Strigolactone and salicylic acid simultaneously enhance the resilience of common bean against salt stress by strengthening the antioxidant defense system

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Salinity is a major abiotic stress that greatly reduces crop yields worldwide. The common bean is especially vulnerable to damage from salinity. In this study, we examined the physiological and molecular responses of salt-stressed common bean plants to foliar applications of salicylic acid (SA) and the synthetic strigolactone analogue GR24. Salt stress increased electrolyte leakage and proline levels while decreasing relative water content, total protein, and photosynthetic pigments. Applying either SA or GR24 alone improved tolerance, but using both together provided even greater protection, mainly by reducing electrolyte leakage. Both treatments boosted antioxidant enzyme activities, such as ascorbate peroxidase, superoxide dismutase, and catalase, by promoting protein synthesis or preventing degradation. The combined use of SA and GR24 partially restored photosynthetic pigment levels under salinity. The expression of SOD, CAT, APX, and GPX genes was upregulated in plants treated with both SA and GR24 under salt stress, emphasizing the role of these enzymes in maintaining redox balance and stress tolerance. Overall, SA and GR24 (1 mM SA + 10 µM GR24) worked together to enhance bio-physiological and metabolic functions under salinity, offering a promising strategy to support plant recovery.
Full text 129,862 characters · extracted from preprint-html · click to expand
Strigolactone and salicylic acid simultaneously enhance the resilience of common bean against salt stress by strengthening the antioxidant defense system | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Strigolactone and salicylic acid simultaneously enhance the resilience of common bean against salt stress by strengthening the antioxidant defense system Masoumeh Asadi-Aghbolaghi, Manijeh Sabokdast, Ghasem Parmoon, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7284816/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 17 You are reading this latest preprint version Abstract Salinity is a major abiotic stress that greatly reduces crop yields worldwide. The common bean is especially vulnerable to damage from salinity. In this study, we examined the physiological and molecular responses of salt-stressed common bean plants to foliar applications of salicylic acid (SA) and the synthetic strigolactone analogue GR24. Salt stress increased electrolyte leakage and proline levels while decreasing relative water content, total protein, and photosynthetic pigments. Applying either SA or GR24 alone improved tolerance, but using both together provided even greater protection, mainly by reducing electrolyte leakage. Both treatments boosted antioxidant enzyme activities, such as ascorbate peroxidase, superoxide dismutase, and catalase, by promoting protein synthesis or preventing degradation. The combined use of SA and GR24 partially restored photosynthetic pigment levels under salinity. The expression of SOD, CAT, APX, and GPX genes was upregulated in plants treated with both SA and GR24 under salt stress, emphasizing the role of these enzymes in maintaining redox balance and stress tolerance. Overall, SA and GR24 (1 mM SA + 10 µM GR24) worked together to enhance bio-physiological and metabolic functions under salinity, offering a promising strategy to support plant recovery. Phaseolus vulgaris L Salt Abiotic stress salicylic acid Strigolactone Antioxidant system Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 1. Introduction Abiotic stresses, especially salinity, continue to pose a major challenge for crop production, particularly in semi-arid and arid regions [ 1 ]. Salinity currently impacts about 800 million acres of arable land [ 2 ], with projections suggesting a potential 50% increase by 2050 [ 3 ]. In glycophytic species like the common bean, salinity causes osmotic stress, ionic imbalance, and secondary oxidative and nutritional disturbances [ 4 ]. The common bean ( Phaseolus vulgaris L.), an important dietary source of protein, carbohydrates, micronutrients, and vitamins [ 5 ], experiences significant yield reductions even at low salinity levels (below 2 dS·m − 1 ) [ 6 ], affecting biomass, yield components, and root growth [ 7 ]. Limited nitrate uptake due to salinity also decreases grain protein concentration, a key quality trait in legumes [ 8 ]. Plant responses to salt stress involve complex regulatory mechanisms that include various physiological responses under unfavorable conditions [ 9 ]. Plants use intricate regulatory networks to adapt to salinity, with phytohormones controlling key processes like osmolyte buildup, stomatal regulation, root growth, and water balance [ 10 ]. Salicylic acid (SA), produced in chloroplasts during stress [ 11 ], manages antioxidant systems, osmoprotectant production, nitrogen metabolism, and photosynthesis [ 12 ]. Applying SA externally has been shown to boost growth and yield in several crops under stress by increasing enzymatic antioxidant activity and maintaining redox balance [ 13 – 18 ]. Strigolactones (SLs) are involved in various plant processes, including plant architecture, adventitious root formation, leaf senescence, nutrient uptake, and reproductive maturity [ 19 ]. Additionally, SLs accumulate in plant tissues under abiotic stress and interact with other hormones to regulate processes that help plants adapt to harsh conditions [ 20 ]. Several studies have shown that plants modify strigolactone levels differently in response to various abiotic stresses [ 21 ]. Abiotic stresses such as salinity and drought can decrease strigolactone production in some plants [ 22 , 23 ]. Stomatal closure, which is the plant's initial response to drought, has been reported to be influenced by strigolactone in Arabidopsis [ 24 ]. In this context, applying strigolactone externally to Vicia faba causes stomatal closure depending on the concentration [ 25 ]. Additionally, SLs promote flavonoid production, which serves as an osmoprotectant during plant adaptation to abiotic stress [ 26 ]. It is also notable that SL signaling is linked to reactive oxygen species (ROS) responses in plants. One study found that treating rice with strigolactone increased antioxidant enzyme activity and decreased malondialdehyde, a key factor in plant tolerance to salt stress [ 21 ]. The analogs GR5, GR7, and GR24 are recognized as strigolactone mimics, with GR24, a synthetic SL, showing the highest activity [ 21 ]. Various studies have illustrated that SA regulates plant response to abiotic stress. Still, little information exists about the single and combined effects of SL and SA on plant adaptation to stress. Moreover, the synergistic effect of SA and GR 24 , achieved through simultaneous treatment of common beans with salt, has not been reported. Therefore, we aimed to profoundly determine the impact of exogenous treatment of SA and GR 24 on salt-tolerant and susceptible common beans. Our findings provide novel insights into the SA + GR24-induced influences on physiological, molecular, and metabolic processes, aiming to improve tolerance in common beans against salt-induced oxidative stress. Additionally, this finding suggests the potential for manipulating the SA and GR 24 signaling pathways to enhance salt tolerance in common bean plants. 2. Materials and methods Plant material and experimental design The common bean belongs to the legume family Fabaceae , with a global annual production of about 28 million tons. According to FAOSTAT data from 2022 [ 27 ], approximately 400 million people in the tropics consume beans daily. Two Phaseolus vulgaris L. cultivars, ‘Jules’ (tolerant) and ‘Naz’ (sensitive), were obtained from the University of Tehran, Iran [ 28 ]. Seeds were surface-sterilized in 70% ethanol for 3 minutes, rinsed, and sown in 5 kg pots filled with sandy loam soil (3% clay, 13% silt, 84% sand). Seven seeds per pot were thinned to five seedlings after emergence. At the 8-leaf stage, plants were subjected to 200 mM NaCl for three weeks; controls received distilled water. In the second week of stress, foliar sprays of SA (0 or 1 mM) and GR24 (0 or 10 µM) were applied. Controls were sprayed with distilled water [ 29 ]. A factorial, completely randomized design with three replicates was used in growth chambers (16 hours of light / 8 hours of dark, 25 ± 1°C). At the 8-leaf stage, plants were subjected to 200 mM NaCl for three weeks; controls received distilled water. In the second week of stress, foliar sprays of SA (0 or 1 mM) and GR24 (0 or 10 µM) were applied. Controls were sprayed with distilled water [ 29 ]. A factorial, completely randomized design with three replicates was used in growth chambers (16 h light / 8 h dark, 25 ± 1°C). Physiological and biochemical parameters Relative water content (RWC) Leaf relative water content was measured by using the methodology described by Tayyab et al. [ 29 ]. RWC was computed using the following equation: RWC (%) = (fresh weight-dry weight)/ (turgid weight-dry weight) × 100 Electrolyte leakage and Malondialdehyde Electrolyte leakage was determined by weighing 0.3 g of leaf tissue, rinsing it with sterile water, and placing it into tubes containing 10 mL of sterile water. Samples were held at 25°C for 2 h, after which the initial electrical conductivity (EC1) was recorded. The same tubes were then autoclaved for 10 min at 95°C, cooled to 25°C, and the final conductivity (EC2) was measured. EL was calculated as: EL (%) = (EC1/EC2) × 100. MDA content, used as an indicator of lipid peroxidation, was quantified following Hodges et al. [ 31 ] with minor adaptations. In brief, 0.2 g of powdered leaf material was homogenized in 5% trichloroacetic acid (TCA) and centrifuged at 3000 g for 10 min. The supernatant was combined with 0.5% thiobarbituric acid in 20% TCA, incubated in a boiling water bath for 30 min, cooled on ice for 5 min, and centrifuged again at 3000 g for 10 min. Absorbance was recorded at 532 nm and 600 nm, and MDA concentration (µmol mg⁻¹ FW) was determined using an extinction coefficient of 155 mM⁻¹ cm⁻¹. H 2 O 2 content H₂O₂ levels were measured as outlined by Velikova et al. [ 32 ]. Finely ground leaves (0.5 g) were homogenized in 0.1% TCA and centrifuged at 12,000 g for 10 min. From the resulting supernatant, 0.5 mL was mixed with 0.5 mL of 10 mM phosphate buffer (pH 7) and 1 mL of 1 M potassium iodide. Absorbance was measured at 390 nm to estimate H₂O₂ concentration. Proline content Proline content was measured following Bates et al. [ 33 ]. For this, 0.5 g of leaf powder was extracted with 5 mL of 3% sulfosalicylic acid and centrifuged at 15,000 g for 20 minutes. Two mL of supernatant was reacted with 2 mL of acid ninhydrin solution (prepared by dissolving 1.25 g of acid ninhydrin in 30 mL of glacial acetic acid plus 20 mL of 6 M orthophosphoric acid) and 2 mL of glacial acetic acid. The mixture was incubated for 1 hour in a boiling water bath, then quickly cooled and extracted with 4 mL of toluene by inversion for 20 minutes. Absorbance was measured at 520 nm, and proline concentration was expressed as nmol per gram of fresh weight (nmol g⁻¹ FW) using a standard curve for L-proline. Carotenoid and chlorophyll contents Pigments were extracted following the method of Arnon [ 34 ]. Approximately 0.1 g of leaf tissue was ground in 3 mL of 80% acetone, and the extract was clarified by centrifugation at 5000 × g for 10 min. Absorbance readings were taken at 663, 645, 480, and 510 nm with a Shimadzu UV-160 spectrophotometer, and pigment concentrations were calculated using the respective equations. Total protein content Total soluble protein content was determined using the Bradford assay [ 35 ]. Leaves were ground in liquid nitrogen, suspended in 50 mM Na-phosphate buffer (pH 7.6), and centrifuged at 12,000 g for 20 minutes at 4°C. Protein concentration in the supernatant was measured at 595 nm with a spectrophotometer. Remaining supernatants were stored at − 80°C for later enzyme activity assays. Antioxidant enzyme activities Superoxide dismutase (SOD) activity was measured following Dhindsa et al. [ 36 ], where one unit equals the amount of enzyme needed to inhibit 50% of nitroblue tetrazolium (NBT) reduction at 25°C. Reaction mixtures contained 50 mM Na-phosphate buffer (pH 7.6), 13 mM methionine, 75 µM NBT, 0.1 mM EDTA, 0–50 µL enzyme extract, and 2 µM riboflavin. They were illuminated for 15 minutes with a 40 W fluorescent lamp before measuring absorbance at 560 nm. Catalase (CAT) activity, which is defined by the breakdown of H₂O₂ into water and oxygen, was determined as described by Aebi [ 37 ]. Ascorbate peroxidase (APX) activity was measured following Amako et al. [ 38 ] by mixing enzyme extract with 50 mM potassium phosphate buffer (pH 7.6), 0.5 mM ascorbate, and 0.1 M EDTA, then recording absorbance at 290 nm. Glutathione peroxidase (GPX) activity was assessed according to Resende [ 39 ], using pyrogallol (20 mM) and H₂O₂ (20 mM) as substrates, with absorbance read at 420 nm. Gene expression analysis Total RNA was isolated from standard bean samples using the GeneAll Ribospin kit (BioFrontier, Korea). First-strand cDNA synthesis was carried out using the RevertAid™ First Strand cDNA Synthesis Kit (Fermentas, USA). Gene-specific primers (Table 1 ) were designed with PrimerQuest software based on known cDNA sequences. Actin served as the internal reference gene. Quantitative RT-PCR was conducted on a Step One Plus system (ABI, USA) using a HIFI SYBR Green kit. The thermal cycling protocol comprised an initial denaturation at 95°C for 180 s, followed by 35 cycles of 95°C for 10 s, 59°C for 10 s, and 72°C for 30 s. Table 1 Primer sequences used for antioxidant gene expression analysis in common beans under salt stress. Gene name Sequence 5'→ 3' Amplicon Size (bp) Tm (°C) SOD-F GGGTGACCTGGGAAACATAG 140 62 SOD-R TCTTCCACCAGCATTTCCAG 62 CAT-F ACCAAACTATCTGCAACTTCC 135 61 CAT-R TTCCAGAGCAGATAGCAGG 61 GPX-F TCGCTTTAAATCTGAATTTCCC 150 60 GPX-R TAATAGCGATCTACCACTTGC 60 APX-F TTGGAGCGGCACACAAGG 150 61 APX-R GGGCGGAATACAGGGTCAG 62 Actin-F TGGCCGTACAACTGGTATTG 163 61 Actin-R GCTCTGCAGATGTGGTGAAA 61 Data analysis All data were analyzed using SAS v.9.4, and mean comparisons were performed with the least significant difference (LSD) test at a 5% significance level. Primer Quest (IDT) was used for primer design, and the relative expression levels of the target genes compared to the reference control genes were analyzed using REST software [ 40 ]. All analyses, including Pearson correlation analysis, principal component analysis (PCA), and heat map creation, were conducted with Origin Pro version 2022. 