Allelic variation of TaABI5-A4 Significantly Affects Seed Dormancy in Bread Wheat

preprint OA: closed
Full text JSON View at publisher
Full text 208,478 characters · extracted from preprint-html · click to expand
Allelic variation of TaABI5-A4 Significantly Affects Seed Dormancy in Bread Wheat | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Allelic variation of TaABI5-A4 Significantly Affects Seed Dormancy in Bread Wheat Yang Han, Zeng Wang, Bing Han, Yingjun Zhang, Jindong Liu, Yan Yang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4710390/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Sep, 2024 Read the published version in Theoretical and Applied Genetics → Version 1 posted 5 You are reading this latest preprint version Abstract ABI5 is a critical transcription factor in regulation of crop seed maturation, dormancy, germination and post-germination. Sixteen copies of homologous sequences of ABI5 were identified in Chinese wheat line Zhou 8425B. Cultivars of two haplotypes TaABI5-A4a and TaABI5-A4bshowed significantly different seed dormancy. Based on two SNPs between the sequences of TaABI5-A4a and TaABI5-A4b, two complementary dominant sequence-tagged site (STS) markers were developed and validated in a natural population of 103 Chinese wheat cultivars and advanced lines and 200 recombinant inbred lines (RILs) derived from the Yangxiaomai/Zhongyou 9507 cross; the STS markers can be used efficiently and reliably to evaluate the dormancy of wheat seeds. The transcription level of TaABI5-A4b was significantly increased in TaABI5-A4a-GFPtransgenic rice lines compared with that in TaABI5-A4b-GFP. The average seed germination index of TaABI5-A4a-GFP transgenic rice lines were significantly lower than those of TaABI5-A4b-GFP. In addition, seeds of TaABI5-A4a-GFP transgenic lines had higher ABA sensitivity and endogenous ABA content, lower endogenous GA content and plant height, and thicker stem internodes than those of TaABI5-A4b-GFP. Allelic variation of TaABI5-A4 affected wheat seed dormancy and the gene function was confirmed in transgenic rice. The transgenic rice lines of TaABI5-A4a and TaABI5-A4b had significantly different sensitivities to ABA and contents of endogenous ABA and GA in mature seeds, thereby influencing the seed dormancy, plant height and stem internode length and diameter. ABA sensitivity Plant height Seed dormancy TaABI5-A4 Triticum aestivum Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Key Message We identified a pivotal transcription factor TaABI5-A4 that is significantly associated with pre-harvest sprouting in wheat; its function in regulating seed dormancy was confirmed in transgenic rice. Introduction Pre-harvest sprouting (PHS) is the germination of seeds prior to maturity in the spike when there is excessive moisture before harvest. PHS tolerance of wheat is predominantly attributed to seed dormancy (Li et al. 2004; Gubler et al. 2005; Sun et al. 2012; Yang et al. 2014). The lack of seed dormancy in many wheat cultivars leads to PHS under humid weather conditions (Gubler et al. 2005). Therefore, it is important to understand the genetic mechanism of seed dormancy in wheat. ABA plays critical roles in plants to respond biotic and abiotic stresses, such as pathogens, low temperatures, drought, salinity, and osmotic stress (Lim et al. 2014; Gonzalez-Guzman et al. 2012; Wei et al. 2022), In the biosynthesis of ABA, many genes are associated with onset and maintenance of seed dormancy (Gubler et al. 2005; Feng et al. 2022; Lynch et al. 2022; Liu et al. 2023; Song et al. 2024). The ABA signaling pathway includes transcription factors of positive and negative regulators. The positive regulatory factors are ABI3 , ABI4 , and ABI5 (Finkelstein and Lynch 2000), which affect seed development and ABA sensitivity, whereas null mutation of abi3 has weaker seed dormancy and ABA sensitivity than that of abi4 or abi5 (Finkelstein and Lynch 2000; Zhao et al. 2020; Xiao et al. 2021; Lynch et al. 2022). Negative regulators include ABI1 , ABI2 , and AIP2 E3 ligase for ABI3 , RING E3 ligase and ABI5 binding protein (AFP) (Lopez-Molina et al. 2003; Zhang et al. 2005; Stone et al. 2006; Wei et al. 2022). The basic alkaline leucine zipper transcription factor ABI5 is a critical factor in the regulation of seed maturation, dormancy and germination, and post-germination seedling growth (Finkelstein and Lynch 2000; Lopez-Molina and Chua 2000; Lopez-Molina et al. 2001, 2002; Finkelstein et al. 2002; Dai et al. 2013); it belongs to the ABI5 / ABF / AREB / DPBF transcription factor family, binds to the cis-element ABRE, and regulates the expression of many downstream functional genes related to drought resistance and saline-alkali tolerance (Finkelstein and Lynch 2000; Lopez-Molina and Chua 2000). The plants of loss-of-function abi5 mutant are insensitive to ABA, whereas overexpression of ABI5 displays hypersensitive to ABA (Finkelstein and Lynch 2000; Lopez-Molina and Chua 2000; Zhou et al. 2015). The ABI5 protein is activated to be a growth repressor by ABA, resulting in an increase in target promoter occupancy (Lopez-Molina et al. 2002). In addition, degradation of ABI5 protein via the 26S proteasome is inhibited by ABA (Lopez-Molina et al. 2001). The transcription level of ABI5 was highest in late embryonic development and reached a peak during seed drying (Jakoby et al. 2002; Brocard-Gifford et al. 2004). As a transcription factor, ABI5 functions mainly through modulating the expression of target genes (Skubacz et al. 2016), such as ABI3, late embryo genesis abundant (LEA), DELLA, BRI1-EMSSUPPRESSOR1 (BES1), JASMONATEZIM-DOMAIN (JAZ) proteins, TaGATA1, INDUCER OF CBF EXPRESSION1 (ICE1), Pectin methylesterase (PME) and AFP to regulate ABA responses (Hu et al. 2019; Ju et al. 2019; Lim et al. 2013; Pan et al. 2018; Zhao et al. 2019; Xiang et al. 2024; Wei et al. 2022). ABI3 acts together with ABI5 to regulate embryonic gene expression and seed sensitivity to ABA (Lopez-Molina and Chua 2000; Nakamura and Toyama 2001), and ABI3 and ABI5 were degraded during seed germination by the proteasome (Arqyris et al. 2008; Lopez-Molina et al. 2001). ABI5 is insensitive to growth arrest following germination as well as the LEA , induced by ABA, and alters activity of the LEA gene promoter during the later stage of seed development (Lopez-Molina and Chua 2000; Zou et al. 2007). AFP has functions in the development of seedlings, which is a new negative regulator of ABA signaling that facilitates the degradation of ABI5 (Lopez-Molina et al. 2003). During seed development and desiccation, the transcription and translation level of AFP increased, ultimately plateauing in mature seeds (Lopez-Molina et al. 2003; Feng et al. 2019, 2022). HVA1 and HVA22 are ABA-induced genes in barley aleurone cells. HvABI5 , a barley bZIP transcription factor, can specifically recognize ABA response complex (ABRC) cis-elements in the promoters of HVA1 and HVA22 (Casaretto and Ho 2003). Many evidences indicate the functions of ABI5 in seed dormancy formation and releasing in Arabidopsis (Finkelstein and Lynch 2000; Lopez-Molina and Chua 2000), whereas very few proofs are provided in wheat. TaABI5s were isolated in wheat, one of which has the same sequence as TaABF1 , a homolog of TaABI5 (Johnson et al. 2008). TaABF1 interacts with PKABA1 (SnRK2-type kinase) to mediate ABA-suppressed and -induced gene expression in aleurone cells. TaABI5s were expressed in developing grains, roots, and leaves (Ohnishi et al. 2008), whereas Zhou et al. (2017) showed that TaABI5 accumulated late in seed development and was expressed in seed only; the cultivar (SHW-L1) with PHS resistance has much higher transcription level of TaABI5 than the PHS-susceptible cultivar Chuanmai 32 (Zhou et al. 2017). In a transient assay in wheat aleurone cells, TaABI5 activated the promoter of Em containing ABRE, an embryogenesis abundant protein gene, indicating that TaABI5 acts as a transcription factor in wheat seeds (Utsugi et al. 2020), and in rice transgenic lines, TaABI5 plays an important role in mature seeds, particularly before seed germination (Utsugi et al. 2020). Our previous studies showed that TaABI5 belongs to a multigene family, and many copies of TaABI5 were identified in wheat, and allelic variations of TaABI5 are potentially associated with seed dormancy in wheat (Wang 2019). The