Novel Small Molecule DZ-865B Effectively Degrades BCL6, Promotes Apoptosis and Reduces Proliferation of Diffuse Large B-Cell Lymphoma Cells

preprint OA: closed
Full text JSON View at publisher
Full text 88,560 characters · extracted from preprint-html · click to expand
Novel Small Molecule DZ-865B Effectively Degrades BCL6, Promotes Apoptosis and Reduces Proliferation of Diffuse Large B-Cell Lymphoma Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Novel Small Molecule DZ-865B Effectively Degrades BCL6, Promotes Apoptosis and Reduces Proliferation of Diffuse Large B-Cell Lymphoma Cells Yanfeng Wang, Beier Jiang, Yichen Yin, Tao Li, Jing Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6003136/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract B-cell lymphoma 6 (BCL6) is a transcriptional repressor essential for B lymphocyte differentiation and germinal center formation through its BTB structural domain. Overexpression of BCL6 is strongly implicated in the progression of diffuse large B-cell lymphoma (DLBCL), making it a promising therapeutic target. This study aims to identify a novel small molecule, synthesized via proteolysis-targeting chimeras (PROTACs), capable of degrading BCL6, thereby inhibiting DLBCL growth and providing a foundation for future preclinical studies. The expression of BCL6 in DLBCL was analyzed using The Cancer Genome Atlas (TCGA) database and the Human Protein Atlas. Western blotting assays confirmed BCL6 expression in tumor cell lines, leading to the identification of the small molecule compound DZ-865B. To evaluate DZ-865B’s in vitro efficacy, multiple assays were performed, including protein immunoblotting, immunofluorescence, quantitative PCR, EDU proliferation, and soft agar cloning assays. TCGA analysis revealed significant overexpression of BCL6 in DLBCL (P < 0.05), corroborated by immunohistological staining and western blotting. DZ-865B induced BCL6 degradation in DLBCL cell lines (OCI-LY-1 and SU-DHL-4) in a concentration- and time-dependent manner, reducing nuclear BCL6 levels. Notably, DZ-865B did not alter BCL6 mRNA levels but modulated downstream gene expression, leading to the activation of apoptosis pathway proteins and inhibition of DNA synthesis, effectively suppressing DLBCL cell growth. This study demonstrates that the small molecule DZ-865B targets and degrades BCL6 in DLBCL cells, promoting apoptosis and inhibiting cellular proliferation. These findings highlight DZ-865B as a potential therapeutic agent for diffuse large B-cell lymphoma. Diffuse large B-cell lymphoma B-cell lymphoma 6 PROTACs proliferation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Recent GLOBOCAN data highlight the global burden of non-Hodgkin's lymphoma (NHL), with approximately 553,000 new cases anticipated in 2022, accounting for 5.5% of all new cancer diagnoses. Additionally, NHL is projected to cause around 250,000 deaths worldwide, representing 2.4% of all cancer-related mortality( 1 ). Diffuse large B-cell lymphoma (DLBCL), the most common subtype of NHL, comprises roughly one-third of all NHL cases( 2 – 4 ). Current treatment for DLBCL primarily relies on chemoimmunotherapy, yet approximately 30% of patients experience early relapse, and 10% display treatment-refractory disease( 5 ). The germinal center B-cell (GCB) subtype, defined by CD10 + and BCL6 + markers, constitutes around half of all DLBCL cases. While the GCB subtype generally exhibits a better prognosis compared to the activated B-cell (ABC) subtype, the high genetic heterogeneity within DLBCL frequently leads to unpredictable clinical outcomes( 6 ). A significant genetic alteration associated with DLBCL is the chromosomal translocation involving the BCL6 gene, present in approximately 50% of cases( 7 ). BCL6, located on chromosome 3q27, encodes a 95 kDa transcriptional repressor essential for the formation of germinal centers in B-cell follicles during antigenic stimulation( 8 ). Structurally, the BCL6 protein contains three functional domains that contribute to DLBCL pathogenesis by regulating B-cell activation, differentiation, cell cycle arrest, and apoptosis( 9 , 10 ). Dysregulated BCL6 expression not only drives DLBCL progression but has also been implicated in various other malignancies. Elevated BCL6 levels have been detected in acute myeloid leukemia( 11 ), glioma( 12 ), ovarian cancer( 13 ), non-small cell lung cancer( 14 , 15 ), gastric cancer( 16 ), and breast cancer( 17 , 18 ), underscoring its role as a broader oncogenic factor. PROTAC (Proteolysis-Targeting Chimeras) technology has shown significant potential in the targeted degradation of disease-related proteins( 19 ), including BCL6. Several BCL6-targeting PROTAC degraders have been developed, demonstrating promising preclinical results( 20 ). For instance, BI-3802 promotes BCL6 polymerization and facilitates its interaction with the SIAH1 ubiquitin ligase, resulting in BCL6 ubiquitination and subsequent proteasomal degradation( 21 ). Although both BI-3802 and its analog BI-3812 effectively inhibit BCL6, allowing the reactivation of BCL6-repressed tumor suppressor genes, their limited bioavailability constrains their therapeutic potential for patients with BCL6-positive DLBCL( 21 ). Another compound, CCT373566, has been shown to induce BCL6 degradation in DLBCL cell lines; however, despite this degradation, it did not achieve sufficient antiproliferative effects, even in an extended 16-day proliferation study( 22 ). In the present study, to address the need for effective small-molecule degraders targeting BCL6 in GCB-DLBCL cells, we initially explored the expression in DLBCL compared with normal and other leukemia using bioinformatic analysis, validated by western blot in the different cells. We evaluated DZ-865B, a promising compound capable of inducing BCL6 degradation from our previous reports( 23 ). Using in vitro assays with GCB-carrying DLBCL cell lines, we further characterized the biological effects of DZ-865B on cell viability and growth suppression. This study also investigates the downstream molecular consequences of BCL6 degradation, providing insights into how DZ-865B modulates key signaling pathways associated with cell cycle regulation and apoptosis in DLBCL cells. Collectively, these findings highlight DZ-865B as a potential therapeutic candidate for BCL6-positive DLBCL, supporting its further preclinical evaluation. Experimental Section and Methods 1. Cell culture The human diffuse large B-cell lymphoma cells OCI-LY-1 and SU-DHL-4 cell lines were purchased from Zhejiang Mason Cell Technology Co. Gastric cancer cell lines HGC-45, HGC-27, and AGS were purchased from Wuhan Prolife Technology Co. 2. Western blotting Whole cell proteins were extracted using the Whole Protein Extraction Kit. After sonication, the samples were centrifuged at 12,000 rpm for 15 minutes at 4°C and the total protein concentration of the samples was determined using the Micro BCA™ Protein Assay Kit (Cat. NO.23235, Thermo Scientific, USA). Boiling for 10 minutes was followed by electrophoresis. Protein blots were transferred to NC membranes (Cat. NO.66485, PALL, USA) and incubated in blocking buffer containing 5% BSA (Albumin Bovine Ⅴ, Cat. NO. A6020, Biotopped, China), followed by incubation with appropriate primary and secondary antibodies (Cat. NO.14895S, Cell Signaling Technology, USA; Cat. NO.18583, Cell Signaling Technology, USA; Cat. NO.9664, Cell Signaling Technology, USA; Cat. NO.2764, Cell Signaling Technology, USA; Cat. NO.60267-1-Ig, Proteintech, USA; Cat. NO.YM3029, Immunoway, USA; Cat. NO.66009-1-Ig, Proteintech, USA; Cat. NO.A23910, Abbkine, China; Cat. NO.A23920, Abbkine, China). Subsequently, protein expression signals were detected using an Odyssey infrared two-color laser scanning imaging system. Gray scale values were identified using ImageJ software. 3. Immunofluorescence assay Cells given different drug concentrations were fixed on ice using 4% paraformaldehyde (Cat. NO.DF0130, Leagene, China), permeabilized with 0.3% TritonX-100 (Cat. NO.A110694, Sangon Biotech, USA), and closed at room temperature with 1% BSA, followed by incubation with appropriate primary and secondary antibodies (Cat. NO.14895S, Cell Signaling Technology, USA; Cat. NO.SA00003-2, Proteintech, USA). DAPI (DAPI dihydrochloride, Cat. NO.C0065, Solarbio, China) was added for nuclear staining and pictures were taken using NIKON laser confocal microscope (Cat. NO.BDD011035, Biofil, China) in confocal specialized petri dishes. 4. Real-Time Quantitative PCR Total RNA was extracted from cells using the E.Z.N.A. w Total RNA Kit l (Omega Bio-tek, USA) and the concentration and quality of total RNA was measured using a NanoDrop 2000 (Thermo Scientific, USA). The proposed RNA was reverse transcribed and quantified by RT-qPCR. RT-qPCR instrument (Bio-rad, USA) was used to analyze the expression levels of BCL6 , Bcl-xL , Bax , CXCR4 and CDKN1A . The gene expression levels of three independent experiments were calculated using the 2 −ΔΔCt method. The gene-specific primers are shown in the table below: Table 1 Primer sequences for qRT-PCR Gene Primer sequences(5′-3′) BCL6 F: GTCAGCAGCCTCCTCTTCTCC R: EGTGCCTCTTCTGGGATTGTTTC Bcl-xL F:GAGAGCGTTCAGTGATCTAACATCC R: AGAACCACACCAGCCACAGTC Bax F: TTTCTGACGGCAACTTCAACTGG R: GATGGTGAGTGAGGCGGTGAG CXCR4 F: ATTGTCATCCTGTCCTGCTATTGC R: AATGTCCACCTCGCTTTCCTTTG CDKN1A F: GTCACCGAGACACCACTGGAG R: AGCGAGGCACAAGGGTACAAG 5. Soft AGAR cloning assay 1.2% lower gel (Cat. NO.A8190, Solarbio, China) and 0.5% upper gel (Cat. NO.A8190, Solarbio, China) were prepared and the cells were inoculated on soft agar and given different concentrations of drugs for incubation after 21 days of incubation, the cells were observed under an inverted microscope and photographed. 