3. Results 3.1 Relative water content The relative water content (RWC) of leaves decreased in stressed plants compared to controls (Fig. 1 A). However, the exogenous application of salicylic acid (SA) and GR24 increased RWC, regardless of the salt conditions. Notably, the combination of 1 mM SA and 10 µM GR24 produced the highest increase in RWC under both normal and salt-stressed conditions (Fig. 1 B). 3.2 Electrolyte leakage and lipid peroxidation The EL of leaves was found to result from stress-induced damage to the plasma membrane. Under stress, EL increased by 100% in stressed plants compared to the control (Fig. 2 A). Notably, SA and GR 24 mitigated this adverse effect. The protective impact of SA and GR 24 was most pronounced under stress, as evidenced by the reduction in EL in treated plants compared to untreated ones. Exogenously applied SA and GR 24 inhibited EL in both genotypes under salt stress, with a significantly more significant reduction when used in combination (Fig. 2 B). The 1 mM SA and 10 µM GR 24 concentrations effectively countered oxidative stress-induced membrane damage, resulting in the highest MDA levels in untreated Naz genotype plants and the lowest in salt-stressed tolerant genotype plants (Fig. 2 C). Combining phytohormones proved to be the most effective method for reducing MDA levels (Fig. 2 D). 3.3 Chlorophyll pigment and chlorophyll fluorescence Salt stress decreased leaf carotenoids, chlorophyll a, and chlorophyll b in both cultivars. However, the foliar application of phytohormones alleviated this decrease in chlorophyll content. Applying SA and GR24 to both tolerant and susceptible cultivars led to higher levels of chlorophyll and carotenoids compared to plants without one or both phytohormones (Fig. 3 A-D). Additionally, the Fv/Fm ratio was higher in both cultivars when treated with SA and GR24 (Fig. 3 E). 3.4 Proline content The exogenous application of SA and GR 24 reduced proline accumulation in both cultivars under salt stress, particularly when applied together. Notably, the susceptible cultivar had the highest proline content under salt stress. Although SA and GR 24 had no significant effect under control conditions, they substantially decreased the proline content in treated plants compared to untreated ones (Fig. 4 A, B). 3.5 H 2 O 2 content The H 2 O 2 content changed notably, rising from 20.8 nmol g − 1 FW in control conditions to 40.9 nmol g − 1 FW under stress. The susceptible cultivar had higher H 2 O 2 levels than the tolerant cultivar. However, treatment with SA and GR24 decreased H 2 O 2 accumulation in both cultivars, with the most significant effect observed in tolerant cultivars treated with a combination of the two hormones, emphasizing the positive influence of these phytohormones (Fig. 4 B). 3.6 Protein content The protein content decreased in both cultivars under stress conditions; however, the exogenous application of phytohormones reduced the damage. The highest protein level was observed in susceptible cultivars treated with both SA and GR24. Notably, treatment with 1 mM SA under stress further increased protein accumulation compared to stressed plants that did not receive hormonal treatment (Fig. 5 ). 3.7 Antioxidant enzyme activity and gene expression Salt stress significantly increased the activity of SOD, CAT, APX, and GPX in both cultivars. Under stress conditions, CAT activity was 32.1 and 25.1 U mg protein in tolerant and susceptible cultivars, respectively. The application of phytohormones induced CAT activity in both cultivars under salt stress. Notably, the susceptible cultivar showed high CAT activity when treated with both phytohormones simultaneously, with SA alone significantly increasing CAT activity and GR 24 having a slight enhancing effect. The highest CAT activity, 40.85 U mg protein, occurred when plants received both phytohormones under stress conditions (Fig. 6 ). Foliar spraying with SA and GR24, either separately or together, increased APX activity in both cultivars under salt stress and control conditions. In the control group, APX activity was higher in both cultivars treated with SA and GR24 compared to untreated plants. The highest APX activity was observed in the tolerant cultivar treated with both phytohormones, highlighting the effectiveness of using both hormones together across both cultivars and conditions (Fig. 6 ). The results revealed that SA and GR 24 application enhanced GPX activity, with the highest levels observed in the tolerant cultivar under both normal and stress conditions. Notably, salt stress enhanced GPX activity in phytohormone-treated plants, with the most significant increase observed in 1 mM SA + 10 µM GR24-treated plants under salt conditions, reaching 2.04 U mg protein in tolerant cultivars (Fig. 7 ). The results showed significant differences in SOD activity between tolerant and susceptible cultivars under stress and expected conditions (Fig. 7 C, D). Salt stress increased SOD activity in both cultivars, with a more pronounced effect in susceptible cultivars. Phytohormone application enhanced enzyme activity, particularly in the Naz cultivar under salt stress. Moreover, phytohormones were effective in promoting SOD activity under salt conditions, especially with the SA + GR 24 treatment. The impact of exogenous SA and GR 24 on the expression of CAT, GPX, APX, and SOD genes was assessed using real-time PCR. Both SA and GR 24 significantly increased the expression of these genes in the two cultivars compared to the control. GPX expression was elevated by both phytohormones under normal and salt conditions, with the most significant increase in susceptible cultivars treated with SA. In contrast, tolerant cultivars showed the highest GPX expression when treated with both regulators under stress conditions. SOD activity was notably enhanced by 1mM SA and 1mM SA + 10 µM GR 24 in susceptible cultivars, whereas all concentrations of both phytohormones moderately increased SOD expression in the tolerant cultivar (Fig. 8 ). The results showed that CAT and APX activity increased under salt stress in susceptible cultivars but decreased in tolerant cultivars without hormone treatment. Notably, 1mM SA enhanced CAT and APX expression in both control and salt-stressed plants. However, co-treatment with both phytohormones reduced APX expression in both cultivars, whereas CAT expression decreased only under normal conditions and increased slightly under stress (Fig. 8 ). 3.8 Pearson Correlation Analysis Pearson correlation analysis showed positive relationships between proline, EL, MDA, SOD, H2O2, and EL in leaves (Fig. 9 ). Notably, EL was strongly linked with H2O2 (r = 0.91), proline (r = 0.81), MDA (r = 0.81), and SOD (r = 0.71). In contrast, EL had strong negative relationships with RWC (r = -0.89), chlorophyll b (r = -0.83), carotenoid (r = -0.66), and protein (r = -0.93). Protein content was moderately negatively related to MDA (r = -0.70), proline (r = -0.71), and EL, but positively associated with RWC, chlorophyll b, and carotenoids. Moreover, a positive relationship was found between the activity and expression of enzymes CAT, APX, SOD, and GPX (Fig. 9 ). 3.9 Hierarchical Clustering Analysis The similarities and distances among all treatments were assessed using the group average and Euclidean distance index, then displayed as two cluster dendrograms for the Naz and Jules cultivars (Fig. 10 ). Cluster analysis grouped treated and untreated plants based on physicochemical traits and gene expression, with a polar heat map showing the relationships between clusters (Fig. 10 ). The Naz cultivar formed three distinct clusters (Fig. 10 A). Cluster A included unstressed and untreated plants, as well as those treated with SA + SL, characterized by high relative water content (RWC) and moderate levels of chlorophyll b (Chl.b) and carotenoids. Cluster B consisted of stressed and untreated plants, showing high electrolyte leakage index (ELI) and moderate RWC, with notable H2O2 levels. Cluster C included plants treated with SA + SL and those grown in 200 mM NaCl (T8), which displayed high RWC, moderate H 2 O 2 , and moderate ELI. In the Jules cultivar, three distinct clusters appeared (Fig. 10 B). Group A included untreated plants and those treated with SA + SL (T2-T4), both of which had high relative water content (RWC) and moderate levels of carotenoid and chlorophyll b (Chl. b). Group B consisted of untreated plants grown with 200 mM NaCl, showing moderate RWC and a high electrolyte leakage index (ELI). Group C included plants treated with SA + SL in 200 mM NaCl, which displayed moderate RWC and ELI (Fig. 10 B). 3.10 Principal Component Analysis The principal component analysis of phytochemical traits and gene expression revealed that the first two components explained 63% of the variation, with 42% attributed to the first component and 21% to the second. The analysis grouped carotenoids, chlorophyll a, APX activity and gene expression, relative water content, and proteins, indicating strong similarities among these traits. In contrast, proline, SOD activity, electrolyte leakage, CAT activity, and GPX gene expression formed a distinct cluster (Fig. 11 ). 4. Discussion Plants employ a variety of morphological, biochemical, and physiological adjustments to cope with salt stress. In this study, we evaluated whether exogenous application of salicylic acid (SA) and the synthetic strigolactone analog GR24 could alleviate the adverse effects of salinity in common bean plants. In treated plants, SA or GR24 improved salt tolerance, as evidenced by reduced electrolyte leakage and membrane damage, increased relative water content (RWC) and osmoprotectant accumulation, and elevated antioxidant enzyme activities (Fig. 1 – 8 ). Our results showed that RWC was higher in salt-stressed bean plants treated with SA or GR24. This is consistent with [ 41 ], who found that combined SA + GR24 application increased leaf RWC in drought-stressed wheat. The beneficial role of SA in salt stress tolerance is well-established: for example, SA improves salt tolerance in wheat [ 42 ], maize [ 43 ], and other species [ 44 ]. SA is known to modulate salt tolerance [ 45 ] and stomatal conductance [ 46 ], processes that strigolactones can influence. Moreover, [ 47 ] observed that strigolactone treatment induced SA accumulation, an effect not seen in GR24-signaling mutants, suggesting that GR24 may affect stress responses by elevating endogenous SA levels. To investigate oxidative stress under salinity, we quantified hydrogen peroxide (H₂O₂), malondialdehyde (MDA), and electrolyte leakage (EL) (Fig. 9 ), all indicators of membrane oxidative damage. Salt stress is known to induce oxidative stress in crops such as wheat [ 42 ], soybean [ 48 ], maize [ 43 ], and black bean [ 49 ]. In our experiments, exogenous SA or GR24 treatments significantly reduced these oxidative stress markers in salt-stressed beans. This is in line with reports that combined SA + GR24 or MeJA + GR24 applications lower EL, MDA, and H₂O₂ under drought in wheat and Dracocephalum kotschyi [ 50 ]. While SA’s role in mitigating oxidative damage is well-documented, the exact mechanism by which GR24 exerts similar antioxidant effects remains to be elucidated. Salt stress lowered chlorophyll and carotenoid levels in leaves (Fig. 3 ), reflecting the known impact of salinity-induced photo-oxidation and pigment degradation [ 51 ]. Reduced chlorophyll indicates inhibited pigment biosynthesis and damage to the photosystems, leading to diminished light capture and increased ROS generation [ 52 ]. In our study, decreased chlorophyll content likely contributed to reduced photosynthetic efficiency (consistent with previous findings) [ 4 ]. Treatment with SA and/or GR24 ameliorated these effects: similar mitigation of stress-induced pigment decline has been observed in kidney bean [ 53 ], Dracocephalum kotschyi [ 50 ], and rice [ 21 ] when treated with SA, GR24, or related phytohormones. In our experiments, pigment losses were partially prevented by SA or GR24, especially under combined SA + GR24 treatment. Salt-induced accumulation of superoxide (O₂⁻) and H₂O₂ drives lipid peroxidation and chlorophyll degradation [ 51 ]. By lowering H₂O₂ content and boosting antioxidant enzyme activities, SA and GR24 helped maintain chlorophyll and carotenoid levels, thereby improving stress tolerance. This effect likely reflects their stimulatory impact on pigment biosynthesis pathways. Salt stress is also known to impair photosystem II (PSII) and Rubisco activity, halting ATP production and causing excess free oxygen in chloroplasts [ 54 ]. In contrast, the SA application has been shown to stimulate PSII and Rubisco activities, thereby enhancing ATP generation for CO₂ fixation [ 11 ]. Thus, a combined SA + GR24 treatment may help preserve PSII function and chlorophyll integrity under saline conditions. Saline conditions also disturb water relations and osmotic balance in plant tissues, prompting accumulation of compatible solutes [ 28 ]. Common osmolytes include proline, glycine betaine, soluble sugars, and proteins [ 55 ], which stabilize cellular osmotic pressure and can scavenge ROS [ 56 ]. Proline, in particular, protects macromolecules and cellular structures under salt stress [ 26 ]. In our study, exogenous SA and GR24 reduced proline levels in salt-stressed beans, mirroring observations in tomato [ 44 ] and stevia [ 57 ]. This decrease in proline coincided with lower MDA and electrolyte leakage, indicating that SA + GR24 treatments alleviated osmotic and oxidative stress. Plants counteract ROS using enzymatic defenses (e.g., SOD, CAT, POD, APX, and GPX) and non-enzymatic antioxidants. SOD converts superoxide to H₂O₂, which CAT and peroxidases then detoxify. Salt stress typically upregulates these enzymes [ 58 ]. Hormonal treatments can further enhance this response: for example, SA + GR24 increased SOD, POD, and CAT activities in water-stressed wheat [ 41 ]. Foliar SA is also known to elevate antioxidant enzyme activities, reduce MDA, and improve stress tolerance [ 42 ]. In our experiments, SA, GR24, and SA + GR24 all raised antioxidant enzyme activities and lowered MDA levels (Fig. 1 ). This suggests a positive feedback loop between SA signaling and ROS scavenging under stress. Our results showed that the application of GR24 enhanced antioxidant enzymes both alone and in combination with SA (Figs. 7 and 8 ). This supports previous findings: GR24 treatment increased SOD and peroxidase activities and decreased MDA in stressed rapeseed [ 56 ]. Similarly, rice treated with GR24 showed higher activities of CAT, POX, SOD, and APX, along with reduced lipid peroxidation under salt stress [ 21 ]. In tomato, strigolactones were found to induce antioxidant enzyme expression (including SOD, APX, GR, and CAT) under heat and cold stress [ 59 ], and comparable effects were observed in sugarcane under drought and salinity [ 60 ]. Collectively, these studies suggest that strigolactones generally boost enzymatic antioxidant defenses during abiotic stress. 