1mΨ influences the performance of various positive-stranded RNA virus-based replicons

1mΨ influences the performance of various positive-stranded RNA virus-based replicons | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article 1mΨ influences the performance of various positive-stranded RNA virus-based replicons Paola Miyazato, Takafumi Noguchi, Fumiyo Ogawa, Takeshi Sugimoto, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4429063/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Jul, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Self-amplifying RNAs (saRNAs) are versatile vaccine platforms that take advantage of a viral RNA-dependent RNA polymerase (RdRp) to amplify the mRNA of an antigen of interest encoded within the backbone of the viral genome once inside the target cell. In recent years, more saRNA vaccines have been clinically tested with the hope of reducing the vaccination dose compared to the conventional mRNA approach. The use of N1-methyl-pseudouridine (1mY), which enhances RNA stability and reduces the innate immune response triggered by RNAs, is among the improvements included in the current mRNA vaccines. In the present study, we evaluated the effects of this modified nucleoside on various saRNA platforms based on different viruses. The results showed that different stages of the replication process were affected depending on the backbone virus. For TNCL, an insect virus of the Alphanodavirus genus, replication was impaired by poor recognition of viral RNA by RdRp. In contrast, the translation step was severely abrogated in coxsackievirus B3 (CVB3), a member of the Picornaviridae family. Finally, the effects of 1mΨ on Semliki forest virus (SFV), were not detrimental in in vitro studies, but no advantages were observed when immunogenicity was tested in vivo . Biological sciences/Microbiology/Vaccines Biological sciences/Microbiology/Virology Modified nucleosides viral replication Nodavirus N1-methyl-pseudouridine replicons Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction With the implementation of global immunization protocols against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), including mRNA vaccines, during the COVID-19 pandemic, renewed attention has been focused on RNA-based vaccine modalities. Self-amplifying RNAs (saRNAs) are the next generation of RNA vaccines 1 that are usually constructed based on replicons of positive-sense ((+)-RNA) viruses, where the coding sequence of the viral structural proteins (SP) is replaced with that of a gene of interest (GOI), while retaining the coding sequences of non-structural proteins (NsPs), including the viral RNA-dependent RNA polymerase (RdRp) 2–4 . Thus, their advantage over conventional mRNA vaccine platforms relies on the viral replication machinery, which amplifies the mRNA of the encoded GOI within target cells 5 . Several positive-sense and negative-sense RNA viruses have been used as backbone for the development of replicons, including those of the Togaviridae , Flaviviridae , Paramixoviridae , and Rabdoviridae families, among others 6,7 . Alphaviruses such as Venezuelan equine encephalitis virus (VEEV) and Semliki forest virus (SFV) are among the (+)-RNA viruses most commonly used to develop saRNAs that have been tested in clinical settings 8–10 . However, it is unlikely that a single viral backbone is sufficiently versatile to allow the insertion of a wide range of GOIs. Therefore, it is crucial to further understand the practical uses of this innovative and promising vaccine modality by considering other viruses 11 . The Nodaviridae family comprises a group of small non-enveloped bipartite (+)-RNA viruses classified into two genera, Alphanodavirus and Betanodavirus , which infect insects and fish, respectively 12 . The Nodamura virus (NoV), the first nodavirus to be discovered, is known to be pathogenic to its natural insect hosts and is lethal when infecting suckling mice 13 , although not adults. Another member of the Alphanodavirus genus within this family is Flock House virus (FHV). This virus has served as a model to study the replication process of (+)-RNA viruses owing to its simplicity, and is thus the most extensively studied species of the family. FHV RNA has been reported to replicate in insect, yeast, plant, and mammalian cell lines 14–16 . Empty capsid particles have been considered for carrying or displaying heterologous peptides and proteins 17 . These attributes make the members of this family attractive candidates for biomedical applications. Knowledge pertaining to the structural or chemical modifications that play important roles in RNA stability and antigen expression, in addition to formulation compositions for successful delivery in vivo , has been gained as a consequence of COVID-19. The inclusion of a modified nucleoside, namely N1-methyl-pseudouridine (1mΨ), was significantly pivotal 18,19 . Pseudouridine (Ψ), an isomer of uridine (U), is ubiquitously present in several types of RNAs, including transfer, ribosomal, small nuclear, and small nucleolar RNAs 20 . Advances in next-generation sequencing technology have enabled the detection of Ψ mRNAs as well 21 . This modified nucleoside, when present in in vitro -transcribed mRNAs, has been shown to increase the expression of the encoded protein and prevent the activation of the innate immune response 22,23 that would otherwise lead to the degradation of the mRNA. Viruses have been reported to contain RNA modifications that affect various steps of their life cycle in different ways, thus shaping their interactions with their host 24,25 . For example, N( 6 )-methyladenosine (m 6 A), the most abundant modified nucleoside, has been reported to regulate gene expression and reverse transcription of the pre-genomic RNA of the hepatitis B virus 26 . It has also been shown to increase HIV-1 gene expression 27,28 , while 5-methyl cytosine (m 5 C), another epitranscriptomic modification, regulates splicing and decreased protein expression 29 . For viruses with potential utility as saRNA vaccines, the effects of modified nucleosides on replication have not been extensively explored, particularly those with reported effects on reducing innate immune activation. In the current study, we evaluated the effect of 1mΨ on viral replication, using a nodavirus as a model. We found that it interfered more with viral replication than with the translation of viral RNAs. We also found that the effects varied in degree when testing for other RNA viruses such as SFV or coxsackievirus B3 (CVB3). Results 1mΨ negatively affects TNCL RNA1-based replicons Since 1mΨ has been shown to improve the performance of mRNA vaccines, we sought to evaluate the effect of this modified nucleoside on replicons and assess whether similar benefits can be expected for saRNAs constructed using various viral RNAs. In the current study, we used replicons based on the TNCL nodavirus, which is closely related to FHV 30 . We first confirmed the expression of the GPF-HiBiT reporter in BHK-21 cells transfected with conventional mRNAs containing U or 1mΨ, incorporated during in vitro transcription (IVT) (Fig. 1 a). Next, we tested a TNCL RNA1-based reporter replicon, which produced a luminescent signal when synthesized with U alone at one day post-transfection (dpt) (Fig. 1 b). This signal increased significantly one day later, suggesting proper translation and accumulation of the reporter protein. However, when the replicon contained 1mΨ, the expression was significantly reduced, particularly when U was completely substituted with 1mΨ. These results correlated with the levels of GFP mRNA, which increased for the replicon containing U, but not 1mΨ (Fig. 1 c). The expression of the reporter from this replicon results from the translation of RNA3, which is separately transcribed from a subgenomic promoter present in RNA1 31 . The GFP sequence is present not only in RNA3 but also in genomic RNA1, which is amplified in transfected cells. When we amplified a region of viral RdRp ORF present only in RNA1 (Fig. 1 d), the results correlated, as did those for the detection of the intermediate (-)-strand RNA by qPCR (Fig. 1 e): there was a significant increase of RNA measured for the replicon prepared with U, while no increase was observed for that prepared with 1mΨ. Furthermore, we assessed the presence of double-stranded RNA (dsRNA) by immunofluorescence and detected positive staining only in cells transfected with U-containing replicons (Fig. 1 f). For replicons synthesized with a mixture of U and 1mΨ, a significant increase in protein and RNA levels was observed, albeit smaller than for replicons prepared exclusively with U (Fig. 1 b-e). Translation of TNCL RNA1 or RNA2 is not severely affected by 1mΨ TNCL gRNA1 serves as the mRNA for the viral RdRp protein A (PA) 32 . Thus, upon transfection with TNCL RNA1-based replicons, translation of PA is a critical initial step that drives downstream events in the nodavirus replication process. The results shown in Fig. 1 suggest that replication is the step affected most, but the translation of PA may also be affected by 1mΨ. To evaluate the effect of 1mΨ on the translation of TNCL RNAs, we constructed another replicon with a reporter gene cloned in-frame with the PA ORF, where the expression of the reporter reflected that of PA itself. The expression of the reporter from the replicon containing 1mΨ was not completely abrogated, since an increase in the signal was detected between 3 and 24 hours post-transfection (hpt), indicating cumulative translation of the encoded protein (Fig. 2 a). Furthermore, we speculated whether the effect of 1mΨ on RNA2, that encodes the viral capsid protein precursor, is similar to that observed on RNA1. To verify, we constructed a reporter RNA2 containing the GFP-HiBiT-coding sequence between the TNCL RNA2 UTRs, replacing the coding sequence of the capsid. We observed that the luminescent signal from the RNA2 reporter prepared with 1mΨ was significantly lower than that prepared with U, but was still detectable (Fig. 2 b). These results suggest that the presence of 1mΨ within both TNCL RNA molecules might interfere with the translation step, but is not as drastically detrimental as for the replication step. 1mΨ impairs the binding of the RdRp to TNCL RNA1 replicon To provide more evidence on the replication impairment exerted by 1mΨ on TCNL RNA1-based replicons, we analyzed the expression of a reporter gene ( GFP-HiBiT ) using a trans-replication system (Fig. 2 c). A defective template replicon containing a premature stop codon within the PA coding sequence was constructed and mRNA was synthesized by IVT using either U or 1mΨ. An additional source of functional viral RdRp was provided by co-transfecting the mRNA of PA, containing the encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES) sequence to facilitate its translation. The lack of reporter expression from the replicon prepared with U in the absence of PA (Fig. 2 c and d) confirmed that the addition of a separate source of RdRp was required. When viral PA was provided by co-transfecting IVT PA mRNA, reporter expression was only detected from the template replicon containing U. The levels of GFP RNA (Fig. 2 e) were consistent with these results, as an increase of RNA was only detected when the template replicon was synthesized with U in the presence of PA, suggesting that replication, and thus amplification of the replicon and GOI mRNA, were negatively affected by the presence of 1mΨ. This modified nucleoside has been reported to provide increased stability and/or rigidity to RNA molecules 33,34 which might affect the function of regulatory sequences such as viral UTRs. We performed structure prediction analyses of the TNCL RNA1 3’end, comprising part of the PA and B2 coding sequences and the 3’UTR (Supplementary Fig. S1 ). We hypothesized that the bond between G at position 7 and C at position 31 of the analyzed sequences played an important role in establishing the predicted structure (Supplementary Fig. S1 a). Indeed, point mutations aimed at disrupting this bond led to changes in the predicted secondary structures (M1 and M2, Supplementary Fig. S1 b) that were rescued by swapping the positions of the interacting G and C nucleotides (M3, Supplementary Fig. S1 c). Experimentally, we observed that clones with the disrupted 3’end (M1 and M2) showed a decreased level of reporter expression and RNA replication (Supplementary Fig. S1 d), suggesting that the conformation and/or stability of the TNCL RNA1 3’end is important for these processes. Thus, we hypothesized that the presence of 1mΨ in regions of the 3’ end, by affecting the stability of the 3’UTR, might lead to a disrupted binding or recognition of the viral RNA by the RdRp. We performed an RNA-immunoprecipitation assay (RIP), using the trans-replication system described in Fig. 2 c. As shown in Fig. 2 f, TNCL RNA1 containing U was more significantly enriched in the precipitate than in the control IgG, suggesting that the interaction of viral RdRp might be hindered by the presence of 1mΨ in the target RNA. Nevertheless, we observed that the pull-down of 1mΨ-containing RNA was still significantly enriched compared to its control IgG. 1mΨ abrogates the translation of CVB3-based replicons To determine whether our findings on the effect of 1mΨ on TNCL nodavirus can be reproduced in other RNA viruses, we also tested CVB3-based replicons (Fig. 3 a). When the replicon was synthesized to contain U, the expression of the reporter was detected as luminescence as early as 3 hpt. The signal increased significantly after 6 h. However, when the replicon containing 1mΨ was transfected, no expression was detected, suggesting that either translation or replication was impaired (Fig. 3 a). To determine which step was mainly affected, we examined dsRNA in replicon-transfected cells (Fig. 3 b) and found that only replicons containing U showed positive staining, suggesting the abrogation of the replication step. CVB3 RNA is translated immediately after entering the target cell to produce a polyprotein, which is cleaved by viral proteases into various functional proteins 35 . The translation is dependent on the viral IRES sequence located at the 5’ end of the viral genome 36 . Ψ has been reported to exert deleterious effects on EMCV IRES sequences 37 and 1mΨ prevented translation driven by CVB3 IRES in circular RNAs 38 . To confirm the effects of 1mΨ on replication in the context of linear CVB3-based replicons, we constructed a reporter RNA, containing the CVB3 IRES sequence that includes a part of the viral 5’UTR, upstream of the GFP-HiBiT reporter, followed by the polyA tail, also present in the original replicon (Fig. 3 c) 39 . The results for this reporter were concordant with those obtained for the full replicon (Fig. 3 a), indicating that translation was severely crippled by 1mΨ. Overall, our findings support the hypothesis that 1mΨ interferes with the normal IRES-mediated translation of CVB3 RNA, and hence, the downstream replication process of CVB3-based replicons. The effect of 1mΨ on Semliki forest virus (SFV) replicons varies in vitro and in vivo Alphaviruses are among the most commonly used viruses for developing saRNA vaccines. We tested the use of 1mΨ on a SFV replicon containing the coding sequence for GFP-HiBiT (Fig. 4 a), driven by the sub-genomic promoter 40 . Cells transfected with in vitro -transcribed replicons containing either U or 1mΨ, were evaluated for expression of the encoded reporter and amplification of RNA. As shown in Fig. 4 b, expression of GFP was confirmed at 1 