objectives of the present study were to: ( 1 ) identify homologous sequences of ABI5 in bread wheat, ( 2 ) evaluate allelic variations of TaABI5 in Chinese wheat cultivars and RILs with different PHS tolerance to develop functional markers associated with PHS tolerance for marker-assisted breeding, ( 3 ) characterize the transcript expression level of TaABI5-A4 in wheat, and ( 4 ) confirm the function of TaABI5-A4 underlying seed dormancy or PHS tolerance in transgenic rice. Materials and methods Plant materials Wheat line Zhou 8425B (germination index (GI%) 56.0) was used to amplify TaABI5 with universal primers. Nine other wheat cultivars were used for PCR amplification of TaABI5 sequences with specific primers, including five PHS-resistant cultivars, Xiaobaiyuhua, Yumai 18, Yangxiaomai, Xiaoyuhua and Xiaoyan 6, with GI values of 4.0, 7.2, 7.5, 9.2 and 13.7 respectively, and four PHS-susceptible cultivars, Jimai 19, Jing 411, Hengshui 7228 and Zhongyou 9507, with GI values of 58.4, 64.2, 68.4 and 70.8, respectively. One hundred and three Chinese wheat cultivars and advanced lines with different PHS tolerance from the China Autumn-sown Wheat Region (CAWR), representing more than 85% of wheat production areas in China, were used for an association study (Table S1 ). Among these, 18 cultivars and advanced lines had GI values less than 15, and 85 had GI values between 15–71. GI was determined based on the average data across two cropping seasons at two locations, Anyang in Henan province and Beijing (Yang et al. 2014). Additionally, 200 RILs derived from the Yangxiaomai/Zhongyou 9507 cross also were used to validate the association between allelic variations of TaABI5-A4 and PHS tolerance. Yangxiaomai is a Chinese landrace wheat, with a low GI value (7.5), whereas Zhongyou 9507 had a high GI value (70.8). Primer design Based on the sequences of TmABI5 (accession number: AB238933.1), OsABI5 (EF199630.1), and TaABI5 (AB238934.1 and AB238932.1) in GenBank, universal primer sets TaABI5F1/R1 and TaABI5F2/R2 were designed to amplify full-length sequences of TaABI5 in Zhou 8425B. Three primer sets, TaABI5D3F/R, TaABI5A4F/R, and TaABI5D6F/R were used to amplify the sequences of TaABI5-D3 , TaABI5-A4 , and TaABI5-D6 , respectively. Two other primer pairs, TaABI5A4aF/R and TaABI5A4bF/R, were gene-specific markers used for identifying the allelic variants of TaABI5-A4a and TaABI5-A4b , respectively. The primer sets RT-TaABI5F/R and RT-TaABI5A4F/R were designed to analyze mRNA expression level of TaABI5 and TaABI5-A4 , respectively. The wheat Actin gene was used as an internal control and included in each reaction to normalize the expression level of TaABI5 and TaABI5-A4 genes; the expected PCR product was 410 bp in length (Table 1 ). Table 1 The primer sets used for characterization of TaABI5 allelic variants and transgenic lines Primer set Primer sequence Annealing temperature (℃) Fragment size (bp) TaABI5F1 ATGGCATCGGAGATGAGCA 57.7 948 TaABI5R1 CTCACGGTTCTTGATCATGC 56.5 948 TaABI5F2 CATGATCAAGAACCGTGAGTC 56.4 606 TaABI5R2 TTCACCAGATGCAGCTGC 57.2 606 TaABI5D3F1 ATGGCATCGGAGATGAGCAAGGAC 64.7 1464 TaABI5D3R1 GCTGTAGGAAAAAAAAGATCACGA 57.8 1464 TaABI5A4F1 ATGGCATCGGAGATGAGCA 57.8 823 TaABI5A4R1 CATCGCTCTGTCGCCCATA 58.8 823 TaABI5D6F1 ATGGCATCGGAGATGAGC 55.8 1384 TaABI5D6R1 GATTGTTACAAGCAATTGGC 53.4 1384 TaABI5A4aF ATGGCATCGGAGATGAGCA 57.8 494 TaABI5A4aR TGCAACCCCACCACCATTCCTC 64.9 494 TaABI5A4bF ATGGCATCGGAGATGAGCA 57.8 703 TaABI5A4aR CGACCATCCCTGCGTACAAGT 59.76 703 RT-TaABI5F ATGGCATCGGAGATGAGCA 57.0 1174 RT-TaABI5R TTCACCAGATGCAGCTGC 57.0 1174 RT-TaABI5A4F ATGGCATCGGAGATGAGCA 57.8 823 RT-TaABI5A4R CATCGCTCTGTCGCCCATA 58.8 823 Actin F GTTTCCTGGAATTGCTGATCGCAT 62.0 410 Actin R CATTATTTCATACAGCAGGCAAGC 59.4 410 Hpt557F ACACTACATGGCGTGATTTCAT 57.0 557 Hpt557R TCCACYAYCGGCGAGTACTTCT 57.0 557 Q-TaABI5-A4F TCCCGTCAAACCACCAAC 60.0 120 Q-TaABI5-A4R GTCCCCTGCTGTTCGTTC 59.0 120 Q-GFP-F TGGAGAGGGTGAAGGTGA 56.0 130 Q-GFP-R TCTTGAAAAGCATTGAAC 50.0 130 PCR amplification and semi-quantitative RT-PCR analysis Because TaABI5 has multiple copies of gene sequences, semi-quantitative RT-PCR was used for TaABI5 transcript expression analysis. PCR for gene cloning, molecular marker test, and semi-quantitative RT-PCR for gene transcript expression analysis of TaABI5s and TaABI5-A4 were performed in an Applied Biosystems 2720 thermal cycler. Reactions had a total volume of 15 µl, including 1.5 µl of 10×PCR buffer, 1.2 µl of 2.5 µM dNTP each, 4 pmol of each primer, 0.75 U of La Taq polymerase (TaKaRa), and 30 ng of template DNA (cDNA), and brought to 15 µl with ddH 2 O. PCR amplification procedures were 94°C for 5 min, followed by 35 cycles of 94°C for 1 min, 56°C–67°C for 45 s, and 72°C for 1 min, with a final extension of 72°C for 10 min. Amplified PCR and semi-quantitative RT-PCR products were separated on 1.5% agarose gels with the nucleic acid dye Gelview. cDNA was synthesized from 5 µg of total RNA using M-MLV reverse transcriptase (TaKaRa) with random hexamer primer Oligod (T) 19 according to the manufacturer’s instructions. Semi-quantitative RT-PCR was performed in an Applied Biosystems 2720 thermal cycler. PCR cycling was performed at 94°C for 5 min, followed by 36 cycles of 94°C for 1 min, 57°C–59°C for 30 s and 72°C for 45 s, with a final extension of 72°C for 10 min. Values were normalized with the amplification rate of the Actin gene as a constitutively expressed internal control. Three replications were carried out for each sample. Statistical analysis Statistical analysis was conducted using PROC MIXED (SAS Institute, 8.0). In this study, two types of fragments were amplified using two dominant complementary STS markers TaABI5A4a and TaABI5A4b. These fragments were used to indicate genotype clusters as a categorical variable; mean GI values were derived from each cluster and used in testing the level of significance. GraphPad Prism 8 statistical software was used for data analysis to test significance of differences between clusters. Construction of transgenic rice materials Sequences of TaABI5-A4a and TaABI5-A4b were cloned into the pCAMBIA1302-GFP vector by General Biology (Anhui) Co., Ltd ( www.generalbiol.com ), respectively. The recombinant vectors were transformed into Agrobacterium tumefaciens strain EHA105 to genetically transform embryonic calli of rice ( Oryza sativa L. ssp. japonica cv. Nipponbare) to create gene-overexpression rice plants following Feng et al. (2019). Identification of transgenic plants and phenotyping All transgenic rice lines were planted at 28/24 ℃ under 16/8 h light/darkness in greenhouse. The genomic DNA was extracted from fresh leaves of 15 plants of each T1 line by the CTAB method. The positive transgenic lines were identified by PCR. The primer sets and amplified fragments are listed in Table 1 . At least 10 positive transgenic lines for each genotype were grown in Rice Professional Cooperative in Yiwu city. The positive T2 transgenic rice lines of TaABI5-A4a-GFP and TaABI5-A4b-GFP were analyzed for germination index, ABA sensitivity, exogenous ABA and GA contents, plant height, 100-grain weight, and stem length and diameter. Germination assays and ABA sensitivity tests For germination assays, 100 seeds each T2 line were sterilized with 75% ethyl alcohol, and placed in petri dishes covered with damp filter paper at room temperature. Germination for each transgenic line was scored based on radical emergence every 24 h for 7 d for calculating the GI value (Sun et al. 2012). For the ABA sensitivity test, 30 seeds from each T2 line were sterilized with 75% ethyl alcohol and were incubated on filter paper with water or 50 µM ABA solution at room temperature for at least two weeks, then the germination rate was calculated (Sun et al. 2012). Each experiment was performed in three biological replications. Stress treatments and qPCR analysis For stress treatments, 100 µM ABA, 150 µM NaCl solution and 300 µM mannitol solution were used to treat transgenic rice leaves at the three-leaf stage for 48 h (Feng et al. 2019; Liang et al. 2022). The samples were treated in greenhouse at 28/24 ℃ under 16/8 h light/darkness. Samples were collected at 0, 6, 12, 24, and 48 h post treatments, then frozen in liquid nitrogen to extract total RNA. Transgenic leaves from empty vector transformants were used as controls. Each experiment was performed in three