5. Conclusions In summary, exogenous SA and GR24 treatments reduced salt stress damage in common bean plants. The combined use of SA (1 mM) and GR24 (10 µM) had a synergistic effect, significantly lowering oxidative stress markers. Treated plants displayed improved water status, decreased levels of MDA, electrolyte leakage, and H₂O₂, and reduced proline accumulation, indicating better osmotic regulation. These findings suggest that SA and GR24 work together to enhance salt tolerance and strengthen the plant’s defense mechanisms (Fig. 12 ). Declarations Author contribution: M.S. investigation, original draft writing, conceptualization, and methodology. M.S.A. original draft writing, data evaluation, and validation. G.P. Data analyses. B.D. Visualization, review, and final editing. All authors have read and agreed to the published final version of the manuscript. Funding: The University of Tehran supported this research by providing all the necessary equipment and facilities. Data availability : The datasets generated and/or analyzed during the current study are available from the corresponding author upon request. All results obtained in this study are presented here. Conflict of Interest: All authors declare that there is no conflict of interest. Clinical studies: Not applicable. Competing Interest: The Authors declare no competing interests. Consent to Publish: Not applicable. Ethical Declaration: Not applicable. References Beebe SE, Rao IM, Blair MW, Acosta-Gallegos JA (2013)Phenotyping common beans for adaptation to drought. Front. Physiol. 4:1–20. https://doi.org/10.3389/fphys.2013.00035 Gopalakrishnan T, Kumar L (2020) Modeling and mapping soil salinity and its impact on paddy lands in Jaffna Peninsula, Sri Lanka. Sustainability 12:1 15. https://doi.org/10.3390/su12208317 Machado RMA, Serralheiro RP (2017). Soil salinity: effect on vegetable crop growth. Management Practices to Prevent and Mitigate Soil Salinization. Horticulturae 3:1 13. https://doi.org/:10.3390/horticulturae3020030 Liang W, Ma X, Wan P, Liu L (2018) Plant salt-tolerance mechanism: A review. Biochem. Biophys Res Commun 495:286 291. https://doi.org/10.1016/j.bbrc.2017.11.043 Asfaw A, Blair MW (2014) Quantifying drought tolerance in Ethiopian common bean varieties. Agric Sci 5:124-139. https://doi.org/10.4236/as.2014.52016 Al Hassan M, Morosan M, López-Gresa MDP, Prohens J, Vicente O, Boscaiu M (2016) Salinity-induced and variation in biochemical markers provide insight into the mechanisms of salt tolerance in common ( Phaseolus vulgaris ) and runner ( P. coccineus ) beans. Int J Mol Sci 17:1582. https://doi.org/doi: 10.3390/ijms17091582 Sarkar S, Khatun M, Era FM, Islam A.M.M., Anwar M.P., Danish S, Datta R., Islam A.K.M.A. (2021)Abiotic stresses: Alteration of composition and grain quality in food legumes. Agronomy 11:1 24. https://doi.org/10.3390/agronomy11112238 Farooq M, Gogoi N, Hussain M, Barthakur S, Paul S, Bharadwaj N, Migdadi HM, Alghamdi SS, Siddique KHM (2017) Effects, tolerance mechanisms and management of salt stress in grain legumes. Plant Physiol Biochem 118:199 217. https://doi.org/10.1016/j.plaphy.2017.06.020 Torche Y, Blair M, Said C (2018) Biochemical, physiological, and phenological genetic analysis in common bean ( Phaseolus vulgaris L.) under salt stress. Ann Agric Sci 63:153 161. https://doi.org/10.1016/j.aoas.2018.10.002 Sharma A, Shahzad B, Kumar V, Kohli SK, Sidhu GPS, Bali AS, Handa N, Kapoor D, Bhardwaj R, Zheng B (2019). Phytohormones regulate the accumulation of osmolytes under abiotic stress. Biomolecules 9:1 36. https://doi.org/10.3390/biom9070285 Khan MIR, Fatma M, Per TS, Anjum NA, Khan NA (2015) Salicylic acid-induced abiotic stress tolerance and underlying mechanisms in plants. Front. Plant Sci. 6: 1–17. https://doi.org/10.3389/fpls.2015.00462 Khan A, Pan X, Najeeb U, Tan DKY, Fahad S, Zahoor R, Luo H (2018) Coping with drought: stress and adaptive mechanisms, and management through cultural and molecular alternatives in cotton as vital constituents for plant stress resilience and fitness. Biol Res 51:1 17. https://doi.org/10.1186/s40659-018-0198-z Keshavarz H, Sanavy SAMM (2016). How salicylic acid modulates photosynthetic pigments, growth, and canola yield. J Glob Agric Ecol 2(1):1-9. https://doi.org/10.22080/JGR.2016.1475 Husen A, Iqbal M, Sohrab SS. Ansari MKA (2018) Salicylic acid alleviates salinity-caused damage to foliar functions, plant growth, and antioxidant systems in Ethiopian mustard ( Brassica carinata A. Br.). Agric. Food Security 7:1 14. https://doi.org/10.1186/s40066-018-0194-0 Habibi G (2013). Effect of drought stress and selenium spraying on photosynthesis and antioxidant activity of spring barley. Acta Agric Slov 101:31 29. https://doi.org/10.2478/acas-2013-0004 Kang G, Li G, Xu W, Peng X, Han Q, Zhu Y, Guo T (2012) Proteomics reveals the effects of salicylic acid on growth tolerance to subsequent drought stress in wheat. J Proteome Res 11: 6066–6079. https://doi.org/10.1021/pr300728y Dawood MFA, Zaid A, Latef AAHA (2022). Salicylic acid spraying-induced resilience strategies against the damaging impacts of drought and/or salinity stress in two varieties of Vicia faba L. seedlings. J Plant Growth Reg. 41:1919 1942. https://doi.org/10.1007/s00344-021-10381-8 Heidarian F, Roshandel P. (2021) Salicylic acid improves tolerance against salt stress by boosting the antioxidant defense system in black beans. Int. J. Hort. Sci. Technol. 10:1–14. https://doi.org/10.1016/j.heliyon.2024.e34486 Gogna M, Kumar R, Tiwari L D, Tailor A, Kumari A, Mehta S (2023). Strigolactones: A new player in regulating adventitious root formation. In Environmental, Physiological and Chemical Controls of Adventitious Rooting in Cuttings 343–366. https://doi.org/10.1016/B978-0-323-90636-4.00004-0 Bhoi A, Yadu B, Chandra J, Keshavkant S (2021) Contribution of strigolactone in plant physiology, hormonal interaction, and abiotic stresses. Planta, 254:1-21. https://doi.org/10.1007/s00425-021-03678-1 Ling F, Su Q, Jiang H, Cui J, He X, Wu Z, Zhang Z, Liu J, Zhao Y (2020) Effects of strigolactone on photosynthetic and physiological characteristics in salt-stressed rice seedlings. Sci Rep 10: 1–8. https://doi.org/10.1038/s41598-020-63352-6 Liu J, Lovisolo C, Schubert A, Cardinal F (2013) Signaling role of strigolactones at the interface between plants, microorganisms, and a changing environment. J Plant Interact 8: 17–33. https://doi.org/10.1080/17429145.2012.750692 Ruiz-Lozano JM, Aroca R, Zamarreño ÁM, Molina S, Andreo-Jiménez B, Porcel R, García‐Mina JM, Ruyter-Spira C, López‐Ráez JA (2016) Arbuscular mycorrhizal symbiosis induces strigolactone biosynthesis under drought and improves drought tolerance in lettuce and tomatoes. Plant Cell Environ 39: 441–452. https://doi.org/10.1111/pce.12631 Visentin I, Pagliarani C, Deva E, Caracci A, Turečková V, Novák O, Lovisolo C, Schubert A, Cardinale F (2020) A novel strigolactone-miR156 module controls stomatal behavior during drought recovery. Plant. Cell Environ 43:1613 1624. https://doi.org/10.1111/pce.13758 Mostofa MG, Li W, Nguyen KH, Fujita M, Tran P (2018) Strigolactones in plant adaptation to abiotic stresses: An emerging avenue of plant research. Plant Cell Environ 41: 2227–2243. https://doi.org/10.1111/pce.13364 Nguyen HTT, Das Bhowmik S, Long H, Cheng Y, Mundree S, Hoang LTM (2021) Rapid proline accumulation enhances salinity tolerance in Australian wild rice Oryza australiensis domain. Plants 10:1 16. https://doi.org/10.3390/plants10102044 FAOSTAT (2024) Dry bean production in 2022, Crops/Regions/World list/Production Quantity/Year. UN Food and Agriculture Organization, Corporate Statistical Database. Retrieved 20 December 2024. Azimychetabi Z, Sabokdast M (2021) Physiological and biochemical responses of four common bean genotypes ( Phaseolus vulgaris L.) under salt stress. J. Agric. Sci. Technol. 23:1091 1103. Luisi A, Lorenzi R, Sorce C (2011) Strigolactone may interact with gibberellin to control apical dominance in peas ( Pisum sativum ). Plant Growth Reg 65:415-419. https://doi.org/10.1007/s10725-011-9603-0 Tayyab N, Naz R, Yasmin H, Nosheen A, Keyani R, Sajjad M, Hassan MN, Roberts TH (2020). Combined seed and foliar pre-treatments with exogenous methyl jasmonate and salicylic acid mitigate drought-induced stress in maize. PLoS One 1:1–18. https://doi.org/10.1371/journal.pone.0232269 Hodges DM, DeLong JM, Forney ChF, Prange RK (1999). Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207: 604–611. https://doi.org/10.1007/s004250050524 Velikova V, Yordanov I, Edreva A (2000) Oxidative stress and some antioxidant systems in acid rain-treated bean plants: protective role of exogenous polyamines. Plant Sci 151:59 66. https://doi.org/10.1016/S0168-9452(99)00197-1 Bates LS, Waldren RP, Teare ID (1973) Rapid determination of free proline for water-stress studies. Plant Soil 39:205-207. https://doi.org/10.1007/BF00018060 Arnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenol oxidase in Beta vulgaris . Plant Physiol. 24:1–15. https://doi.org/10.1104/pp.24.1.1 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal Biochem 72:248–254. https://doi.org/10.1016/0003-2697(76)90527-3 Dhindsa RS, Plumb-Dhindsa P, Thorpe TA (1981) Leaf senescence: correlated with increased levels of membrane permeability, lipid peroxidation, and decreased superoxide dismutase and catalase levels. J Exp Bot 32:93 101. https://doi.org/10.1093/jxb/32.1.93 Aebi, H (1984). Catalase in vitro . Methods Enzymol105:121-126. https://doi.org/10.1016/s0076-6879(84)05016-3 Amako K, Chen GX, Asada K (1994) Separate assays specific for ascorbate peroxidase and guaiacol peroxidase and the chloroplastic and cytosolic isozymes of ascorbate peroxidase in plants. Plant Cell Physiol 35:497 504. https://doi.org/10.1093/oxfordjournals.pcp.a078621 Resende MLV de, Nojosa GBA, Cavalcanti LS, Aguilar MAG, Silva L, Perez JO, Andrade GCG, Carvalho GA, Castro RM (2002) Induction of resistance in cocoa against Crinipellis perniciosa and Verticillium dahliae by acibenzolar‐ S‐ methyl (ASM). Plant Pathol 51:621-628. https://doi.org/10.1046/j.1365-3059.2002.00754.x Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP (2004) Determination of stable housekeeping genes, differentially regulated target genes, and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol Lett 26:509 515. https://doi.org/10.1023/b:bile.0000019559.84305.47 Sedaghat M, Tahmasebi-Sarvestani Z, Emam Y, Mokhtassi-Bidgoli A (2017) Physiological and antioxidant responses of winter wheat cultivars to strigolactone and salicylic acid in drought. Plant Physiol Biochem 119:59 69. https://doi.org/10.1016/j.plaphy.2017.08.015 Arfan M, Athar HR, Ashraf M (2007) Does exogenous application of salicylic acid through the rooting medium modulate growth and photosynthetic capacity in two differently adapted spring wheat cultivars under salt stress? J Plant Physiol 164: 685–694. https://doi.org/10.1016/j.jplph.2006.05.010 Elhakem A. (2020). Salicylic acid ameliorates salinity tolerance in maize by regulating phytohormones and osmolytes. Plant Soil Environ 66: 533–54. https://doi.org/10.17221/441/2020-PSE Mimouni H, Wasti S, Manaa A, Gharbi E, Chalh A, Vandoorne B, Lutts S, Ahmed H Ben (2016). Does salicylic acid (SA) improve tolerance to salt stress in plants? A study of SA effects on tomato plant growth, water dynamics, photosynthesis, and biochemical parameters. OMICS20: 180–190. https://doi.org/10.1089/omi.2015.0161 Askari E, Ehsanzadeh P (2015) Drought stress mitigation by foliar application of salicylic acid and its Interactive effects on physiological characteristics of fennel ( Foeniculum vulgare Mill.) genotypes. Acta Physiol Plant 37:1 14. https://doi.org/10.1007/s11738-014-1762-y Prodhan MY, Munemasa S, Nahar MNEN, Nakamura Y, Murata (2018) Guard cell salicylic acid signaling is integrated into abscisic acid signaling via the Ca2+/CPK-dependent pathway. Plant Physiol 178: 441–450. https://doi.org/10.1104/pp.18.00321 Rozpądek P, Domka AM, Nosek M, Ważny R, Jędrzejczyk RJ, Wiciarz M, Turnau K (2018) The role of strigolactone in the cross-talk between Arabidopsis thaliana and the endophytic fungus Mucor sp. Front Microbiol 9:1 14. https://doi.org/10.3389/fmicb.2018.00441 Razmi N, Ebadi A, Daneshian J, Jahanbakhsh S (2017) Salicylic acid-induced changes in the antioxidant capacity, pigments, and grain yield of soybean genotypes under water deficit conditions. J. Plant Interact. 12: 457–464. https://doi.org/10.1080/17429145.2017.1392623 Heidarian F, Roshandel P. (2021) Salicylic acid improves tolerance against salt stress by boosting the antioxidant defense system in black beans. Int. J. Hort. Sci. Technol. 