dpt. HiBiT quantitative analysis showed an increase in the luminescent signal at 2 dpt originating from replicons containing either U or 1mΨ (Fig. 4 c), demonstrating continuous translation and accumulation of the protein. Although there was a significant difference in the levels of luminescence between the replicons synthesized with different nucleotides, these results suggest that 1mΨ did not inhibit the performance of SFV-based replicon, as was previously observed for TNCL or CVB3. Consistent with these protein expression results, increasing levels of SFV RNA were detected in both types of replicons (Fig. 4 d), indicating that replication was not severely impaired. There was, however, a delay in the increase of RNA when the replicon was synthesized with 1mΨ, indicating that it might generate a barrier during the replication process. These results were in line with the dsRNA staining of transfected cells, that showed lower levels for 1mY-containing replicons (Fig. 4 e). Nevertheless, we evaluated the efficacy of the modified SFV replicon to induce an immune response against an antigen of interest in vivo . For this purpose, we used the SARS-CoV-2 receptor-binding and transmembrane domains (RBD-TM) of the spike protein as a model antigen and cloned it into the SFV replicon, replacing the GFP-HiBiT sequence of the previous reporter (Fig. 4 f). In vitro , this replicon led to the expression of the antigen (Supplementary Fig. 2) and replication of the RNA (Fig. 4 g). However, compared to the previous replicon containing GFP-HiBiT (Fig. 4 a-d), more pronounced differences were observed when they were synthesized with U or 1mΨ, not favoring 1mΨ. For the in vivo experiments, lipid nanoparticles encapsulating the in vitro -transcribed replicons were injected intramuscularly into BALB/c mice following the schedule detailed in Fig. 4 h. Mice immunized with the U-containing replicon showed a clear increase in antibodies targeting the RBD antigen as determined by enzyme-linked immune-sorbent assay ELISA (Fig. 4 i). In contrast, mice injected with the modified replicon showed very low and variable levels of antibodies, with titers that differed by approximately seven orders of magnitude. These results suggest that, at least at the dose tested, 1mΨ did not show beneficial effects on the performance of SFV replicons in vivo . Discussion During the COVID-19 pandemic, mRNA vaccines marked a pivotal milestone in the therapeutic usage of RNA molecules and opened doors to related next-generation vaccine platforms, including saRNAs, which are constructed based on viral RNAs. The incorporation of modified nucleosides such as 1mΨ was among the strategic modifications included in the current mRNA vaccines that was demonstrated to reduce the innate immune response triggered by foreign RNAs. However, the effects of modified nucleosides on saRNA vaccines have not yet been investigated in detail. In the current study, we found that the translation of nodavirus TNCL RNA-based replicons was not severely impaired when they contained 1mΨ (Fig. 2 a). However, the replication was significantly hindered (Figs. 1 and 2 ). RNA viruses rely on regulatory sequences within their genomes for replication in infected cells. The translation of uncapped viral mRNAs is sometimes facilitated by the presence of an IRES. These regulatory sequences, which were first discovered in picornaviruses, usually adopt structural conformations that vary in complexity and convey different degrees of reliance on endogenous factors for translation. In addition to increasing ribosome recruitment, Ψ and 1mΨ increase the stability of RNA molecules by improving base-pair interactions and base stacking 34,41,42 , which may affect the ability of the IRES to recruit the host translation machinery to the viral RNA 37 . The results of the CVB3 replicons analyzed in the current study (Fig. 3 ) are in line with previous reports, where CVB3 IRES was abrogated by 1mΨ 38 . The same mechanism may underlie the interference exerted by 1mΨ on the replication of TNCL nodavirus. In the in vitro characterization of the constructed replicons, we observed that single point mutations in the 3’ end of RNA1 led to a decreased or delayed expression of the encoded GOI. Changes in the predicted secondary structure were observed in the fragments containing these point-mutations suggesting that, the structural conformation of the 3’ end is important for viral replication. Considering the characteristics attributed to Ψ and 1mΨ on RNA molecules, it can be inferred that U-A interactions in regions of the 3’end that are normally flexible (with high entropy nucleotides highlighted in blue in Supplementary Fig. S1 a) might become more rigid when 1mΨ is used instead (△, Supplementary Fig. S1 a). RIP results support this possibility, which was observed as a hindrance to the recognition or proper functioning of viral RdRp (Fig. 2 f). Therefore, although 1mΨ provides advantageous effects on mRNAs, those on replicons may vary depending on the viral RNA backbone used, as observed in our study. Our findings using SFV-based replicons synthesized with 1mΨ led to the expression of GOI without vital differences in vitro (Fig. 4 a-d). Nevertheless, when tested in vivo as an saRNA vaccine, the modified version did not perform as well as the unmodified version (Fig. 4 i). These results suggest that replication inefficiencies and SFV replicon degradation occur in vivo . Another possibility could be the generation of proteins different from the GOI, as suggested in a recent report, where the presence of 1mΨ in COVID-19 mRNA vaccines was shown to induce frame shifts, resulting in the expression of aberrant proteins 43 . To improve this outcome, it could be more beneficial to use a mixture of saRNAs, some containing U and some containing 1mΨ; or containing both U and 1mΨ (as shown in Fig. 1 ) may provide a balance between RNA stability, RdRp and GOI expression and, saRNA replication. In this case, we could not ascertain where each nucleotide was incorporated within the replicon. However, based on our results, we can infer that once the barrier of the first round of replication is overcome, 1mΨ no longer constitutes a hindrance, and the expression of the GOI may increase (Fig. 1 b-e). Novel approaches to the synthesis of therapeutic RNAs might enable the use of specific modified nucleosides for specific regions of RNAs which, in the case of replicons, might help avoid the crippling of important regulatory sequences. Furthermore, other studies have provided alternative strategies to optimize the performance of saRNA vaccines, such as the inclusion of coding sequences for modulators of innate immunity 44 or the use of trans-amplifying systmes 45 overall increasing the success of this vaccine modality. Modern technologies, such as reverse genetics, have enabled the construction of more customizable designs for recombinant viruses, widening the possibilities for their medical applications 46,47 . The number of RNA-based vaccines is rapidly increasing, reflecting the expectations placed on this vaccine platform, which includes a broad range of RNA molecules, in addition to the conventional mRNAs currently in use or the saRNAs analyzed here. Our study demonstrated that the inclusion of 1mΨ, although expected to improve the performance of saRNAs, resulted in different outcomes based on the backbone virus used, acting on different stages of the replication cycle. Other modified nucleosides such as m5C, with similar immunological benefits as 1mΨ, have shown better results in platforms based on other viruses 48,49 . Thus, increased knowledge on basic virology and the strategies used to optimize RNA-based vaccine development will pave the way for the application of this versatile vaccine modality, using a variety of viruses, in the near future. Methods Cell lines Baby hamster kidney (BHK-21) cells were purchased from the Japanese collection of research bioresources (JCRB) cell bank. They were maintained in Minimum Essential Medium (MEM) (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich), penicillin (100 units/mL) (Nacalai Tesque, Kyoto, Japan), and streptomycin (100 µg/mL) (Nacalai Tesque), at 37°C with 5% CO 2 . When transfected with TNCL replicons, cells were incubated at 30°C. Human embryonic kidney (HEK 293T) cells were purchased from ATCC (Manassas, VA, USA) and were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma-Aldrich) supplemented with 10% FBS, penicillin, and streptomycin. High Five insect cells were purchased from Thermo Fisher Scientific (Waltham, MA, USA), and cultured in SF-900 II SFM medium (Gibco-Thermo Fisher Scientific) in the absence of FBS or additional antibiotics, at 27°C. Vero cells were purchased from ATCC and maintained in DMEM, supplemented with 10% FBS, penicillin, and streptomycin. Mice All experiments and protocols were approved by the Animal Care and Use Committee of Osaka University and BIKEN. Seven-week-old BALB/c female mice were used to test the immunogenicity of SFV replicons in vivo . Mice were immunized with two doses of SFV replicon prepared with either U or 1mY (1 µg of RNA/30 µL/dose) administered intra-muscularly, three weeks apart, and sera was analyzed by ELISA three weeks after the second dose. Two independent experiments using 3 or 5 mice per group were performed. The mice were kept in a temperature- and light-controlled room at the animal facility of Osaka University with free access to food and water. Methods are reported in accordance with the ARRIVE guidelines. Cloning of TNCL and CVB3 genomes High Five cells (Thermo Fisher Scientific) were infected with a baculovirus to induce the reactivation of the TNCL nodavirus that is latently present in this cell line 30 . Four days later, the supernatant was collected and subjected to ultra-centrifugation (100,000 × g, 4 h) over a 10% sucrose cushion at 4°C. The pellet containing the virus was resuspended in PBS and stored at -80°C until use. Viral RNA was extracted from an aliquot of the stored virus using TriReagent (Molecular Research Center, Cincinnati, OH, USA) following the manufacturer’s protocol. The cDNA of TNCL genomic RNA1 and RNA2 were synthesized using SuperScript III reverse transcriptase (Thermo Fisher Scientific) according to the procedure described by Li et al 30 , and cloned into Invitrogen’s pCR4 Blunt TOPO plasmid (Thermo Fisher Scientific). To clone the CVB3 genome, Vero cells were infected with the Nancy strain of CVB3 (ATCC VR-30). Three days later, the supernatant was collected and viral RNA was extracted using TriReagent (Molecular Research Center), as described above for TNCL. The cDNA of CVB3 was synthesized with SuperScriptIII, and used as a template to amplify two viral fragments containing the required additional flanking sequences: the hammerhead ribozyme 50 was inserted upstream of the 5’UTR, and a poly(A) 25 tail was added downstream of the region encompassing P2 to the 3’UTR, in addition to a Mlu I site, used to linearize the plasmid for IVT 51,52 . These sequences were then added to the primers used for PCR. The EMCV IRES sequence was separately amplified from the pAAV-IRES-Puro expression vector (Cell Biolabs, San Diego, CA, USA) with an inserted Hpa I restriction site in the 5’end. These three fragments were assembled into pcDNA3.1 plasmid (Invitrogen) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Generation of various viral replicons TNCL RNA1-based replicons. We used the WT TNCL RNA1-containing TOPO vector as the backbone to be modified for different purposes. We constructed template plasmids for IVT by adding the T7 promoter and terminator sequences, and other regulatory sequences such as the hepatitis virus D ribozyme, based on a previous report 53 . SFV-based replicons. A LacZ SFV-based replicon (pSFV3-LacZ) was purchased from Addgene (Watertown, MA, USA) (plasmid #92074) 54 and used as the backbone for the SFV replicons tested in the current study, replacing the LacZ sequence with that of GFP-HiBiT (Fig. 4 a) or the SARS-CoV-2 spike protein RBD-TM (Fig. 4 e). For the CVB3-based reporter experiments, the sequence encoding GFP-HiBiT was inserted into the Hpa I site using the wild-type replicon described above. In vitro transcription (IVT) TNCL template plasmids were linearized with Not I restriction enzyme (New England BioLabs, Ipswich, MA, USA) and purified using a Qiagen gel extraction kit (Qiagen, Hilden, Germany). One microgram of the digested plasmid was used for each reaction using the MEGAscript T7 transcription kit (Invitrogen), where 1mΨ triphosphate (TriLink, San Diego, CA, USA) was used instead of the U triphosphate contained in the kit (or a mixture), where necessary. Capping was performed using 50 µg of RNA with ScriptCap Cap1 system reagent (CellScript, Madison, WI, USA). This procedure was the same for mRNAs but required polyA tailing, which was performed using a poly(A) tailing kit (Invitrogen). In vitro transcription of CVB3 replicons was performed following the same protocol, but omitting the capping reaction. CVB3 replicons were constructed on a pcDNA3.1 vector background, and linearized with Xha I (New England BioLabs) restriction enzyme prior to IVT. Plasmids encoding SFV replicons were linearized with Spe I (New England BioLabs) restriction enzyme for IVT using the MEGAscript SP6 transcription kit (Invitrogen), following the procedure described above, as well as the capping step. The polyA tailing reaction was not necessary in this case because the polyA tail was encoded within the template plasmid and was thus generated during the IVT reaction. Transfection of cells was performed with Lipofectamine2000 reagent (Invitrogen) at a ratio of 150 ng of RNA/µL of reagent. Assessment of GOI expression from the replicons The expression of the GFP-HiBiT reporter at the protein level was confirmed by fluorescence microscopy (Keyence BZ-X710, Osaka, Japan) and luminescence measurements (HiBiT, Promega, Madison, WI, USA) of lysates with the same total protein content. To confirm replication, quantitative real-time PCR was performed to detect viral and GOI RNAs. The primer sequences are listed in Table 1 . Total RNA was extracted from the transfected cells using the RNeasy Plus kit (Qiagen) following the manufacturer’s instructions. Five hundred to 1000 ng of RNA was used for reverse transcription using random oligomers and the PrimeStar RT kit (Takara, Shiga, Japan). Where indicated, cDNA was prepared using virus-specific primers and SuperScript III first-strand synthesis system for RT-PCR (Invitrogen). Real-time PCR was performed using Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) in a QuantStudio1 thermal cycler (Applied Biosystems). Relative expression to the initial analyzed time point was calculated following the 2 ΔΔCt method, using hamster gapdh or human GAPDH genes as internal controls for normalization. The details of the primers used are listed in Table 1 . For Western blot analysis of the RBD-TM-encoding SFV replicon, an anti-RBD Ab (40592-T62 SinoBiological, Wayne, PA, USA) was used and was detected with HRP-labeled anti-rabbit IgG Ab (Sigma-Aldrich AP307P). Human GAPDH was used as a protein-loading control and was detected using mouse anti-human GAPDH (Abcam ab8245, Cambridge, England) and anti-mouse IgG-HRP (Sigma-Aldrich). Table 1 Primers used in the current study Primer name Sequence Target Assay RNA1_F AAAGTGAGCGGCTTTGATGC TNCL gRNA1 qPCR* RNA1_R TTGTAAAAACCATTCCTTCC hGapdh_F TCTTCCAGGAGCGAGATCCC Hamster gapdh hGapdh_R ACTTGTCATGGTTCACACCC GAPDH_F CACATCGCTCAGACACCATG Human GAPDH GAPDH_R TGACGGTGCCATGGAATTTG GFP_F