biological replications. The expression characteristics of TaABI5-A4 gene were analyzed under different treatments (Table 1 ), and the primers were designed on Primer Premier 5 ( http://www.premierbiosoft.com/primerdesign/index.html ). The TB Green Premix Ex Taq™ Ⅱ (TaKaRa, www.takarabiomed.com.cn ) was used in PCR. Three biological replications were conducted for each sample and the relative expression level was calculated using the 2 −∆∆ct method (Livak and Schmittgen 2001). RNA sequencing analysis Total RNA was extracted from the mature seeds of TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice lines, using TRIzol reagent according to the manufacturer’s instructions. RNA purity and quantification were evaluated using the NanoDrop 2000 spectrophotometer (Thermo Scientific USA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Then the libraries were constructed using VAHTS Universal V6 RNA-seq Library Prep Kit according to the manufacturer’s instructions, with each sample in three biological replications, and transcriptome sequencing and analysis were conducted by OE Biotech Co., Ltd. (Shanghai, China). Raw reads of fastp format were firstly processed using fastp and the low-quality reads were removed to obtain the clean reads. The clean reads were mapped to the rice reference genome ( http://rice.uga.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/pseudomolecules/version_7.0/ ) using HISAT2. FPKM of each gene was calculated and the read counts of each gene were obtained by HT Seq-count. Differential expression analysis was performed using the DESeq2. The Q value 2 or foldchange < 0.5 were set as the thresholds to determine significantly differentially expressed genes (DEGs). Based on the hypergeometric distribution, GO and KEGG pathway enrichment analysis of DEGs was performed to screen the significantly enriched terms by Bioinformatic analysis using the OECloud tools ( https://cloud.oebiotech.cn ). Fluorescent protein expression and Western blotting Fresh leaves of positive TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice plants at 30 d after germination (DAG) were used to analyze the expression of GFP by qPCR; the primer sets and amplified fragments are shown in Table 1 . Each experiment was performed in three biological replications. The total protein of transgenic rice seeds was extracted by Plant Total Protein Extraction Kit (Sangon Biotech, https://www.sangon.com ); the proteins were separated by 12% (w/v) SDS-PAGE gel electrophoresis, and transferred to PVDF membrane (Sangon Biotech). Anti-GFP (Shanghai Univ Technology, 1:2000 dilution) was used as a probe to detect the TaABI5-A fusion protein in transgenic rice. Results Identification of new copies of TaABI5 in wheat line 8425B The full-length sequence of TaABI5 was isolated from Zhou 8425B using a universal primer set (Table S1 ). A total of 16 copies of TaABI5 from Zhou 8425B were detected based on the comparison of ABI5 with the sequences deposited in the IWGSC and the 2005 Supplement of the Wheat Gene Catalogue. These copies were named TaABI5-A1 , TaABI5-A2 , TaABI5-A3 and TaABI5-A4 on the short arm of chromosome 3A, TaABI5-B1 , TaABI5-B2 , TaABI5-B3 , TaABI5-B4 and TaABI5-B5 on the short arm of chromosome 3B, TaABI5-D1 , TaABI5-D2 , TaABI5-D3 , TaABI5-D4 , TaABI5-D5 , TaABI5-D6 and TaABI5-D7 on the short arm of chromosome 3D, respectively. The results showed that TaABI5 was present in Triticum aestivum as a multi-copy gene. Sequence analysis indicated that the 16 copies of TaABI5 had 84.43–94.06% similarity with sequence AB238934.1 at the nucleotide level; the length of these copies ranged from 876 to 1556 bp. All sequences were deposited in GenBank under accession numbers MK287847 to MK287860 and MK334234 to MK334236 ( https://www.ncbi.nlm.nih.gov/gene/ ). Selection of specific primers for identifying the allelic variation of TaABI5 and sequences analysis Based on the 16 copies of TaABI5 , gene specific primers were designed to amplify all copies of TaABI5 sequences. In total, three specific primer pairs, TaABI5D3F/R, TaABI5D6F/R, and TaABI5A4F/R, were identified to specifically amplify the sequences of TaABI5-D3 , TaABI5-D6 , and TaABI5-A4 , respectively. However, no specific primers could be designed for the other 13 copies of TaABI5 because of very high sequence similarities among them. Ten cultivars (Xiaobaiyuhua, Yumai 18, Yangxiaomai, Xiaoyuhua, Xiaoyan 6, Zhou 8425B, Jimai 19, Jing 411, Hengshui 7228, and Zhongyou 9507) with different levels of seed dormancy were selected to identify allelic variation of TaABI5-D3 , TaABI5-D6 , and TaABI5-A4. In these ten cultivars, four variants were detected in TaABI5-D3 , designated TaABI5-D3a , TaABI5-D3b, TaABI5-D3c , and TaABI5-D3d , respectively. Compared with the sequence of TaABI5-D3a from Zhou 8425B, both TaABI5-D3c and TaABI5-D3d had two SNPs (A to G at position 449 bp changed His into Arg, and A to G at position 705 bp changed Asn into Asp), and TaABI5-D3b had two SNPs (A to G at position 449 bp changed His into Arg, and T to C at position 1270 bp in the intron). In TaABI5-D6 , five allelic variants were detected, viz. TaABI5-D6a , TaABI5-D6b , TaABI5-D6c , TaABI5-D6d , and TaABI5-D6e . Compared with the sequence of TaABI5-D6a from Zhou 8425B, InDels and SNPs located in the first exon were identified in TaABI5-D6b , TaABI5-D6c , TaABI5-D6d , and TaABI5-D6e . There were two allelic variants in TaABI5-A4 , i.e. TaABI5-A4a and TaABI5-A4b . Compared with the sequence of TaABI5-A4a , TaABI5-A4b had three SNPs (A to G at positions 269 bp and 473 bp, and C to T at position 686 bp) (Fig. S1 ). TaABI5-A4a was detected in five PHS-resistant cultivars (Xiaobaiyuhua, Yumai 18, Yangxiaomai, Xiaoyuhua, and Xiaoyan 6), while TaABI5-A4b was identified in five PHS-sensitive cultivars (Zhou 8425B, Jimai 19, Jing 411, Hengshui 7228, and Zhongyou 9507) (Fig. 1 ). In addition, the sequence analysis showed that TaABI5-A4a and TaABI5-A4b could not encode full-length proteins, compared with full length of TaABI5 protein, as there is a stop codon at the position of 266th amino acid. Expression of TaABI5s and TaABI5-A4 from Wanxianbaimaizi and Jing 411 at different seed developmental stages To evaluate the potential influence of TaABI5 and the specific copy of TaABI5-A4 in Jing 411 (GI = 64.2) and Wanxianbaimaizi (GI = 7.6), the expression patterns of Wanxianbaimaizi ( TaABI5-A4a ) and Jing 411 ( TaABI5-A4b ) were determined using semi-quantitative RT-PCR analysis. The transcript expression levels of TaABI5 showed an increasing trend in seeds from 10 to 30 days post-anthesis (DPA) with the highest level at 30 DPA and the lowest at 10 DPA (Fig. 2 a). In addition, the transcript expression levels of TaABI5-A4 and TaABI5 had the same trend in Wanxianbaimaizi ( TaABI5-A4a ) and Jing 411 ( TaABI5-A4b ) at 10, 20 and 30 DPA (Figs. 2 a and 2 b), although Wanxianbaimaizi ( TaABI5-A4a ) had higher transcript levels at all stages than Jing 411 (Figs. 2 a and 2 b). Three PHS-resistant (Xiaoyan 6, Wanxianbaimai and Xiaobaiyuhua, TaABI5-A4a ) and three PHS-susceptible genotypes (Jing 411, Zhou 8425B and Hengshui 7228, TaABI5-A4b ) were chosen to analyze the transcript level by qPCR at mature seeds. Significantly higher transcript levels of TaABI5 and TaABI5-A4 were observed in the genotype TaABI5-A4a than in TaABI5-A4b (Figs. 3 a and 3 b). Development and validation of gene-specific markers TaABI5A4a and TaABI5A4b for PHS resistance Based on the SNPs between the sequences of TaABI5-A4a and TaABI5-A4b , two complementary STS markers were developed, designated TaABI5A4a (primer set TaABI5A4aF/R) and TaABI5A4b (TaABI5A4bF/R), respectively, and used for association analysis with 103 wheat cultivars and advanced lines. It was first to amplify the cultivars with the primer set TaABI5A4F/R, and the PCR product was used as the template in the following PCR system. The primer set TaABI5A4aF/R produced a 494-bp fragment in the TaABI5-A4a genotype and no PCR product in TaABI5-A4b (Table 2 and Fig. 1 a), while the primer set TaABI5A4bF/R generated a 703-bp fragment in the TaABI5-A4b genotype (Table 2 and Fig. 1 b) and no PCR product in TaABI5-A4a . Among the 103 cultivars and lines tested, 51 had TaABI5-A4a presenting a 494-bp fragment and 52 contained TaABI5-A4b with a 703-bp fragment (Table 2 and Table S1 ); TaABI5-A4a and TaABI5-A4b accounted for 