10:1–14. https://doi.org/10.1016/j.heliyon.2024.e34486 Shirani Bidabadi S, Sharifi P (2021) Strigolactone and methyl Jasmonate-induced antioxidant defense and the composition alterations of different active compounds in Dracocephalum kotschyi Boiss under drought stress. J Plant Growth Reg 40: 878–889. https://doi.org/10.1007/s00344-020-10157-6 Yang Y, GuoY (2018) Unraveling salt stress signaling in plants. J Integr Plant Biol 60:796–804. https://doi.org/10.1111/jipb.12689 Dalal VK, Tripathy BC (2018) Water stress-induced downsizing of light-harvesting antenna complex protects developing rice seedlings from photo-oxidative damage. Sci Rep 8:1 16. https://doi.org/10.1038/s41598-017-14419-4 Galindo-Castañeda T, Lynch JP, Six J, Hartmann M (2022) Improving plant soil resource uptake by capitalizing on synergies between root architecture, anatomy, and root-associated microorganisms. Front Plant Sci 13:1–15. https://doi.org/10.3389/fpls.2022.827369 Zhao H, Liang H, ChuY, Sun C, Wei N, Yang M, Zheng C (2019.)Effects of salt stress on chlorophyll fluorescence and the antioxidant system in Ginkgo biloba L. seedlings. HortScience 54: 2125–2133. https://doi.org/10.1038/nature23667 Chen K, Song M, Guo Y, Liu L, Xue H, Dai H, Zhang Z (2019). Md MYB 46 could enhance apple salt and osmotic stress tolerance by directly activating stress-responsive signals. Plant Biotechnology J 17: 2341–2355. https://doi.org/10.1111/pbi.13151 Nadeem M, Li J, Yahya M, Sher A, Ma C, Wang X, Qiu L (2019) Research progress and perspective on drought stress in legumes: A review. Int. J. Mol. Sci. 20: 1–32. https://doi.org/10.3390/ijms20102541 Akbarpour V. (2019). The effect of putrescine and salicylic acid on physiological characteristics and antioxidants in Stevia rebaudiana B. under salinity stress. J Crop Breed 11:40 54. https://doi.org/10.29252/jcb.11.29.40 Cao Y, Luo Q, Tian Y, Meng F (2017) Physiological and proteomic analyses of the drought stress response in Amygdalus mira (Koehne) Yü et Lu roots. BMC Plant Biol 17:1 16. https://doi.org/10.1186/s12870-017-1000-z CHi C, Xu X, Wang M, Zhang H, Fang P, Zhou J, Xia X, Shi K, Zhou Y, Yu J (2021) Strigolactones positively regulate abscisic acid-dependent heat and cold tolerance in tomatoes. Hortic. Res. 8 (237): 1–15. https://doi.org/10.1038/s41438-021-00668-y Kaura V, Malhotra, PK, Mittal, A. (2023). Physiological, biochemical, and gene expression responses of sugarcane under cold, drought, and salt stresses. J Plant Growth Reg 42:6367 6376. https://doi.org/10.1007/s00344-022-10850-8 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 30 Sep, 2025 Reviews received at journal 03 Sep, 2025 Reviews received at journal 27 Aug, 2025 Reviewers agreed at journal 27 Aug, 2025 Reviewers agreed at journal 26 Aug, 2025 Reviews received at journal 26 Aug, 2025 Reviews received at journal 25 Aug, 2025 Reviewers agreed at journal 25 Aug, 2025 Reviewers agreed at journal 22 Aug, 2025 Reviewers agreed at journal 21 Aug, 2025 Reviewers agreed at journal 21 Aug, 2025 Reviewers agreed at journal 21 Aug, 2025 Reviewers invited by journal 21 Aug, 2025 Editor assigned by journal 19 Aug, 2025 Editor invited by journal 18 Aug, 2025 Submission checks completed at journal 16 Aug, 2025 First submitted to journal 16 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7284816","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":506902976,"identity":"b8263a84-92bc-4911-97b5-14dbf771cbd3","order_by":0,"name":"Masoumeh Asadi-Aghbolaghi","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Masoumeh","middleName":"","lastName":"Asadi-Aghbolaghi","suffix":""},{"id":506902977,"identity":"c1e2a1ea-2693-4e9b-a9a9-d291ae56ca9c","order_by":1,"name":"Manijeh Sabokdast","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyElEQVRIiWNgGAWjYFACHgbGBjYgzd4A4bMRrYWH5wBjA4laJBIYG4hylnz72YMPZ5TZ2dtLvjF/wFBjx8AnfQC/FoMzecmGG84lJ/ZI5xg2MBxLZmDjSyCghSHHTPJhG3MCD1gL2wEGNh5CDut/A9JSb88jeQao5R8RWhhuAG3Z2HaYsUeCx7CBsY0ILQY33iUbzjh3PLHnTFrhjMS+ZB4iHJZ78GFPWbU9e/vhDR8+fLOTk+8h5DAUkACKplEwCkbBKBgFlAMA0d07lSgCW3QAAAAASUVORK5CYII=","orcid":"","institution":"University of Tehran","correspondingAuthor":true,"prefix":"","firstName":"Manijeh","middleName":"","lastName":"Sabokdast","suffix":""},{"id":506902978,"identity":"64fbc9a3-09a0-4ee7-9c95-b51d34748ad1","order_by":2,"name":"Ghasem Parmoon","email":"","orcid":"","institution":"Kermanshah Agricultural and Natural Resources Research and Education Center, AREEO","correspondingAuthor":false,"prefix":"","firstName":"Ghasem","middleName":"","lastName":"Parmoon","suffix":""},{"id":506902979,"identity":"81dce39f-190c-40ba-b2a0-8cd08cfe284d","order_by":3,"name":"Beata Dedicova","email":"","orcid":"","institution":"Swedish University of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Beata","middleName":"","lastName":"Dedicova","suffix":""}],"badges":[],"createdAt":"2025-08-03 17:38:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7284816/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7284816/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90199923,"identity":"faaa02b1-ea5c-4da8-bd53-0202dbafd703","added_by":"auto","created_at":"2025-08-29 18:14:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":76771,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salinity and genotype interactions (A), salinity and exogenous SA and SL application interactions (B) on relative water content (RWC) in common beans. Different letters are significantly different (LSD, P \u0026lt; 0.05, n = 3).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/3d36ed131ca29c533c74371b.png"},{"id":90200653,"identity":"2cd5a474-4629-4f2e-bd64-d0f3525e5d50","added_by":"auto","created_at":"2025-08-29 18:30:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":147431,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salinity and genotype interactions (A, C), salinity and exogenous SA and SL application interactions (B, D) on electrolyte leakage (ELI) and lipid peroxidation (MDA) in common beans. A, B: ELI. C, D: MDA. Different letters are significantly different (LSD, P \u0026lt; 0.05, n = 3).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/e901aa9d7bab27dff902d611.png"},{"id":90199925,"identity":"dab9ac46-07b0-4f49-b5b6-6472ef8b6d10","added_by":"auto","created_at":"2025-08-29 18:14:24","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":144166,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salinity and exogenous SA and SL application interactions on photosynthetic pigments in common beans. A: chlorophyll a, B: chlorophyll b, C: total chlorophyll, D: carotenoids. Different letters indicate significant differences (LSD, P \u0026lt; 0.05, n = 3).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/17eec1d969db2d871c2870bc.png"},{"id":90199931,"identity":"bb7e395a-b8be-4b42-afda-d2a2408f4bb4","added_by":"auto","created_at":"2025-08-29 18:14:24","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":152500,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salinity and genotype interactions (A, C), as well as salinity and exogenous SA and SL application interactions (B, D), on proline and H2O2 content in common beans. A, B: proline. C, D: H2O2. Different letters indicate significant differences (LSD, P \u0026lt; 0.05, n = 3).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/098049e5804cbbfd34d4c996.png"},{"id":90200160,"identity":"4693bee2-b10a-44a6-b075-8a6b480080dc","added_by":"auto","created_at":"2025-08-29 18:22:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":94958,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salinity and genotype interactions (A), salinity and exogenous SA and SL application interactions (B) on total protein in common beans. Different letters are significantly different (LSD, P \u0026lt; 0.05, n = 3).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/c535cc117de54cd14ffefd54.png"},{"id":90200655,"identity":"ff0bbad4-843c-43ed-9461-493207318e90","added_by":"auto","created_at":"2025-08-29 18:30:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":133751,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salinity and genotype interactions (A, C), salinity and exogenous SA and SL application interactions (B, D) on CAT and APX activity in common beans. A, B: CAT. C, D: APX. Different letters are significantly different (LSD, P \u0026lt; 0.05, n = 3).\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/287686d30fcfc8df1f1a436e.png"},{"id":90199939,"identity":"dcb76445-1443-44c4-8d3f-58d6ecda1ee1","added_by":"auto","created_at":"2025-08-29 18:14:24","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":172032,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salinity and genotype interactions (A, C), as well as salinity and exogenous SA and SL application interactions (B, D) on GPX and SOD activity in common beans. Panels A and B illustrate GPX, while panels C and D show SOD. Different letters indicate significant differences (LSD, P \u0026lt; 0.05, n = 3).\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/1391e7552e55e4df711ad93c.png"},{"id":90200167,"identity":"f6e75ce6-c03e-431b-91ec-18fac9f40800","added_by":"auto","created_at":"2025-08-29 18:22:24","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":83429,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of salinity and exogenous SA and SL application interactions (B, D) on Gene expression activity in typical bean leaves of common beans. A, B: GPX. C, D: SOD. A: CAT expression in Naz, B: CAT expression in Jules, C: GPX expression in Naz cultivar. D: GPX expression in Jules cultivar, E: SOD expression in NAZ cultivar. F: SOD expression in Jules’s cultivar.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/691d979d9f4ccae48544e0cb.png"},{"id":90201188,"identity":"e1b3cd3b-1e78-4f0f-a043-4ec93ccbf82c","added_by":"auto","created_at":"2025-08-29 18:38:27","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":167347,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation matrix among the different parameters of bean plants influenced by salt stress and foliar spraying of SA and the synthetic form of SL. Here, Chla; Chlorophyll a, Chlb; Chlorophyll b; RWC; Relative water content, EL; Electrolyte leakage, APX; Ascorbate peroxidase, POX; Guaiacol peroxidase, CAT; Catalase, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e; Hydrogen peroxide, MDA; Malondialdehyde.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/7e75b15f4cb0d40953719c01.png"},{"id":90199946,"identity":"6d12cde5-9980-419e-b72e-702e3d9b2357","added_by":"auto","created_at":"2025-08-29 18:14:24","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":145757,"visible":true,"origin":"","legend":"\u003cp\u003ePolar heatmap represents the grouping of control and treated plants based on yield, growth, and physicochemical characteristics in the (A) salt-sensitive (Naz) cultivar and (B) salt-tolerant (Jules) cultivar. T1: NaCl\u003csub\u003e0\u003c/sub\u003e-SL\u003csup\u003e-\u003c/sup\u003eSA\u003csup\u003e-\u003c/sup\u003e, T2: NaCl\u003csub\u003e0\u003c/sub\u003e-SL\u003csup\u003e-\u003c/sup\u003eSA\u003csup\u003e+\u003c/sup\u003e, T3: NaCl\u003csub\u003e0\u003c/sub\u003e-SL\u003csup\u003e+\u003c/sup\u003eSA\u003csup\u003e-\u003c/sup\u003e, T4: NaCl\u003csub\u003e0\u003c/sub\u003e-SL\u003csup\u003e+\u003c/sup\u003eSA\u003csup\u003e+\u003c/sup\u003e, T5: NaCl\u003csub\u003e100\u003c/sub\u003e-SL\u003csup\u003e-\u003c/sup\u003eSA\u003csup\u003e-\u003c/sup\u003e, T6: NaCl\u003csub\u003e100\u003c/sub\u003e-SL\u003csup\u003e-\u003c/sup\u003eSA\u003csup\u003e+\u003c/sup\u003e, T7: NaCl\u003csub\u003e100\u003c/sub\u003e-SL\u003csup\u003e+\u003c/sup\u003eSA\u003csup\u003e-\u003c/sup\u003e, T8: NaCl\u003csub\u003e100\u003c/sub\u003e-SL\u003csup\u003e+\u003c/sup\u003eSA\u003csup\u003e+\u003c/sup\u003e, T9: NaCl\u003csub\u003e200\u003c/sub\u003e-SL\u003csup\u003e-\u003c/sup\u003eSA\u003csup\u003e-\u003c/sup\u003e, T10: NaCl\u003csub\u003e200\u003c/sub\u003e-SL\u003csup\u003e-\u003c/sup\u003eSA\u003csup\u003e+\u003c/sup\u003e, T11: NaCl\u003csub\u003e200\u003c/sub\u003e-SL\u003csup\u003e+\u003c/sup\u003eSA\u003csup\u003e-\u003c/sup\u003e, T12: NaCl\u003csub\u003e200\u003c/sub\u003e-SL\u003csup\u003e+\u003c/sup\u003eSA\u003csup\u003e+\u003c/sup\u003e.Here, Chla; Chlorophyll a, Chlb; Chlorophyll b; RWC; Relative water content, EL; Electrolyte leakage, APX; Ascorbate peroxidase, GPX; Guaiacol peroxidase, CAT; Catalase, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e; Hydrogen peroxide, MDA; Malondialdehyde.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/1a746111b360689a7b3b7898.png"},{"id":90199934,"identity":"15b079e4-e02c-4d18-a6b1-9b5fd63fb618","added_by":"auto","created_at":"2025-08-29 18:14:24","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":92874,"visible":true,"origin":"","legend":"\u003cp\u003eillustrates the Principal Component Analysis (PCA) of the various parameters of bean plants influenced by salt stress and foliar spraying of SA and synthetic form of SL: Chla (Chlorophyll a), Chlb (Chlorophyll b), RWC (Relative water content), EL (Electrolyte leakage), APX (Ascorbate peroxidase), GPX (Guaiacol peroxidase), CAT (Catalase), H2O2 (Hydrogen peroxide), and MDA (Malondialdehyde).\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/012d164ee5a489637c2abace.png"},{"id":90199943,"identity":"865a21fa-9ec6-4f8b-93bf-0e206cbe1e3d","added_by":"auto","created_at":"2025-08-29 18:14:24","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":151819,"visible":true,"origin":"","legend":"\u003cp\u003eDifferent responses of non-treated and treated common bean plants under salinity stress. Plants can better withstand salt stress by integrating salicylic acid (SA) and Strigolactone (GR\u003csub\u003e24\u003c/sub\u003e), enhancing overall growth and productivity.