6. EDU Cell Proliferation Assay Cells were labeled with EDU using the EdU Method Cell Proliferation Imaging Analysis Kit (green fluorescence) (Cat. NO.KTA2030, Abbkine, China ), followed by EDU detection. The cell slides were blocked, dried at room temperature protected from light, and photographed using a laser confocal (NIKON) microscope. 7. Immunohistochemical staining The Human Protein Atlas (HPA, http://www.proteinatlas.org/) is a comprehensive online resource designed to provide detailed information on human protein expression and localization. The database integrates a wide range of immunohistochemistry, cellular immunohistochemistry, proteomics, and histology data, providing valuable information for studying the expression patterns of human proteins at the tissue and cellular levels. Immunohistochemical staining images of four tumor groups and paraneoplastic tissues were downloaded from the Human Protein Atlas for analysis. 8. Bioinformatics analysis of BCL6 The expression level of BCL6 was analyzed using Gene Expression Omnibus (GEO, https∶/ww.ncbinlm.nih.gov/geo/) based on the GSE32018 dataset, with 13 cases in the normal tissue group (including lymph nodes and reactive tonsils), 17 cases in the group of patients with chronic lymphocytic leukemia, 22 cases in the group of patients with diffuse large B-cell lymphoma, and 75 cases in the group of patients with other lymphomas. The group of 75 patients included patients with follicular lymphoma, pocket cell lymphoma, marginal zone lymphoma-MALT type, and node-marginal zone lymphoma. 9. Quantum calculation The highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) energies of DZ-865B were calculated using the Python-based Simulations of Chemistry Framework (PySCF). For this study, the B3LYP (Becke, three-parameter, Lee-Yang-Parr) exchange-correlation functional was employed. The 6-311G basis set was chosen to provide a balance between computational efficiency and accuracy for the HOMO and LUMO calculations. The structure of DZ-865B was first optimized at the B3LYP/6-311G level, ensuring that it reached a stable conformation with minimum energy. Subsequently, the HOMO and LUMO energies were calculated based on the optimized structure. Presentation of HOMO and LUMO was conducted by Avogadro software. 9. Statistical analysis All data were analyzed using GraphPad Prism 8.0 software (San Diego, CA, USA). The data were represented as mean ± standard deviation. Significant differences were identified through the use of a t-test and analysis of variance (ANOVA), with p-values less than 0.05 considered to be statistically significant. Each experiment was conducted in triplicate. Results 1. BCL6 Highly Expressed in DLBCL In studies of DLBCL, aberrant expression of the BCL6 gene has been identified as a critical factor in disease development. To explore BCL6 expression in DLBCL, we first analyzed lymph node tissues from B-cell germinal centers and non-germinal centers using immunohistochemistry from the Human Protein Atlas (HPA) database. Our results revealed higher BCL6 expression in germinal centers, evidenced by medium to strong nuclear staining (Fig. 1 A). Immunohistochemical analysis of DLBCL tissue samples confirmed robust nuclear staining of BCL6 in lymphoma cells (Fig. 1 B). Furthermore, differential gene expression analysis using the GEO database showed that BCL6 was significantly upregulated in DLBCL patient samples (p = 6.0e-6) (Fig. 1 C). Western blotting of DLBCL cell lines, specifically OCI-LY-1 and SU-DHL-4, also indicated markedly higher levels of BCL6 protein compared to other tumor cell lines (Fig. 1 D). These findings collectively suggest that BCL6 is highly and specifically expressed in DLBCL, underscoring its potential role as a therapeutic target. 2. Identification of DZ-865B as a novel BCL6 degradation To degrade the BCL6 in vivo, we designed an emerging PROTAC molecules, and the chemical structure of DZ-865B, evaluated in this study, is shown in Fig. 2 A. To understand its electronic properties, we calculated the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of DZ-865B using PySCF with the B3LYP/6-311G method (Fig. 2 B). These calculations provide insights into the electronic distribution of DZ-865B, which may influence its interaction with target proteins. To assess the BCL6-degrading potential of DZ-865B, we performed Western blot analyses on two DLBCL cell lines, OCI-LY-1 and SU-DHL-4. Initially, we treated these cells with BI-3802, a known BCL6 degrader, as a positive control. As expected, BI-3802 treatment led to a marked decrease in BCL6 protein levels in both cell lines, indicating effective BCL6 degradation (Fig. 2 C). Subsequently, we treated OCI-LY-1 and SU-DHL-4 cells with DZ-865B and evaluated BCL6 expression via Western blotting. Similar to BI-3802, DZ-865B treatment significantly reduced BCL6 protein levels in a concentration-dependent manner in both cell lines, suggesting that DZ-865B effectively targets and degrades BCL6 (Fig. 2 D). These findings demonstrate that DZ-865B functions as a novel BCL6 degrader and holds potential as a therapeutic agent for DLBCL by facilitating the degradation of BCL6 in cancer cells. 2. DZ-865B Induces Concentration- and Time-Dependent Degradation of BCL6 in DLBCL Cell Lines To evaluate the efficacy of DZ-865B in targeting BCL6, we performed concentration- and time-dependent assays in DLBCL cell lines OCI-LY-1 and SU-DHL-4. Western blot analyses demonstrated a dose- and time-dependent reduction in BCL6 protein levels upon treatment with increasing concentrations of DZ-865B in both cell lines (Fig. 3 A, E). Quantitative analysis of these Western blot results confirmed a significant decrease in BCL6 expression, with statistical analysis indicating high significance compared to controls (Fig. 3 C, G). Next, we examined the time-dependent effects of DZ-865B on BCL6 degradation. Western blot analysis revealed a progressive decrease in BCL6 protein levels in both OCI-LY-1 and SU-DHL-4 cell lines over time following DZ-865B treatment (Fig. 3 B, F). Quantitative assessment of these time-course data, shown as line graphs, indicated a significant reduction in BCL6 expression at all time points compared to the control group (Fig. 3 D, H). To further explore the effects of DZ-865B on BCL6 localization, we conducted immunofluorescence staining. Treatment with DZ-865B disrupted BCL6 colocalization in DLBCL cells, as indicated by the altered nuclear staining pattern. These changes in BCL6 localization were observed in both cell lines, further supporting the degradation and functional modulation of BCL6 by DZ-865B (Fig. 3 I, J). 4. DZ-865B Regulation of BCL6 downstream gene expression BCL6 is a crucial transcriptional repressor involved in the regulation of various cellular processes, including proliferation, differentiation, and apoptosis. It exerts its effects by modulating the expression of downstream target genes. To investigate the regulatory effects of DZ-865B on BCL6 and its target genes, we treated BCL6-overexpressing DLBCL cell lines (OCI-LY-1 and SU-DHL-4) with increasing concentrations of DZ-865B (0, 2.5, 5, and 10 µM) for 48 h. Quantitative real-time PCR (qRT-PCR) analysis revealed that DZ-865B had no significant effect on BCL6 mRNA levels, indicating that the compound does not alter BCL6 at the transcriptional level (Fig. 4 A–B). However, treatment with DZ-865B significantly modulated the expression of BCL6-regulated downstream genes in a concentration-dependent manner. Specifically, DZ-865B upregulated the expression of pro-apoptotic genes, such as Bax and CDKN1A , while downregulating anti-apoptotic and cell survival-related genes, including Bcl-xL and CXCR4 , in both OCI-LY-1 (Fig. 4 C–F) and SU-DHL-4 cell lines (Fig. 4 G–J). This effect was more pronounced than that of the positive control compound, BI-3802, at the same concentration. These findings suggest that DZ-865B exerts a stronger regulatory impact on the transcriptional network controlled by BCL6, highlighting its potential as a therapeutic agent targeting BCL6-mediated pathways in DLBCL. 5. DZ-865B inhibits DLBCL cell proliferation in vitro BCL6 is essential for the regulation of B-cell development and function. In certain cases of DLBCL, BCL6 expression is abnormally elevated, disrupting the balance of B-cell proliferation and promoting the uncontrolled growth of DLBCL cells. In this study, DZ-865B significantly inhibited the formation of tumor cell colonies, as demonstrated by the soft agar assay (Fig. 5 A). Additionally, DZ-865B treatment resulted in a marked downregulation of C-Myc, a protein associated with cell proliferation, indicating that DZ-865B effectively suppresses the growth of OCI-LY-1 cells (Fig. 5 B, C). To further explore the impact of DZ-865B on apoptosis-related proteins, we analyzed key markers of apoptosis in both OCI-LY-1 and SU-DHL-4 cell lines. In OCI-LY-1 cells, DZ-865B treatment led to increased levels of Cleaved Caspase-3, a critical executioner of apoptosis, along with Bax, a pro-apoptotic protein, and decreased expression of Bcl-xL, an anti-apoptotic protein, in a dose-dependent manner. Similarly, in SU-DHL-4 cells, DZ-865B upregulated Cleaved Caspase-3 and Bax and downregulated Bcl-xL, indicating enhanced pro-apoptotic signaling. Notably, DZ-865B showed a more pronounced effect on these apoptotic markers compared to the positive control compound, BI-3802, at equivalent concentrations (Fig. 5 B, C). The EdU incorporation assay was employed to assess the impact of DZ-865B on DNA synthesis, a key indicator of cell proliferation( 21 ). Following 48 hours of treatment with 5 µM DZ-865B, both OCI-LY-1 and SU-DHL-4 cells exhibited a significant reduction in EdU-positive cells, suggesting that DZ-865B