49.5% and 50.5% with average GI values of 22.2 and 49.6, respectively. The GI values of the 103 lines were consistent across two years ( r = 0.966, P < 0.0001), with mean GI values and standard deviations of 36.1 ± 20 in 2006 and 35.9 ± 19 in 2007, respectively. The results indicated that the genotype TaABI5-A4a were more resistant to PHS than TaABI5-A4b (Table 2 ). Table 2 Association analysis between TaABI5-A4 and GI values in 103 wheat cultivars and advanced lines with different PHS tolerance using the GIM model Genotype No. of lines Average GI (%) values F value Phenotypic variance explained (%) R 2 TaABI5-A4a 51 22.2 114.054* 52.6 TaABI5-A4b 52 49.6 *Significant association between TaABI5-A4 and phenotypic values at P < 0.001 level To further confirm the association, 200 RILs from the cross of Yangxiaomai/Zhongyou 9507 were genotyped using TaABI5A4a and TaABI5A4b specific markers (Fig. 2 ). Statistical analysis confirmed the significant association ( P < 0.001) of allelic variation of TaABI5-A4a/TaABI5-A4b with GI values and PHS tolerance. In this population, TaABI5-A4 explained 42.3%, 60.8%, and 63.7% of the phenotypic variations in Shijiazhuang, Beijing and the averaged GI values of two environments, based on the test of two complimentary STS markers TaABI5A4a and TaABI5A4b (Table 3 ). Table 3 Association analysis between TaABI5-A4 and GI values in 200 RILs using the GIM model Trait TaABI5-A4 No. of lines Average GI% values F value Phenotypic variance explained (%) R 2 Beijing GI value (%) TaABI5-A4a 130 20.28 310.001* 60.8 TaABI5-A4b 70 56.54 Shijiazhuang GI value (%) TaABI5-A4a 130 6.40 147.101* 42.3 TaABI5-A4b 70 29.08 Average GI value (%) TaABI5-A4a 130 13.34 349.687* 63.7 TaABI5-A4b 70 42.81 *Significant association between TaABI5-A4 and phenotypic values at P < 0.001 level Phenotypic evaluation of transgenic rice lines Fifteen transgenic rice plants (T1) for each of TaABI5-A4a-GFP and TaABI5-A4b-GFP constructs were selected using hygromycin. The primers of hpt557F/R were used to identify transgenic events. The frequencies of positive TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice plants were 73% and 80%, respectively (Fig. S2). Plant height, germination index, 100-grain weight, stem length and diameter of T2 lines were phenotyped and analyzed (Fig. 4 and Table 4 ). The plant height of TaABI5-A4b-GFP transgenic lines (84.76 cm) was significantly higher ( P < 0.01) than that of the negative control with an empty vector (80.33 cm) and TaABI5-A4a-GFP transgenic lines (79.58 cm). The average GI values of TaABI5-A4a-GFP , TaABI5-A4b-GFP transgenic lines and control plants were 57.7, 67.5, and 62.1, respectively, with significant differences ( P < 0.05). The lengths of the first internodes of TaABI5-A4a-GFP, TaABI5-A4b-GFP transgenic lines and control plants were 1.38 cm, 1.57 cm and 1.31 cm, and those of the second internodes were 3.09 cm, 3.65 cm and 3.32 cm, respectively. The data analysis showed that the lengths of the first and second internodes between TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic lines also were significantly different ( P < 0.001). The length of the third internode of TaABI5-A4b-GFP transgenic line was 7.98 cm, with significant differences from the control (7.57 cm) and TaABI5-A4a-GFP (7.26 cm) ( P < 0.05 and P < 0.01, respectively) (Fig. 4 and Table 4 ). The diameters of the second and third internodes of TaABI5-A4b-GFP and TaABI5-A4b-GFP transgenic lines were 2.91 mm and 2.76 mm, 2.83 mm and 2.76 mm, respectively, all with significant differences ( P < 0.05 and P < 0.01, respectively). Analysis of variance indicated that the TaABI5-A4b-GFP genotype had significantly ( P < 0.01) higher average GI values than the TaABI5-A4a-GFP (Fig. 4 ). These showed that the TaABI5-A4 gene affected not only GI values in transgenic rice lines, but also plant height, internode length and diameters (Fig. 4 , Table 4 ). Table 4 Phenotypic data of TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice lines Control TaABI5-A4a-GFP TaABI5-A4b-GFP Plant height (cm) 80.33 79.58 84.76 ** GI% value 62.13 57.74 * 67.54 * 100-grain weight (g) 2.18 2.17 2.07 Length of first internode (cm) 1.31 1.38 ** 1.51 **** Length of second internode (cm) 3.32 3.09 * 3.65 *** Length of third internode (cm) 7.57 7.26 7.98 * Diameter of first internode (mm) 3.09 3.14 3.09 Diameter of second internode (mm) 3.09 3.01 2.90 * Diameter of third internode (mm) 2.88 2.83 2.76 ** *, **, *** and **** represent significant differences between transgenic plants and controls at P < 0.05, P < 0.01, P < 0.001, P < 0.0001, respectively. Control stands for transgenic plants with an empty vector as a negative control Endogenous ABA and GA contents were examined in mature seeds of the control, TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic lines by HPLC. The endogenous ABA in seeds of TaABI5-A4a-GFP and TaABI5-A4b-GFP were 0.71 and 0.41 µg/g, respectively, and the endogenous GA contents were 9.82 and 12.14 µg/g, respectively, (Figs. 5 a and 5 b). These results indicated that the TaABI5-A4a-GFP transgenic rice line had significantly ( P < 0.0001) higher endogenous ABA and significantly ( P < 0.01) lower endogenous GA contents in mature seeds than TaABI5-A4b-GFP . ABA sensitivity in transgenic rice lines In order to determine the ABA responsiveness in the seeds of TaABI5-A4a-GFP and TaABI5-A4b-GFP lines, GI values of the seeds were evaluated in water and in 50 µM ABA solution, respectively. The results showed a much lower GI value in seeds of TaABI5-A4a-GFP than that in TaABI5-A4b-GFP lines, indicating that TaABI5-A4a-GFP transgenic rice lines had higher ABA sensitivity than TaABI5-A4b-GFP (Fig. 6 ). To understand the expression level of TaABI5-A4 on abiotic stress response, we examined the relative gene expression in TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic lines under different stress conditions. The plants at the three-leaf stage were treated with ABA (100 µM), salt (150 mM NaCl) and drought (300 mM mannitol to mimic dehydration) at 0, 6, 12, 24, 48 h post treatments (Fig. 7 ). The expression levels of TaABI5-A4 in TaABI5-A4a-GFP transgenic rice were higher than those in TaABI5-A4b-GFP after 6 or 12 h treatment with NaCl, whereas the expression levels of TaABI5-A4 in the TaABI5-A4a-GFP lines were lower than those in the TaABI5-A4b-GFP lines after 12–48 h treatment with manntiol. After 24 h in the ABA treatment, the expression levels of TaABI5-A4 in TaABI5-A4a-GFP lines were higher than those in TaABI5-A4b-GFP , which is consistent with ABA sensitivity tests, indicating that the TaABI5-A4a-GFP transgenic plants were more sensitive to exogenous ABA than the TaABI5-A4b-GFP . Effect of decreased accumulation of spliced mRNA caused by nonsense-mediated decay (NMD) on phenotypic changes Although the sequences of TaABI5-A4a and TaABI5-A4b have premature nonsense codons at the position of 266th amino acid, TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice lines had significantly different GI values, ABA sensitivities, and contents of endogenous ABA and GA. TaABI5-D3 encodes a full-length protein and its DNA sequence has the most similarity (99.07%) with the sequences of TaABI5-A4a and TaABI5-A4b ; therefore, TaABI5-D3 was chosen as the positive control to verify whether the premature nonsense codon affects the transcription level and even the translation level. The GFP transcription level and TaABI5-A4-GFP fusion protein level in transgenic rice lines were analyzed with qPCR and Western blotting (WB). In the two-week-old leaves of transgenic rice plants, the transcription expression level of GFP was very much higher in the positive control with the TaABI5-D3-GFP than those in TaABI5-A4a-GFP and TaABI5-A4b-GFP lines ( P < 0.0001), and the expression in TaABI5-A4a-GFP lines were significantly ( P < 0.01) higher than that in TaABI5-A4b-GFP lines (Fig. 8 a). This result indicated that the much lower accumulation of fully spliced RNA in the TaABI5-A4a/b-GFP transgenic lines was caused by nonsense-mediated decay (NMD). Moreover, WB analysis was performed using an Anti-GFP monoclonal antibody to detect the expression level of GFP fusion protein in transgenic rice seeds. The result showed that GFP fusion protein was only detected in the positive control, rather than in transgenic TaABI5-A4a-GFP and TaABI5-A4b-GFP lines (Fig. 8 b). These