\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/12fda3716d424a02f9769bb9.png"},{"id":90201463,"identity":"97a38114-affd-441f-8d15-e9e28172af59","added_by":"auto","created_at":"2025-08-29 18:46:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2155822,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7284816/v1/25521485-a5ba-497c-a9a9-dd9b282f645e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Strigolactone and salicylic acid simultaneously enhance the resilience of common bean against salt stress by strengthening the antioxidant defense system","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAbiotic stresses, especially salinity, continue to pose a major challenge for crop production, particularly in semi-arid and arid regions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Salinity currently impacts about 800\u0026nbsp;million acres of arable land [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], with projections suggesting a potential 50% increase by 2050 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In glycophytic species like the common bean, salinity causes osmotic stress, ionic imbalance, and secondary oxidative and nutritional disturbances [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The common bean (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.), an important dietary source of protein, carbohydrates, micronutrients, and vitamins [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], experiences significant yield reductions even at low salinity levels (below 2 dS\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], affecting biomass, yield components, and root growth [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Limited nitrate uptake due to salinity also decreases grain protein concentration, a key quality trait in legumes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePlant responses to salt stress involve complex regulatory mechanisms that include various physiological responses under unfavorable conditions [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Plants use intricate regulatory networks to adapt to salinity, with phytohormones controlling key processes like osmolyte buildup, stomatal regulation, root growth, and water balance [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Salicylic acid (SA), produced in chloroplasts during stress [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], manages antioxidant systems, osmoprotectant production, nitrogen metabolism, and photosynthesis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Applying SA externally has been shown to boost growth and yield in several crops under stress by increasing enzymatic antioxidant activity and maintaining redox balance [\u003cspan additionalcitationids=\"CR14 CR15 CR16 CR17\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eStrigolactones (SLs) are involved in various plant processes, including plant architecture, adventitious root formation, leaf senescence, nutrient uptake, and reproductive maturity [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Additionally, SLs accumulate in plant tissues under abiotic stress and interact with other hormones to regulate processes that help plants adapt to harsh conditions [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Several studies have shown that plants modify strigolactone levels differently in response to various abiotic stresses [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Abiotic stresses such as salinity and drought can decrease strigolactone production in some plants [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Stomatal closure, which is the plant's initial response to drought, has been reported to be influenced by strigolactone in Arabidopsis [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In this context, applying strigolactone externally to \u003cem\u003eVicia faba\u003c/em\u003e causes stomatal closure depending on the concentration [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Additionally, SLs promote flavonoid production, which serves as an osmoprotectant during plant adaptation to abiotic stress [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. It is also notable that SL signaling is linked to reactive oxygen species (ROS) responses in plants. One study found that treating rice with strigolactone increased antioxidant enzyme activity and decreased malondialdehyde, a key factor in plant tolerance to salt stress [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The analogs GR5, GR7, and GR24 are recognized as strigolactone mimics, with GR24, a synthetic SL, showing the highest activity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eVarious studies have illustrated that SA regulates plant response to abiotic stress. Still, little information exists about the single and combined effects of SL and SA on plant adaptation to stress. Moreover, the synergistic effect of SA and GR\u003csub\u003e24\u003c/sub\u003e, achieved through simultaneous treatment of common beans with salt, has not been reported. Therefore, we aimed to profoundly determine the impact of exogenous treatment of SA and GR\u003csub\u003e24\u003c/sub\u003e on salt-tolerant and susceptible common beans.\u003c/p\u003e\u003cp\u003eOur findings provide novel insights into the SA\u0026thinsp;+\u0026thinsp;GR24-induced influences on physiological, molecular, and metabolic processes, aiming to improve tolerance in common beans against salt-induced oxidative stress. Additionally, this finding suggests the potential for manipulating the SA and GR\u003csub\u003e24\u003c/sub\u003e signaling pathways to enhance salt tolerance in common bean plants.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cp\u003e\u003cb\u003ePlant material and experimental design\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe common bean belongs to the legume family \u003cem\u003eFabaceae\u003c/em\u003e, with a global annual production of about 28\u0026nbsp;million tons. According to FAOSTAT data from 2022 [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], approximately 400\u0026nbsp;million people in the tropics consume beans daily. Two \u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L. cultivars, \u0026lsquo;Jules\u0026rsquo; (tolerant) and \u0026lsquo;Naz\u0026rsquo; (sensitive), were obtained from the University of Tehran, Iran [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Seeds were surface-sterilized in 70% ethanol for 3 minutes, rinsed, and sown in 5 kg pots filled with sandy loam soil (3% clay, 13% silt, 84% sand). Seven seeds per pot were thinned to five seedlings after emergence. At the 8-leaf stage, plants were subjected to 200 mM NaCl for three weeks; controls received distilled water. In the second week of stress, foliar sprays of SA (0 or 1 mM) and GR24 (0 or 10 \u0026micro;M) were applied. Controls were sprayed with distilled water [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. A factorial, completely randomized design with three replicates was used in growth chambers (16 hours of light / 8 hours of dark, 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C).\u003c/p\u003e\u003cp\u003eAt the 8-leaf stage, plants were subjected to 200 mM NaCl for three weeks; controls received distilled water. In the second week of stress, foliar sprays of SA (0 or 1 mM) and GR24 (0 or 10 \u0026micro;M) were applied. Controls were sprayed with distilled water [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. A factorial, completely randomized design with three replicates was used in growth chambers (16 h light / 8 h dark, 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C).\u003c/p\u003e\u003cp\u003e\u003cb\u003ePhysiological and biochemical parameters\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eRelative water content (RWC)\u003c/b\u003e\u003c/p\u003e\u003cp\u003eLeaf relative water content was measured by using the methodology described by Tayyab et al. [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. RWC was computed using the following equation:\u003c/p\u003e\u003cp\u003eRWC (%) = (fresh weight-dry weight)/ (turgid weight-dry weight) \u0026times; 100\u003c/p\u003e\u003cp\u003e\u003cb\u003eElectrolyte leakage and Malondialdehyde\u003c/b\u003e\u003c/p\u003e\u003cp\u003eElectrolyte leakage was determined by weighing 0.3 g of leaf tissue, rinsing it with sterile water, and placing it into tubes containing 10 mL of sterile water. Samples were held at 25\u0026deg;C for 2 h, after which the initial electrical conductivity (EC1) was recorded. The same tubes were then autoclaved for 10 min at 95\u0026deg;C, cooled to 25\u0026deg;C, and the final conductivity (EC2) was measured. EL was calculated as:\u003c/p\u003e\u003cp\u003eEL (%) = (EC1/EC2) \u0026times; 100.\u003c/p\u003e\u003cp\u003eMDA content, used as an indicator of lipid peroxidation, was quantified following Hodges et al. [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] with minor adaptations. In brief, 0.2 g of powdered leaf material was homogenized in 5% trichloroacetic acid (TCA) and centrifuged at 3000 g for 10 min. The supernatant was combined with 0.5% thiobarbituric acid in 20% TCA, incubated in a boiling water bath for 30 min, cooled on ice for 5 min, and centrifuged again at 3000 g for 10 min. Absorbance was recorded at 532 nm and 600 nm, and MDA concentration (\u0026micro;mol mg⁻\u0026sup1; FW) was determined using an extinction coefficient of 155 mM⁻\u0026sup1; cm⁻\u0026sup1;.\u003c/p\u003e\u003cp\u003e\u003cb\u003eH\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e\u003cb\u003eO\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e \u003cb\u003econtent\u003c/b\u003e\u003c/p\u003e\u003cp\u003eH₂O₂ levels were measured as outlined by Velikova et al. [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Finely ground leaves (0.5 g) were homogenized in 0.1% TCA and centrifuged at 12,000 g for 10 min. From the resulting supernatant, 0.5 mL was mixed with 0.5 mL of 10 mM phosphate buffer (pH 7) and 1 mL of 1 M potassium iodide. Absorbance was measured at 390 nm to estimate H₂O₂ concentration.\u003c/p\u003e\u003cp\u003e\u003cb\u003eProline content\u003c/b\u003e\u003c/p\u003e\u003cp\u003eProline content was measured following Bates et al. [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. For this, 0.5 g of leaf powder was extracted with 5 mL of 3% sulfosalicylic acid and centrifuged at 15,000 g for 20 minutes. Two mL of supernatant was reacted with 2 mL of acid ninhydrin solution (prepared by dissolving 1.25 g of acid ninhydrin in 30 mL of glacial acetic acid plus 20 mL of 6 M orthophosphoric acid) and 2 mL of glacial acetic acid. The mixture was incubated for 1 hour in a boiling water bath, then quickly cooled and extracted with 4 mL of toluene by inversion for 20 minutes. Absorbance was measured at 520 nm, and proline concentration was expressed as nmol per gram of fresh weight (nmol g⁻\u0026sup1; FW) using a standard curve for L-proline.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCarotenoid and chlorophyll contents\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePigments were extracted following the method of Arnon [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Approximately 0.1 g of leaf tissue was ground in 3 mL of 80% acetone, and the extract was clarified by centrifugation at 5000 \u0026times; g for 10 min. Absorbance readings were taken at 663, 645, 480, and 510 nm with a Shimadzu UV-160 spectrophotometer, and pigment concentrations were calculated using the respective equations.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTotal protein content\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal soluble protein content was determined using the Bradford assay [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Leaves were ground in liquid nitrogen, suspended in 50 mM Na-phosphate buffer (pH 7.6), and centrifuged at 12,000 g for 20 minutes at 4\u0026deg;C. Protein concentration in the supernatant was measured at 595 nm with a spectrophotometer. Remaining supernatants were stored at \u0026minus;\u0026thinsp;80\u0026deg;C for later enzyme activity assays.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAntioxidant enzyme activities\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSuperoxide dismutase (SOD) activity was measured following Dhindsa et al. [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], where one unit equals the amount of enzyme needed to inhibit 50% of nitroblue tetrazolium (NBT) reduction at 25\u0026deg;C. Reaction mixtures contained 50 mM Na-phosphate buffer (pH 7.6), 13 mM methionine, 75 \u0026micro;M NBT, 0.1 mM EDTA, 0\u0026ndash;50 \u0026micro;L enzyme extract, and 2 \u0026micro;M riboflavin. They were illuminated for 15 minutes with a 40 W fluorescent lamp before measuring absorbance at 560 nm. Catalase (CAT) activity, which is defined by the breakdown of H₂O₂ into water and oxygen, was determined as described by Aebi [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Ascorbate peroxidase (APX) activity was measured following Amako et al. [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] by mixing enzyme extract with 50 mM potassium phosphate buffer (pH 7.6), 0.5 mM ascorbate, and 0.1 M EDTA, then recording absorbance at 290 nm. Glutathione peroxidase (GPX) activity was assessed according to Resende [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], using pyrogallol (20 mM) and H₂O₂ (20 mM) as substrates, with absorbance read at 420 nm.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGene expression analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal RNA was isolated from standard bean samples using the GeneAll Ribospin kit (BioFrontier, Korea). First-strand cDNA synthesis was carried out using the RevertAid\u0026trade; First Strand cDNA Synthesis Kit (Fermentas, USA). Gene-specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were designed with PrimerQuest software based on known cDNA sequences. Actin served as the internal reference gene. Quantitative RT-PCR was conducted on a Step One Plus system (ABI, USA) using a HIFI SYBR Green kit. The thermal cycling protocol comprised an initial denaturation at 95\u0026deg;C for 180 s, followed by 35 cycles of 95\u0026deg;C for 10 s, 59\u0026deg;C for 10 s, and 72\u0026deg;C for 30 s.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for antioxidant gene expression analysis in common beans under salt stress.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence 5'\u0026rarr; 3'\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAmplicon Size (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTm (\u0026deg;C)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSOD-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGTGACCTGGGAAACATAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e140\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e62\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSOD-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTTCCACCAGCATTTCCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e62\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCAT-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACCAAACTATCTGCAACTTCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e135\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCAT-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCCAGAGCAGATAGCAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGPX-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCGCTTTAAATCTGAATTTCCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e150\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGPX-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTAATAGCGATCTACCACTTGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAPX-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTGGAGCGGCACACAAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e150\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAPX-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGCGGAATACAGGGTCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e62\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eActin-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGCCGTACAACTGGTATTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e163\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eActin-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTCTGCAGATGTGGTGAAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e61\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eData analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAll data were analyzed using SAS v.9.4, and mean comparisons were performed with the least significant difference (LSD) test at a 5% significance level. Primer Quest (IDT) was used for primer design, and the relative expression levels of the target genes compared to the reference control genes were analyzed using REST software [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. All analyses, including Pearson correlation analysis, principal component analysis (PCA), and heat map creation, were conducted with Origin Pro version 2022.