inhibits DNA synthesis and cell proliferation (Fig. 5 D, E). Quantitative analysis of EdU fluorescence intensity confirmed a significant decrease in DNA synthesis in the DZ-865B-treated groups compared to the control, further supporting the anti-proliferative effect of DZ-865B in DLBCL cells (Fig. 5 F, G). Discussion In recent years, the advent of PROTAC (proteolysis-targeting chimera) technology has opened new avenues for targeting proteins previously considered undruggable( 24 ). PROTACs induce the ubiquitination and subsequent proteasomal degradation of specific proteins, thereby directly modulating their function( 25 ). Efforts to develop PROTACs targeting the BTB domain of BCL6 have shown promise, yet challenges remain. For instance, targeting the side groove of the BCL6 BTB domain to disrupt interactions with co-repressor proteins can lead to degradation of BCL6 aggregates, inadvertently exposing the pro-inflammatory effects of BCL6 deficiency( 26 ). Additionally, while BCL6-targeting PROTACs have achieved cellular concentrations sufficient for degradation, they have not yet demonstrated significant phenotypic responses in DLBCL, likely due to suboptimal pharmacokinetic and pharmacodynamic properties( 22 ). To date, no direct BCL6 degraders have received FDA approval, underscoring the need for further optimization of these compounds( 20 , 27 ). To address these challenges, we identified a novel small molecule degrader, DZ-865B, and investigated its efficacy in BCL6-overexpressing DLBCL cells. DZ-865B was found to degrade BCL6 in a concentration- and time-dependent manner, significantly reducing nuclear BCL6 levels in DLBCL cell lines (OCI-LY-1 and SU-DHL-4). Notably, while DZ-865B did not affect BCL6 mRNA expression, it modulated the transcriptional profile of BCL6-regulated genes, upregulating pro-apoptotic markers such as Bax and CDKN1A and downregulating anti-apoptotic and cell survival genes like Bcl-xL and CXCR4 . These findings suggest that DZ-865B acts primarily by degrading BCL6 protein, which in turn disrupts downstream pathways essential for DLBCL cell survival. Functionally, DZ-865B exhibited potent anti-proliferative effects in DLBCL cells at relatively low concentrations, as demonstrated by soft agar colony formation and EdU incorporation assays. Treatment with DZ-865B led to a reduction in C-Myc expression, a key regulator of cell proliferation, and increased levels of pro-apoptotic markers such as Cleaved Caspase-3 and Bax, while downregulating the anti-apoptotic protein Bcl-xL. These results confirm that DZ-865B not only inhibits DLBCL cell growth but also promotes apoptosis, indicating its potential as a therapeutic candidate for BCL6-driven malignancies. By specifically targeting the abnormal expression of BCL6, DZ-865B could help restore normal apoptotic processes, thereby limiting the uncontrolled proliferation of DLBCL cells. The development of DZ-865B and its effects on DLBCL cells underscores the potential of small molecule degraders in targeting oncogenic transcription factors like BCL6. Our study highlights the therapeutic value of BCL6 degradation, particularly for DLBCL subtypes dependent on BCL6 signaling. By specifically targeting BCL6, DZ-865B could complement existing therapies, such as those that target apoptosis pathways, and may also synergize with other agents to further impair DLBCL cell survival. Moving forward, additional in vivo studies are warranted to evaluate the pharmacokinetics and therapeutic efficacy of DZ-865B in preclinical DLBCL models. Furthermore, assessing DZ-865B's effects on BCL6-driven gene expression profiles will enhance our understanding of its impact on broader signaling pathways and may reveal combinatory strategies with other targeted agents, such as those inhibiting BET or apoptosis regulators like Bcl-xL. This approach could help develop more effective combination therapies tailored to the molecular profile of BCL6-dependent DLBCL, potentially improving patient outcomes. In summary, our study demonstrates that DZ-865B significantly impairs BCL6 function in DLBCL cells, paving the way for potential clinical application of BCL6-targeting PROTACs as part of a precision oncology approach. By highlighting DZ-865B’s ability to reduce BCL6 expression and disrupt associated signaling pathways, this work supports further investigation of BCL6 degraders in DLBCL and underscores the importance of exploring novel therapeutic avenues for treatment-resistant lymphoma. Conclusion Our findings indicate that DZ-865B effectively targets BCL6 in DLBCL cells, leading to a marked inhibition of BCL6 expression and subsequent activation of apoptosis-related genes. This mechanism significantly reduces the proliferative capacity of DLBCL cells, suggesting that DZ-865B could serve as a potent therapeutic agent for BCL6-driven lymphomas. The specific downregulation of BCL6 and the induction of apoptosis-related markers emphasize DZ-865B's potential role in overcoming the growth and survival advantages conferred by BCL6 overexpression in these tumors. Given the emergence of BCL6-targeting compounds DZ-865B, our investigation underscores the importance of continued exploration of BCL6 as a therapeutic target by specifical BCL6 degradation, particularly in treatment-resistant DLBCL cases. These findings further highlight the need for precision oncology approaches that assess BCL6 expression and downstream pathway alterations in order to tailor targeted therapies effectively. Declarations Author Contributions Yanfeng Wang, Beier Jiang, Yichen Yi, Jing Chen, and Tao Li designed and performed in vivo experiments; Beier Jiang contributed to quantum calculation-associated experiments; Yanfeng Wang, Beier Jiang provided cell lines and assisted with in vitro experiments; Beier Jian g and Yichen Yi analyzed the data and discussed the results; Jing Chen, Tao Li and Yichen Yin conceived and co-supervised the overall project and wrote the paper with contributions from all authors. Acknowledgement We are grateful to Professor Chen Yihua's research group for providing us with the small molecule compounds DZ-865B. This work was supported by the National Natural Science Foundation of China (82060663, 82260716), the Key Research and Development Program of Ningxia (2023BEG02010). Conflicts of Interest Statement The authors declare no conflict of interest. Declaration of interests ☐ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☒ The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: References Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024. Pacis S, Bolzani A, Heuck A, Gossens K, Kruse M, Fritz B, et al. Epidemiology and Real-World Treatment of Incident Diffuse Large B-cell Lymphoma (DLBCL): A German Claims Data Analysis. Oncology and therapy. 2024. Danese MD, Griffiths RI, Gleeson ML, Dalvi T, Li J, Mikhael JR, et al. Second-line therapy in diffuse large B-cell lymphoma (DLBCL): treatment patterns and outcomes in older patients receiving outpatient chemotherapy. Leukemia & lymphoma. 2017;58(5):1094-104. Garg M, Takyar J, Dhawan A, Saggu G, Agrawal N, Hall A, et al. Diffuse Large B-Cell Lymphoma (DLBCL): A Structured Literature Review of the Epidemiology, Treatment Guidelines, and Real-World Treatment Patterns. Blood. 2022;140(Supplement 1):12106-7. Susanibar-Adaniya S, Barta SK. 2021 Update on Diffuse large B cell lymphoma: A review of current data and potential applications on risk stratification and management. American journal of hematology. 2021;96(5):617-29. Kubacz M, Kusowska A, Winiarska M, Bobrowicz M. In Vitro Diffuse Large B-Cell Lymphoma Cell Line Models as Tools to Investigate Novel Immunotherapeutic Strategies. Cancers. 2022;15(1). Gopalakrishnan V, Roy U, Srivastava S, Kariya KM, Sharma S, Javedakar SM, et al. Delineating the mechanism of fragility at BCL6 breakpoint region associated with translocations in diffuse large B cell lymphoma. Cellular and molecular life sciences : CMLS. 2024;81(1):21. Leeman-Neill RJ, Bhagat G. BCL6 as a therapeutic target for lymphoma. Expert opinion on therapeutic targets. 2018;22(2):143-52. Mlynarczyk C, Fontán L, Melnick A. Germinal center-derived lymphomas: The darkest side of humoral immunity. Immunological reviews. 2019;288(1):214-39. Wu J, Meng F, Ran D, Song Y, Dang Y, Lai F, et al. The Metabolism and Immune Environment in Diffuse Large B-Cell Lymphoma. Metabolites. 2023;13(6). Zhang L, Wu M, Guo W, Zhu S, Li S, Lv S, et al. A small molecule BCL6 inhibitor as chemosensitizers in acute myeloid leukemia. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2023;166:115358. Xu L, Chen Y, Dutra-Clarke M, Mayakonda A, Hazawa M, Savinoff SE, et al. BCL6 promotes glioma and serves as a therapeutic target. Proceedings of the National Academy of Sciences of the United States of America. 2017;114(15):3981-6. Wu M, Xie J, Xing Y, Zhang L, Chen H, Tang B, et al. Selectively targeting BCL6 using a small molecule inhibitor is a potential therapeutic strategy for ovarian cancer. International journal of biological sciences. 2024;20(2):486-501. Guo J, Liu Y, Lv J, Zou B, Chen Z, Li K, et al. BCL6 confers KRAS-mutant non-small-cell lung cancer resistance to BET inhibitors. The Journal of clinical investigation. 2021;131(1). Li K, Liu Y, Ding Y, Zhang Z, Feng J, Hu J, et al. BCL6 is regulated by the MAPK/ELK1 axis and promotes KRAS-driven lung cancer. The Journal of clinical investigation. 2022;132(22). Guo S, Deng J, Wang P, Kou F, Wu Z, Zhang N, et al. The malignancy suppression and ferroptosis facilitation of BCL6 in gastric cancer mediated by FZD7 repression are strengthened by RNF180/RhoC pathway. Cell & bioscience. 2023;13(1):73. Sultan M, Nearing JT, Brown JM, Huynh TT, Cruickshank BM, Lamoureaux E, et al. An in vivo genome-wide shRNA screen identifies BCL6 as a targetable biomarker of paclitaxel resistance in breast cancer. Molecular oncology. 