indicated that it was decreased accumulation of spliced mRNA, but fusion protein, that led to phenotypic changes between TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice lines. Effect of mRNA accumulation of TaABI5-A4 in transgenic rice on the expression of level ERF13 and GSL-OH associated with seed dormancy In order to identify the downstream genes regulated by transcription factor TaABI5 , we performed RNA sequencing (RNA-seq) using mature seeds of TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice lines. A total of 68 DEGs were identified in TaABI5-A4a-GFP transgenic lines compared with TaABI5-A4b-GFP lines, including 26 up-regulated and 42 down-regulated genes (Fig. 9 a). Compared with TaABI5-A4b-GFP transgenic lines, the up-regulated DEGs in TaABI5-A4a-GFP lines belong to the pathways of regulation for response to stress, abiotic stimulus and metabolic process based on GO and KEGG analysis, whereas the down-regulated DEGs in TaABI5-A4a-GFP transgenic lines are involved in the protein metabolic process (Figs. 9 b, c and d). Among them, we found ERF113/At5g13330 (LOC_Os08g30100), GSTU16 (LOC_Os10g38360) and GSL-OH (LOC_Os03g08460) in the up-regulated DEGs, and ESD4 (LOC_Os01g16730) in the down-regulated DEGs (Fig. 9 e), which may be involved in seed dormancy and germination. We further examined the transcript expression levels of RAP2.6L , GSTU16 and GSL-OH with qPCR in mature seeds. The results confirmed significantly higher expression levels of these three genes in TaABI5-A4a-GFP transgenic rice lines than those in TaABI5-A4b-GFP (Fig. 9 f). However, ESD4 could not be detected by qPCR due to the extremely low expression, which was a significantly down-regulated gene in RNA-seq. These results further verified the up/down-regulated DEGs in the RNA-seq from the mature seeds of TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic lines (Fig. 9 ). Discussion Many genes are known to be involved in ABA biosynthesis (Gubler et al. 2005). Among them, LEC2 , ABI3 , ABI5 , Vp-1 , AFP , and FUS3 are related to seed dormancy and PHS resistance, and have dual effects of inhibiting seed germination and promoting embryo maturation (Li et al. 2004). ABI3 is crucial in establishing dormancy and tolerance to desiccation during seed development (Lopez-Molina et al. 2002) and is required for appropriate ABI5 expression (Finkelstein and Lynch 2000), because ABI5 acts in the downstream of ABI3 (Lopez-Molina et al. 2003). In wheat, the TaVp-1 homolog ABI3 is associated with seed dormancy and STS markers Vp1B3 and Vp1A3 have been developed and validated (Yang et al. 2007, 2014). In this study, allelic variants of TaABI5-A4a and TaABI5-A4b were detected and validated, and gene-specific markers of TaABI5 (TaABI5A4a and TaABI5A4b) were significantly ( P < 0.001) associated with seed dormancy in wheat lines. The 103 wheat cultivars used in this study also was used to validate the STS marker Vp1A3 associated with seed dormancy (Yang et al. 2014), whereas much higher phenotypic variation was explained by TaABI5A4a and TaABI5A4b in this study ( R 2 = 52.6%). Moreover, the RIL population of Yangxiaomai×Zhongyou 9507 was also used to validate the STS marker Tamyb10D ( R 2 = 22.6%) (Wang et al., 2014), while the TaABI5-A4 gene explained much higher ( R 2 = 63.7%) phenotypic variation in this population than Tamyb10D. These results indicate that TaABI5-A4 is very likely to be a major-effect gene for seed dormancy in ABA signal pathway in wheat. It is very worthwhile to understand the molecular mechanism of TaABI5-A4 . In TaAIB5-A4a-GFP and TaAIB5-A4b-GFP transgenic rice lines, the transcript expression levels of TaABI5-A4 showed different sensitivities to ABA due to different CDS sequences of TaAIB5-A4a and TaAIB5-A4b (Figs. 8 and 9 ). Compared with the mature seeds of TaAIB5-A4b-GFP , TaAIB5-A4a-GFP showed higher transcript expression level of TaABI5A4 and GFP , more ABA sensitivity, higher endogenous ABA content and lower GI value. But no GFP fusion protein was detected by WB in the mature seeds of TaAIB5-A4a-GFP and TaAIB5-A4b-GFP transgenic lines. These results further indicate that although there is no full-length TaABI5-A4 protein due to the premature termination codon at the position of 266th amino acid, TaABI5-A4 mRNA or some truncated proteins could affect the phenotypes of transgenic lines. Nonsense-mediated decay (NMD) is a mechanism in which abnormal mRNAs containing premature translation termination codons are efficiently eliminated so that production of undesirable truncated proteins is avoided (Culbertson 1999; Hentze and Kulozik 1999), and NMD occurs in rice waxy RNA containing a premature nonsense codon (Isshiki et al. 2001). In this study, transcription of TaABI5-A4a and TaABI5-A4b was obviously observed in transgenic rice lines, but no GFP fusion proteins were detected by WB (Fig. 8 b). The NMD for TaABI5-A4a and TaABI5-A4b is also present, thus it must be the transcriptional regulation of TaABI5-A4 that plays a critical function, leading to phenotypic differences between transgenic TaABI5-A4a and TaABI5-A4b rice lines. The significantly different phenotypes between TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice lines were not only in ABA sensitivity, endogenous ABA content, and GI value, but also in endogenous GA content, plant height, internode length and diameter (Figs. 5 , 6 and 7 ). The balance of ABA and GA levels and sensitivity is a major regulator of dormancy status. The changes of ABA sensitivity and endogenous ABA and GA contents were observed in seeds of TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice lines. Both embryo sensitivity to ABA and GA metabolism plays an important role in the expression of dormancy of the developing sorghum grain (Benech-Arnold and Rodríguez 2018). Meanwhile, with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 ( SbABI4 ) and SbABA-INSENSITIVE 5 ( SbABI5 ), dormant grains accumulate less active GA4 due to more active GA catabolism (Renata et al. 2013). Moreover, plant height is especially affected by hormones like GA (Eshed and Lippman 2019), and GA is the most important hormone for plant height regulation (Kong et al. 2023). The transgenic lines with higher endogenous ABA content have lower endogenous GA content, leading to shorter plant height, shorter internode length and thicker internode diameter (Figs. 5 a and b). Based on the function of GA described above (Renata et al. 2013; Eshed and Lippman 2019; Kong et al. 2023), significantly different phenotypes between TaABI5-A4a-GFP and TaABI5-A4a-GFP transgenic rice lines have a reasonable explanation. As a transcription factor, TaABI5 probably participates in the regulation of the expression of multiple genes. For instance, the NF-YC9 directly binds to ABI5, which facilitates the function of ABI5 to bind and activate the promoter of a target gene EM6, further positively regulates the response to ABA (Bi et al. 2017). Furthermore, the RNA-seq results revealed that the genes ERF113/At5g13330 (LOC_Os08g30100), GSTU16 (LOC_Os10g38360), GSL-OH (LOC_Os03g08460) and ESD4 (LOC_Os01g16730), which respond to ABA stimulus and may be involved in seed dormancy and germination (Liu et al. 2012; Krishnaswamy et al. 2011; Griffiths et al. 1998; Hansen et al. 2008; Chang et al. 2022; Cui et al. 2022), were differentially expressed between TaABI5-A4a-GFP and TaABI5-A4b-GFP transgenic rice lines. A working model for TaABI5-A4 was predicated according to the data of RNA-seq for mature seeds of TaABI5-A4a/b-GFP transgenic lines (Fig. 10 ). Overexpression of TaABI5-A4 increased the endogenous ABA content in mature seeds of TaABI5-A4a-GFP transgenic rice. ABA is perceived and bound by ABA receptors PYR/PYL/PCAR; these receptors can form a complex with PP2C, thereby leading to the relief of inhibition of PP2C to the SnRK2s, and then activating SnRK2s (Chen et al. 2020; Cutler et al. 2010; Lin et al. 2021; Soma et al. 2020). Activated SnRK2s in turn activate downstream transcription factors such as ABI5 and its homologs ABRE-binding factors (ABFs), which activate ABA-responsive genes (Fujii et al. 2007; Nakashima et al. 2009), resulting in the change of seed dormancy (Fig. 10 ). In addition, the ethylene response factor ERF96 increases the content of GSH (Jiang et al. 2020), thus enhances the antioxidative defense function (Van 2013). Therefore, increasing