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Relative water content\u003c/h2\u003e\u003cp\u003eThe relative water content (RWC) of leaves decreased in stressed plants compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). However, the exogenous application of salicylic acid (SA) and GR24 increased RWC, regardless of the salt conditions. Notably, the combination of 1 mM SA and 10 \u0026micro;M GR24 produced the highest increase in RWC under both normal and salt-stressed conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Electrolyte leakage and lipid peroxidation\u003c/h2\u003e\u003cp\u003eThe EL of leaves was found to result from stress-induced damage to the plasma membrane. Under stress, EL increased by 100% in stressed plants compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Notably, SA and GR\u003csub\u003e24\u003c/sub\u003e mitigated this adverse effect. The protective impact of SA and GR\u003csub\u003e24\u003c/sub\u003e was most pronounced under stress, as evidenced by the reduction in EL in treated plants compared to untreated ones. Exogenously applied SA and GR\u003csub\u003e24\u003c/sub\u003e inhibited EL in both genotypes under salt stress, with a significantly more significant reduction when used in combination (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The 1 mM SA and 10 \u0026micro;M GR\u003csub\u003e24\u003c/sub\u003e concentrations effectively countered oxidative stress-induced membrane damage, resulting in the highest MDA levels in untreated Naz genotype plants and the lowest in salt-stressed tolerant genotype plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Combining phytohormones proved to be the most effective method for reducing MDA levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Chlorophyll pigment and chlorophyll fluorescence\u003c/h2\u003e\u003cp\u003eSalt stress decreased leaf carotenoids, chlorophyll a, and chlorophyll b in both cultivars. However, the foliar application of phytohormones alleviated this decrease in chlorophyll content. Applying SA and GR24 to both tolerant and susceptible cultivars led to higher levels of chlorophyll and carotenoids compared to plants without one or both phytohormones (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-D). Additionally, the Fv/Fm ratio was higher in both cultivars when treated with SA and GR24 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Proline content\u003c/h2\u003e\u003cp\u003eThe exogenous application of SA and GR\u003csub\u003e24\u003c/sub\u003e reduced proline accumulation in both cultivars under salt stress, particularly when applied together. Notably, the susceptible cultivar had the highest proline content under salt stress. Although SA and GR\u003csub\u003e24\u003c/sub\u003e had no significant effect under control conditions, they substantially decreased the proline content in treated plants compared to untreated ones (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e3.5 H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content\u003c/h2\u003e\u003cp\u003eThe H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content changed notably, rising from 20.8 nmol g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW in control conditions to 40.9 nmol g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e FW under stress. The susceptible cultivar had higher H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e levels than the tolerant cultivar. However, treatment with SA and GR24 decreased H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e accumulation in both cultivars, with the most significant effect observed in tolerant cultivars treated with a combination of the two hormones, emphasizing the positive influence of these phytohormones (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e3.6 Protein content\u003c/h2\u003e\u003cp\u003eThe protein content decreased in both cultivars under stress conditions; however, the exogenous application of phytohormones reduced the damage. The highest protein level was observed in susceptible cultivars treated with both SA and GR24. Notably, treatment with 1 mM SA under stress further increased protein accumulation compared to stressed plants that did not receive hormonal treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e3.7 Antioxidant enzyme activity and gene expression\u003c/h2\u003e\u003cp\u003eSalt stress significantly increased the activity of SOD, CAT, APX, and GPX in both cultivars. Under stress conditions, CAT activity was 32.1 and 25.1 U mg protein in tolerant and susceptible cultivars, respectively. The application of phytohormones induced CAT activity in both cultivars under salt stress. Notably, the susceptible cultivar showed high CAT activity when treated with both phytohormones simultaneously, with SA alone significantly increasing CAT activity and GR\u003csub\u003e24\u003c/sub\u003e having a slight enhancing effect. The highest CAT activity, 40.85 U mg protein, occurred when plants received both phytohormones under stress conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFoliar spraying with SA and GR24, either separately or together, increased APX activity in both cultivars under salt stress and control conditions. In the control group, APX activity was higher in both cultivars treated with SA and GR24 compared to untreated plants. The highest APX activity was observed in the tolerant cultivar treated with both phytohormones, highlighting the effectiveness of using both hormones together across both cultivars and conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe results revealed that SA and GR\u003csub\u003e24\u003c/sub\u003e application enhanced GPX activity, with the highest levels observed in the tolerant cultivar under both normal and stress conditions. Notably, salt stress enhanced GPX activity in phytohormone-treated plants, with the most significant increase observed in 1 mM SA\u0026thinsp;+\u0026thinsp;10 \u0026micro;M GR24-treated plants under salt conditions, reaching 2.04 U mg protein in tolerant cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe results showed significant differences in SOD activity between tolerant and susceptible cultivars under stress and expected conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC, D). Salt stress increased SOD activity in both cultivars, with a more pronounced effect in susceptible cultivars. Phytohormone application enhanced enzyme activity, particularly in the Naz cultivar under salt stress. Moreover, phytohormones were effective in promoting SOD activity under salt conditions, especially with the SA\u0026thinsp;+\u0026thinsp;GR\u003csub\u003e24\u003c/sub\u003e treatment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe impact of exogenous SA and GR\u003csub\u003e24\u003c/sub\u003e on the expression of CAT, GPX, APX, and SOD genes was assessed using real-time PCR. Both SA and GR\u003csub\u003e24\u003c/sub\u003e significantly increased the expression of these genes in the two cultivars compared to the control. GPX expression was elevated by both phytohormones under normal and salt conditions, with the most significant increase in susceptible cultivars treated with SA. In contrast, tolerant cultivars showed the highest GPX expression when treated with both regulators under stress conditions. SOD activity was notably enhanced by 1mM SA and 1mM SA\u0026thinsp;+\u0026thinsp;10 \u0026micro;M GR\u003csub\u003e24\u003c/sub\u003e in susceptible cultivars, whereas all concentrations of both phytohormones moderately increased SOD expression in the tolerant cultivar (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe results showed that CAT and APX activity increased under salt stress in susceptible cultivars but decreased in tolerant cultivars without hormone treatment. Notably, 1mM SA enhanced CAT and APX expression in both control and salt-stressed plants. However, co-treatment with both phytohormones reduced APX expression in both cultivars, whereas CAT expression decreased only under normal conditions and increased slightly under stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e3.8 Pearson Correlation Analysis\u003c/h2\u003e\u003cp\u003ePearson correlation analysis showed positive relationships between proline, EL, MDA, SOD, H2O2, and EL in leaves (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Notably, EL was strongly linked with H2O2 (r\u0026thinsp;=\u0026thinsp;0.91), proline (r\u0026thinsp;=\u0026thinsp;0.81), MDA (r\u0026thinsp;=\u0026thinsp;0.81), and SOD (r\u0026thinsp;=\u0026thinsp;0.71). In contrast, EL had strong negative relationships with RWC (r = -0.89), chlorophyll b (r = -0.83), carotenoid (r = -0.66), and protein (r = -0.93). Protein content was moderately negatively related to MDA (r = -0.70), proline (r = -0.71), and EL, but positively associated with RWC, chlorophyll b, and carotenoids. Moreover, a positive relationship was found between the activity and expression of enzymes CAT, APX, SOD, and GPX (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.9 Hierarchical Clustering Analysis\u003c/h2\u003e\u003cp\u003eThe similarities and distances among all treatments were assessed using the group average and Euclidean distance index, then displayed as two cluster dendrograms for the Naz and Jules cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). Cluster analysis grouped treated and untreated plants based on physicochemical traits and gene expression, with a polar heat map showing the relationships between clusters (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe Naz cultivar formed three distinct clusters (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA). Cluster A included unstressed and untreated plants, as well as those treated with SA\u0026thinsp;+\u0026thinsp;SL, characterized by high relative water content (RWC) and moderate levels of chlorophyll b (Chl.b) and carotenoids. Cluster B consisted of stressed and untreated plants, showing high electrolyte leakage index (ELI) and moderate RWC, with notable H2O2 levels. Cluster C included plants treated with SA\u0026thinsp;+\u0026thinsp;SL and those grown in 200 mM NaCl (T8), which displayed high RWC, moderate H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, and moderate ELI.\u003c/p\u003e\u003cp\u003eIn the Jules cultivar, three distinct clusters appeared (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB). Group A included untreated plants and those treated with SA\u0026thinsp;+\u0026thinsp;SL (T2-T4), both of which had high relative water content (RWC) and moderate levels of carotenoid and chlorophyll b (Chl. b). Group B consisted of untreated plants grown with 200 mM NaCl, showing moderate RWC and a high electrolyte leakage index (ELI). Group C included plants treated with SA\u0026thinsp;+\u0026thinsp;SL in 200 mM NaCl, which displayed moderate RWC and ELI (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.10 Principal Component Analysis\u003c/h2\u003e\u003cp\u003eThe principal component analysis of phytochemical traits and gene expression revealed that the first two components explained 63% of the variation, with 42% attributed to the first component and 21% to the second. The analysis grouped carotenoids, chlorophyll a, APX activity and gene expression, relative water content, and proteins, indicating strong similarities among these traits. In contrast, proline, SOD activity, electrolyte leakage, CAT activity, and GPX gene expression formed a distinct cluster (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003ePlants employ a variety of morphological, biochemical, and physiological adjustments to cope with salt stress. In this study, we evaluated whether exogenous application of salicylic acid (SA) and the synthetic strigolactone analog GR24 could alleviate the adverse effects of salinity in common bean plants. In treated plants, SA or GR24 improved salt tolerance, as evidenced by reduced electrolyte leakage and membrane damage, increased relative water content (RWC) and osmoprotectant accumulation, and elevated antioxidant enzyme activities (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOur results showed that RWC was higher in salt-stressed bean plants treated with SA or GR24. This is consistent with [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], who found that combined SA\u0026thinsp;+\u0026thinsp;GR24 application increased leaf RWC in drought-stressed wheat. The beneficial role of SA in salt stress tolerance is well-established: for example, SA improves salt tolerance in wheat [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], maize [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], and other species [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. SA is known to modulate salt tolerance [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] and stomatal conductance [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], processes that strigolactones can influence. Moreover, [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] observed that strigolactone treatment induced SA accumulation, an effect not seen in GR24-signaling mutants, suggesting that GR24 may affect stress responses by elevating endogenous SA levels.