AAGTTCATCTGCACCACCGG GFP GFP_R AGAAGATGGTGCGCTCCTGG SFV_F GAGCTGAAAGAACTGACGCCG Semliki forest virus gRNA SFV_R CGGCCTGATCTTCAGCCC RBD_F CGCCGACTACAATACAAGC SARS-CoV-2 spike mRNA RBD_R GCTCGAAGGGCTTCAGATTG RT_RNA1 CGGTCATGGTGGCGAATAA AACCAACAATCGAAGAACGC TNCL (-) RNA1 RT** Tag CGGTCATGGTGGCGAATAA qPCR GFP_R2 AACTTCAGGGTCAGCTTGCCGTAGGTGGC Sequence of the primers used for detection of the indicated target mRNAs or viral RNAs (gRNA) by real-time PCR * qPCR: quantitative real-time PCR ** RT: reverse transcription Immuno-fluorescent staining TNCL or SFV replicons were transfected into BHK-21 cells, which had been pre-seeded onto glass slides and placed inside the wells of a 12-well plate. At 24 hpt, the glass slides were removed, washed with PBS, and fixed with a 4% paraformaldehyde solution for 15 min at room temperature. After washing again with PBS, the cells were permeabilized with 0.5% solution of Triton X-100 in PBS. Blocking with 0.5% BSA in PBS (for 30 min at room temperature) was performed before staining with anti-dsRNA antibody (Ab) (Millipore, Burlington, MA, USA). Detection was performed using an Alexa568-labeled anti-mouse IgM Ab (Abcam) and observed under a Keyence BZ-X710 fluorescence microscope. The same procedure was performed on HeLa cells transfected with CVB3 replicons. RNA immunoprecipitation (RIP) BHK-21 cells were transfected with HA-tagged IRES-PA mRNA and defective TNCL replicons in vitro -transcribed with either U or 1mΨ. Lysates were collected at 48 hpt and RIP was performed using the Magna RIP RNA-binding protein immunoprecipitation kit (Millipore) with an anti-HA tag Ab (Thermo Fisher Scientific, cat# 26183) or mouse isotype control IgG (Invitrogen cat# 02-6100), following the manufacturer’s instructions. Ten percent of the raw lysate was processed in parallel with the precipitated samples for RNA extraction using TriReagent (Molecular Research Center), and the RNA pellet was dissolved in 20 µL of water. The precipitated RNA (2 µL) was used for cDNA synthesis using a SuperScript III reverse transcription kit (Invitrogen) with random hexamers. A standard curve was constructed using the RNA of the raw lysates (input), and the amount of precipitated RNA was expressed as “percentage of input.” TNCL viral RNA1 in the precipitated RNA was detected by RT-qPCR using the primers listed in Table 1 . Formulation of SFV replicons for in vivo experiments In vitro -transcribed SFV replicons containing the SARS-CoV-2 spike RBD-TM coding sequence were encapsulated in lipid nanoparticles, prepared with: ssPalmE-P4C2 (NOF Co, Tokyo, Japan), 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylen glycol 2000 (NOF Co.), 1,2-dioleolyl-sn-glycero-3-phosphoetyanoamine (DOPE) (Avanti Polar lipids Inc., Alabama, USA), and cholesterol (Sigma-Aldrich), as previously described 55 and using a microfluidics device, kindly provided by Manabu Tokeshi and Masatoshi Maeki of Hokkaido University. Enzyme-linked immune-sorbent assay (ELISA) Plates were coated with recombinant RBD peptide dissolved in PBS (1 µug/mL, 100 µL/well, 96-well plates), and were incubated at 4 ˚C overnight. Wells were washed three times using 0.05% Tween20 in PBS, and blocking was performed with a solution of 1% BSA (Sigma-Aldrich) in PBS at room temperature for 2 h. After another washing step, aliquots of serially diluted serum from immunized mice were added to the coated plates and incubated at room temperature for 2 h. The dilution buffer consisted of PBS with 1% BSA and 0.05% Tween20. Goat horseradish peroxidase-labeled anti-mouse Ab (Sigma-Aldrich) was used to detect RBD-specific antibodies together with the BioFix TMB One component HRP microwell substrate (Surmodics, MN, USA). A solution of 0.5 N HCl was used to stop the reaction, and the optical density was measured at 450 nm using an SH-9000 microplate reader (Corona Electric, Ibaraki, Japan). Statistical analysis Statistical analysis was performed using GraphPad Prism version 9.4.1 (Graphpad Software LLC). Figures were generated using the same software. The details of each analysis are provided in the corresponding figure legends. Declarations Ethics statement All methods were carried out in accordance of relevant guidelines or regulations. Competing Interests P.M., T.N., F.O., T.S., Y.F., R.S., and H.E. are employed by BIKEN. H.E. holds a managerial position at BIKEN. Author Contribution P.M. designed and performed the experiments, analyzed the data, and wrote the manuscript. T.N., F.O., T.S., Y.F., and R.S. performed the experiments and analyzed the data. H.E. conceived and designed the study, supervised the project and reviewed the manuscript. Acknowledgement The authors thank Hidetaka Akita, Hiroki Tanaka, and Ryotaro Oyama of Tohoku University (Japan) for their advice and helpful feedback on the generation of RNA/LNP complexes for in vivo delivery; Manabu Tokeshi and Masatoshi Maeki of Hokkaido University (Japan) for kindly providing the microfluidic device used in the generation of the nanoparticles; Sayuri Komatsu (BIKEN) for technical assistance with plasmid construction; and Mitsuyo Kosaka (BIKEN) and Masako Inanaka (Osaka University) for administrative support.This work was conducted as part of “The Research Foundation for Microbial Diseases of Osaka University Project for Infectious Disease Prevention”. Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. References Comes, J. D. G., Pijlman, G. P. & Hick, T. A. H. Rise of the RNA machines - self-amplification in mRNA vaccine design. Trends Biotechnol 41, 1417–1429, doi: 10.1016/j.tibtech.2023.05.007 (2023). Xiong, C. et al. Sindbis virus: an efficient, broad host range vector for gene expression in animal cells. Science 243, 1188–1191, doi: 10.1126/science.2922607 (1989). Zhou, X. et al. Self-replicating Semliki Forest virus RNA as recombinant vaccine. Vaccine 12, 1510–1514, doi: 10.1016/0264-410x(94)90074-4 (1994). Pushko, P. et al. Replicon-helper systems from attenuated Venezuelan equine encephalitis virus: expression of heterologous genes in vitro and immunization against heterologous pathogens in vivo. Virology 239, 389–401, doi: 10.1006/viro.1997.8878 (1997). Vogel, A. B. et al. Self-Amplifying RNA Vaccines Give Equivalent Protection against Influenza to mRNA Vaccines but at Much Lower Doses. Mol Ther 26, 446–455, doi: 10.1016/j.ymthe.2017.11.017 (2018). Lundstrom, K. Self-Replicating RNA Viruses for Vaccine Development against Infectious Diseases and Cancer. Vaccines (Basel) 9, doi: 10.3390/vaccines9101187 (2021). Lundstrom, K. Self-replicating vehicles based on negative strand RNA viruses. Cancer Gene Ther 30, 771–784, doi: 10.1038/s41417-022-00436-7 (2023). Lundstrom, K. Self-Amplifying RNA Viruses as RNA Vaccines. Int J Mol Sci 21, doi: 10.3390/ijms21145130 (2020). Blakney, A. K., Ip, S. & Geall, A. J. An Update on Self-Amplifying mRNA Vaccine Development. Vaccines (Basel) 9, doi: 10.3390/vaccines9020097 (2021). Akahata, W. et al. Safety and immunogenicity of SARS-CoV-2 self-amplifying RNA vaccine expressing an anchored RBD: A randomized, observer-blind phase 1 study. Cell Rep Med 4, 101134, doi: 10.1016/j.xcrm.2023.101134 (2023). Aliahmad, P., Miyake-Stoner, S. J., Geall, A. J. & Wang, N. S. Next generation self-replicating RNA vectors for vaccines and immunotherapies. Cancer Gene Ther 30, 785–793, doi: 10.1038/s41417-022-00435-8 (2023). Sahul Hameed, A. S. et al. ICTV Virus Taxonomy Profile: Nodaviridae. J Gen Virol 100, 3–4, doi: 10.1099/jgv.0.001170 (2019). Murphy, F. A., Scherer, W. F., Harrison, A. K., Dunne, H. W. & Gary, G. W., Jr. Characterization of Nodamura virus, an arthropod transmissible picornavirus. Virology 40, 1008–1021, doi: 10.1016/0042-6822(70)90147-9 (1970). Ball, L. A., Amann, J. M. & Garrett, B. K. Replication of nodamura virus after transfection of viral RNA into mammalian cells in culture. J Virol 66, 2326–2334, doi: 10.1128/JVI.66.4.2326-2334.1992 (1992). Selling, B. H., Allison, R. F. & Kaesberg, P. Genomic RNA of an insect virus directs synthesis of infectious virions in plants. Proc Natl Acad Sci U S A 87, 434–438, doi: 10.1073/pnas.87.1.434 (1990). Price, B. D., Rueckert, R. R. & Ahlquist, P. Complete replication of an animal virus and maintenance of expression vectors derived from it in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 93, 9465–9470, doi: 10.1073/pnas.93.18.9465 (1996). Venter, P. A. & Schneemann, A. Recent insights into the biology and biomedical applications of Flock House virus. Cell Mol Life Sci 65, 2675–2687, doi: 10.1007/s00018-008-8037-y (2008). Morais, P., Adachi, H. & Yu, Y. T. The Critical Contribution of Pseudouridine to mRNA COVID-19 Vaccines. Front Cell Dev Biol 9, 789427, doi: 10.3389/fcell.2021.789427 (2021). Nance, K. D. & Meier, J. L. Modifications in an Emergency: The Role of N1-Methylpseudouridine in COVID-19 Vaccines. ACS Cent Sci 7, 748–756, doi: 10.1021/acscentsci.1c00197 (2021). Charette, M. & Gray, M. W. Pseudouridine in RNA: what, where, how, and why. IUBMB Life 49, 341–351, doi: 10.1080/152165400410182 (2000). Rodell, R., Robalin, N. & Martinez, N. M. Why U matters: detection and functions of pseudouridine modifications in mRNAs. Trends Biochem Sci 49, 12–27, doi: 10.1016/j.tibs.2023.10.008 (2024). Kariko, K., Buckstein, M., Ni, H. & Weissman, D. Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA. Immunity 23, 165–175, doi: 10.1016/j.immuni.2005.06.008 (2005). Kariko, K. et al. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol Ther 16, 1833–1840, doi: 10.1038/mt.2008.200 (2008). Wilson, A. C. & Mohr, I. Control of animal virus replication by RNA adenosine methylation. Adv Virus Res 112, 87–114, doi: 10.1016/bs.aivir.2022.01.002 (2022). Wang, Y. & Zhou, X. N(6)-methyladenosine and Its Implications in Viruses. Genomics Proteomics Bioinformatics 21, 695–706, doi: 10.1016/j.gpb.2022.04.009 (2023). Kim, G. W. & Siddiqui, A. Hepatitis B Virus X Protein Expression Is Tightly Regulated by N6-Methyladenosine Modification of Its mRNA. J Virol 96, e0165521, doi: 10.1128/JVI.01655-21 (2022). Kennedy, E. M. et al. Posttranscriptional m(6)A Editing of HIV-1 mRNAs Enhances Viral Gene Expression. Cell Host Microbe 19, 675–685, doi: 10.1016/j.chom.2016.04.002 (2016). Lichinchi, G. et al. Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol 1, 16011, doi: 10.1038/nmicrobiol.2016.11 (2016). Courtney, D. G. et al. Epitranscriptomic Addition of m(5)C to HIV-1 Transcripts Regulates Viral Gene Expression. Cell Host Microbe 26, 217–227 e216, doi: 10.1016/j.chom.2019.07.005 (2019). Li, T. C., Scotti, P. D., Miyamura, T. & Takeda, N. Latent infection of a new alphanodavirus in an insect cell line. J Virol 81, 10890–10896, doi: 10.1128/JVI.00807-07 (2007). Eckerle, L. D., Albarino, C. G. & Ball, L. A. Flock House virus subgenomic RNA3 is replicated and its replication correlates with transactivation of RNA2. Virology 317, 95–108, doi: 10.1016/j.virol.2003.08.029 (2003). Gallagher, T. M., Friesen, P. D. & Rueckert, R. R. Autonomous replication and expression of RNA 1 from black beetle virus. J Virol 46, 481–489, doi: 10.1128/JVI.46.2.481-489.1983 (1983). Mauger, D. M. et al. mRNA structure regulates protein expression through changes in functional half-life. Proc Natl Acad Sci U S A 116, 24075–24083, doi: 10.1073/pnas.1908052116 (2019). Parr, C. J. C. et al. N 1-Methylpseudouridine substitution enhances the performance of synthetic mRNA switches in cells. Nucleic Acids Res 48, e35, doi: 10.1093/nar/gkaa070 (2020). Lin, J. Y. et al. Viral and host proteins involved in picornavirus life cycle. J Biomed Sci 16, 103, doi: 10.1186/1423-0127-16-103 (2009). Bailey, J. M. & Tapprich, W. E. Structure of the 5' nontranslated region of the coxsackievirus b3 genome: Chemical modification and comparative sequence analysis. J Virol 81, 650–668, doi: 10.1128/JVI.01327-06 (2007). Thess, A. et al. Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals. Mol Ther 23, 1456–1464, doi: 10.1038/mt.2015.103 (2015). Wesselhoeft, R. A. et al. RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo. Mol Cell 74, 508–520 e504, doi: 10.1016/j.molcel.2019.02.015 (2019). Kameda, S., Ohno, H. & Saito, H. Synthetic circular RNA switches and circuits that control protein expression in mammalian cells. Nucleic Acids Res 51, e24, doi: 10.1093/nar/gkac1252 (2023). Pietila, M. K., Hellstrom, K. & Ahola, T. Alphavirus polymerase and RNA replication. Virus Res 234, 44–57, doi: 10.1016/j.virusres.2017.01.007 (2017). Westhof, E. Pseudouridines or how to draw on weak energy differences. Biochem Biophys Res Commun 520, 702–704, doi: 10.1016/j.bbrc.2019.10.009 (2019). Svitkin, Y. V. et al. N1-methyl-pseudouridine in mRNA enhances translation through eIF2alpha-dependent and independent mechanisms by increasing ribosome density. Nucleic Acids Res 45, 6023–6036, doi: 10.1093/nar/gkx135 (2017). Mulroney, T. E. et al. N(1)-methylpseudouridylation of mRNA causes + 1 ribosomal frameshifting. Nature 625, 189–194, doi: 10.1038/s41586-023-06800-3 (2024). Blakney, A. K. et al. Innate Inhibiting Proteins Enhance Expression and Immunogenicity of Self-Amplifying RNA. Mol Ther 29, 1174–1185, doi: 10.1016/j.ymthe.2020.11.011 (2021). Perkovic, M. et al. A trans-amplifying RNA simplified to essential elements is highly replicative and robustly immunogenic in mice. Mol Ther 31, 1636–1646, doi: 10.1016/j.ymthe.2023.01.019 (2023). Yoshida, A. et al. Versatile live-attenuated SARS-CoV-2 vaccine platform applicable to variants induces protective immunity. iScience 25, 105412, doi: 10.1016/j.isci.2022.105412 (2022). Yeh, M. T. et al. Genetic stabilization of attenuated oral vaccines against poliovirus types 1 and 3. Nature 619, 135–142, doi: 10.1038/s41586-023-06212-3 (2023). Komori, M. et al. Incorporation of 5 methylcytidine alleviates innate immune response to self-amplifying RNA vaccine. bioRxiv, doi: 10.1101/2023.11.01.565056 (2023). Aboshi, M. et al. Safety and immunogenicity of VLPCOV-02, a SARS-CoV-2 self-amplifying RNA vaccine with a modified base, 5-methylcytosine. iScience 27, 108964, doi: 10.1016/j.isci.2024.108964 (2024). Herold, J. & Andino, R. Poliovirus requires a precise 5' end for efficient positive-strand RNA synthesis. J Virol 74, 6394–6400, doi: 10.1128/jvi.74.14.6394-6400.2000 (2000). Vignuzzi, M., Gerbaud, S., van der Werf, S. & Escriou, N. Expression of a membrane-anchored glycoprotein, the influenza virus hemagglutinin, by dicistronic replicons derived from the poliovirus genome. J Virol 76, 5285–5290, doi: 10.1128/jvi.76.10.5285-5290.2002 (2002). Meyer, R. G. et al. Plasmid-based generation of recombinant coxsackievirus B3 particles carrying capsid gene replacement replicons. Virus Res 104, 17–26, doi: 10.1016/j.virusres.2004.02.037 (2004). Quirin, T., Chen, Y., Pietila, M. K., Guo, D. & Ahola, T. The RNA Capping Enzyme Domain in Protein A is Essential for Flock House Virus Replication. Viruses 10, doi: 10.3390/v10090483 (2018). Liljestrom, P. & Garoff, H. A New Generation of Animal-Cell Expression Vectors Based on the Semliki Forest Virus Replicon. Bio-Technol 9, 1356–1361, doi:DOI 10.1038/nbt1291-1356 (1991). Oyama, R. et al. An Ionizable Lipid Material with a Vitamin E Scaffold as an mRNA Vaccine Platform for Efficient Cytotoxic T Cell Responses. ACS Nano 17, 18758–18774, doi: 10.1021/acsnano.3c02251 (2023). Lorenz, R. et al. ViennaRNA Package 2.0. Algorithms Mol Biol 6, 26, doi: 10.1186/1748-7188-6-26 (2011). Additional Declarations Competing interest reported. P.M., T.N., F.O., T.S., Y.F., R.S., and H.E. are employed by BIKEN. H.E. holds a managerial position at BIKEN. Supplementary Files SupplInfo240518.pdf Cite Share Download PDF Status: Published Journal Publication