2021;15(8):2046-64. De Santis F, Romero-Cordoba SL, Castagnoli L, Volpari T, Faraci S, Fucà G, et al. BCL6 and the Notch pathway: a signaling axis leading to a novel druggable biotarget in triple negative breast cancer. Cellular oncology (Dordrecht). 2022;45(2):257-74. Han X, Sun Y. PROTACs: A novel strategy for cancer drug discovery and development. MedComm. 2023;4(3):e290. Kerres N, Steurer S, Schlager S, Bader G, Berger H, Caligiuri M, et al. Chemically Induced Degradation of the Oncogenic Transcription Factor BCL6. Cell reports. 2017;20(12):2860-75. Słabicki M, Yoon H, Koeppel J, Nitsch L, Roy Burman SS, Di Genua C, et al. Small-molecule-induced polymerization triggers degradation of BCL6. Nature. 2020;588(7836):164-8. McCoull W, Cheung T, Anderson E, Barton P, Burgess J, Byth K, et al. Development of a Novel B-Cell Lymphoma 6 (BCL6) PROTAC To Provide Insight into Small Molecule Targeting of BCL6. ACS chemical biology. 2018;13(11):3131-41. Mi D, Li C, Li Y, Yao M, Li Y, Hong K, et al. Discovery of novel BCL6-Targeting PROTACs with effective antitumor activities against DLBCL in vitro and in vivo. European journal of medicinal chemistry. 2024;277:116789. Békés M, Langley DR, Crews CM. PROTAC targeted protein degraders: the past is prologue. Nature reviews Drug discovery. 2022;21(3):181-200. Wang C, Zhang Y, Yu W, Xu J, Xing D. PROTAC-biomacromolecule conjugates for precise protein degradation in cancer therapy: A review. International journal of biological macromolecules. 2024;261(Pt 2):129864. Liu J, Zhang H. Zinc Finger and BTB Domain-Containing 20: A Newly Emerging Player in Pathogenesis and Development of Human Cancers. Biomolecules. 2024;14(2). Huckvale R, Harnden AC, Cheung KJ, Pierrat OA, Talbot R, Box GM, et al. Improved Binding Affinity and Pharmacokinetics Enable Sustained Degradation of BCL6 In Vivo. Journal of medicinal chemistry. 2022;65(12):8191-207. Additional Declarations No competing interests reported. Supplementary Files Hightligh.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6003136","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":414246052,"identity":"5df6a16c-1ed9-473f-b7ec-b4d2d4a2ddd1","order_by":0,"name":"Yanfeng Wang","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanfeng","middleName":"","lastName":"Wang","suffix":""},{"id":414246053,"identity":"71057412-5bbf-44cc-86cb-be2c1d740b96","order_by":1,"name":"Beier Jiang","email":"","orcid":"","institution":"Naval Medical University","correspondingAuthor":false,"prefix":"","firstName":"Beier","middleName":"","lastName":"Jiang","suffix":""},{"id":414246054,"identity":"b974dc11-8694-4261-af72-fa2c474565cd","order_by":2,"name":"Yichen Yin","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yichen","middleName":"","lastName":"Yin","suffix":""},{"id":414246055,"identity":"0297ad46-4793-4074-9b96-8ae2f658d9dd","order_by":3,"name":"Tao Li","email":"","orcid":"","institution":"General Hospital of the Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Li","suffix":""},{"id":414246056,"identity":"951e6dbd-addb-4c33-9a52-4a2949a4c6b5","order_by":4,"name":"Jing Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYDACCRA2YGBgY+//+OCDgY0d8Vr4eA4YG84oSEsmTgsIyEkkmEnzfDjE2EBIB//s5mMPLAru2LVJJKRJ2xgcYGZgP3x0A15L7hxLN5AweJbcxvPgsHWOwR0+Bp60tBv4tBhI5JhJSBgcTmZjT2y8nWPwjJlBgseMgJb8bxAtDMkM0hYGhxkbCGvJYQNpsWPjSGOSZiBGi8SNNLDDEth4zjAb9hikJbMR8gv/jORn0hJ/DtvLt/cwPvjxx8aOn/3wMbxaQIAZGDeJDTAeGyHlIMD4gYHBnhiFo2AUjIJRMEIBAOnqRZ6u4d3GAAAAAElFTkSuQmCC","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jing","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2025-02-11 03:08:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6003136/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6003136/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":76228679,"identity":"c820e85f-fd2b-43d4-8149-1bae4cb8daac","added_by":"auto","created_at":"2025-02-13 17:32:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":282549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eElevated BCL6 Expression in Lymphoma. A\u003c/strong\u003e. Immunohistochemical staining of lymph node tissues from B-cell germinal centers, demonstrating medium to strong nuclear staining for BCL6. Scale bars: 200 μm and 50 μm. \u003cstrong\u003eB\u003c/strong\u003e. Immunohistochemical staining of diffuse large B-cell lymphoma (DLBCL) tissue samples, showing robust nuclear BCL6 expression. Scale bars: 200 μm and 50 μm. \u003cstrong\u003eC\u003c/strong\u003e. Comparative analysis of BCL6 expression across different patient groups, including normal tissues (Normal, n=13), chronic lymphocytic leukemia (CLL, n=17), diffuse large B-cell lymphoma (DLBCL, n=22), and other lymphomas (Tumor, n=75). Statistical significance was assessed using Kruskal-Wallis analysis. \u003cstrong\u003eD\u003c/strong\u003e. Western blot analysis of BCL6 protein levels in various tumor cell lines, confirming higher expression in DLBCL cell lines compared to other tumor types.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6003136/v1/50538953e23787589b2b6001.png"},{"id":76228678,"identity":"17a31b5a-ada0-418b-8913-2cbd1201f08b","added_by":"auto","created_at":"2025-02-13 17:32:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":211752,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIdentification of DZ-865B as a Novel BCL6 Degrader.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e. Chemical structure of DZ-865B utilized in this study. \u003cstrong\u003eB\u003c/strong\u003e. Highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of DZ-865B, calculated using PySCF with the B3LYP/6-311G method. \u003cstrong\u003eC\u003c/strong\u003e. Western blot analysis of BCL6 expression in DLBCL cell lines (OCI-LY-1 and SU-DHL-4) following treatment with the known BCL6 degrader BI-3802, used as a positive control. \u003cstrong\u003eD\u003c/strong\u003e. Western blot analysis of BCL6 expression in DLBCL cell lines (OCI-LY-1 and SU-DHL-4) following treatment with DZ-865B, demonstrating its efficacy as a BCL6 degrader.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6003136/v1/aca771b6576e91250b7ba417.png"},{"id":76228682,"identity":"5e5efb12-5e00-42cf-8598-0fa03e06cada","added_by":"auto","created_at":"2025-02-13 17:32:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":266743,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eConcentration- and Time-Dependent Degradation of BCL6 by DZ-865B in DLBCL Cell Lines. \u003c/strong\u003e(\u003cstrong\u003eA, E\u003c/strong\u003e) Western blot analysis showing the concentration-dependent degradation of BCL6 in DLBCL cell lines OCI-LY-1 and SU-DHL-4 following treatment with varying concentrations of DZ-865B. (\u003cstrong\u003eC, G\u003c/strong\u003e) Quantitative analysis of the Western blot bands, presented as histograms. Significant degradation of BCL6 is observed compared to control (***, P \u0026lt; 0.001). (\u003cstrong\u003eB, F\u003c/strong\u003e) Western blot analysis depicting the time-dependent degradation of BCL6 in OCI-LY-1 and SU-DHL-4 cell lines after treatment with DZ-865B at specific time intervals. (\u003cstrong\u003eD, H\u003c/strong\u003e) Quantitative analysis of the Western blot bands over time, presented as line graphs, with significant reduction in BCL6 levels compared to control (****, P \u0026lt; 0.001). (\u003cstrong\u003eI, J\u003c/strong\u003e) Immunofluorescence images demonstrating the disruption of BCL6 colocalization in DLBCL cells upon treatment with DZ-865B. Scale bar: 10 μm.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6003136/v1/ff73cf3ea53c15b2e9351041.png"},{"id":76228680,"identity":"870d3de1-c1a3-4867-974b-18d7250d45da","added_by":"auto","created_at":"2025-02-13 17:32:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":401938,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDZ-865B Modulates Expression of BCL6 Downstream Genes in DLBCL Cell Lines.\u003c/strong\u003e (A, B) Quantitative PCR analysis showing that DZ-865B treatment does not significantly affect BCL6 mRNA levels in OCI-LY-1 and SU-DHL-4 cell lines, indicating that DZ-865B regulates BCL6 at the protein level rather than through transcriptional downregulation. (C–F) Relative mRNA expression of BCL6 target genes in OCI-LY-1 cells after treatment with DZ-865B. Data reveal a significant reduction in the mRNA levels of BCL6-regulated genes, with statistical significance indicated by *P \u0026lt; 0.05, **P \u0026lt; 0.01, and ***P \u0026lt; 0.001 compared to control levels. (G–J) Relative mRNA expression of BCL6 target genes in SU-DHL-4 cells following exposure to DZ-865B. Similar to OCI-LY-1 cells, treatment with DZ-865B leads to significant downregulation of specific BCL6 target genes, with statistical significance marked by *P \u0026lt; 0.05, **P \u0026lt; 0.01, and ***P \u0026lt; 0.001 versus control.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6003136/v1/c0f0668f5c4225b2ded19e25.png"},{"id":76228683,"identity":"fd514f5f-e82c-47bd-8e33-f25318bacc08","added_by":"auto","created_at":"2025-02-13 17:32:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":271192,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDZ-865B Inhibits Proliferation of DLBCL Cells In Vitro.