transcript expression level of ERF113 due to the overexpression of TaABI5-A4 (Fig. 10 ) can lead to the changes of GSH homeostasis in the regulation of ABA signaling regulated by GST (Zhang et al. 2019), and peroxidation of GSH can be catalyzed by GSTs (Wagner et al. 2002), which promotes removal of ROS and leads to seed dormancy (Fig. 10 ). Transcript expression level of GSL-OH also increased as shown in the RNA-seq data, which could catalyze the 2-hydroxybut-3-enyl glucosinolate, and have biological activities including toxicity to Caenorhabditis elegans , and enhance the seed dormancy (Griffiths et al. 1998; Hansen et al. 2008) (Fig. 10 ). The ESD4 was significantly decreased based on RNA-seq data; it has negative roles in response to ABA in seed dormancy (Chang et al. 2022), and esd4-3 mutant is ABA-hypersensitive (Cui et al. 2022), and the decreased transcript expression level of ESD4 may also result in much high seed dormancy (Fig. 10 ). Declarations Author contribution statement Y Han and Z Wang performed the experiments. YJ Zhang and JD Liu constructed the RIL population. Y Yang designed the experiment and assisted in writing the paper. Acknowledgements This work was supported by grants from the Key Projects of Inner Mongolia Natural Science Foundation (2023ZD08), Universities directly under the Inner Mongolia Autonomous Region Basal Research Fund (BR231519), and the National Natural Science Foundation of China (31960424). Compliance with ethical standards Conflict of interest The authors declare no conflicts of interest in regard to this manuscript. Ethical standards We declare that these experiments comply with the ethical standards in China where they were performed. References Arqyris J, Dahal P, Hayashi E, Still DW, Bradford KJ (2008) Genetic variation for lettuce seed thermoinhibition is associated with temperature-sensitive expression of abscisic acid, gibberellin and ethylene biosynthesis, metabolism and response genes. Plant Physiol 148(2):926–947. https://doi.org/10.1104/pp.108.125807 Benech-Arnold RL, Rodríguez MV (2018) Pre-harvest sprouting and grain dormancy in Sorghum bicolor : What Have We Learned? Front Plant Sci 9:811. https://doi.org/10.3389/fpls.2018.00811 Bi C, Ma Y, Wang XF, Zhang DP (2017) Overexpression of the transcription factor NF-YC9 confers abscisic acid hypersensitivity in Arabidopsis . Plant Mol Biol 95(4–5):425–439. https://doi.org/10.1007/s11103-017-0661-1 Brocard-Gifford I, Lynch TJ, Garcia ME, Malhotra B, Finkelstein RR (2004) The Arabidopsis thaliana Abscisic Acid-insensitive8 locus encodes a novel protein mediating abscisic acid and sugar responses essential for growth. Plant Cell 16:406–421. https://doi.org/10.1105/tpc.018077 Casaretto J, Ho TH (2003) The transcription factors HvABI5 and HvVP1 are required for the abscisic acid induction of gene expression in barley aleurone cells. Plant Cell 15:271–284. https://doi.org/10.1105/tpc.007096 Chang YN, Wang Z, Ren Z, Wang CH, Wang P, Zhu JK, Li X, Duan CG (2022) NUCLEAR PORE ANCHOR and EARLY IN SHORT DAYS 4 negatively regulate abscisic acid signaling by inhibiting Snf1-related protein kinase2 activity and stability in Arabidopsis . J Integr Plant Biol 64(11):2060–2074. https://doi.org/10.1111/jipb.13349 Chen K, Li GJ, Bressan RA, Song CP, Zhu JK, Zhao Y (2020) Abscisic acid dynamics, signaling, and functions in plants. J Integr Plant Biol 62:25–54. https://doi.org/10.1111/jipb.12899 Cui X, Lv M, Cao Y, Li Z, Liu Y, Ren Z, Zhang H (2022) NUA and ESD4 negatively regulate ABA signaling during seed germination. Stress Biol 2(1):38. https://doi.org/10.1007/s44154-022-00062-1 Culbertson MR (1999) RNA surveillance. Unforeseen consequences for gene expression, inherited genetic disorders and cancer. Trends Genet 15(2):74–80. https://doi.org/10.1016/s0168-9525(98)01658-8 Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61:651–679. https://doi.org/10.1146/annurev-arplant-042809-112122 Dai MQ, Xue Q, Mccray T, Margavage K, Chen F, Lee JH, Nezames CD, Guo LQ, Terzaghi W, Wan JM, Deng XW, Wang HY (2013) The PP6 phosphatase regulates ABI5 phosphorylation and abscisic acid signaling in Arabidopsis . Plant Cell 25:517–534. https://doi.org/10.1105/tpc.112.105767 Eshed Y, Lippman ZB (2019) Revolutions in agriculture chart a course for targeted breeding of old and new crops. Science 366(6466):eaax0025. https://doi.org/10.1126/science.aax0025 Feng YM, Han Y, Han B, Zhao YY, Yang Y, Xing YP (2022) A 4 bp InDel in the promoter of wheat gene TaAFP-B affecting seed dormancy confirmed in transgenic rice. Front Plant Sci 13:837805. https://doi.org/10.3389/fpls.2022.837805 Feng YM, Liu M, Wang Z, Zhao XL, Han B, Xing YP, Wang MY, Yang Y (2019) A 4-bp deletion in the 5’UTR of TaAFP-B is associated with seed dormancy in common wheat ( Triticum aestivum L). BMC Plant Biol 19:349. https://doi.org/10.1186/s12870-019-1950-4 Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell 14(Suppl):s15–s45. https://doi.org/10.1105/tpc.010441 Finkelstein RR, Lynch TJ (2000) The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 12:599–609. https://doi.org/10.1105/tpc.12.4.599 Fujii H, Verslues PE, Zhu JK (2007) Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis . Plant Cell 19:485–494. https://doi.org/10.1105/tpc.106.048538 Gonzalez-Guzman M, Pizzio GA, Antoni R, Vera-Sirera F, Merilo E, Bassel GW, Fernández MA, Holdsworth MJ, Perez-Amador MA, Kollist H, Rodriguez PL (2012) Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid. Plant Cell 24(6):2483–2496. https://doi.org/10.1105/tpc.112.098574 Griffiths DW, Birch ANE, Hillman JR (1998) Antinutritional compounds in the Brassicaceae -analysis, biosynthesis, chemistry and dietary effects. J Hortic Sci Biotechnol 73:1–18. https://doi.org/10.1080/14620316.1998.11510937 Gubler F, Millar AA, Jacobsen JV (2005) Dormancy release, ABA and pre-harvest sprouting. Curr Opin Plant Biol 8(2):183–187. https://doi.org/10.1016/j.pbi.2005.01.011 Hansen BG, Kerwin RE, Ober JA, Lambrix VM, Mitchell-Olds T, Gershenzon J, Halkier BA, Kliebenstein DJ (2008) A novel 2-oxoacid-dependent dioxygenase involved in the formation of the goiterogenic 2-hydroxybut-3-enyl glucosinolate and generalist insect resistance in Arabidopsis . Plant Physiol 148(4):2096–2108. https://doi.org/10.1104/pp.108.129981 Hentze MW, Kulozik AE (1999) A perfect message: RNA surveillance and nonsense-mediated decay. Cell 96(3):307–310. https://doi.org/10.1016/s0092-8674(00)80542-5 Hu Y, Han X, Yang ML, Zhang MH, Pan JJ, Yu DQ (2019) The transcription factor INDUCER OF CBF EXPRESSION1 interacts with ABSCISIC ACID INSENSITIVE5 and DELLA proteins to Fine-tune abscisic acid signaling during seed germination in Arabidopsis . Plant Cell 31(7):1520–1538. https://doi.org/10.1105/tpc.18.00825 Isshiki M, Yamamoto Y, Satoh H, Shimamoto K (2001) Nonsense-mediated decay of mutant waxy mRNA in rice. Plant Physiol 125(3):1388–1395. https://doi.org/10.1104/pp.125.3.1388 Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj T, Parcy F (2002) bZIP transcription factors in Arabidopsis . Trends Plant Sci 7:106–111. https://doi.org/10.1016/s1360-1385(01)02223-3 Jiang L, Yang J, Liu CX, Chen ZP, Yao ZC, Cao SQ (2020) Overexpression of ethylene response factor ERF96 gene enhances selenium tolerance in Arabidopsis . Plant Physiol Biochem 149:294–300. https://doi.org/10.1016/j.plaphy.2020.02.024 Johnson RR, Shin M, Shen JQ (2008) The wheat PKABA1-interacting factor TaABF1 mediates both abscisic acid-suppressed and abscisic acid-induced gene expression in bombarded aleurone cells. Plant Mol Biol 68:93–103. https://doi.org/10.1007/s11103-008-9354-0 Ju L, Jing YX, Shi PT, Liu J, Chen JS, Yan JJ, Chu JF, Chen KM, Sun JQ (2019) JAZ proteins modulate seed germination through interaction with ABI5 in bread wheat and Arabidopsis . New Phytol 223(1):246–260. https://doi.org/10.1111/nph.15757 Kong XC, Wang F, Wang ZY, Gao XH, Geng SF, Deng ZY, Zhang S, Fu MX, Cui DD, Liu SS, Che YQ, Liao RY, Yin LJ, Zhou P, Wang K, Ye XG, Liu DC, Fu XD, Mao L, Li AL (2023) Grain yield improvement by genome editing of TaARF12 that decoupled peduncle and rachis development trajectories via differential regulation of gibberellin signalling in wheat. Plant Biotechnol J 21(10):1990–2001. https://doi.org/10.1111/pbi.14107 Krishnaswamy S, Verma S, Rahmab MH, Kav NNV (2011) Functional characterization of four APETALA2-family genes ( RAP2.6 , RAP2.6L , DREB19 and DREB26 ) in Arabidopsis . Plant Mol Biol 75(1/2):107–127. https://doi.org/10.1007/s11103-010-9711-7 Li CD, Ni PX, Francki M, Hunter A, Zhang Y, Schibeci D, Li H, Tarr A, Wang J, Cakir M, Yu J, Bellgard M, Lance R, Appels R (2004) Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison. Funct Integr Genom 4:84–93. https://doi.org/10.1007/s10142-004-0104-3 Liang Y, Xia JQ, Jiang YS, Bao YZ, Chen HC, Wang DJ, Zhang D, Yu J, Cang J (2022) Genome-wide identification and analysis of bZIP gene family and resistance of TaABI5 ( TabZIP96 ) under freezing stress in wheat ( Triticum aestivum ). Int J Mol Sci 4:2351. https://doi.org/10.3390/ijms23042351 Lim S, Park J, Lee N, Jeong J, Toh S, Watanabe A, Kim J, Kang H, Kim DH, Kawakami N, Choi G (2013) ABA-insensitive3, ABA-insensitive5, and DELLAs interact to activate the expression of SOMNUS and other high-temperature-inducible genes in imbibed seeds in Arabidopsis . Plant Cell 25(12):4863–4878. https://doi.org/10.1105/tpc.113.118604 Lim SD, Lee C, Jang CS (2014) The rice RING E3 ligase, OsCTR1, inhibits trafficking to the chloroplasts of OsCP12 and OsRP1, and its overexpression confers drought tolerance in Arabidopsis . Plant Cell Environ 37(5):1097–1113. https://doi.org/10.1111/pce.12219 Lin Z, Li Y, Wang YB, Liu XL, Ma L, Zhang ZJ, Mu C, Zhang Y, Peng L, Xie SJ, Song CP, Shi HZ, Zhu JK, Wang PC (2021) Initiation and amplification of SnRK2 activation in abscisic acid signaling. Nat Commun 12(1):2456. https://doi.org/10.1038/s41467-021-22812-x Liu PQ, Sun F, Gao R, Dong HS (2012) RAP2.6L overexpression delays waterlogging induced premature senescence by increasing stomatal closure more than antioxidant enzyme activity. Plant Mol Biol 79(6):609–622. https://doi.org/10.1007/s11103-012-9936-8 Liu SP, Li L, Wang WL, Xia GM, Liu SW (2023) TaSRO1 interacts with TaVP1 to modulate seed dormancy and pre-harvest sprouting resistance in wheat. J Integr Plant Biol 66(1):36–53. https://doi.org/10.1111/jipb.13600 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 –∆∆CT method. Methods 25:402–408 Lopez-Molina L, Chua NH (2000) A null mutation in a bZIP factor confers ABA-insensitivity in Arabidopsis thaliana . Plant Cell Physiol 41:541–547. https://doi.org/10.1093/pcp/41.5.541 Lopez-Molina L, Mongrand S, Mclachlin DT, Chait BT, Chua NH (2002) ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during germination. Plant J 32:317–328. https://doi.org/10.1046/j.1365-313x.2002.01430.x Lopez-Molina L, Mongrand S, Chua NH (2001) A post-germination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in Arabidopsis . Proc Natl Acad Sci USA 98:4782–4787. https://doi.org/10.1073/pnas.081594298 Lopez-Molina L, Mongrand S, Kinoshita N, Chua NH (2003) AFP is a novel negative regulator of ABA signaling that promotes ABI5 protein degradation. Genes Dev 17:410–418. https://doi.org/10.1101/gad.1055803 Lynch T, Née G, Chu A, Krüger T, Finkemeier I, Finkelstein RR (2022) ABI5 binding protein2 inhibits ABA responses during germination without ABA-INSENSITIVE5 degradation. Plant Physiol 189(2):666–678. https://doi.org/10.1093/plphys/kiac096 Nakamura S, Toyama T (2001) Isolation of a VP1 homologue from wheat and analysis of its expression in embryos of dormant and non-dormant cultivars. J Exp Bot 52:875–876. https://doi.org/10.1093/jexbot/52.357.875 Nakashima K, Fujita Y, Kanamori N, Katagiri T, Umezawa T, Kidokoro S, Maruyama K, Yoshida T, Ishiyama K, Kobayashi M, Shinozaki K, Yamaguchi-Shinozaki K (2009) Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. Plant Cell Physiol 50:1345–1363. https://doi.org/10.1093/pcp/pcp083 Ohnishi N, Himi E, Yamasaki Y, Noda K (2008) Differential expression of three ABA-insensitive five binding protein (AFP)-like genes in wheat. Genes Genet Syst 83:167–177. https://doi.org/10.1266/ggs.83.167 Pan JJ, Wang HP, Hu YR, Yu DQ (2018) Arabidopsis VQ18 and VQ26 proteins interact with ABI5 transcription factor to negatively modulate ABA response during seed germination. Plant J 95(3):529–544. https://doi.org/10.1111/tpj.13969 Renata C, Daniel CC, Luis BAR, Verónica RM (2013) In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy. J Exp Bot 18:5721–5735. https://doi.org/10.1093/jxb/ert347 Skubacz A, Daszkowska-Golec A, Szarejko I (2016) The role and regulation of ABI5 (ABA-Insensitive 5) in plant development, abiotic stress responses and phytohormone crosstalk. Front Plant Sci 7:1884. https://doi.org/10.3389/fpls.2016.01884 Soma F, Takahashi F, Suzuki T, Shinozaki K, Yamaguchi-Shinozaki K (2020) Plant Raf-like kinases regulate the mRNA population upstream of ABA-unresponsive SnRK2 kinases under drought stress. Nat Commun 11(1):1373. https://doi.org/10.1038/s41467-020-15239-3 Song RF, Hu XY, Liu WC, Yuan HM (2024) ABA functions in low phosphate-induced anthocyanin accumulation through the transcription factor ABI5 in Arabidopsis . Plant Cell Rep 43(2):55. https://doi.org/10.1007/s00299-024-03146-6 Stone SL, Williams LA, Farmer L (2006) Keep on going a RING E3 ligase essential for Arabidopsis growth and development, is involved in abscisic acid signaling. Plant Cell 18:3415–3428. https://doi.org/10.1105/tpc.106.046532 Sun YW, Jones HD, Yang Y, Dreisigacker S, Li SM, Chen XM, Shewry PR, Xia LQ (2012) Haplotype analysis of Viviparous-1 gene in CIMMYT elite bread wheat germplasm. Euphytica 186:25–43. https://doi.org/10.1007/s10681-011-0482-2 Utsugi S, Ashikawa I, Nakamura S, Shibasaka M (2022) TaABI5, a wheat homolog of Arabidopsis thaliana ABA insensitive 5, controls seed germination. J Plant Res 133(2):245–256. https://doi.org/10.1007/s10265-020-01166-3 Van Hoewyk D (2013) A tale of two toxicities: malformed selenoproteins and oxidative stress both contribute to selenium stress in plants. Ann Bot 112(6):965–972. https://doi.org/10.1093/aob/mct163 Wagner U, Edwards R, Dixon DP, Mauch F (2002) Probing the diversity of the Arabidopsis glutathione S -Transferase gene family. Plant Mol Biol 49:515–532. https://doi.org/10.1023/a:1015557300450 Wang SL, Chen YB, Qu FL, He SM, Huang XJ, Jiang HQ, Jin TB, Wan SG, Xing JL (2014) Association between leukocyte telomere length and glioma risk: a case-control study. Neuro Oncol 16(4):505–512. https://doi.org/10.1093/neuonc/not240 Wang Z (2019) Isolation of TaABI5 and development of a STS marker for pre-harvest sprouting resistance in Chinese bread wheat. Inner Mongolia Agricultural University Wei JK, Li XJ, Song P, Wang YG, Ma JZ (2022) Studies on the interactions of AFPs and bZIP transcription factor ABI5. Biochem Biophys Res Commun 590:75–81. https://doi.org/10.1016/j.bbrc.2021.12.046 Xiang Y, Zhao CY, Li Q, Niu YX, Pan YT, Li GD, Cheng Y, Zhang AY (2024) Pectin methylesterase 31 is transcriptionally repressed by ABI5 to negatively regulate ABA-mediated inhibition of seed germination. Front Plant Sci 15:1336689. https://doi.org/10.3389/fpls.2024.1336689 Xiao CS, Liu Yu J, Chen WS, Yang J, Cheng MP, Watt C, Cheng JY, Wang ZZ, Tan Z, Li ML, Wang JR (2021) Characterization and expression QTL analysis of TaABI4 , a pre-harvest sprouting related gene in wheat. Cold Spring Harb Lab 31:188–198. https://doi.org/10.1101/2020.09.18.303065 Yang Y, Ma YZ, Xu ZS, Chen XM, He ZH, Yu Z, Wilkinson M, Jones DH, Shewry RP, Xia LQ (2007) Isolation and characterization of Viviparous-1 genes in wheat varieties with distinct pre-harvest sprouting tolerance and ABA sensitivity. J Exp Bot 58:2863–2871. https://doi.org/10.1093/jxb/erm073 Yang Y, Zhang CL, Liu SX, Sun YQ, Meng JY, Xia LQ (2014) Characterization of the rich haplotypes of Viviparous-1A in Chinese wheats and development of a novel sequence-tagged site marker for pre-harvest sprouting resistance. Mol Breed 33:75–88. https://doi.org/10.1007/s11032-013-9935-8 Zhang LP, Wu M, Teng YJ, Jia SH, Yu DS, Wei T, Chen CB, Song WQ (2019) Overexpression of the glutathione peroxidase 5 ( RcGPX5 ) gene from Rhodiola crenulata increases drought tolerance in Salvia miltiorrhiza . Front Plant Sci 9:1950. https://doi.org/10.3389/fpls.2018.01950 Zhang X, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes Dev 19:1532–1543. https://doi.org/10.1101/gad.1318705 Zhao HY, Nie KL, Zhou HP, Yan XJ, Zhan QD, Zheng Y, Song CP (2020) ABI5 modulates seed germination via feedback regulation of the expression of the PYR/PYL/RCAR ABA receptor genes. New Phytol 228(2):596–608. https://doi.org/10.1111/nph.16713 Zhao X, Dou LR, Gong ZZ, Wang