published 31 Jul, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 07 Jun, 2024 Reviews received at journal 06 Jun, 2024 Reviews received at journal 30 May, 2024 Reviewers agreed at journal 24 May, 2024 Reviewers agreed at journal 24 May, 2024 Reviewers invited by journal 24 May, 2024 Editor assigned by journal 24 May, 2024 Editor invited by journal 21 May, 2024 Submission checks completed at journal 21 May, 2024 First submitted to journal 16 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4429063","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":308593881,"identity":"f9a6dd1c-50cf-478d-9fcb-9563cf170625","order_by":0,"name":"Paola Miyazato","email":"","orcid":"","institution":"The Research Foundation for Microbial Diseases of Osaka University (BIKEN)","correspondingAuthor":false,"prefix":"","firstName":"Paola","middleName":"","lastName":"Miyazato","suffix":""},{"id":308593882,"identity":"bfcb7dd0-9eb9-4513-8aa5-a02e572c482c","order_by":1,"name":"Takafumi Noguchi","email":"","orcid":"","institution":"The Research Foundation for Microbial Diseases of Osaka University (BIKEN)","correspondingAuthor":false,"prefix":"","firstName":"Takafumi","middleName":"","lastName":"Noguchi","suffix":""},{"id":308593883,"identity":"7758f863-9db2-4fcd-a3c5-087924144f45","order_by":2,"name":"Fumiyo Ogawa","email":"","orcid":"","institution":"The Research Foundation for Microbial Diseases of Osaka University (BIKEN)","correspondingAuthor":false,"prefix":"","firstName":"Fumiyo","middleName":"","lastName":"Ogawa","suffix":""},{"id":308593885,"identity":"ff945945-473f-46cb-b96e-184e5064337b","order_by":3,"name":"Takeshi Sugimoto","email":"","orcid":"","institution":"The Research Foundation for Microbial Diseases of Osaka University (BIKEN)","correspondingAuthor":false,"prefix":"","firstName":"Takeshi","middleName":"","lastName":"Sugimoto","suffix":""},{"id":308593887,"identity":"11ddb68f-8288-461e-b70c-fd30f3c54399","order_by":4,"name":"Yuzy Fauzyah","email":"","orcid":"","institution":"The Research Foundation for Microbial Diseases of Osaka University (BIKEN)","correspondingAuthor":false,"prefix":"","firstName":"Yuzy","middleName":"","lastName":"Fauzyah","suffix":""},{"id":308593889,"identity":"4d73fa92-f9ae-40e5-8660-33a8c80607be","order_by":5,"name":"Ryo Sasaki","email":"","orcid":"","institution":"The Research Foundation for Microbial Diseases of Osaka University (BIKEN)","correspondingAuthor":false,"prefix":"","firstName":"Ryo","middleName":"","lastName":"Sasaki","suffix":""},{"id":308593891,"identity":"01278983-aaf4-4f6f-8ce6-145a1826a92d","order_by":6,"name":"Hirotaka Ebina","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEElEQVRIie3RPUvDQBjA8ecInMsTs56L+QrJUito/CoXArpIFLp0KKFTXGLnk0g/y8lBXGK7BjqYycmhIGQsnqBgMYm6Cd5/Ou74cW8AJtMfzAMECXDEKb7PsI8lMu0lp78kOsXhC+nqYOf6Tl1OlvEuqqKGceLuXUnKYBKAlbdvc5gtuBLFakTt9MyDUvk5ck2KCMitbD9Yde4ppKswdXDASCrJHC4aBlQCEbydPD5rsllo4jSaJCdzp9a7bHpIhZ6yUxmmdkY1scKc8bdBDyljruxZNKJYDBgvVXQjamsYziLsvMv9g3rBJojdLHpi63FyLJacVOsm2Pc7Xmw7/mmAvviB2M799lNNJpPpn/QK4ita/iwsQ3QAAAAASUVORK5CYII=","orcid":"","institution":"The Research Foundation for Microbial Diseases of Osaka University (BIKEN)","correspondingAuthor":true,"prefix":"","firstName":"Hirotaka","middleName":"","lastName":"Ebina","suffix":""}],"badges":[],"createdAt":"2024-05-16 07:03:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4429063/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4429063/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-68617-y","type":"published","date":"2024-07-31T15:57:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":57624837,"identity":"bcf2f7b9-e4d2-4850-aa3e-caafc7457a7c","added_by":"auto","created_at":"2024-06-03 13:49:30","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":431327,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e1mY negatively affects the replication of TNCL gRNA1-based replicons.\u003c/strong\u003e BHK-21 cells were transfected with mRNA \u003cstrong\u003e(a)\u003c/strong\u003e or a TNCL GFP-HiBiT (GFP-H) reporter replicon \u003cstrong\u003e(b-f)\u003c/strong\u003e, that were transcribed \u003cem\u003ein vitro\u003c/em\u003e using U, 1mY or a mixture of both. \u003cstrong\u003e(a)\u003c/strong\u003e Reporter expression from both types of mRNAs.\u003cstrong\u003e (b)\u003c/strong\u003eReporter expression from TNCL RNA1-based replicons prepared with 1mYsignificantly decreased compared to that of U- or U/1mY-containing replicons. GFP RNA \u003cstrong\u003e(c)\u003c/strong\u003e, RNA1\u003cstrong\u003e (d)\u003c/strong\u003e (-)-RNA1 \u003cstrong\u003e(e)\u003c/strong\u003e levels in samples taken at the indicated time-points from transfected cells, were measured by RT-qPCR. The black segments on the replicon schematics represent the amplified targets. The same primers were used for amplicons in (d) and (e).\u003cstrong\u003e (f)\u003c/strong\u003e dsRNA staining of U- or 1mY-containing TNCL replicons in transfected cells. Unpaired t-test was used to calculate the p-value in (a), and two-way analysis of variance (ANOVA) with Tukey’s multiple comparison test was performed for the statistical analysis of the rest of the graphs.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4429063/v1/73e77b7438947bb271d8cbb5.png"},{"id":57624334,"identity":"13b13a67-3717-4a5e-ad00-83df90db7aa5","added_by":"auto","created_at":"2024-06-03 13:41:30","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":233799,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e1mY does not abrogate the translation of TNCL-based replicons, but hinders the replication step.\u003c/strong\u003e A TNCL gRNA1-based replicon with the reporter encoded in-frame with the PA ORF \u003cstrong\u003e(a)\u003c/strong\u003eor TNCL gRNA2-based RNA \u003cstrong\u003e(b)\u003c/strong\u003e was transcribed\u003cem\u003e in vitro\u003c/em\u003e using either U or 1mY and transfected into BHK-21 cells. Expression of the GFP-HiBiT reporter was measured using HiBiT luminescent signals at 3 and 24 hpt. Two-way ANOVA with Tukey’s multiple comparison test was used for statistical analysis.\u003cstrong\u003e (c)\u003c/strong\u003e Schematic representation of PA RdRp mRNA (top) and the defective template TNCL reporter replicon (bottom). BHK-21 cells were transfected with U- or 1mY-containing target TNCL reporter replicons, in the presence or absence of PA mRNA. GFP expression was detected by fluorescence microscopy and HiBiT luminescence was measured in the cell lysates. \u003cstrong\u003e(d)\u003c/strong\u003eStatistical analysis was performed using one-way ANOVA with Tukey’s multiple comparison test. \u003cstrong\u003e(e)\u003c/strong\u003e Relative GFP RNA levels measured by RT-qPCR are shown.\u003cstrong\u003e \u003c/strong\u003eTwo-way ANOVA with Sidak’s multiple comparison test was performed. \u003cstrong\u003e(f)\u003c/strong\u003e RNA immunoprecipitation was performed with HA-tagged PA and template TNCL defective replicons containing either U or 1mY. Two-way ANOVA with an uncorrected Fisher’s least significant difference (LSD) was performed for statistical analysis.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4429063/v1/429563df332818a58e80b443.png"},{"id":57625712,"identity":"0894afac-8914-426a-b1a9-85604dd38de1","added_by":"auto","created_at":"2024-06-03 13:57:30","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":372153,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e1mY severely impairs the translation of CVB3 replicons. (a) \u003c/strong\u003eSchematic representation of CVB3 reporter replicon. VPg: virion protein genome-linked; viral peptide corresponding to 3B in the early translated polyprotein. HEK 293T cells were transfected with \u003cem\u003ein vitro\u003c/em\u003e-transcribed reporter replicons containing either U or 1mY, and HiBiT luminescence was measured in the lysates of transfected cells harvested at the indicated hpt. \u003cstrong\u003e(b)\u003c/strong\u003e dsRNA was detected by immunofluorescence in the transfected cells at 24 hpt. \u003cstrong\u003e(c)\u003c/strong\u003e A shorter reporter RNA, containing CVB3 IRES and part of the viral 5’UTR upstream of the GFP-HiBiT coding sequence was constructed and \u003cem\u003ein vitro\u003c/em\u003e transcribed, using either U or 1mY. RNA was transfected into HEK 293T cells, and HiBiT luminescence was measured at the indicated time points. Two-way ANOVA with Tukey’s multiple comparison test was performed for statistical analysis of (a) and (c).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4429063/v1/c67d387ebe860bf6a0292a70.png"},{"id":57624331,"identity":"8b26f4e4-6fd9-4cbe-aae4-9585132152ca","added_by":"auto","created_at":"2024-06-03 13:41:30","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":680706,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSFV replicons containing 1mY do not effectively induce an immune response \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e \u003cstrong\u003e(a)\u003c/strong\u003e Schematic representation of the SFV reporter replicon containing the GFP-HiBiT-coding sequence replacing the viral structural proteins. SFV reporter replicons were transcribed \u003cem\u003ein vitro\u003c/em\u003eusing U or 1mY, and transfected into HEK 293T cells. \u003cstrong\u003e(b) \u003c/strong\u003eGFP expression was confirmed by fluorescence microscopy 24 hpt.\u003cstrong\u003e (c)\u003c/strong\u003eHiBiT luminescence of the lysate of transfected cells was measured at the indicated time-point \u003cstrong\u003e(d)\u003c/strong\u003e The presence of SFV genomic RNA was analyzed by RT-qPCR, at the indicated time-points post-transfection, targeting the region indicated by the black segment in (a). \u003cstrong\u003e(e)\u003c/strong\u003e Replication was confirmed by staining dsRNA in BHK-21 cells transfected with the SFV replicon. \u003cstrong\u003e(f)\u003c/strong\u003e Schematic representation of the SFV replicon containing the coding sequence of an antigen of interest (SARS-CoV2 spike protein RBD and trans-membrane domain) for \u003cem\u003ein vivo\u003c/em\u003e use. \u003cstrong\u003e(g)\u003c/strong\u003e The presence of the SFV genomic RNA from the replicon was first analyzed \u003cem\u003ein vitro\u003c/em\u003e, at the indicated time-points. \u003cstrong\u003e(h)\u003c/strong\u003e Immunization protocol \u003cstrong\u003e(i)\u003c/strong\u003e ELISA results using the sera of the immunized mice. Two-way ANOVA with Tukey’s multiple comparison test was performed for statistical analysis of (c), (d) and (f) data. All data were collected from at least two independent experiments.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4429063/v1/4c9dbe6d8092d552d9d8957e.png"},{"id":61793639,"identity":"13411f74-737f-46ea-9c2d-049b7f46032c","added_by":"auto","created_at":"2024-08-05 16:14:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2226545,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4429063/v1/95424f44-f648-48bd-9cd3-eb71a7a18619.pdf"},{"id":57624336,"identity":"a4752598-3269-47c8-9311-a92967d0011d","added_by":"auto","created_at":"2024-06-03 13:41:30","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":32440150,"visible":true,"origin":"","legend":"","description":"","filename":"SupplInfo240518.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4429063/v1/ecfee0304e0cb18946dcd90b.pdf"}],"financialInterests":"Competing interest reported. P.M., T.N., F.O., T.S., Y.F., R.S., and H.E. are employed by BIKEN. H.E. holds a managerial position at BIKEN.","formattedTitle":"1mΨ influences the performance of various positive-stranded RNA virus-based replicons","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWith the implementation of global immunization protocols against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), including mRNA vaccines, during the COVID-19 pandemic, renewed attention has been focused on RNA-based vaccine modalities. Self-amplifying RNAs (saRNAs) are the next generation of RNA vaccines\u003csup\u003e1\u003c/sup\u003e that are usually constructed based on replicons of positive-sense ((+)-RNA) viruses, where the coding sequence of the viral structural proteins (SP) is replaced with that of a gene of interest (GOI), while retaining the coding sequences of non-structural proteins (NsPs), including the viral RNA-dependent RNA polymerase (RdRp)\u003csup\u003e2\u0026ndash;4\u003c/sup\u003e. Thus, their advantage over conventional mRNA vaccine platforms relies on the viral replication machinery, which amplifies the mRNA of the encoded GOI within target cells\u003csup\u003e5\u003c/sup\u003e. Several positive-sense and negative-sense RNA viruses have been used as backbone for the development of replicons, including those of the \u003cem\u003eTogaviridae\u003c/em\u003e, \u003cem\u003eFlaviviridae\u003c/em\u003e, \u003cem\u003eParamixoviridae\u003c/em\u003e, and \u003cem\u003eRabdoviridae\u003c/em\u003e families, among others\u003csup\u003e6,7\u003c/sup\u003e. Alphaviruses such as Venezuelan equine encephalitis virus (VEEV) and Semliki forest virus (SFV) are among the (+)-RNA viruses most commonly used to develop saRNAs that have been tested in clinical settings\u003csup\u003e8\u0026ndash;10\u003c/sup\u003e. However, it is unlikely that a single viral backbone is sufficiently versatile to allow the insertion of a wide range of GOIs. Therefore, it is crucial to further understand the practical uses of this innovative and promising vaccine modality by considering other viruses\u003csup\u003e11\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eNodaviridae\u003c/em\u003e family comprises a group of small non-enveloped bipartite (+)-RNA viruses classified into two genera, \u003cem\u003eAlphanodavirus\u003c/em\u003e and \u003cem\u003eBetanodavirus\u003c/em\u003e, which infect insects and fish, respectively\u003csup\u003e12\u003c/sup\u003e. The Nodamura virus (NoV), the first nodavirus to be discovered, is known to be pathogenic to its natural insect hosts and is lethal when infecting suckling mice\u003csup\u003e13\u003c/sup\u003e, although not adults. Another member of the \u003cem\u003eAlphanodavirus\u003c/em\u003e genus within this family is Flock House virus (FHV). This virus has served as a model to study the replication process of (+)-RNA viruses owing to its simplicity, and is thus the most extensively studied species of the family. FHV RNA has been reported to replicate in insect, yeast, plant, and mammalian cell lines\u003csup\u003e14\u0026ndash;16\u003c/sup\u003e. Empty capsid particles have been considered for carrying or displaying heterologous peptides and proteins\u003csup\u003e17\u003c/sup\u003e. These attributes make the members of this family attractive candidates for biomedical applications.