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e. Soft agar colony formation assay of DLBCL cell line OCI-LY-1 after 21 days of treatment with various concentrations of DZ-865B, showing a dose-dependent decrease in colony formation. \u003cstrong\u003eB\u003c/strong\u003e. Western blot analysis of OCI-LY-1 cells treated with BI-3802 and DZ-865B for 48 hours, examining the expression levels of apoptosis and proliferation-related proteins, including Cleaved Caspase-3, Bax, Bcl-xL, and C-Myc, in response to increasing concentrations of each compound. \u003cstrong\u003eC\u003c/strong\u003e. Western blot analysis of SU-DHL-4 cells treated with BI-3802 and DZ-865B for 48 hours, assessing the expression of Cleaved Caspase-3, Bax, and Bcl-xL to evaluate apoptotic and anti-apoptotic protein modulation in a concentration-dependent manner. \u003cstrong\u003eD-E\u003c/strong\u003e. EdU incorporation assay to assess DNA synthesis in OCI-LY-1 and SU-DHL-4 cell lines treated with 5 μM DZ-865B for 48 hours. Immunofluorescence images show reduced EdU-positive cells after DZ-865B treatment, indicating decreased DNA synthesis and proliferation. Scale bar: 10 μm. \u003cstrong\u003eF-G\u003c/strong\u003e. Quantitative analysis of EdU fluorescence intensity, measured as integrated density using ImageJ software. Results indicate a significant reduction in DNA synthesis in DZ-865B-treated groups compared to control groups (*P \u0026lt; 0.05; **P \u0026lt; 0.01 vs. control).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6003136/v1/885526398724e25e5bb37109.png"},{"id":76371485,"identity":"0d1a3ff2-6a89-44d1-a263-d402f0baa44c","added_by":"auto","created_at":"2025-02-15 18:31:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2163390,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6003136/v1/e0be3cad-1e87-44cc-a5a1-45274f892a37.pdf"},{"id":76229301,"identity":"00742327-9797-43f4-8313-215c95576f1e","added_by":"auto","created_at":"2025-02-13 17:40:51","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":16176,"visible":true,"origin":"","legend":"","description":"","filename":"Hightligh.docx","url":"https://assets-eu.researchsquare.com/files/rs-6003136/v1/399ab87ff53d9e709689aad8.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Novel Small Molecule DZ-865B Effectively Degrades BCL6, Promotes Apoptosis and Reduces Proliferation of Diffuse Large B-Cell Lymphoma Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRecent GLOBOCAN data highlight the global burden of non-Hodgkin's lymphoma (NHL), with approximately 553,000 new cases anticipated in 2022, accounting for 5.5% of all new cancer diagnoses. Additionally, NHL is projected to cause around 250,000 deaths worldwide, representing 2.4% of all cancer-related mortality(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Diffuse large B-cell lymphoma (DLBCL), the most common subtype of NHL, comprises roughly one-third of all NHL cases(\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e–\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Current treatment for DLBCL primarily relies on chemoimmunotherapy, yet approximately 30% of patients experience early relapse, and 10% display treatment-refractory disease(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). The germinal center B-cell (GCB) subtype, defined by CD10 + and BCL6 + markers, constitutes around half of all DLBCL cases. While the GCB subtype generally exhibits a better prognosis compared to the activated B-cell (ABC) subtype, the high genetic heterogeneity within DLBCL frequently leads to unpredictable clinical outcomes(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA significant genetic alteration associated with DLBCL is the chromosomal translocation involving the BCL6 gene, present in approximately 50% of cases(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). BCL6, located on chromosome 3q27, encodes a 95 kDa transcriptional repressor essential for the formation of germinal centers in B-cell follicles during antigenic stimulation(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Structurally, the BCL6 protein contains three functional domains that contribute to DLBCL pathogenesis by regulating B-cell activation, differentiation, cell cycle arrest, and apoptosis(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Dysregulated BCL6 expression not only drives DLBCL progression but has also been implicated in various other malignancies. Elevated BCL6 levels have been detected in acute myeloid leukemia(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e), glioma(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e), ovarian cancer(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e), non-small cell lung cancer(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e), gastric cancer(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e), and breast cancer(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e), underscoring its role as a broader oncogenic factor.\u003c/p\u003e \u003cp\u003ePROTAC (Proteolysis-Targeting Chimeras) technology has shown significant potential in the targeted degradation of disease-related proteins(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e), including BCL6. Several BCL6-targeting PROTAC degraders have been developed, demonstrating promising preclinical results(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). For instance, BI-3802 promotes BCL6 polymerization and facilitates its interaction with the SIAH1 ubiquitin ligase, resulting in BCL6 ubiquitination and subsequent proteasomal degradation(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Although both BI-3802 and its analog BI-3812 effectively inhibit BCL6, allowing the reactivation of BCL6-repressed tumor suppressor genes, their limited bioavailability constrains their therapeutic potential for patients with BCL6-positive DLBCL(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Another compound, CCT373566, has been shown to induce BCL6 degradation in DLBCL cell lines; however, despite this degradation, it did not achieve sufficient antiproliferative effects, even in an extended 16-day proliferation study(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the present study, to address the need for effective small-molecule degraders targeting BCL6 in GCB-DLBCL cells, we initially explored the expression in DLBCL compared with normal and other leukemia using bioinformatic analysis, validated by western blot in the different cells. We evaluated DZ-865B, a promising compound capable of inducing BCL6 degradation from our previous reports(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Using in vitro assays with GCB-carrying DLBCL cell lines, we further characterized the biological effects of DZ-865B on cell viability and growth suppression. This study also investigates the downstream molecular consequences of BCL6 degradation, providing insights into how DZ-865B modulates key signaling pathways associated with cell cycle regulation and apoptosis in DLBCL cells. Collectively, these findings highlight DZ-865B as a potential therapeutic candidate for BCL6-positive DLBCL, supporting its further preclinical evaluation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e\u003c/p\u003e "},{"header":"Experimental Section and Methods","content":"\u003cp\u003e1. Cell culture\u003c/p\u003e\n\u003cp\u003eThe human diffuse large B-cell lymphoma cells OCI-LY-1 and SU-DHL-4 cell lines were purchased from Zhejiang Mason Cell Technology Co. Gastric cancer cell lines HGC-45, HGC-27, and AGS were purchased from Wuhan Prolife Technology Co.\u003c/p\u003e\n\u003cp\u003e2. Western blotting\u003c/p\u003e\n\u003cp\u003eWhole cell proteins were extracted using the Whole Protein Extraction Kit. After sonication, the samples were centrifuged at 12,000 rpm for 15 minutes at 4\u0026deg;C and the total protein concentration of the samples was determined using the Micro BCA\u0026trade; Protein Assay Kit (Cat. NO.23235, Thermo Scientific, USA). Boiling for 10 minutes was followed by electrophoresis. Protein blots were transferred to NC membranes (Cat. NO.66485, PALL, USA) and incubated in blocking buffer containing 5% BSA (Albumin Bovine Ⅴ, Cat. NO. A6020, Biotopped, China), followed by incubation with appropriate primary and secondary antibodies (Cat. NO.14895S, Cell Signaling Technology, USA; Cat. NO.18583, Cell Signaling Technology, USA; Cat. NO.9664, Cell Signaling Technology, USA; Cat. NO.2764, Cell Signaling Technology, USA; Cat. NO.60267-1-Ig, Proteintech, USA; Cat. NO.YM3029, Immunoway, USA; Cat. NO.66009-1-Ig, Proteintech, USA; Cat. NO.A23910, Abbkine, China; Cat. NO.A23920, Abbkine, China). Subsequently, protein expression signals were detected using an Odyssey infrared two-color laser scanning imaging system. Gray scale values were identified using ImageJ software.\u003c/p\u003e\n\u003cp\u003e3. Immunofluorescence assay\u003c/p\u003e\n\u003cp\u003eCells given different drug concentrations were fixed on ice using 4% paraformaldehyde (Cat. NO.DF0130, Leagene, China), permeabilized with 0.3% TritonX-100 (Cat. NO.A110694, Sangon Biotech, USA), and closed at room temperature with 1% BSA, followed by incubation with appropriate primary and secondary antibodies (Cat. NO.14895S, Cell Signaling Technology, USA; Cat. NO.SA00003-2, Proteintech, USA). DAPI (DAPI dihydrochloride, Cat. NO.C0065, Solarbio, China) was added for nuclear staining and pictures were taken using NIKON laser confocal microscope (Cat. NO.BDD011035, Biofil, China) in confocal specialized petri dishes.