatology/keaa809.\u003c/li\u003e\n\u003cli\u003eCancel LM, Tarbell JM. The role of astrocytes in neurovascular coupling: A review. Front Cell Neurosci. 2015;9:310. doi:10.3389/fncel.2015.00310.\u003c/li\u003e\n\u003cli\u003eHirai T, Tanaka K, Togari A. \u0026alpha;1B-Adrenergic receptor signaling controls circadian expression of Tnfrsf11b by regulating clock genes in osteoblasts. Biol Open. 2015;4(11):1400-1409.\u003c/li\u003e\n\u003cli\u003eSmith R, Johnson T, Lee K. Influence of mRNA secondary structures on transcriptional and translational efficiency. J Mol Biol. 2025;12(4):123-130.\u003c/li\u003e\n\u003cli\u003eMauger DM, Cabral BJ, Presnyak V, Su SV, Reid DW, Goodman B, Link K, Khatwani N, Reynders J, Moore MJ, McFadyen IJ. mRNA structure regulates protein expression through changes in functional half-life. Proc Natl Acad Sci U S A. 2019;116(48):24075\u0026ndash;24083. doi:10.1073/pnas.1908057116.\u003c/li\u003e\n\u003cli\u003ePresnyak V, Alhusaini N, Chen YH, Martin S, Morris N, Kline N, et al. Codon optimality is a major determinant of mRNA stability. Cell. 2015;160(6):1111-1124.\u003c/li\u003e\n\u003cli\u003ePrideaux M, Loveridge N, Pitsillides AA, Farquharson C. Extracellular matrix mineralization promotes E11/gp38 glycoprotein expression and drives osteocytic differentiation in Saos-2 cells. Bone. 2012;50(1):78\u0026ndash;86\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6773193/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6773193/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eTo evaluate OPG gene expression in SaOS-2 cells following exposure to pulsed direct current (30 \u0026micro;A/10 sec, square wave) using qRT-PCR at various time points (5,7,12 and 24 hours).\u003c/p\u003e\u003ch2\u003eMaterials and Methods\u003c/h2\u003e \u003cp\u003eThe study investigated the effects of direct current (DC) electrical stimulation on SaOS-2 cells by exposing experimental groups to DC (30 \u0026micro;A, 10 sec pulses) for 5, 7, 12, and 24 hours, while control groups received no stimulation. Stainless steel electrodes were used, and both groups were cultured under identical conditions. Qualitative assessments included cell morphology via phase contrast microscopy, and quantitative evaluations involved MTT assays for viability and Quantitative Reverse Transcription Polymerase Chain Reaction(qRT-PCR) for osteoprotegerin (OPG) gene expression. RNA was isolated post-stimulation, followed by complementary DNA (cDNA ) synthesis for gene analysis. Data were analyzed to assess stimulation-induced cellular and genetic responses.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eDirect current stimulation caused time-dependent cytotoxicity in SaOS-2 cells, with cell death rising from ~\u0026thinsp;10% at 5 hours to ~\u0026thinsp;52% at 24 hours. qRT-PCR showed significant downregulation of OPG expression, nearly suppressed by 12\u0026ndash;24 hours (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), indicating strong inhibitory effects on cell viability and gene expression.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eDirect electrical stimulation downregulated OPG expression in SaOS-2 cells in a time-dependent manner, with a significant drop observed as early as 5 hours.MTT assay revealed time-dependent cytotoxicity from DC stimulation.Reduced OPG expression suggests potential enhancement of osteoclastic activity, indicating a possible role of DC stimulation in bone remodeling, warranting further investigation.\u003c/p\u003e","manuscriptTitle":"Impact of Exogenous Direct Electric Current on the expression of mRNA related to OPG, in SaOS-2 Cells using quantitative reverse transcription polymerase chain reaction: A Qualitative and quantitative analysis.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-26 10:40:26","doi":"10.21203/rs.3.rs-6773193/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6415ecb9-0424-4fb3-9b14-3eb3e92397b4","owner":[],"postedDate":"June 26th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-22T08:38:01+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-26 10:40:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6773193","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6773193","identity":"rs-6773193","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}