\u003c/p\u003e \u003cp\u003eKnowledge pertaining to the structural or chemical modifications that play important roles in RNA stability and antigen expression, in addition to formulation compositions for successful delivery \u003cem\u003ein vivo\u003c/em\u003e, has been gained as a consequence of COVID-19. The inclusion of a modified nucleoside, namely N1-methyl-pseudouridine (1mΨ), was significantly pivotal\u003csup\u003e18,19\u003c/sup\u003e. Pseudouridine (Ψ), an isomer of uridine (U), is ubiquitously present in several types of RNAs, including transfer, ribosomal, small nuclear, and small nucleolar RNAs\u003csup\u003e20\u003c/sup\u003e. Advances in next-generation sequencing technology have enabled the detection of Ψ mRNAs as well\u003csup\u003e21\u003c/sup\u003e. This modified nucleoside, when present in \u003cem\u003ein vitro\u003c/em\u003e-transcribed mRNAs, has been shown to increase the expression of the encoded protein and prevent the activation of the innate immune response\u003csup\u003e22,23\u003c/sup\u003e that would otherwise lead to the degradation of the mRNA. Viruses have been reported to contain RNA modifications that affect various steps of their life cycle in different ways, thus shaping their interactions with their host \u003csup\u003e24,25\u003c/sup\u003e. For example, N(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e)-methyladenosine (m\u003csup\u003e6\u003c/sup\u003eA), the most abundant modified nucleoside, has been reported to regulate gene expression and reverse transcription of the pre-genomic RNA of the hepatitis B virus\u003csup\u003e26\u003c/sup\u003e. It has also been shown to increase HIV-1 gene expression\u003csup\u003e27,28\u003c/sup\u003e, while 5-methyl cytosine (m\u003csup\u003e5\u003c/sup\u003eC), another epitranscriptomic modification, regulates splicing and decreased protein expression\u003csup\u003e29\u003c/sup\u003e. For viruses with potential utility as saRNA vaccines, the effects of modified nucleosides on replication have not been extensively explored, particularly those with reported effects on reducing innate immune activation. In the current study, we evaluated the effect of 1mΨ on viral replication, using a nodavirus as a model. We found that it interfered more with viral replication than with the translation of viral RNAs. We also found that the effects varied in degree when testing for other RNA viruses such as SFV or coxsackievirus B3 (CVB3).\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1mΨ negatively affects TNCL RNA1-based replicons\u003c/h2\u003e \u003cp\u003eSince 1mΨ has been shown to improve the performance of mRNA vaccines, we sought to evaluate the effect of this modified nucleoside on replicons and assess whether similar benefits can be expected for saRNAs constructed using various viral RNAs. In the current study, we used replicons based on the TNCL nodavirus, which is closely related to FHV\u003csup\u003e30\u003c/sup\u003e. We first confirmed the expression of the GPF-HiBiT reporter in BHK-21 cells transfected with conventional mRNAs containing U or 1mΨ, incorporated during \u003cem\u003ein vitro\u003c/em\u003e transcription (IVT) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Next, we tested a TNCL RNA1-based reporter replicon, which produced a luminescent signal when synthesized with U alone at one day post-transfection (dpt) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). This signal increased significantly one day later, suggesting proper translation and accumulation of the reporter protein. However, when the replicon contained 1mΨ, the expression was significantly reduced, particularly when U was completely substituted with 1mΨ. These results correlated with the levels of \u003cem\u003eGFP\u003c/em\u003e mRNA, which increased for the replicon containing U, but not 1mΨ (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). The expression of the reporter from this replicon results from the translation of RNA3, which is separately transcribed from a subgenomic promoter present in RNA1\u003csup\u003e31\u003c/sup\u003e. The GFP sequence is present not only in RNA3 but also in genomic RNA1, which is amplified in transfected cells. When we amplified a region of viral RdRp ORF present only in RNA1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed), the results correlated, as did those for the detection of the intermediate (-)-strand RNA by qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee): there was a significant increase of RNA measured for the replicon prepared with U, while no increase was observed for that prepared with 1mΨ. Furthermore, we assessed the presence of double-stranded RNA (dsRNA) by immunofluorescence and detected positive staining only in cells transfected with U-containing replicons (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). For replicons synthesized with a mixture of U and 1mΨ, a significant increase in protein and RNA levels was observed, albeit smaller than for replicons prepared exclusively with U (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb-e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eTranslation of TNCL RNA1 or RNA2 is not severely affected by 1mΨ\u003c/h2\u003e \u003cp\u003eTNCL gRNA1 serves as the mRNA for the viral RdRp protein A (PA)\u003csup\u003e32\u003c/sup\u003e. Thus, upon transfection with TNCL RNA1-based replicons, translation of PA is a critical initial step that drives downstream events in the nodavirus replication process. The results shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e suggest that replication is the step affected most, but the translation of PA may also be affected by 1mΨ. To evaluate the effect of 1mΨ on the translation of TNCL RNAs, we constructed another replicon with a reporter gene cloned in-frame with the PA ORF, where the expression of the reporter reflected that of PA itself. The expression of the reporter from the replicon containing 1mΨ was not completely abrogated, since an increase in the signal was detected between 3 and 24 hours post-transfection (hpt), indicating cumulative translation of the encoded protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFurthermore, we speculated whether the effect of 1mΨ on RNA2, that encodes the viral capsid protein precursor, is similar to that observed on RNA1. To verify, we constructed a reporter RNA2 containing the GFP-HiBiT-coding sequence between the TNCL RNA2 UTRs, replacing the coding sequence of the capsid. We observed that the luminescent signal from the RNA2 reporter prepared with 1mΨ was significantly lower than that prepared with U, but was still detectable (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). These results suggest that the presence of 1mΨ within both TNCL RNA molecules might interfere with the translation step, but is not as drastically detrimental as for the replication step.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e1mΨ impairs the binding of the RdRp to TNCL RNA1 replicon\u003c/h2\u003e \u003cp\u003eTo provide more evidence on the replication impairment exerted by 1mΨ on TCNL RNA1-based replicons, we analyzed the expression of a reporter gene (\u003cem\u003eGFP-HiBiT\u003c/em\u003e) using a trans-replication system (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). A defective template replicon containing a premature stop codon within the PA coding sequence was constructed and mRNA was synthesized by IVT using either U or 1mΨ. An additional source of functional viral RdRp was provided by co-transfecting the mRNA of PA, containing the encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES) sequence to facilitate its translation. The lack of reporter expression from the replicon prepared with U in the absence of PA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec and d) confirmed that the addition of a separate source of RdRp was required. When viral PA was provided by co-transfecting IVT \u003cem\u003ePA\u003c/em\u003e mRNA, reporter expression was only detected from the template replicon containing U. The levels of \u003cem\u003eGFP\u003c/em\u003e RNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee) were consistent with these results, as an increase of RNA was only detected when the template replicon was synthesized with U in the presence of PA, suggesting that replication, and thus amplification of the replicon and GOI mRNA, were negatively affected by the presence of 1mΨ. This modified nucleoside has been reported to provide increased stability and/or rigidity to RNA molecules\u003csup\u003e33,34\u003c/sup\u003e which might affect the function of regulatory sequences such as viral UTRs. We performed structure prediction analyses of the TNCL RNA1 3\u0026rsquo;end, comprising part of the PA and B2 coding sequences and the 3\u0026rsquo;UTR (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). We hypothesized that the bond between G at position 7 and C at position 31 of the analyzed sequences played an important role in establishing the predicted structure (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea). Indeed, point mutations aimed at disrupting this bond led to changes in the predicted secondary structures (M1 and M2, Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eb) that were rescued by swapping the positions of the interacting G and C nucleotides (M3, Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ec). Experimentally, we observed that clones with the disrupted 3\u0026rsquo;end (M1 and M2) showed a decreased level of reporter expression and RNA replication (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ed), suggesting that the conformation and/or stability of the TNCL RNA1 3\u0026rsquo;end is important for these processes. Thus, we hypothesized that the presence of 1mΨ in regions of the 3\u0026rsquo; end, by affecting the stability of the 3\u0026rsquo;UTR, might lead to a disrupted binding or recognition of the viral RNA by the RdRp. We performed an RNA-immunoprecipitation assay (RIP), using the trans-replication system described in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef, TNCL RNA1 containing U was more significantly enriched in the precipitate than in the control IgG, suggesting that the interaction of viral RdRp might be hindered by the presence of 1mΨ in the target RNA. Nevertheless, we observed that the pull-down of 1mΨ-containing RNA was still significantly enriched compared to its control IgG.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e1mΨ abrogates the translation of CVB3-based replicons\u003c/h2\u003e \u003cp\u003eTo determine whether our findings on the effect of 1mΨ on TNCL nodavirus can be reproduced in other RNA viruses, we also tested CVB3-based replicons (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). When the replicon was synthesized to contain U, the expression of the reporter was detected as luminescence as early as 3 hpt. The signal increased significantly after 6 h. However, when the replicon containing 1mΨ was transfected, no expression was detected, suggesting that either translation or replication was impaired (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). To determine which step was mainly affected, we examined dsRNA in replicon-transfected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb) and found that only replicons containing U showed positive staining, suggesting the abrogation of the replication step. CVB3 RNA is translated immediately after entering the target cell to produce a polyprotein, which is cleaved by viral proteases into various functional proteins\u003csup\u003e35\u003c/sup\u003e. The translation is dependent on the viral IRES sequence located at the 5\u0026rsquo; end of the viral genome\u003csup\u003e36\u003c/sup\u003e. Ψ has been reported to exert deleterious effects on EMCV IRES sequences\u003csup\u003e37\u003c/sup\u003e and 1mΨ prevented translation driven by CVB3 IRES in circular RNAs\u003csup\u003e38\u003c/sup\u003e. To confirm the effects of 1mΨ on replication in the context of linear CVB3-based replicons, we constructed a reporter RNA, containing the CVB3 IRES sequence that includes a part of the viral 5\u0026rsquo;UTR, upstream of the GFP-HiBiT reporter, followed by the polyA tail, also present in the original replicon (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec)\u003csup\u003e39\u003c/sup\u003e. The results for this reporter were concordant with those obtained for the full replicon (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea), indicating that translation was severely crippled by 1mΨ. Overall, our findings support the hypothesis that 1mΨ interferes with the normal IRES-mediated translation of CVB3 RNA, and hence, the downstream replication process of CVB3-based replicons.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe effect of 1mΨ on Semliki forest virus (SFV) replicons varies\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAlphaviruses are among the most commonly used viruses for developing saRNA vaccines. We tested the use of 1mΨ on a SFV replicon containing the coding sequence for GFP-HiBiT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea), driven by the sub-genomic promoter\u003csup\u003e40\u003c/sup\u003e. Cells transfected with \u003cem\u003ein vitro\u003c/em\u003e-transcribed replicons containing either U or 1mΨ, were evaluated for expression of the encoded reporter and amplification of RNA. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, expression of GFP was confirmed at 1 dpt. HiBiT quantitative analysis showed an increase in the luminescent signal at 2 dpt originating from replicons containing either U or 1mΨ (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec), demonstrating continuous translation and accumulation of the protein. Although there was a significant difference in the levels of luminescence between the replicons synthesized with different nucleotides, these results suggest that 1mΨ did not inhibit the performance of SFV-based replicon, as was previously observed for TNCL or CVB3. Consistent with these protein expression results, increasing levels of \u003cem\u003eSFV\u003c/em\u003e RNA were detected in both types of replicons (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed), indicating that replication was not severely impaired. There was, however, a delay in the increase of RNA when the replicon was synthesized with 1mΨ, indicating that it might generate a barrier during the replication process. These results were in line with the dsRNA staining of transfected cells, that showed lower levels for 1mY-containing replicons (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). Nevertheless, we evaluated the efficacy of the modified SFV replicon to induce an immune response against an antigen of interest \u003cem\u003ein vivo\u003c/em\u003e. For this purpose, we used the SARS-CoV-2 receptor-binding and transmembrane domains (RBD-TM) of the spike protein as a model antigen and cloned it into the SFV replicon, replacing the GFP-HiBiT sequence of the previous reporter (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). \u003cem\u003eIn vitro\u003c/em\u003e, this replicon led to the expression of the antigen (Supplementary Fig.