\u003c/p\u003e\n\u003cp\u003e4. Real-Time Quantitative PCR\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from cells using the E.Z.N.A. w Total RNA Kit l (Omega Bio-tek, USA) and the concentration and quality of total RNA was measured using a NanoDrop 2000 (Thermo Scientific, USA). The proposed RNA was reverse transcribed and quantified by RT-qPCR. RT-qPCR instrument (Bio-rad, USA) was used to analyze the expression levels of \u003cem\u003eBCL6\u003c/em\u003e, \u003cem\u003eBcl-xL\u003c/em\u003e, \u003cem\u003eBax\u003c/em\u003e, \u003cem\u003eCXCR4\u003c/em\u003e and \u003cem\u003eCDKN1A\u003c/em\u003e. The gene expression levels of three independent experiments were calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method. The gene-specific primers are shown in the table below:\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003ePrimer sequences for qRT-PCR\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer sequences(5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eBCL6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: GTCAGCAGCCTCCTCTTCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: EGTGCCTCTTCTGGGATTGTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eBcl-xL\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF:GAGAGCGTTCAGTGATCTAACATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: AGAACCACACCAGCCACAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eBax\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TTTCTGACGGCAACTTCAACTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: GATGGTGAGTGAGGCGGTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCXCR4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: ATTGTCATCCTGTCCTGCTATTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: AATGTCCACCTCGCTTTCCTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCDKN1A\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: GTCACCGAGACACCACTGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: AGCGAGGCACAAGGGTACAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003e5. Soft AGAR cloning assay\u003cbr\u003e1.2% lower gel (Cat. NO.A8190, Solarbio, China) and 0.5% upper gel (Cat. NO.A8190, Solarbio, China) were prepared and the cells were inoculated on soft agar and given different concentrations of drugs for incubation after 21 days of incubation, the cells were observed under an inverted microscope and photographed.\u003cbr\u003e6. EDU Cell Proliferation Assay\u003c/p\u003e\n\u003cp\u003eCells were labeled with EDU using the EdU Method Cell Proliferation Imaging Analysis Kit (green fluorescence) (Cat. NO.KTA2030, Abbkine, China ), followed by EDU detection. The cell slides were blocked, dried at room temperature protected from light, and photographed using a laser confocal (NIKON) microscope.\u003c/p\u003e\n\u003cp\u003e7. Immunohistochemical staining\u003c/p\u003e\n\u003cp\u003eThe Human Protein Atlas (HPA, http://www.proteinatlas.org/) is a comprehensive online resource designed to provide detailed information on human protein expression and localization. The database integrates a wide range of immunohistochemistry, cellular immunohistochemistry, proteomics, and histology data, providing valuable information for studying the expression patterns of human proteins at the tissue and cellular levels. Immunohistochemical staining images of four tumor groups and paraneoplastic tissues were downloaded from the Human Protein Atlas for analysis.\u003c/p\u003e\n\u003cp\u003e8. Bioinformatics analysis of BCL6\u003c/p\u003e\n\u003cp\u003eThe expression level of BCL6 was analyzed using Gene Expression Omnibus (GEO, https∶/ww.ncbinlm.nih.gov/geo/) based on the GSE32018 dataset, with 13 cases in the normal tissue group (including lymph nodes and reactive tonsils), 17 cases in the group of patients with chronic lymphocytic leukemia, 22 cases in the group of patients with diffuse large B-cell lymphoma, and 75 cases in the group of patients with other lymphomas. The group of 75 patients included patients with follicular lymphoma, pocket cell lymphoma, marginal zone lymphoma-MALT type, and node-marginal zone lymphoma.\u003c/p\u003e\n\u003cp\u003e9. Quantum calculation\u003c/p\u003e\n\u003cp\u003eThe highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) energies of DZ-865B were calculated using the Python-based Simulations of Chemistry Framework (PySCF). For this study, the B3LYP (Becke, three-parameter, Lee-Yang-Parr) exchange-correlation functional was employed. The 6-311G basis set was chosen to provide a balance between computational efficiency and accuracy for the HOMO and LUMO calculations.\u003c/p\u003e\n\u003cp\u003eThe structure of DZ-865B was first optimized at the B3LYP/6-311G level, ensuring that it reached a stable conformation with minimum energy. Subsequently, the HOMO and LUMO energies were calculated based on the optimized structure. Presentation of HOMO and LUMO was conducted by Avogadro software.\u003c/p\u003e\n\u003cp\u003e9. Statistical analysis\u003c/p\u003e\n\u003cp\u003eAll data were analyzed using GraphPad Prism 8.0 software (San Diego, CA, USA). The data were represented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Significant differences were identified through the use of a t-test and analysis of variance (ANOVA), with p-values less than 0.05 considered to be statistically significant. Each experiment was conducted in triplicate.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1. BCL6 Highly Expressed in DLBCL\u003c/h2\u003e \u003cp\u003eIn studies of DLBCL, aberrant expression of the BCL6 gene has been identified as a critical factor in disease development. To explore BCL6 expression in DLBCL, we first analyzed lymph node tissues from B-cell germinal centers and non-germinal centers using immunohistochemistry from the Human Protein Atlas (HPA) database. Our results revealed higher BCL6 expression in germinal centers, evidenced by medium to strong nuclear staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Immunohistochemical analysis of DLBCL tissue samples confirmed robust nuclear staining of BCL6 in lymphoma cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Furthermore, differential gene expression analysis using the GEO database showed that BCL6 was significantly upregulated in DLBCL patient samples (p\u0026thinsp;=\u0026thinsp;6.0e-6) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Western blotting of DLBCL cell lines, specifically OCI-LY-1 and SU-DHL-4, also indicated markedly higher levels of BCL6 protein compared to other tumor cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). These findings collectively suggest that BCL6 is highly and specifically expressed in DLBCL, underscoring its potential role as a therapeutic target.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2. Identification of DZ-865B as a novel BCL6 degradation\u003c/h3\u003e\n\u003cp\u003eTo degrade the BCL6 in vivo, we designed an emerging PROTAC molecules, and the chemical structure of DZ-865B, evaluated in this study, is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA. To understand its electronic properties, we calculated the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of DZ-865B using PySCF with the B3LYP/6-311G method (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). These calculations provide insights into the electronic distribution of DZ-865B, which may influence its interaction with target proteins. To assess the BCL6-degrading potential of DZ-865B, we performed Western blot analyses on two DLBCL cell lines, OCI-LY-1 and SU-DHL-4. Initially, we treated these cells with BI-3802, a known BCL6 degrader, as a positive control. As expected, BI-3802 treatment led to a marked decrease in BCL6 protein levels in both cell lines, indicating effective BCL6 degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Subsequently, we treated OCI-LY-1 and SU-DHL-4 cells with DZ-865B and evaluated BCL6 expression via Western blotting. Similar to BI-3802, DZ-865B treatment significantly reduced BCL6 protein levels in a concentration-dependent manner in both cell lines, suggesting that DZ-865B effectively targets and degrades BCL6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). These findings demonstrate that DZ-865B functions as a novel BCL6 degrader and holds potential as a therapeutic agent for DLBCL by facilitating the degradation of BCL6 in cancer cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e2. DZ-865B Induces Concentration- and Time-Dependent Degradation of BCL6 in DLBCL Cell Lines\u003c/h3\u003e\n\u003cp\u003eTo evaluate the efficacy of DZ-865B in targeting BCL6, we performed concentration- and time-dependent assays in DLBCL cell lines OCI-LY-1 and SU-DHL-4. Western blot analyses demonstrated a dose- and time-dependent reduction in BCL6 protein levels upon treatment with increasing concentrations of DZ-865B in both cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, E). Quantitative analysis of these Western blot results confirmed a significant decrease in BCL6 expression, with statistical analysis indicating high significance compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, G). Next, we examined the time-dependent effects of DZ-865B on BCL6 degradation. Western blot analysis revealed a progressive decrease in BCL6 protein levels in both OCI-LY-1 and SU-DHL-4 cell lines over time following DZ-865B treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, F). Quantitative assessment of these time-course data, shown as line graphs, indicated a significant reduction in BCL6 expression at all time points compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, H).\u003c/p\u003e \u003cp\u003eTo further explore the effects of DZ-865B on BCL6 localization, we conducted immunofluorescence staining. Treatment with DZ-865B disrupted BCL6 colocalization in DLBCL cells, as indicated by the altered nuclear staining pattern. These changes in BCL6 localization were observed in both cell lines, further supporting the degradation and functional modulation of BCL6 by DZ-865B (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI, J).