\u003c/p\u003e\u003cp\u003eTo investigate oxidative stress under salinity, we quantified hydrogen peroxide (H₂O₂), malondialdehyde (MDA), and electrolyte leakage (EL) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e), all indicators of membrane oxidative damage. Salt stress is known to induce oxidative stress in crops such as wheat [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], soybean [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], maize [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], and black bean [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In our experiments, exogenous SA or GR24 treatments significantly reduced these oxidative stress markers in salt-stressed beans. This is in line with reports that combined SA\u0026thinsp;+\u0026thinsp;GR24 or MeJA\u0026thinsp;+\u0026thinsp;GR24 applications lower EL, MDA, and H₂O₂ under drought in wheat and \u003cem\u003eDracocephalum kotschyi\u003c/em\u003e [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. While SA\u0026rsquo;s role in mitigating oxidative damage is well-documented, the exact mechanism by which GR24 exerts similar antioxidant effects remains to be elucidated.\u003c/p\u003e\u003cp\u003eSalt stress lowered chlorophyll and carotenoid levels in leaves (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), reflecting the known impact of salinity-induced photo-oxidation and pigment degradation [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Reduced chlorophyll indicates inhibited pigment biosynthesis and damage to the photosystems, leading to diminished light capture and increased ROS generation [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In our study, decreased chlorophyll content likely contributed to reduced photosynthetic efficiency (consistent with previous findings) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Treatment with SA and/or GR24 ameliorated these effects: similar mitigation of stress-induced pigment decline has been observed in kidney bean [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], \u003cem\u003eDracocephalum kotschyi\u003c/em\u003e [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], and rice [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] when treated with SA, GR24, or related phytohormones.\u003c/p\u003e\u003cp\u003eIn our experiments, pigment losses were partially prevented by SA or GR24, especially under combined SA\u0026thinsp;+\u0026thinsp;GR24 treatment. Salt-induced accumulation of superoxide (O₂⁻) and H₂O₂ drives lipid peroxidation and chlorophyll degradation [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. By lowering H₂O₂ content and boosting antioxidant enzyme activities, SA and GR24 helped maintain chlorophyll and carotenoid levels, thereby improving stress tolerance. This effect likely reflects their stimulatory impact on pigment biosynthesis pathways.\u003c/p\u003e\u003cp\u003eSalt stress is also known to impair photosystem II (PSII) and Rubisco activity, halting ATP production and causing excess free oxygen in chloroplasts [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In contrast, the SA application has been shown to stimulate PSII and Rubisco activities, thereby enhancing ATP generation for CO₂ fixation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Thus, a combined SA\u0026thinsp;+\u0026thinsp;GR24 treatment may help preserve PSII function and chlorophyll integrity under saline conditions.\u003c/p\u003e\u003cp\u003eSaline conditions also disturb water relations and osmotic balance in plant tissues, prompting accumulation of compatible solutes [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Common osmolytes include proline, glycine betaine, soluble sugars, and proteins [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e], which stabilize cellular osmotic pressure and can scavenge ROS [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Proline, in particular, protects macromolecules and cellular structures under salt stress [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In our study, exogenous SA and GR24 reduced proline levels in salt-stressed beans, mirroring observations in tomato [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] and stevia [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. This decrease in proline coincided with lower MDA and electrolyte leakage, indicating that SA\u0026thinsp;+\u0026thinsp;GR24 treatments alleviated osmotic and oxidative stress.\u003c/p\u003e\u003cp\u003ePlants counteract ROS using enzymatic defenses (e.g., SOD, CAT, POD, APX, and GPX) and non-enzymatic antioxidants. SOD converts superoxide to H₂O₂, which CAT and peroxidases then detoxify. Salt stress typically upregulates these enzymes [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Hormonal treatments can further enhance this response: for example, SA\u0026thinsp;+\u0026thinsp;GR24 increased SOD, POD, and CAT activities in water-stressed wheat [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Foliar SA is also known to elevate antioxidant enzyme activities, reduce MDA, and improve stress tolerance [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In our experiments, SA, GR24, and SA\u0026thinsp;+\u0026thinsp;GR24 all raised antioxidant enzyme activities and lowered MDA levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This suggests a positive feedback loop between SA signaling and ROS scavenging under stress.\u003c/p\u003e\u003cp\u003eOur results showed that the application of GR24 enhanced antioxidant enzymes both alone and in combination with SA (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e and \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). This supports previous findings: GR24 treatment increased SOD and peroxidase activities and decreased MDA in stressed rapeseed [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Similarly, rice treated with GR24 showed higher activities of CAT, POX, SOD, and APX, along with reduced lipid peroxidation under salt stress [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In tomato, strigolactones were found to induce antioxidant enzyme expression (including SOD, APX, GR, and CAT) under heat and cold stress [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], and comparable effects were observed in sugarcane under drought and salinity [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Collectively, these studies suggest that strigolactones generally boost enzymatic antioxidant defenses during abiotic stress.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn summary, exogenous SA and GR24 treatments reduced salt stress damage in common bean plants. The combined use of SA (1 mM) and GR24 (10 \u0026micro;M) had a synergistic effect, significantly lowering oxidative stress markers. Treated plants displayed improved water status, decreased levels of MDA, electrolyte leakage, and H₂O₂, and reduced proline accumulation, indicating better osmotic regulation. These findings suggest that SA and GR24 work together to enhance salt tolerance and strengthen the plant\u0026rsquo;s defense mechanisms (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contribution:\u0026nbsp;\u003c/strong\u003eM.S. investigation, original draft writing, conceptualization, and methodology. \u0026nbsp;M.S.A. original draft writing, data evaluation, and validation. \u0026nbsp;G.P. Data analyses. \u0026nbsp;B.D. Visualization, review, and final editing. All authors have read and agreed to the published final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThe University of Tehran supported this research by providing all the necessary equipment and facilities.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e: The datasets generated and/or analyzed during the current study are available from the corresponding author upon request.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eAll results obtained in this study are presented here.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest:\u0026nbsp;\u003c/strong\u003eAll authors declare that there is no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical studies:\u003c/strong\u003e Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest:\u003c/strong\u003e The Authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish:\u003c/strong\u003e Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Declaration: \u003c/strong\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBeebe SE, Rao IM, Blair MW, Acosta-Gallegos JA (2013)Phenotyping common beans for adaptation to drought. Front. Physiol. 4:1\u0026ndash;20. https://doi.org/10.3389/fphys.2013.00035\u003c/li\u003e\n\u003cli\u003eGopalakrishnan T, Kumar L (2020) Modeling and mapping soil salinity and its impact on paddy lands in Jaffna Peninsula, Sri Lanka. Sustainability 12:1 15. https://doi.org/10.3390/su12208317\u003c/li\u003e\n\u003cli\u003eMachado RMA, Serralheiro RP (2017). Soil salinity: effect on vegetable crop growth. Management Practices to Prevent and Mitigate Soil Salinization. Horticulturae 3:1 13. https://doi.org/:10.3390/horticulturae3020030\u003c/li\u003e\n\u003cli\u003eLiang W, Ma X, Wan P, Liu L (2018) Plant salt-tolerance mechanism: A review. Biochem. Biophys Res Commun 495:286 291. https://doi.org/10.1016/j.bbrc.2017.11.043\u003c/li\u003e\n\u003cli\u003eAsfaw A, Blair MW (2014) Quantifying drought tolerance in Ethiopian common bean varieties. Agric Sci 5:124-139. https://doi.org/10.4236/as.2014.52016\u003c/li\u003e\n\u003cli\u003eAl Hassan M, Morosan M, L\u0026oacute;pez-Gresa MDP, Prohens J, Vicente O, Boscaiu M (2016) Salinity-induced and variation in biochemical markers provide insight into the mechanisms of salt tolerance in common (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e) and runner (\u003cem\u003eP. coccineus\u003c/em\u003e) beans. Int J Mol Sci 17:1582. https://doi.org/doi: 10.3390/ijms17091582\u003c/li\u003e\n\u003cli\u003eSarkar S, Khatun M, Era FM, Islam A.M.M., Anwar M.P., Danish S, Datta R., Islam A.K.M.A. (2021)Abiotic stresses: Alteration of composition and grain quality in food legumes. Agronomy 11:1 24. https://doi.org/10.3390/agronomy11112238\u003c/li\u003e\n\u003cli\u003eFarooq M, Gogoi N, Hussain M, Barthakur S, Paul S, Bharadwaj N, Migdadi HM, Alghamdi SS, Siddique KHM (2017) Effects, tolerance mechanisms and management of salt stress in grain legumes. Plant Physiol Biochem 118:199 217. https://doi.org/10.1016/j.plaphy.2017.06.020\u003c/li\u003e\n\u003cli\u003eTorche Y, Blair M, Said C (2018) Biochemical, physiological, and phenological genetic analysis in common bean (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.) under salt stress. Ann Agric Sci 63:153 161. https://doi.org/10.1016/j.aoas.2018.10.002\u003c/li\u003e\n\u003cli\u003eSharma A, Shahzad B, Kumar V, Kohli SK, Sidhu GPS, Bali AS, Handa N, Kapoor D, Bhardwaj R, Zheng B (2019). Phytohormones regulate the accumulation of osmolytes under abiotic stress. Biomolecules 9:1 36. https://doi.org/10.3390/biom9070285\u003c/li\u003e\n\u003cli\u003eKhan MIR, Fatma M, Per TS, Anjum NA, Khan NA (2015) Salicylic acid-induced abiotic stress tolerance and underlying mechanisms in plants. Front. Plant Sci. 6: 1\u0026ndash;17. https://doi.org/10.3389/fpls.2015.00462\u003c/li\u003e\n\u003cli\u003eKhan A, Pan X, Najeeb U, Tan DKY, Fahad S, Zahoor R, Luo H (2018) Coping with drought: stress and adaptive mechanisms, and management through cultural and molecular alternatives in cotton as vital constituents for plant stress resilience and fitness. Biol Res 51:1 17. https://doi.org/10.1186/s40659-018-0198-z\u003c/li\u003e\n\u003cli\u003eKeshavarz H, Sanavy SAMM (2016). How salicylic acid modulates photosynthetic pigments, growth, and canola yield. J Glob Agric Ecol 2(1):1-9. https://doi.org/10.22080/JGR.2016.1475\u003c/li\u003e\n\u003cli\u003eHusen A, Iqbal M, Sohrab SS. Ansari MKA (2018) Salicylic acid alleviates salinity-caused damage to foliar functions, plant growth, and antioxidant systems in Ethiopian mustard (\u003cem\u003eBrassica carinata\u003c/em\u003e A. Br.). Agric. Food Security 7:1 14. https://doi.org/10.1186/s40066-018-0194-0\u003c/li\u003e\n\u003cli\u003eHabibi G (2013). Effect of drought stress and selenium spraying on photosynthesis and antioxidant activity of spring barley. Acta Agric Slov 101:31 29. https://doi.org/10.2478/acas-2013-0004\u003c/li\u003e\n\u003cli\u003eKang G, Li G, Xu W, Peng X, Han Q, Zhu Y, Guo T (2012) Proteomics reveals the effects of salicylic acid on growth tolerance to subsequent drought stress in wheat. J Proteome Res 11: 6066\u0026ndash;6079. https://doi.org/10.1021/pr300728y\u003c/li\u003e\n\u003cli\u003eDawood MFA, Zaid A, Latef AAHA (2022). Salicylic acid spraying-induced resilience strategies against the damaging impacts of drought and/or salinity stress in two varieties of \u003cem\u003eVicia faba\u003c/em\u003e L. seedlings. J Plant Growth Reg. 41:1919 1942. https://doi.org/10.1007/s00344-021-10381-8\u003c/li\u003e\n\u003cli\u003eHeidarian F, Roshandel P. (2021) Salicylic acid improves tolerance against salt stress by boosting the antioxidant defense system in black beans. Int. J. Hort. Sci. Technol. 10:1\u0026ndash;14. https://doi.org/10.1016/j.heliyon.2024.e34486\u003c/li\u003e\n\u003cli\u003eGogna M, Kumar R, Tiwari L D, Tailor A, Kumari A, Mehta S (2023). Strigolactones: A new player in regulating adventitious root formation. In Environmental, Physiological and Chemical Controls of Adventitious Rooting in Cuttings 343\u0026ndash;366. https://doi.org/10.1016/B978-0-323-90636-4.00004-0\u003c/li\u003e\n\u003cli\u003eBhoi A, Yadu B, Chandra J, Keshavkant S (2021) Contribution of strigolactone in plant physiology, hormonal interaction, and abiotic stresses. Planta, 254:1-21. https://doi.org/10.1007/s00425-021-03678-1\u003c/li\u003e\n\u003cli\u003eLing F, Su Q, Jiang H, Cui J, He X, Wu Z, Zhang Z, Liu J, Zhao Y (2020) Effects of strigolactone on photosynthetic and physiological characteristics in salt-stressed rice seedlings. Sci Rep 10: 1\u0026ndash;8. https://doi.org/10.1038/s41598-020-63352-6\u003c/li\u003e\n\u003cli\u003eLiu J, Lovisolo C, Schubert A, Cardinal F (2013) Signaling role of strigolactones at the interface between plants, microorganisms, and a changing environment. J Plant Interact 8: 17\u0026ndash;33. https://doi.org/10.1080/17429145.2012.750692\u003c/li\u003e\n\u003cli\u003eRuiz-Lozano JM, Aroca R, Zamarre\u0026ntilde;o \u0026Aacute;M, Molina S, Andreo-Jim\u0026eacute;nez B, Porcel R, Garc\u0026iacute;a‐Mina JM, Ruyter-Spira C, L\u0026oacute;pez‐R\u0026aacute;ez JA (2016) Arbuscular mycorrhizal symbiosis induces strigolactone biosynthesis under drought and improves drought tolerance in lettuce and tomatoes. Plant Cell Environ 39: 441\u0026ndash;452. https://doi.org/10.1111/pce.12631\u003c/li\u003e\n\u003cli\u003eVisentin I, Pagliarani C, Deva E, Caracci A, Turečkov\u0026aacute; V, Nov\u0026aacute;k O, Lovisolo C, Schubert A, Cardinale F (2020) A novel strigolactone-miR156 module controls stomatal behavior during drought recovery. Plant. Cell Environ 43:1613 1624. https://doi.org/10.1111/pce.13758\u003c/li\u003e\n\u003cli\u003eMostofa MG, Li W, Nguyen KH, Fujita M, Tran P (2018) Strigolactones in plant adaptation to abiotic stresses: An emerging avenue of plant research. Plant Cell Environ 41: 2227\u0026ndash;2243. https://doi.org/10.1111/pce.13364\u003c/li\u003e\n\u003cli\u003eNguyen HTT, Das Bhowmik S, Long H, Cheng Y, Mundree S, Hoang LTM (2021) Rapid proline accumulation enhances salinity tolerance in Australian wild rice \u003cem\u003eOryza australiensis\u003c/em\u003e domain. Plants 10:1 16. https://doi.org/10.3390/plants10102044\u003c/li\u003e\n\u003cli\u003eFAOSTAT (2024) Dry bean production in 2022, Crops/Regions/World list/Production Quantity/Year. UN Food and Agriculture Organization, Corporate Statistical Database. Retrieved 20 December 2024.