\u0026nbsp;2) and replication of the RNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg). However, compared to the previous replicon containing GFP-HiBiT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-d), more pronounced differences were observed when they were synthesized with U or 1mΨ, not favoring 1mΨ. For the \u003cem\u003ein vivo\u003c/em\u003e experiments, lipid nanoparticles encapsulating the \u003cem\u003ein vitro\u003c/em\u003e-transcribed replicons were injected intramuscularly into BALB/c mice following the schedule detailed in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eh. Mice immunized with the U-containing replicon showed a clear increase in antibodies targeting the RBD antigen as determined by enzyme-linked immune-sorbent assay ELISA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ei). In contrast, mice injected with the modified replicon showed very low and variable levels of antibodies, with titers that differed by approximately seven orders of magnitude. These results suggest that, at least at the dose tested, 1mΨ did not show beneficial effects on the performance of SFV replicons \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDuring the COVID-19 pandemic, mRNA vaccines marked a pivotal milestone in the therapeutic usage of RNA molecules and opened doors to related next-generation vaccine platforms, including saRNAs, which are constructed based on viral RNAs. The incorporation of modified nucleosides such as 1mΨ was among the strategic modifications included in the current mRNA vaccines that was demonstrated to reduce the innate immune response triggered by foreign RNAs. However, the effects of modified nucleosides on saRNA vaccines have not yet been investigated in detail. In the current study, we found that the translation of nodavirus TNCL RNA-based replicons was not severely impaired when they contained 1mΨ (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). However, the replication was significantly hindered (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRNA viruses rely on regulatory sequences within their genomes for replication in infected cells. The translation of uncapped viral mRNAs is sometimes facilitated by the presence of an IRES. These regulatory sequences, which were first discovered in picornaviruses, usually adopt structural conformations that vary in complexity and convey different degrees of reliance on endogenous factors for translation. In addition to increasing ribosome recruitment, Ψ and 1mΨ increase the stability of RNA molecules by improving base-pair interactions and base stacking\u003csup\u003e34,41,42\u003c/sup\u003e, which may affect the ability of the IRES to recruit the host translation machinery to the viral RNA\u003csup\u003e37\u003c/sup\u003e. The results of the CVB3 replicons analyzed in the current study (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) are in line with previous reports, where CVB3 IRES was abrogated by 1mΨ\u003csup\u003e38\u003c/sup\u003e. The same mechanism may underlie the interference exerted by 1mΨ on the replication of TNCL nodavirus. In the \u003cem\u003ein vitro\u003c/em\u003e characterization of the constructed replicons, we observed that single point mutations in the 3\u0026rsquo; end of RNA1 led to a decreased or delayed expression of the encoded GOI. Changes in the predicted secondary structure were observed in the fragments containing these point-mutations suggesting that, the structural conformation of the 3\u0026rsquo; end is important for viral replication. Considering the characteristics attributed to Ψ and 1mΨ on RNA molecules, it can be inferred that U-A interactions in regions of the 3\u0026rsquo;end that are normally flexible (with high entropy nucleotides highlighted in blue in Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea) might become more rigid when 1mΨ is used instead (△, Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea). RIP results support this possibility, which was observed as a hindrance to the recognition or proper functioning of viral RdRp (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef). Therefore, although 1mΨ provides advantageous effects on mRNAs, those on replicons may vary depending on the viral RNA backbone used, as observed in our study. Our findings using SFV-based replicons synthesized with 1mΨ led to the expression of GOI without vital differences \u003cem\u003ein vitro\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-d). Nevertheless, when tested \u003cem\u003ein vivo\u003c/em\u003e as an saRNA vaccine, the modified version did not perform as well as the unmodified version (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ei). These results suggest that replication inefficiencies and SFV replicon degradation occur \u003cem\u003ein vivo\u003c/em\u003e. Another possibility could be the generation of proteins different from the GOI, as suggested in a recent report, where the presence of 1mΨ in COVID-19 mRNA vaccines was shown to induce frame shifts, resulting in the expression of aberrant proteins\u003csup\u003e43\u003c/sup\u003e. To improve this outcome, it could be more beneficial to use a mixture of saRNAs, some containing U and some containing 1mΨ; or containing both U and 1mΨ (as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) may provide a balance between RNA stability, RdRp and GOI expression and, saRNA replication. In this case, we could not ascertain where each nucleotide was incorporated within the replicon. However, based on our results, we can infer that once the barrier of the first round of replication is overcome, 1mΨ no longer constitutes a hindrance, and the expression of the GOI may increase (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb-e). Novel approaches to the synthesis of therapeutic RNAs might enable the use of specific modified nucleosides for specific regions of RNAs which, in the case of replicons, might help avoid the crippling of important regulatory sequences. Furthermore, other studies have provided alternative strategies to optimize the performance of saRNA vaccines, such as the inclusion of coding sequences for modulators of innate immunity\u003csup\u003e44\u003c/sup\u003e or the use of trans-amplifying systmes\u003csup\u003e45\u003c/sup\u003e overall increasing the success of this vaccine modality. Modern technologies, such as reverse genetics, have enabled the construction of more customizable designs for recombinant viruses, widening the possibilities for their medical applications\u003csup\u003e46,47\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe number of RNA-based vaccines is rapidly increasing, reflecting the expectations placed on this vaccine platform, which includes a broad range of RNA molecules, in addition to the conventional mRNAs currently in use or the saRNAs analyzed here. Our study demonstrated that the inclusion of 1mΨ, although expected to improve the performance of saRNAs, resulted in different outcomes based on the backbone virus used, acting on different stages of the replication cycle. Other modified nucleosides such as m5C, with similar immunological benefits as 1mΨ, have shown better results in platforms based on other viruses\u003csup\u003e48,49\u003c/sup\u003e. Thus, increased knowledge on basic virology and the strategies used to optimize RNA-based vaccine development will pave the way for the application of this versatile vaccine modality, using a variety of viruses, in the near future.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCell lines\u003c/h2\u003e \u003cp\u003eBaby hamster kidney (BHK-21) cells were purchased from the Japanese collection of research bioresources (JCRB) cell bank. They were maintained in Minimum Essential Medium (MEM) (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich), penicillin (100 units/mL) (Nacalai Tesque, Kyoto, Japan), and streptomycin (100 \u0026micro;g/mL) (Nacalai Tesque), at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. When transfected with TNCL replicons, cells were incubated at 30\u0026deg;C. Human embryonic kidney (HEK 293T) cells were purchased from ATCC (Manassas, VA, USA) and were maintained in Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium (DMEM) (Sigma-Aldrich) supplemented with 10% FBS, penicillin, and streptomycin. High Five insect cells were purchased from Thermo Fisher Scientific (Waltham, MA, USA), and cultured in SF-900 II SFM medium (Gibco-Thermo Fisher Scientific) in the absence of FBS or additional antibiotics, at 27\u0026deg;C. Vero cells were purchased from ATCC and maintained in DMEM, supplemented with 10% FBS, penicillin, and streptomycin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003e All experiments and protocols were approved by the Animal Care and Use Committee of Osaka University and BIKEN. Seven-week-old BALB/c female mice were used to test the immunogenicity of SFV replicons \u003cem\u003ein vivo\u003c/em\u003e. Mice were immunized with two doses of SFV replicon prepared with either U or 1mY (1 \u0026micro;g of RNA/30 \u0026micro;L/dose) administered intra-muscularly, three weeks apart, and sera was analyzed by ELISA three weeks after the second dose. Two independent experiments using 3 or 5 mice per group were performed. The mice were kept in a temperature- and light-controlled room at the animal facility of Osaka University with free access to food and water. Methods are reported in accordance with the ARRIVE guidelines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCloning of TNCL and CVB3 genomes\u003c/h2\u003e \u003cp\u003eHigh Five cells (Thermo Fisher Scientific) were infected with a baculovirus to induce the reactivation of the TNCL nodavirus that is latently present in this cell line\u003csup\u003e30\u003c/sup\u003e. Four days later, the supernatant was collected and subjected to ultra-centrifugation (100,000 \u0026times; g, 4 h) over a 10% sucrose cushion at 4\u0026deg;C. The pellet containing the virus was resuspended in PBS and stored at -80\u0026deg;C until use. Viral RNA was extracted from an aliquot of the stored virus using TriReagent (Molecular Research Center, Cincinnati, OH, USA) following the manufacturer\u0026rsquo;s protocol. The cDNA of TNCL genomic RNA1 and RNA2 were synthesized using SuperScript III reverse transcriptase (Thermo Fisher Scientific) according to the procedure described by Li et al\u003csup\u003e30\u003c/sup\u003e, and cloned into Invitrogen\u0026rsquo;s pCR4 Blunt TOPO plasmid (Thermo Fisher Scientific). To clone the CVB3 genome, Vero cells were infected with the Nancy strain of CVB3 (ATCC VR-30). Three days later, the supernatant was collected and viral RNA was extracted using TriReagent (Molecular Research Center), as described above for TNCL. The cDNA of CVB3 was synthesized with SuperScriptIII, and used as a template to amplify two viral fragments containing the required additional flanking sequences: the hammerhead ribozyme\u003csup\u003e50\u003c/sup\u003e was inserted upstream of the 5\u0026rsquo;UTR, and a poly(A)\u003csub\u003e25\u003c/sub\u003e tail was added downstream of the region encompassing P2 to the 3\u0026rsquo;UTR, in addition to a \u003cem\u003eMlu\u003c/em\u003e I site, used to linearize the plasmid for IVT\u003csup\u003e51,52\u003c/sup\u003e. These sequences were then added to the primers used for PCR. The EMCV IRES sequence was separately amplified from the pAAV-IRES-Puro expression vector (Cell Biolabs, San Diego, CA, USA) with an inserted \u003cem\u003eHpa\u003c/em\u003e I restriction site in the 5\u0026rsquo;end. These three fragments were assembled into pcDNA3.1 plasmid (Invitrogen) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of various viral replicons\u003c/h2\u003e \u003cp\u003eTNCL RNA1-based replicons. We used the WT TNCL RNA1-containing TOPO vector as the backbone to be modified for different purposes. We constructed template plasmids for IVT by adding the T7 promoter and terminator sequences, and other regulatory sequences such as the hepatitis virus D ribozyme, based on a previous report\u003csup\u003e53\u003c/sup\u003e. SFV-based replicons. A LacZ SFV-based replicon (pSFV3-LacZ) was purchased from Addgene (Watertown, MA, USA) (plasmid #92074)\u003csup\u003e54\u003c/sup\u003e and used as the backbone for the SFV replicons tested in the current study, replacing the LacZ sequence with that of GFP-HiBiT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea) or the SARS-CoV-2 spike protein RBD-TM (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). For the CVB3-based reporter experiments, the sequence encoding GFP-HiBiT was inserted into the \u003cem\u003eHpa\u003c/em\u003e I site using the wild-type replicon described above.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003etranscription (IVT)\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTNCL template plasmids were linearized with \u003cem\u003eNot\u003c/em\u003e I restriction enzyme (New England BioLabs, Ipswich, MA, USA) and purified using a Qiagen gel extraction kit (Qiagen, Hilden, Germany). One microgram of the digested plasmid was used for each reaction using the MEGAscript T7 transcription kit (Invitrogen), where 1mΨ triphosphate (TriLink, San Diego, CA, USA) was used instead of the U triphosphate contained in the kit (or a mixture), where necessary. Capping was performed using 50 \u0026micro;g of RNA with ScriptCap Cap1 system reagent (CellScript, Madison, WI, USA). This procedure was the same for mRNAs but required polyA tailing, which was performed using a poly(A) tailing kit (Invitrogen). \u003cem\u003eIn vitro\u003c/em\u003e transcription of CVB3 replicons was performed following the same protocol, but omitting the capping reaction. CVB3 replicons were constructed on a pcDNA3.1 vector background, and linearized with \u003cem\u003eXha\u003c/em\u003e I (New England BioLabs) restriction enzyme prior to IVT. Plasmids encoding SFV replicons were linearized with \u003cem\u003eSpe\u003c/em\u003e I (New England BioLabs) restriction enzyme for IVT using the MEGAscript SP6 transcription kit (Invitrogen), following the procedure described above, as well as the capping step. The polyA tailing reaction was not necessary in this case because the polyA tail was encoded within the template plasmid and was thus generated during the IVT reaction.\u003c/p\u003e \u003cp\u003eTransfection of cells was performed with Lipofectamine2000 reagent (Invitrogen) at a ratio of 150 ng of RNA/\u0026micro;L of reagent.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of GOI expression from the replicons\u003c/h2\u003e \u003cp\u003eThe expression of the GFP-HiBiT reporter at the protein level was confirmed by fluorescence microscopy (Keyence BZ-X710, Osaka, Japan) and luminescence measurements (HiBiT, Promega, Madison, WI, USA) of lysates with the same total protein content. To confirm replication, quantitative real-time PCR was performed to detect viral and GOI RNAs. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Total RNA was extracted from the transfected cells using the RNeasy Plus kit (Qiagen) following the manufacturer\u0026rsquo;s instructions. Five hundred to 1000 ng of RNA was used for reverse transcription using random oligomers and the PrimeStar RT kit (Takara, Shiga, Japan). Where indicated, cDNA was prepared using virus-specific primers and SuperScript III first-strand synthesis system for RT-PCR (Invitrogen). Real-time PCR was performed using Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) in a QuantStudio1 thermal cycler (Applied Biosystems). Relative expression to the initial analyzed time point was calculated following the 2\u003csup\u003eΔΔCt\u003c/sup\u003e method, using hamster \u003cem\u003egapdh\u003c/em\u003e or human \u003cem\u003eGAPDH\u003c/em\u003e genes as internal controls for normalization. The details of the primers used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. For Western blot analysis of the RBD-TM-encoding SFV replicon, an anti-RBD Ab (40592-T62 SinoBiological, Wayne, PA, USA) was used and was detected with HRP-labeled anti-rabbit IgG Ab (Sigma-Aldrich AP307P). Human GAPDH was used as a protein-loading control and was detected using mouse anti-human GAPDH (Abcam ab8245, Cambridge, England) and anti-mouse IgG-HRP (Sigma-Aldrich).