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e4. DZ-865B Regulation of BCL6 downstream gene expression\u003c/h3\u003e\n\u003cp\u003eBCL6 is a crucial transcriptional repressor involved in the regulation of various cellular processes, including proliferation, differentiation, and apoptosis. It exerts its effects by modulating the expression of downstream target genes. To investigate the regulatory effects of DZ-865B on BCL6 and its target genes, we treated BCL6-overexpressing DLBCL cell lines (OCI-LY-1 and SU-DHL-4) with increasing concentrations of DZ-865B (0, 2.5, 5, and 10 \u0026micro;M) for 48 h. Quantitative real-time PCR (qRT-PCR) analysis revealed that DZ-865B had no significant effect on BCL6 mRNA levels, indicating that the compound does not alter BCL6 at the transcriptional level (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026ndash;B).\u003c/p\u003e \u003cp\u003eHowever, treatment with DZ-865B significantly modulated the expression of BCL6-regulated downstream genes in a concentration-dependent manner. Specifically, DZ-865B upregulated the expression of pro-apoptotic genes, such as \u003cem\u003eBax\u003c/em\u003e and \u003cem\u003eCDKN1A\u003c/em\u003e, while downregulating anti-apoptotic and cell survival-related genes, including \u003cem\u003eBcl-xL\u003c/em\u003e and \u003cem\u003eCXCR4\u003c/em\u003e, in both OCI-LY-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC\u0026ndash;F) and SU-DHL-4 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG\u0026ndash;J). This effect was more pronounced than that of the positive control compound, BI-3802, at the same concentration. These findings suggest that DZ-865B exerts a stronger regulatory impact on the transcriptional network controlled by BCL6, highlighting its potential as a therapeutic agent targeting BCL6-mediated pathways in DLBCL.\u003c/p\u003e\n\u003ch3\u003e5. DZ-865B inhibits DLBCL cell proliferation in vitro\u003c/h3\u003e\n\u003cp\u003eBCL6 is essential for the regulation of B-cell development and function. In certain cases of DLBCL, BCL6 expression is abnormally elevated, disrupting the balance of B-cell proliferation and promoting the uncontrolled growth of DLBCL cells. In this study, DZ-865B significantly inhibited the formation of tumor cell colonies, as demonstrated by the soft agar assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Additionally, DZ-865B treatment resulted in a marked downregulation of C-Myc, a protein associated with cell proliferation, indicating that DZ-865B effectively suppresses the growth of OCI-LY-1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, C).\u003c/p\u003e \u003cp\u003eTo further explore the impact of DZ-865B on apoptosis-related proteins, we analyzed key markers of apoptosis in both OCI-LY-1 and SU-DHL-4 cell lines. In OCI-LY-1 cells, DZ-865B treatment led to increased levels of Cleaved Caspase-3, a critical executioner of apoptosis, along with Bax, a pro-apoptotic protein, and decreased expression of Bcl-xL, an anti-apoptotic protein, in a dose-dependent manner. Similarly, in SU-DHL-4 cells, DZ-865B upregulated Cleaved Caspase-3 and Bax and downregulated Bcl-xL, indicating enhanced pro-apoptotic signaling. Notably, DZ-865B showed a more pronounced effect on these apoptotic markers compared to the positive control compound, BI-3802, at equivalent concentrations (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, C).\u003c/p\u003e \u003cp\u003eThe EdU incorporation assay was employed to assess the impact of DZ-865B on DNA synthesis, a key indicator of cell proliferation(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Following 48 hours of treatment with 5 \u0026micro;M DZ-865B, both OCI-LY-1 and SU-DHL-4 cells exhibited a significant reduction in EdU-positive cells, suggesting that DZ-865B inhibits DNA synthesis and cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD, E). Quantitative analysis of EdU fluorescence intensity confirmed a significant decrease in DNA synthesis in the DZ-865B-treated groups compared to the control, further supporting the anti-proliferative effect of DZ-865B in DLBCL cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF, G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn recent years, the advent of PROTAC (proteolysis-targeting chimera) technology has opened new avenues for targeting proteins previously considered undruggable(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). PROTACs induce the ubiquitination and subsequent proteasomal degradation of specific proteins, thereby directly modulating their function(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Efforts to develop PROTACs targeting the BTB domain of BCL6 have shown promise, yet challenges remain. For instance, targeting the side groove of the BCL6 BTB domain to disrupt interactions with co-repressor proteins can lead to degradation of BCL6 aggregates, inadvertently exposing the pro-inflammatory effects of BCL6 deficiency(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Additionally, while BCL6-targeting PROTACs have achieved cellular concentrations sufficient for degradation, they have not yet demonstrated significant phenotypic responses in DLBCL, likely due to suboptimal pharmacokinetic and pharmacodynamic properties(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). To date, no direct BCL6 degraders have received FDA approval, underscoring the need for further optimization of these compounds(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo address these challenges, we identified a novel small molecule degrader, DZ-865B, and investigated its efficacy in BCL6-overexpressing DLBCL cells. DZ-865B was found to degrade BCL6 in a concentration- and time-dependent manner, significantly reducing nuclear BCL6 levels in DLBCL cell lines (OCI-LY-1 and SU-DHL-4). Notably, while DZ-865B did not affect BCL6 mRNA expression, it modulated the transcriptional profile of BCL6-regulated genes, upregulating pro-apoptotic markers such as \u003cem\u003eBax\u003c/em\u003e and \u003cem\u003eCDKN1A\u003c/em\u003e and downregulating anti-apoptotic and cell survival genes like \u003cem\u003eBcl-xL\u003c/em\u003e and \u003cem\u003eCXCR4\u003c/em\u003e. These findings suggest that DZ-865B acts primarily by degrading BCL6 protein, which in turn disrupts downstream pathways essential for DLBCL cell survival.\u003c/p\u003e \u003cp\u003eFunctionally, DZ-865B exhibited potent anti-proliferative effects in DLBCL cells at relatively low concentrations, as demonstrated by soft agar colony formation and EdU incorporation assays. Treatment with DZ-865B led to a reduction in C-Myc expression, a key regulator of cell proliferation, and increased levels of pro-apoptotic markers such as Cleaved Caspase-3 and Bax, while downregulating the anti-apoptotic protein Bcl-xL. These results confirm that DZ-865B not only inhibits DLBCL cell growth but also promotes apoptosis, indicating its potential as a therapeutic candidate for BCL6-driven malignancies. By specifically targeting the abnormal expression of BCL6, DZ-865B could help restore normal apoptotic processes, thereby limiting the uncontrolled proliferation of DLBCL cells.\u003c/p\u003e \u003cp\u003eThe development of DZ-865B and its effects on DLBCL cells underscores the potential of small molecule degraders in targeting oncogenic transcription factors like BCL6. Our study highlights the therapeutic value of BCL6 degradation, particularly for DLBCL subtypes dependent on BCL6 signaling. By specifically targeting BCL6, DZ-865B could complement existing therapies, such as those that target apoptosis pathways, and may also synergize with other agents to further impair DLBCL cell survival.\u003c/p\u003e \u003cp\u003eMoving forward, additional in vivo studies are warranted to evaluate the pharmacokinetics and therapeutic efficacy of DZ-865B in preclinical DLBCL models. Furthermore, assessing DZ-865B's effects on BCL6-driven gene expression profiles will enhance our understanding of its impact on broader signaling pathways and may reveal combinatory strategies with other targeted agents, such as those inhibiting BET or apoptosis regulators like Bcl-xL. This approach could help develop more effective combination therapies tailored to the molecular profile of BCL6-dependent DLBCL, potentially improving patient outcomes.\u003c/p\u003e \u003cp\u003eIn summary, our study demonstrates that DZ-865B significantly impairs BCL6 function in DLBCL cells, paving the way for potential clinical application of BCL6-targeting PROTACs as part of a precision oncology approach. By highlighting DZ-865B\u0026rsquo;s ability to reduce BCL6 expression and disrupt associated signaling pathways, this work supports further investigation of BCL6 degraders in DLBCL and underscores the importance of exploring novel therapeutic avenues for treatment-resistant lymphoma.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur findings indicate that DZ-865B effectively targets BCL6 in DLBCL cells, leading to a marked inhibition of BCL6 expression and subsequent activation of apoptosis-related genes. This mechanism significantly reduces the proliferative capacity of DLBCL cells, suggesting that DZ-865B could serve as a potent therapeutic agent for BCL6-driven lymphomas. The specific downregulation of BCL6 and the induction of apoptosis-related markers emphasize DZ-865B's potential role in overcoming the growth and survival advantages conferred by BCL6 overexpression in these tumors. Given the emergence of BCL6-targeting compounds DZ-865B, our investigation underscores the importance of continued exploration of BCL6 as a therapeutic target by specifical BCL6 degradation, particularly in treatment-resistant DLBCL cases. These findings further highlight the need for precision oncology approaches that assess BCL6 expression and downstream pathway alterations in order to tailor targeted therapies effectively.