\u003c/li\u003e\n\u003cli\u003eAzimychetabi Z, Sabokdast M (2021) Physiological and biochemical responses of four common bean genotypes (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.) under salt stress. J. Agric. Sci. Technol. 23:1091 1103.\u003c/li\u003e\n\u003cli\u003eLuisi A, Lorenzi R, Sorce C (2011) Strigolactone may interact with gibberellin to control apical dominance in peas (\u003cem\u003ePisum sativum\u003c/em\u003e). Plant Growth Reg 65:415-419. https://doi.org/10.1007/s10725-011-9603-0\u003c/li\u003e\n\u003cli\u003eTayyab N, Naz R, Yasmin H, Nosheen A, Keyani R, Sajjad M, Hassan MN, Roberts TH (2020). Combined seed and foliar pre-treatments with exogenous methyl jasmonate and salicylic acid mitigate drought-induced stress in maize. PLoS One 1:1\u0026ndash;18. https://doi.org/10.1371/journal.pone.0232269\u003c/li\u003e\n\u003cli\u003eHodges DM, DeLong JM, Forney ChF, Prange RK (1999). Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207: 604\u0026ndash;611. https://doi.org/10.1007/s004250050524\u003c/li\u003e\n\u003cli\u003eVelikova V, Yordanov I, Edreva A (2000) Oxidative stress and some antioxidant systems in acid rain-treated bean plants: protective role of exogenous polyamines. Plant Sci 151:59 66. https://doi.org/10.1016/S0168-9452(99)00197-1\u003c/li\u003e\n\u003cli\u003eBates LS, Waldren RP, Teare ID (1973) Rapid determination of free proline for water-stress studies. Plant Soil 39:205-207. https://doi.org/10.1007/BF00018060\u003c/li\u003e\n\u003cli\u003eArnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenol oxidase in \u003cem\u003eBeta vulgaris\u003c/em\u003e. Plant Physiol. 24:1\u0026ndash;15. https://doi.org/10.1104/pp.24.1.1\u003c/li\u003e\n\u003cli\u003eBradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal Biochem 72:248\u0026ndash;254. https://doi.org/10.1016/0003-2697(76)90527-3\u003c/li\u003e\n\u003cli\u003eDhindsa RS, Plumb-Dhindsa P, Thorpe TA (1981) Leaf senescence: correlated with increased levels of membrane permeability, lipid peroxidation, and decreased superoxide dismutase and catalase levels. J Exp Bot 32:93 101. https://doi.org/10.1093/jxb/32.1.93\u003c/li\u003e\n\u003cli\u003eAebi, H (1984). Catalase \u003cem\u003ein vitro\u003c/em\u003e. Methods Enzymol105:121-126. https://doi.org/10.1016/s0076-6879(84)05016-3\u003c/li\u003e\n\u003cli\u003eAmako K, Chen GX, Asada K (1994) Separate assays specific for ascorbate peroxidase and guaiacol peroxidase and the chloroplastic and cytosolic isozymes of ascorbate peroxidase in plants. Plant Cell Physiol 35:497 504. https://doi.org/10.1093/oxfordjournals.pcp.a078621\u003c/li\u003e\n\u003cli\u003eResende MLV de, Nojosa GBA, Cavalcanti LS, Aguilar MAG, Silva L, Perez JO, Andrade GCG, Carvalho GA, Castro RM (2002) Induction of resistance in cocoa against \u003cem\u003eCrinipellis perniciosa\u003c/em\u003e and \u003cem\u003eVerticillium dahliae\u003c/em\u003e by acibenzolar‐ S‐ methyl (ASM). Plant Pathol 51:621-628. https://doi.org/10.1046/j.1365-3059.2002.00754.x\u003c/li\u003e\n\u003cli\u003ePfaffl MW, Tichopad A, Prgomet C, Neuvians TP (2004) Determination of stable housekeeping genes, differentially regulated target genes, and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol Lett 26:509 515. https://doi.org/10.1023/b:bile.0000019559.84305.47\u003c/li\u003e\n\u003cli\u003eSedaghat M, Tahmasebi-Sarvestani Z, Emam Y, Mokhtassi-Bidgoli A (2017) Physiological and antioxidant responses of winter wheat cultivars to strigolactone and salicylic acid in drought. Plant Physiol Biochem 119:59 69. https://doi.org/10.1016/j.plaphy.2017.08.015\u003c/li\u003e\n\u003cli\u003eArfan M, Athar HR, Ashraf M (2007) Does exogenous application of salicylic acid through the rooting medium modulate growth and photosynthetic capacity in two differently adapted spring wheat cultivars under salt stress? J Plant Physiol 164: 685\u0026ndash;694. https://doi.org/10.1016/j.jplph.2006.05.010\u003c/li\u003e\n\u003cli\u003eElhakem A. (2020). Salicylic acid ameliorates salinity tolerance in maize by regulating phytohormones and osmolytes. Plant Soil Environ 66: 533\u0026ndash;54. https://doi.org/10.17221/441/2020-PSE\u003c/li\u003e\n\u003cli\u003eMimouni H, Wasti S, Manaa A, Gharbi E, Chalh A, Vandoorne B, Lutts S, Ahmed H Ben (2016). Does salicylic acid (SA) improve tolerance to salt stress in plants? A study of SA effects on tomato plant growth, water dynamics, photosynthesis, and biochemical parameters. OMICS20: 180\u0026ndash;190. https://doi.org/10.1089/omi.2015.0161\u003c/li\u003e\n\u003cli\u003eAskari E, Ehsanzadeh P (2015) Drought stress mitigation by foliar application of salicylic acid and its Interactive effects on physiological characteristics of fennel (\u003cem\u003eFoeniculum vulgare\u003c/em\u003e Mill.) genotypes. Acta Physiol Plant 37:1 14. https://doi.org/10.1007/s11738-014-1762-y\u003c/li\u003e\n\u003cli\u003eProdhan MY, Munemasa S, Nahar MNEN, Nakamura Y, Murata (2018) Guard cell salicylic acid signaling is integrated into abscisic acid signaling via the Ca2+/CPK-dependent pathway. Plant Physiol 178: 441\u0026ndash;450. https://doi.org/10.1104/pp.18.00321\u003c/li\u003e\n\u003cli\u003eRozpądek P, Domka AM, Nosek M, Ważny R, Jędrzejczyk RJ, Wiciarz M, Turnau K (2018) The role of strigolactone in the cross-talk between Arabidopsis thaliana and the endophytic fungus Mucor sp. Front Microbiol 9:1 14. https://doi.org/10.3389/fmicb.2018.00441\u003c/li\u003e\n\u003cli\u003eRazmi N, Ebadi A, Daneshian J, Jahanbakhsh S (2017) Salicylic acid-induced changes in the antioxidant capacity, pigments, and grain yield of soybean genotypes under water deficit conditions. J. Plant Interact. 12: 457\u0026ndash;464. https://doi.org/10.1080/17429145.2017.1392623\u003c/li\u003e\n\u003cli\u003eHeidarian F, Roshandel P. (2021) Salicylic acid improves tolerance against salt stress by boosting the antioxidant defense system in black beans. Int. J. Hort. Sci. Technol. 10:1\u0026ndash;14. https://doi.org/10.1016/j.heliyon.2024.e34486\u003c/li\u003e\n\u003cli\u003eShirani Bidabadi S, Sharifi P (2021) Strigolactone and methyl Jasmonate-induced antioxidant defense and the composition alterations of different active compounds in \u003cem\u003eDracocephalum kotschyi\u003c/em\u003e Boiss under drought stress. J Plant Growth Reg 40: 878\u0026ndash;889. https://doi.org/10.1007/s00344-020-10157-6\u003c/li\u003e\n\u003cli\u003eYang Y, GuoY (2018) Unraveling salt stress signaling in plants. J Integr Plant Biol 60:796\u0026ndash;804. https://doi.org/10.1111/jipb.12689\u003c/li\u003e\n\u003cli\u003eDalal VK, Tripathy BC (2018) Water stress-induced downsizing of light-harvesting antenna complex protects developing rice seedlings from photo-oxidative damage. Sci Rep 8:1 16. https://doi.org/10.1038/s41598-017-14419-4\u003c/li\u003e\n\u003cli\u003eGalindo-Casta\u0026ntilde;eda T, Lynch JP, Six J, Hartmann M (2022) Improving plant soil resource uptake by capitalizing on synergies between root architecture, anatomy, and root-associated microorganisms. Front Plant Sci 13:1\u0026ndash;15. https://doi.org/10.3389/fpls.2022.827369\u003c/li\u003e\n\u003cli\u003eZhao H, Liang H, ChuY, Sun C, Wei N, Yang M, Zheng C (2019.)Effects of salt stress on chlorophyll fluorescence and the antioxidant system in \u003cem\u003eGinkgo biloba\u003c/em\u003e L. seedlings. HortScience 54: 2125\u0026ndash;2133. https://doi.org/10.1038/nature23667\u003c/li\u003e\n\u003cli\u003eChen K, Song M, Guo Y, Liu L, Xue H, Dai H, Zhang Z (2019). Md MYB 46 could enhance apple salt and osmotic stress tolerance by directly activating stress-responsive signals. Plant Biotechnology J 17: 2341\u0026ndash;2355. https://doi.org/10.1111/pbi.13151\u003c/li\u003e\n\u003cli\u003eNadeem M, Li J, Yahya M, Sher A, Ma C, Wang X, Qiu L (2019) Research progress and perspective on drought stress in legumes: A review. Int. J. Mol. Sci. 20: 1\u0026ndash;32. https://doi.org/10.3390/ijms20102541\u003c/li\u003e\n\u003cli\u003eAkbarpour V. (2019). The effect of putrescine and salicylic acid on physiological characteristics and antioxidants in Stevia rebaudiana B. under salinity stress. J Crop Breed 11:40 54. https://doi.org/10.29252/jcb.11.29.40\u003c/li\u003e\n\u003cli\u003eCao Y, Luo Q, Tian Y, Meng F (2017) Physiological and proteomic analyses of the drought stress response in \u003cem\u003eAmygdalus mira\u003c/em\u003e (Koehne) Y\u0026uuml; et Lu roots. BMC Plant Biol 17:1 16. https://doi.org/10.1186/s12870-017-1000-z\u003c/li\u003e\n\u003cli\u003eCHi C, Xu X, Wang M, Zhang H, Fang P, Zhou J, Xia X, Shi K, Zhou Y, Yu J (2021) Strigolactones positively regulate abscisic acid-dependent heat and cold tolerance in tomatoes. Hortic. Res. 8 (237): 1\u0026ndash;15. https://doi.org/10.1038/s41438-021-00668-y\u003c/li\u003e\n\u003cli\u003eKaura V, Malhotra, PK, Mittal, A. (2023). Physiological, biochemical, and gene expression responses of sugarcane under cold, drought, and salt stresses. J Plant Growth Reg 42:6367 6376. https://doi.org/10.1007/s00344-022-10850-8\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"discover-agriculture","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Agriculture](https://www.springer.com/journal/44279)","snPcode":"44279","submissionUrl":"https://submission.nature.com/new-submission/44279/3","title":"Discover Agriculture","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Phaseolus vulgaris L, Salt, Abiotic stress, salicylic acid, Strigolactone, Antioxidant system","lastPublishedDoi":"10.21203/rs.3.rs-7284816/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7284816/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSalinity is a major abiotic stress that greatly reduces crop yields worldwide. The common bean is especially vulnerable to damage from salinity. In this study, we examined the physiological and molecular responses of salt-stressed common bean plants to foliar applications of salicylic acid (SA) and the synthetic strigolactone analogue GR24. Salt stress increased electrolyte leakage and proline levels while decreasing relative water content, total protein, and photosynthetic pigments. Applying either SA or GR24 alone improved tolerance, but using both together provided even greater protection, mainly by reducing electrolyte leakage. Both treatments boosted antioxidant enzyme activities, such as ascorbate peroxidase, superoxide dismutase, and catalase, by promoting protein synthesis or preventing degradation. The combined use of SA and GR24 partially restored photosynthetic pigment levels under salinity. The expression of SOD, CAT, APX, and GPX genes was upregulated in plants treated with both SA and GR24 under salt stress, emphasizing the role of these enzymes in maintaining redox balance and stress tolerance. Overall, SA and GR24 (1 mM SA\u0026thinsp;+\u0026thinsp;10 \u0026micro;M GR24) worked together to enhance bio-physiological and metabolic functions under salinity, offering a promising strategy to support plant recovery.\u003c/p\u003e","manuscriptTitle":"Strigolactone and salicylic acid simultaneously enhance the resilience of common bean against salt stress by strengthening the antioxidant defense system","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-29 18:14:19","doi":"10.21203/rs.3.rs-7284816/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-30T07:39:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-03T07:14:43+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-27T18:34:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"227348836316147501096155414913406310076","date":"2025-08-27T17:36:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"66105466058385640332492930492938914197","date":"2025-08-26T17:38:51+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-26T06:58:03+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-25T10:35:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"45698434391177102502549919534422945823","date":"2025-08-25T08:59:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"322282474818472764823631401049506809778","date":"2025-08-22T04:13:25+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"58564219257739078090700750450304640971","date":"2025-08-22T02:49:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"204224058430649820472851374243303886454","date":"2025-08-22T01:06:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"324513827610049914162982970341301208892","date":"2025-08-22T00:16:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-21T16:22:35+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-19T16:18:12+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-08-18T14:29:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-16T13:03:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Discover Agriculture","date":"2025-08-16T13:00:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"discover-agriculture","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Agriculture](https://www.springer.com/journal/44279)","snPcode":"44279","submissionUrl":"https://submission.nature.com/new-submission/44279/3","title":"Discover Agriculture","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5f89a560-5090-4799-9fcb-e61efa2513fa","owner":[],"postedDate":"August 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-03-05T05:24:03+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-29 18:14:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7284816","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7284816","identity":"rs-7284816","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00