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in the current study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAssay\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRNA1_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGTGAGCGGCTTTGATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTNCL gRNA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"11\" rowspan=\"12\"\u003e \u003cp\u003eqPCR*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRNA1_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGTAAAAACCATTCCTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehGapdh_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTTCCAGGAGCGAGATCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHamster \u003cem\u003egapdh\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehGapdh_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTTGTCATGGTTCACACCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACATCGCTCAGACACCATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHuman \u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGACGGTGCCATGGAATTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGFP_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGTTCATCTGCACCACCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eGFP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGFP_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAAGATGGTGCGCTCCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSFV_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGCTGAAAGAACTGACGCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSemliki forest virus gRNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSFV_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGCCTGATCTTCAGCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRBD_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCCGACTACAATACAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSARS-CoV-2 \u003cem\u003espike\u003c/em\u003e mRNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRBD_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCGAAGGGCTTCAGATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRT_RNA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCGGTCATGGTGGCGAATAA\u003c/b\u003eAACCAACAATCGAAGAACGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eTNCL \u003cem\u003e(-)\u003c/em\u003e RNA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRT**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGTCATGGTGGCGAATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGFP_R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACTTCAGGGTCAGCTTGCCGTAGGTGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eSequence of the primers used for detection of the indicated target mRNAs or viral RNAs (gRNA) by real-time PCR\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e* qPCR: quantitative real-time PCR\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e** RT: reverse transcription\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImmuno-fluorescent staining\u003c/h2\u003e \u003cp\u003eTNCL or SFV replicons were transfected into BHK-21 cells, which had been pre-seeded onto glass slides and placed inside the wells of a 12-well plate. At 24 hpt, the glass slides were removed, washed with PBS, and fixed with a 4% paraformaldehyde solution for 15 min at room temperature. After washing again with PBS, the cells were permeabilized with 0.5% solution of Triton X-100 in PBS. Blocking with 0.5% BSA in PBS (for 30 min at room temperature) was performed before staining with anti-dsRNA antibody (Ab) (Millipore, Burlington, MA, USA). Detection was performed using an Alexa568-labeled anti-mouse IgM Ab (Abcam) and observed under a Keyence BZ-X710 fluorescence microscope. The same procedure was performed on HeLa cells transfected with CVB3 replicons.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eRNA immunoprecipitation (RIP)\u003c/h2\u003e \u003cp\u003eBHK-21 cells were transfected with HA-tagged \u003cem\u003eIRES-PA\u003c/em\u003e mRNA and defective TNCL replicons \u003cem\u003ein vitro\u003c/em\u003e-transcribed with either U or 1mΨ. Lysates were collected at 48 hpt and RIP was performed using the Magna RIP RNA-binding protein immunoprecipitation kit (Millipore) with an anti-HA tag Ab (Thermo Fisher Scientific, cat# 26183) or mouse isotype control IgG (Invitrogen cat# 02-6100), following the manufacturer\u0026rsquo;s instructions. Ten percent of the raw lysate was processed in parallel with the precipitated samples for RNA extraction using TriReagent (Molecular Research Center), and the RNA pellet was dissolved in 20 \u0026micro;L of water. The precipitated RNA (2 \u0026micro;L) was used for cDNA synthesis using a SuperScript III reverse transcription kit (Invitrogen) with random hexamers. A standard curve was constructed using the RNA of the raw lysates (input), and the amount of precipitated RNA was expressed as \u0026ldquo;percentage of input.\u0026rdquo; TNCL viral RNA1 in the precipitated RNA was detected by RT-qPCR using the primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFormulation of SFV replicons for\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e \u003cb\u003eexperiments\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eIn vitro\u003c/em\u003e-transcribed SFV replicons containing the SARS-CoV-2 spike RBD-TM coding sequence were encapsulated in lipid nanoparticles, prepared with: ssPalmE-P4C2 (NOF Co, Tokyo, Japan), 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylen glycol 2000 (NOF Co.), 1,2-dioleolyl-sn-glycero-3-phosphoetyanoamine (DOPE) (Avanti Polar lipids Inc., Alabama, USA), and cholesterol (Sigma-Aldrich), as previously described\u003csup\u003e55\u003c/sup\u003e and using a microfluidics device, kindly provided by Manabu Tokeshi and Masatoshi Maeki of Hokkaido University.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immune-sorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003ePlates were coated with recombinant RBD peptide dissolved in PBS (1 \u0026micro;ug/mL, 100 \u0026micro;L/well, 96-well plates), and were incubated at 4 ˚C overnight. Wells were washed three times using 0.05% Tween20 in PBS, and blocking was performed with a solution of 1% BSA (Sigma-Aldrich) in PBS at room temperature for 2 h. After another washing step, aliquots of serially diluted serum from immunized mice were added to the coated plates and incubated at room temperature for 2 h. The dilution buffer consisted of PBS with 1% BSA and 0.05% Tween20. Goat horseradish peroxidase-labeled anti-mouse Ab (Sigma-Aldrich) was used to detect RBD-specific antibodies together with the BioFix TMB One component HRP microwell substrate (Surmodics, MN, USA). A solution of 0.5 N HCl was used to stop the reaction, and the optical density was measured at 450 nm using an SH-9000 microplate reader (Corona Electric, Ibaraki, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using GraphPad Prism version 9.4.1 (Graphpad Software LLC). Figures were generated using the same software. The details of each analysis are provided in the corresponding figure legends.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eEthics statement\u003c/h2\u003e \u003cp\u003eAll methods were carried out in accordance of relevant guidelines or regulations.\u003c/p\u003e \u003cp\u003e\u003ch2\u003eCompeting Interests\u003c/h2\u003e\u003cp\u003eP.M., T.N., F.O., T.S., Y.F., R.S., and H.E. are employed by BIKEN. H.E. holds a managerial position at BIKEN.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eP.M. designed and performed the experiments, analyzed the data, and wrote the manuscript. T.N., F.O., T.S., Y.F., and R.S. performed the experiments and analyzed the data. H.E. conceived and designed the study, supervised the project and reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors thank Hidetaka Akita, Hiroki Tanaka, and Ryotaro Oyama of Tohoku University (Japan) for their advice and helpful feedback on the generation of RNA/LNP complexes for in vivo delivery; Manabu Tokeshi and Masatoshi Maeki of Hokkaido University (Japan) for kindly providing the microfluidic device used in the generation of the nanoparticles; Sayuri Komatsu (BIKEN) for technical assistance with plasmid construction; and Mitsuyo Kosaka (BIKEN) and Masako Inanaka (Osaka University) for administrative support.This work was conducted as part of \u0026ldquo;The Research Foundation for Microbial Diseases of Osaka University Project for Infectious Disease Prevention\u0026rdquo;.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eComes, J. D. G., Pijlman, G. P. \u0026amp; Hick, T. A. H. Rise of the RNA machines - self-amplification in mRNA vaccine design. Trends Biotechnol 41, 1417\u0026ndash;1429, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tibtech.2023.05.007\u003c/span\u003e\u003cspan address=\"10.1016/j.tibtech.2023.05.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiong, C. \u003cem\u003eet al.\u003c/em\u003e Sindbis virus: an efficient, broad host range vector for gene expression in animal cells. Science 243, 1188\u0026ndash;1191, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.2922607\u003c/span\u003e\u003cspan address=\"10.1126/science.2922607\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1989).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, X. \u003cem\u003eet al.\u003c/em\u003e Self-replicating Semliki Forest virus RNA as recombinant vaccine. Vaccine 12, 1510\u0026ndash;1514, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0264-410x(94)90074-4\u003c/span\u003e\u003cspan address=\"10.1016/0264-410x(94)90074-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1994).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePushko, P. \u003cem\u003eet al.\u003c/em\u003e Replicon-helper systems from attenuated Venezuelan equine encephalitis virus: expression of heterologous genes in vitro and immunization against heterologous pathogens in vivo. Virology 239, 389\u0026ndash;401, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/viro.1997.8878\u003c/span\u003e\u003cspan address=\"10.1006/viro.1997.8878\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogel, A. B. \u003cem\u003eet al.\u003c/em\u003e Self-Amplifying RNA Vaccines Give Equivalent Protection against Influenza to mRNA Vaccines but at Much Lower Doses. Mol Ther 26, 446\u0026ndash;455, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ymthe.2017.11.017\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2017.11.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLundstrom, K. Self-Replicating RNA Viruses for Vaccine Development against Infectious Diseases and Cancer. Vaccines (Basel) 9, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/vaccines9101187\u003c/span\u003e\u003cspan address=\"10.3390/vaccines9101187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLundstrom, K. Self-replicating vehicles based on negative strand RNA viruses. Cancer Gene Ther 30, 771\u0026ndash;784, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41417-022-00436-7\u003c/span\u003e\u003cspan address=\"10.1038/s41417-022-00436-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLundstrom, K. Self-Amplifying RNA Viruses as RNA Vaccines. Int J Mol Sci 21, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21145130\u003c/span\u003e\u003cspan address=\"10.3390/ijms21145130\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlakney, A. K., Ip, S. \u0026amp; Geall, A. J. An Update on Self-Amplifying mRNA Vaccine Development. Vaccines (Basel) 9, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/vaccines9020097\u003c/span\u003e\u003cspan address=\"10.3390/vaccines9020097\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAkahata, W. \u003cem\u003eet al.\u003c/em\u003e Safety and immunogenicity of SARS-CoV-2 self-amplifying RNA vaccine expressing an anchored RBD: A randomized, observer-blind phase 1 study. Cell Rep Med 4, 101134, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.xcrm.2023.101134\u003c/span\u003e\u003cspan address=\"10.1016/j.xcrm.2023.101134\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAliahmad, P., Miyake-Stoner, S. J., Geall, A. J. \u0026amp; Wang, N. S. Next generation self-replicating RNA vectors for vaccines and immunotherapies. Cancer Gene Ther 30, 785\u0026ndash;793, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41417-022-00435-8\u003c/span\u003e\u003cspan address=\"10.1038/s41417-022-00435-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSahul Hameed, A. S. \u003cem\u003eet al.\u003c/em\u003e ICTV Virus Taxonomy Profile: Nodaviridae. J Gen Virol 100, 3\u0026ndash;4, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1099/jgv.0.001170\u003c/span\u003e\u003cspan address=\"10.1099/jgv.0.001170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurphy, F. A., Scherer, W. F., Harrison, A. K., Dunne, H. W. \u0026amp; Gary, G. W., Jr. Characterization of Nodamura virus, an arthropod transmissible picornavirus. Virology 40, 1008\u0026ndash;1021, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0042-6822(70)90147-9\u003c/span\u003e\u003cspan address=\"10.1016/0042-6822(70)90147-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1970).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBall, L. A., Amann, J. M. \u0026amp; Garrett, B. K. Replication of nodamura virus after transfection of viral RNA into mammalian cells in culture. J Virol 66, 2326\u0026ndash;2334, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.66.4.2326-2334.1992\u003c/span\u003e\u003cspan address=\"10.1128/JVI.66.4.2326-2334.1992\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1992).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelling, B. H., Allison, R. F. \u0026amp; Kaesberg, P. Genomic RNA of an insect virus directs synthesis of infectious virions in plants. Proc Natl Acad Sci U S A 87, 434\u0026ndash;438, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.87.1.434\u003c/span\u003e\u003cspan address=\"10.1073/pnas.87.1.434\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1990).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrice, B. D., Rueckert, R. R. \u0026amp; Ahlquist, P. Complete replication of an animal virus and maintenance of expression vectors derived from it in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 93, 9465\u0026ndash;9470, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.93.18.9465\u003c/span\u003e\u003cspan address=\"10.1073/pnas.93.18.9465\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVenter, P. A. \u0026amp; Schneemann, A. Recent insights into the biology and biomedical applications of Flock House virus. Cell Mol Life Sci 65, 2675\u0026ndash;2687, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00018-008-8037-y\u003c/span\u003e\u003cspan address=\"10.1007/s00018-008-8037-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorais, P., Adachi, H. \u0026amp; Yu, Y. T. The Critical Contribution of Pseudouridine to mRNA COVID-19 Vaccines. Front Cell Dev Biol 9, 789427, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcell.2021.789427\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2021.789427\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNance, K. D. \u0026amp; Meier, J. L. Modifications in an Emergency: The Role of N1-Methylpseudouridine in COVID-19 Vaccines. ACS Cent Sci 7, 748\u0026ndash;756, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acscentsci.1c00197\u003c/span\u003e\u003cspan address=\"10.1021/acscentsci.1c00197\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCharette, M. \u0026amp; Gray, M. W. Pseudouridine in RNA: what, where, how, and why. IUBMB Life 49, 341\u0026ndash;351, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/152165400410182\u003c/span\u003e\u003cspan address=\"10.1080/152165400410182\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodell, R., Robalin, N. \u0026amp; Martinez, N. M. Why U matters: detection and functions of pseudouridine modifications in mRNAs. Trends Biochem Sci 49, 12\u0026ndash;27, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tibs.2023.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.tibs.2023.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKariko, K., Buckstein, M., Ni, H. \u0026amp; Weissman, D. Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA. Immunity 23, 165\u0026ndash;175, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2005.06.008\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2005.06.