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYanfeng Wang, Beier Jiang, Yichen Yi, Jing Chen, and Tao Li designed and performed in vivo experiments; Beier Jiang contributed to quantum calculation-associated experiments; Yanfeng Wang, Beier Jiang provided cell lines and assisted with in vitro experiments; Beier Jian\u003cu\u003eg\u003c/u\u003e and Yichen Yi analyzed the data and discussed the results; Jing Chen, Tao Li and Yichen Yin conceived and co-supervised the overall project and wrote the paper with contributions from all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to Professor Chen Yihua\u0026apos;s research group for providing us with the small molecule compounds DZ-865B. This work was supported by the National Natural Science Foundation of China (82060663, 82260716), the Key Research and Development Program of Ningxia (2023BEG02010).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eDeclaration of interests\u003c/strong\u003e \u003cbr\u003e ☐ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003cbr\u003e ☒ The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024.\u003c/li\u003e\n\u003cli\u003ePacis S, Bolzani A, Heuck A, Gossens K, Kruse M, Fritz B, et al. Epidemiology and Real-World Treatment of Incident Diffuse Large B-cell Lymphoma (DLBCL): A German Claims Data Analysis. Oncology and therapy. 2024.\u003c/li\u003e\n\u003cli\u003eDanese MD, Griffiths RI, Gleeson ML, Dalvi T, Li J, Mikhael JR, et al. Second-line therapy in diffuse large B-cell lymphoma (DLBCL): treatment patterns and outcomes in older patients receiving outpatient chemotherapy. Leukemia \u0026amp; lymphoma. 2017;58(5):1094-104.\u003c/li\u003e\n\u003cli\u003eGarg M, Takyar J, Dhawan A, Saggu G, Agrawal N, Hall A, et al. Diffuse Large B-Cell Lymphoma (DLBCL): A Structured Literature Review of the Epidemiology, Treatment Guidelines, and Real-World Treatment Patterns. Blood. 2022;140(Supplement 1):12106-7.\u003c/li\u003e\n\u003cli\u003eSusanibar-Adaniya S, Barta SK. 2021 Update on Diffuse large B cell lymphoma: A review of current data and potential applications on risk stratification and management. American journal of hematology. 2021;96(5):617-29.\u003c/li\u003e\n\u003cli\u003eKubacz M, Kusowska A, Winiarska M, Bobrowicz M. In Vitro Diffuse Large B-Cell Lymphoma Cell Line Models as Tools to Investigate Novel Immunotherapeutic Strategies. Cancers. 2022;15(1).\u003c/li\u003e\n\u003cli\u003eGopalakrishnan V, Roy U, Srivastava S, Kariya KM, Sharma S, Javedakar SM, et al. Delineating the mechanism of fragility at BCL6 breakpoint region associated with translocations in diffuse large B cell lymphoma. Cellular and molecular life sciences : CMLS. 2024;81(1):21.\u003c/li\u003e\n\u003cli\u003eLeeman-Neill RJ, Bhagat G. BCL6 as a therapeutic target for lymphoma. Expert opinion on therapeutic targets. 2018;22(2):143-52.\u003c/li\u003e\n\u003cli\u003eMlynarczyk C, Font\u0026aacute;n L, Melnick A. Germinal center-derived lymphomas: The darkest side of humoral immunity. Immunological reviews. 2019;288(1):214-39.\u003c/li\u003e\n\u003cli\u003eWu J, Meng F, Ran D, Song Y, Dang Y, Lai F, et al. The Metabolism and Immune Environment in Diffuse Large B-Cell Lymphoma. Metabolites. 2023;13(6).\u003c/li\u003e\n\u003cli\u003eZhang L, Wu M, Guo W, Zhu S, Li S, Lv S, et al. A small molecule BCL6 inhibitor as chemosensitizers in acute myeloid leukemia. Biomedicine \u0026amp; pharmacotherapy = Biomedecine \u0026amp; pharmacotherapie. 2023;166:115358.\u003c/li\u003e\n\u003cli\u003eXu L, Chen Y, Dutra-Clarke M, Mayakonda A, Hazawa M, Savinoff SE, et al. BCL6 promotes glioma and serves as a therapeutic target. Proceedings of the National Academy of Sciences of the United States of America. 2017;114(15):3981-6.\u003c/li\u003e\n\u003cli\u003eWu M, Xie J, Xing Y, Zhang L, Chen H, Tang B, et al. Selectively targeting BCL6 using a small molecule inhibitor is a potential therapeutic strategy for ovarian cancer. International journal of biological sciences. 2024;20(2):486-501.\u003c/li\u003e\n\u003cli\u003eGuo J, Liu Y, Lv J, Zou B, Chen Z, Li K, et al. BCL6 confers KRAS-mutant non-small-cell lung cancer resistance to BET inhibitors. The Journal of clinical investigation. 2021;131(1).\u003c/li\u003e\n\u003cli\u003eLi K, Liu Y, Ding Y, Zhang Z, Feng J, Hu J, et al. BCL6 is regulated by the MAPK/ELK1 axis and promotes KRAS-driven lung cancer. The Journal of clinical investigation. 2022;132(22).\u003c/li\u003e\n\u003cli\u003eGuo S, Deng J, Wang P, Kou F, Wu Z, Zhang N, et al. The malignancy suppression and ferroptosis facilitation of BCL6 in gastric cancer mediated by FZD7 repression are strengthened by RNF180/RhoC pathway. Cell \u0026amp; bioscience. 2023;13(1):73.\u003c/li\u003e\n\u003cli\u003eSultan M, Nearing JT, Brown JM, Huynh TT, Cruickshank BM, Lamoureaux E, et al. An in vivo genome-wide shRNA screen identifies BCL6 as a targetable biomarker of paclitaxel resistance in breast cancer. Molecular oncology. 2021;15(8):2046-64.\u003c/li\u003e\n\u003cli\u003eDe Santis F, Romero-Cordoba SL, Castagnoli L, Volpari T, Faraci S, Fuc\u0026agrave; G, et al. BCL6 and the Notch pathway: a signaling axis leading to a novel druggable biotarget in triple negative breast cancer. Cellular oncology (Dordrecht). 2022;45(2):257-74.\u003c/li\u003e\n\u003cli\u003eHan X, Sun Y. PROTACs: A novel strategy for cancer drug discovery and development. MedComm. 2023;4(3):e290.\u003c/li\u003e\n\u003cli\u003eKerres N, Steurer S, Schlager S, Bader G, Berger H, Caligiuri M, et al. Chemically Induced Degradation of the Oncogenic Transcription Factor BCL6. Cell reports. 2017;20(12):2860-75.\u003c/li\u003e\n\u003cli\u003eSłabicki M, Yoon H, Koeppel J, Nitsch L, Roy Burman SS, Di Genua C, et al. Small-molecule-induced polymerization triggers degradation of BCL6. Nature. 2020;588(7836):164-8.\u003c/li\u003e\n\u003cli\u003eMcCoull W, Cheung T, Anderson E, Barton P, Burgess J, Byth K, et al. Development of a Novel B-Cell Lymphoma 6 (BCL6) PROTAC To Provide Insight into Small Molecule Targeting of BCL6. ACS chemical biology. 2018;13(11):3131-41.\u003c/li\u003e\n\u003cli\u003eMi D, Li C, Li Y, Yao M, Li Y, Hong K, et al. Discovery of novel BCL6-Targeting PROTACs with effective antitumor activities against DLBCL in vitro and in vivo. European journal of medicinal chemistry. 2024;277:116789.\u003c/li\u003e\n\u003cli\u003eB\u0026eacute;k\u0026eacute;s M, Langley DR, Crews CM. PROTAC targeted protein degraders: the past is prologue. Nature reviews Drug discovery. 2022;21(3):181-200.\u003c/li\u003e\n\u003cli\u003eWang C, Zhang Y, Yu W, Xu J, Xing D. PROTAC-biomacromolecule conjugates for precise protein degradation in cancer therapy: A review. International journal of biological macromolecules. 2024;261(Pt 2):129864.\u003c/li\u003e\n\u003cli\u003eLiu J, Zhang H. Zinc Finger and BTB Domain-Containing 20: A Newly Emerging Player in Pathogenesis and Development of Human Cancers. Biomolecules. 2024;14(2).\u003c/li\u003e\n\u003cli\u003eHuckvale R, Harnden AC, Cheung KJ, Pierrat OA, Talbot R, Box GM, et al. Improved Binding Affinity and Pharmacokinetics Enable Sustained Degradation of BCL6 In Vivo. Journal of medicinal chemistry. 2022;65(12):8191-207.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Diffuse large B-cell lymphoma, B-cell lymphoma 6, PROTACs, proliferation","lastPublishedDoi":"10.21203/rs.3.rs-6003136/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6003136/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eB-cell lymphoma 6 (BCL6) is a transcriptional repressor essential for B lymphocyte differentiation and germinal center formation through its BTB structural domain. Overexpression of BCL6 is strongly implicated in the progression of diffuse large B-cell lymphoma (DLBCL), making it a promising therapeutic target. This study aims to identify a novel small molecule, synthesized via proteolysis-targeting chimeras (PROTACs), capable of degrading BCL6, thereby inhibiting DLBCL growth and providing a foundation for future preclinical studies. The expression of BCL6 in DLBCL was analyzed using The Cancer Genome Atlas (TCGA) database and the Human Protein Atlas. Western blotting assays confirmed BCL6 expression in tumor cell lines, leading to the identification of the small molecule compound DZ-865B. To evaluate DZ-865B\u0026rsquo;s in vitro efficacy, multiple assays were performed, including protein immunoblotting, immunofluorescence, quantitative PCR, EDU proliferation, and soft agar cloning assays. TCGA analysis revealed significant overexpression of BCL6 in DLBCL (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), corroborated by immunohistological staining and western blotting. DZ-865B induced BCL6 degradation in DLBCL cell lines (OCI-LY-1 and SU-DHL-4) in a concentration- and time-dependent manner, reducing nuclear BCL6 levels. Notably, DZ-865B did not alter BCL6 mRNA levels but modulated downstream gene expression, leading to the activation of apoptosis pathway proteins and inhibition of DNA synthesis, effectively suppressing DLBCL cell growth. This study demonstrates that the small molecule DZ-865B targets and degrades BCL6 in DLBCL cells, promoting apoptosis and inhibiting cellular proliferation. These findings highlight DZ-865B as a potential therapeutic agent for diffuse large B-cell lymphoma.\u003c/p\u003e","manuscriptTitle":"Novel Small Molecule DZ-865B Effectively Degrades BCL6, Promotes Apoptosis and Reduces Proliferation of Diffuse Large B-Cell Lymphoma Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-13 17:32:46","doi":"10.21203/rs.3.rs-6003136/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"736a6ee2-74e7-4315-97ec-88840ecdd25a","owner":[],"postedDate":"February 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-02-15T18:23:15+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-13 17:32:46","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6003136","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6003136","identity":"rs-6003136","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00