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKariko, K. \u003cem\u003eet al.\u003c/em\u003e Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol Ther 16, 1833\u0026ndash;1840, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/mt.2008.200\u003c/span\u003e\u003cspan address=\"10.1038/mt.2008.200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilson, A. C. \u0026amp; Mohr, I. Control of animal virus replication by RNA adenosine methylation. Adv Virus Res 112, 87\u0026ndash;114, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/bs.aivir.2022.01.002\u003c/span\u003e\u003cspan address=\"10.1016/bs.aivir.2022.01.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Y. \u0026amp; Zhou, X. N(6)-methyladenosine and Its Implications in Viruses. Genomics Proteomics Bioinformatics 21, 695\u0026ndash;706, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.gpb.2022.04.009\u003c/span\u003e\u003cspan address=\"10.1016/j.gpb.2022.04.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, G. W. \u0026amp; Siddiqui, A. Hepatitis B Virus X Protein Expression Is Tightly Regulated by N6-Methyladenosine Modification of Its mRNA. J Virol 96, e0165521, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.01655-21\u003c/span\u003e\u003cspan address=\"10.1128/JVI.01655-21\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKennedy, E. M. \u003cem\u003eet al.\u003c/em\u003e Posttranscriptional m(6)A Editing of HIV-1 mRNAs Enhances Viral Gene Expression. Cell Host Microbe 19, 675\u0026ndash;685, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.chom.2016.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.chom.2016.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLichinchi, G. \u003cem\u003eet al.\u003c/em\u003e Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol 1, 16011, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nmicrobiol.2016.11\u003c/span\u003e\u003cspan address=\"10.1038/nmicrobiol.2016.11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCourtney, D. G. \u003cem\u003eet al.\u003c/em\u003e Epitranscriptomic Addition of m(5)C to HIV-1 Transcripts Regulates Viral Gene Expression. \u003cem\u003eCell Host Microbe\u003c/em\u003e 26, 217\u0026ndash;227 e216, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.chom.2019.07.005\u003c/span\u003e\u003cspan address=\"10.1016/j.chom.2019.07.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, T. C., Scotti, P. D., Miyamura, T. \u0026amp; Takeda, N. Latent infection of a new alphanodavirus in an insect cell line. J Virol 81, 10890\u0026ndash;10896, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.00807-07\u003c/span\u003e\u003cspan address=\"10.1128/JVI.00807-07\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEckerle, L. D., Albarino, C. G. \u0026amp; Ball, L. A. Flock House virus subgenomic RNA3 is replicated and its replication correlates with transactivation of RNA2. \u003cem\u003eVirology\u003c/em\u003e 317, 95\u0026ndash;108, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.virol.2003.08.029\u003c/span\u003e\u003cspan address=\"10.1016/j.virol.2003.08.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallagher, T. M., Friesen, P. D. \u0026amp; Rueckert, R. R. Autonomous replication and expression of RNA 1 from black beetle virus. J Virol 46, 481\u0026ndash;489, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.46.2.481-489.1983\u003c/span\u003e\u003cspan address=\"10.1128/JVI.46.2.481-489.1983\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1983).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMauger, D. M. \u003cem\u003eet al.\u003c/em\u003e mRNA structure regulates protein expression through changes in functional half-life. Proc Natl Acad Sci U S A 116, 24075\u0026ndash;24083, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1908052116\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1908052116\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParr, C. J. C. \u003cem\u003eet al.\u003c/em\u003e N 1-Methylpseudouridine substitution enhances the performance of synthetic mRNA switches in cells. Nucleic Acids Res 48, e35, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkaa070\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkaa070\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, J. Y. \u003cem\u003eet al.\u003c/em\u003e Viral and host proteins involved in picornavirus life cycle. J Biomed Sci 16, 103, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1423-0127-16-103\u003c/span\u003e\u003cspan address=\"10.1186/1423-0127-16-103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBailey, J. M. \u0026amp; Tapprich, W. E. Structure of the 5' nontranslated region of the coxsackievirus b3 genome: Chemical modification and comparative sequence analysis. J Virol 81, 650\u0026ndash;668, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JVI.01327-06\u003c/span\u003e\u003cspan address=\"10.1128/JVI.01327-06\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThess, A. \u003cem\u003eet al.\u003c/em\u003e Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals. Mol Ther 23, 1456\u0026ndash;1464, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/mt.2015.103\u003c/span\u003e\u003cspan address=\"10.1038/mt.2015.103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWesselhoeft, R. A. \u003cem\u003eet al.\u003c/em\u003e RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo. \u003cem\u003eMol Cell\u003c/em\u003e 74, 508\u0026ndash;520 e504, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molcel.2019.02.015\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2019.02.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKameda, S., Ohno, H. \u0026amp; Saito, H. Synthetic circular RNA switches and circuits that control protein expression in mammalian cells. Nucleic Acids Res 51, e24, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkac1252\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkac1252\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePietila, M. K., Hellstrom, K. \u0026amp; Ahola, T. Alphavirus polymerase and RNA replication. Virus Res 234, 44\u0026ndash;57, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.virusres.2017.01.007\u003c/span\u003e\u003cspan address=\"10.1016/j.virusres.2017.01.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWesthof, E. Pseudouridines or how to draw on weak energy differences. Biochem Biophys Res Commun 520, 702\u0026ndash;704, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2019.10.009\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2019.10.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSvitkin, Y. V. \u003cem\u003eet al.\u003c/em\u003e N1-methyl-pseudouridine in mRNA enhances translation through eIF2alpha-dependent and independent mechanisms by increasing ribosome density. Nucleic Acids Res 45, 6023\u0026ndash;6036, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkx135\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkx135\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMulroney, T. E. \u003cem\u003eet al.\u003c/em\u003e N(1)-methylpseudouridylation of mRNA causes\u0026thinsp;+\u0026thinsp;1 ribosomal frameshifting. Nature 625, 189\u0026ndash;194, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-023-06800-3\u003c/span\u003e\u003cspan address=\"10.1038/s41586-023-06800-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlakney, A. K. \u003cem\u003eet al.\u003c/em\u003e Innate Inhibiting Proteins Enhance Expression and Immunogenicity of Self-Amplifying RNA. Mol Ther 29, 1174\u0026ndash;1185, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ymthe.2020.11.011\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2020.11.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerkovic, M. \u003cem\u003eet al.\u003c/em\u003e A trans-amplifying RNA simplified to essential elements is highly replicative and robustly immunogenic in mice. Mol Ther 31, 1636\u0026ndash;1646, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ymthe.2023.01.019\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2023.01.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshida, A. \u003cem\u003eet al.\u003c/em\u003e Versatile live-attenuated SARS-CoV-2 vaccine platform applicable to variants induces protective immunity. iScience 25, 105412, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.isci.2022.105412\u003c/span\u003e\u003cspan address=\"10.1016/j.isci.2022.105412\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYeh, M. T. \u003cem\u003eet al.\u003c/em\u003e Genetic stabilization of attenuated oral vaccines against poliovirus types 1 and 3. Nature 619, 135\u0026ndash;142, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-023-06212-3\u003c/span\u003e\u003cspan address=\"10.1038/s41586-023-06212-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomori, M. \u003cem\u003eet al.\u003c/em\u003e Incorporation of 5 methylcytidine alleviates innate immune response to self-amplifying RNA vaccine. bioRxiv, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2023.11.01.565056\u003c/span\u003e\u003cspan address=\"10.1101/2023.11.01.565056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAboshi, M. \u003cem\u003eet al.\u003c/em\u003e Safety and immunogenicity of VLPCOV-02, a SARS-CoV-2 self-amplifying RNA vaccine with a modified base, 5-methylcytosine. iScience 27, 108964, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.isci.2024.108964\u003c/span\u003e\u003cspan address=\"10.1016/j.isci.2024.108964\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHerold, J. \u0026amp; Andino, R. Poliovirus requires a precise 5' end for efficient positive-strand RNA synthesis. J Virol 74, 6394\u0026ndash;6400, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jvi.74.14.6394-6400.2000\u003c/span\u003e\u003cspan address=\"10.1128/jvi.74.14.6394-6400.2000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVignuzzi, M., Gerbaud, S., van der Werf, S. \u0026amp; Escriou, N. Expression of a membrane-anchored glycoprotein, the influenza virus hemagglutinin, by dicistronic replicons derived from the poliovirus genome. J Virol 76, 5285\u0026ndash;5290, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jvi.76.10.5285-5290.2002\u003c/span\u003e\u003cspan address=\"10.1128/jvi.76.10.5285-5290.2002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeyer, R. G. \u003cem\u003eet al.\u003c/em\u003e Plasmid-based generation of recombinant coxsackievirus B3 particles carrying capsid gene replacement replicons. Virus Res 104, 17\u0026ndash;26, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.virusres.2004.02.037\u003c/span\u003e\u003cspan address=\"10.1016/j.virusres.2004.02.037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuirin, T., Chen, Y., Pietila, M. K., Guo, D. \u0026amp; Ahola, T. The RNA Capping Enzyme Domain in Protein A is Essential for Flock House Virus Replication. \u003cem\u003eViruses\u003c/em\u003e 10, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v10090483\u003c/span\u003e\u003cspan address=\"10.3390/v10090483\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiljestrom, P. \u0026amp; Garoff, H. A New Generation of Animal-Cell Expression Vectors Based on the Semliki Forest Virus Replicon. Bio-Technol 9, 1356\u0026ndash;1361, doi:DOI \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nbt1291-1356\u003c/span\u003e\u003cspan address=\"10.1038/nbt1291-1356\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1991).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOyama, R. \u003cem\u003eet al.\u003c/em\u003e An Ionizable Lipid Material with a Vitamin E Scaffold as an mRNA Vaccine Platform for Efficient Cytotoxic T Cell Responses. ACS Nano 17, 18758\u0026ndash;18774, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acsnano.3c02251\u003c/span\u003e\u003cspan address=\"10.1021/acsnano.3c02251\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLorenz, R. \u003cem\u003eet al.\u003c/em\u003e ViennaRNA Package 2.0. Algorithms Mol Biol 6, 26, doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1748-7188-6-26\u003c/span\u003e\u003cspan address=\"10.1186/1748-7188-6-26\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Modified nucleosides, viral replication, Nodavirus, N1-methyl-pseudouridine, replicons","lastPublishedDoi":"10.21203/rs.3.rs-4429063/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4429063/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSelf-amplifying RNAs (saRNAs) are versatile vaccine platforms that take advantage of a viral RNA-dependent RNA polymerase (RdRp) to amplify the mRNA of an antigen of interest encoded within the backbone of the viral genome once inside the target cell. In recent years, more saRNA vaccines have been clinically tested with the hope of reducing the vaccination dose compared to the conventional mRNA approach. The use of N1-methyl-pseudouridine (1mY), which enhances RNA stability and reduces the innate immune response triggered by RNAs, is among the improvements included in the current mRNA vaccines. In the present study, we evaluated the effects of this modified nucleoside on various saRNA platforms based on different viruses. The results showed that different stages of the replication process were affected depending on the backbone virus. For TNCL, an insect virus of the \u003cem\u003eAlphanodavirus\u003c/em\u003e genus, replication was impaired by poor recognition of viral RNA by RdRp. In contrast, the translation step was severely abrogated in coxsackievirus B3 (CVB3), a member of the \u003cem\u003ePicornaviridae\u003c/em\u003e family. Finally, the effects of 1mΨ on Semliki forest virus (SFV), were not detrimental in \u003cem\u003ein vitro\u003c/em\u003e studies, but no advantages were observed when immunogenicity was tested \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"1mΨ influences the performance of various positive-stranded RNA virus-based replicons","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-03 13:41:25","doi":"10.21203/rs.3.rs-4429063/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-06-07T07:30:29+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-06T23:37:49+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-30T09:38:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"58317462652573944553503141645000459780","date":"2024-05-24T12:26:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8885135006868989704618604652362267078","date":"2024-05-24T11:12:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-24T10:53:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-24T10:43:23+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-05-21T15:12:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-21T15:00:47+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-05-16T07:01:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"61494381-b182-4be4-8716-4bf278b675ab","owner":[],"postedDate":"June 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":32600002,"name":"Biological sciences/Microbiology/Vaccines"},{"id":32600003,"name":"Biological sciences/Microbiology/Virology"}],"tags":[],"updatedAt":"2024-08-05T16:04:46+00:00","versionOfRecord":{"articleIdentity":"rs-4429063","link":"https://doi.org/10.1038/s41598-024-68617-y","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-07-31 15:57:50","publishedOnDateReadable":"July 31st, 2024"},"versionCreatedAt":"2024-06-03 13:41:25","video":"","vorDoi":"10.1038/s41598-024-68617-y","vorDoiUrl":"https://doi.org/10.1038/s41598-024-68617-y","workflowStages":[]},"version":"v1","identity":"rs-4429063","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4429063","identity":"rs-4429063","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}