XF, Mao TL (2019) BES1 hinders ABSCISIC ACID INSENSITIVE5 and promotes seed germination in Arabidopsis . New Phytol 221(2):908–918. https://doi.org/10.1111/nph.15437 Zhou K, Yang J, Wang ZX, Wang JR (2017) Sequence analysis and expression profiles of TaABI5 , a pre-harvest sprouting resistance gene in wheat. Genes Genom 39:161–171. https://doi.org/10.1007/s13258-016-0483-6 Zhou XN, Hao HM, Zhang YG, Bai YL, Zhu WB, Qin YX, Yuan FF, Zhao FY, Wang MY, Hu JJ, Xu H, Guo AG, Zhao HX, Zhao Y, Cao CL, Yang YQ, Schumaker KS, Guo Y, Xie CG (2015) SOS2-LIKE PROTEIN KINASE5, an SNF1-RELATED PROTEIN KINASE3-Type protein kinase, is important for abscisic acid responses in Arabidopsis through phosphorylation of ABSCISIC ACID-INSENSITIVE5. Plant Physiol 168(2):659–676. https://doi.org/10.1104/pp.114.255455 Zou MJ, Guan YC, Ren HB, Zhang F, Chen F (2007) Characterization of alternative splicing products of bZIP transcription factors OsABI5. Biochem Biophys Res Commun 360:307–313. https://doi.org/10.1016/j.bbrc.2007.05.226 Supplementary Files SupplementaryMaterial.pdf Cite Share Download PDF Status: Published Journal Publication published 28 Sep, 2024 Read the published version in Theoretical and Applied Genetics → Version 1 posted Editorial decision: Minor revisions 19 Aug, 2024 Reviewers agreed at journal 21 Jul, 2024 Reviewers invited by journal 10 Jul, 2024 Editor assigned by journal 09 Jul, 2024 First submitted to journal 09 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4710390","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":325421197,"identity":"047b515b-f660-4c87-a325-3a8bb2d52e5c","order_by":0,"name":"Yang Han","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYBACAygtZ9/MfPDxjwoJOXlitRgbsLclGzOcsTA2bCBSS+IGnjNm0oxtFYkMBwhoMWc/e0zi547axO0SOQbShfMkEhgbmB8+uoFHi2VPXppk75njxjtnpBUYz9wmkcfOwGZsnIPPYQdyzCR4247JNtxI3pDAu02imLGBh00ar5bzb8wk/7YdY2y4kWBwgHeORGLDAUJabuSYSfO21ShuOHPEsJm3gSgtb4ytZdsOGEu2tyUzzjgmYWzYTMgv53MMb75tq5PjZ2Y+/uNDTZ2cPHvzw8f4tAABiwQDw2EkPjN+5WAlHxgY6ggrGwWjYBSMgpELANH6UeERGAjGAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0009-0005-8720-3664","institution":"Inner Mongolia Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yang","middleName":"","lastName":"Han","suffix":""},{"id":325421198,"identity":"7c0fb675-260d-4780-8115-24c231636d77","order_by":1,"name":"Zeng Wang","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zeng","middleName":"","lastName":"Wang","suffix":""},{"id":325421199,"identity":"71984987-c1b0-48a1-94a6-8777ed27a79f","order_by":2,"name":"Bing Han","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Bing","middleName":"","lastName":"Han","suffix":""},{"id":325421200,"identity":"46710d3d-d483-417a-9dbc-be5c0fc0ee55","order_by":3,"name":"Yingjun Zhang","email":"","orcid":"","institution":"Hebei Academy of Agriculture and Forestry Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yingjun","middleName":"","lastName":"Zhang","suffix":""},{"id":325421201,"identity":"b4b4af4e-abf9-42f2-8a5c-d5411dbdf682","order_by":4,"name":"Jindong Liu","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jindong","middleName":"","lastName":"Liu","suffix":""},{"id":325421202,"identity":"00e6b72e-1f71-4bb9-8041-f15060abc9c4","order_by":5,"name":"Yan Yang","email":"","orcid":"https://orcid.org/0000-0003-1331-9662","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-07-09 08:28:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4710390/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4710390/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00122-024-04753-3","type":"published","date":"2024-09-28T15:57:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":61801077,"identity":"88963290-bb9f-4675-95e7-3a6de6075bbd","added_by":"auto","created_at":"2024-08-05 17:33:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":71415,"visible":true,"origin":"","legend":"\u003cp\u003ePCR fragments amplified with TaABI5A4aF/R (a) and TaABI5A4bF/R (b) in 12 Chinese wheat cultivars with different PHS tolerance. M: DL 2000; 1: Xiaobaiyuhua (GI% value: 4.0); 2: Yumai 18 (7.2); 3: Yangxiaomai (7.5); 4: Xiaoyuhua (9.7); 5: Jimai 19 (58.4); 6: Jing 411 (64.2); 7: Xiaoyan 6 (13.7); 8: Hengshui 7228 (68.4); 9: Zhongyou 9507 (70.8); 10: Zhou 8425B (56.0); 11: Xinmai 19 (46.8); 12: Weimai 8 (37.5)\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/9ca7b12aa6f7882f189566a3.png"},{"id":61801320,"identity":"f6b14826-b6ae-4bfc-945f-83f82f1c5ccf","added_by":"auto","created_at":"2024-08-05 17:41:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":167592,"visible":true,"origin":"","legend":"\u003cp\u003eSemi-quantitative RT-PCR analysis of\u003cem\u003eTaABI5\u003c/em\u003e (a) and \u003cem\u003eTaABI5-A4\u003c/em\u003e (b) in seeds of Jing 411 and Wanxianbaimaizi M: DL 2000; Lanes 1, 3, and 5: Jing 411 (grains at 10, 20, and 30 days post-anthesis, respectively); Lanes 2, 4 and 6: Wanxianbaimaizi (grains at 10, 20, and 30 days post-anthesis, respectively)\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/d3d0da413339e997d3891408.png"},{"id":61801704,"identity":"a16dbbaf-4e80-4e43-9426-12131a805f76","added_by":"auto","created_at":"2024-08-05 17:49:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":537483,"visible":true,"origin":"","legend":"\u003cp\u003eqPCR analysis of \u003cem\u003eTaABI5\u003c/em\u003e (a) and \u003cem\u003eTaABI5-A4\u003c/em\u003e (b) in grains of Xiaoyan 6, Wanxianbaimaizi, Xiaobaiyuhua, Jing411, Zhou8425B, and Hengshui7228. * and ** mean significant differences at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, respectively\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/490a16ef59a8ee2ffe9e4915.png"},{"id":61801322,"identity":"85f4382d-3a12-4306-b52e-4ecf40e82351","added_by":"auto","created_at":"2024-08-05 17:41:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3242079,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotypic traits and differences between T2 \u003cem\u003eTaABI5-A4a-GFP \u003c/em\u003eand \u003cem\u003eTaABI5-A4b-GFP \u003c/em\u003etransgenic rice lines.\u003c/p\u003e\n\u003cp\u003e*, **, *** and **** represent significant differences between transgenic lines and a negative control at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.0001, respectively\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/d220548a6d210975100b127b.png"},{"id":61801078,"identity":"7711a5f0-a11e-4d9a-bd99-a2a6268c79db","added_by":"auto","created_at":"2024-08-05 17:33:32","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":334401,"visible":true,"origin":"","legend":"\u003cp\u003eEndogenous ABA and GA contents in mature seeds of \u003cem\u003eTaABI5-A4a-GFP \u003c/em\u003eand \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines and a negative control with an empty vector. **, *** and **** mean significant differences between \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e, \u003cem\u003eTaABI5-A4b-GFP \u003c/em\u003etransgenic lines and the control at \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.0001, respectively\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/c563a4826ecc8ca3f4d90266.png"},{"id":61801085,"identity":"60391460-129e-47ba-b67e-9f7e7d1156bd","added_by":"auto","created_at":"2024-08-05 17:33:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3182287,"visible":true,"origin":"","legend":"\u003cp\u003eABA sensitivity assay of T2 \u003cem\u003eTaABI5-A4a-GFP \u003c/em\u003eand \u003cem\u003eTaABI5-A4b-GFP \u003c/em\u003etransgenic rice lines and a negative control with an empty vector. (a) Photographs show seeds of control, \u003cem\u003eTaABI5-A4a-GFP \u003c/em\u003eand \u003cem\u003eTaABI5-A4b-GFP \u003c/em\u003etransgenic rice lines after 48 h of imbibition. The seeds were incubated in distilled water with or without 50 µM ABA. (b) The percentages of germination are indicated by symbols open circle, open square and open triangle for \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e, \u003cem\u003eTaABI5-A4b-GFP \u003c/em\u003eand controls, respectively; and the percentages of germination are indicated by red or blue lines for water and ABA treatments, respectively\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/8505286640c95650d4d06a82.png"},{"id":61801081,"identity":"dd014bf6-5ca1-45c3-bd53-101726d777ed","added_by":"auto","created_at":"2024-08-05 17:33:32","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":576935,"visible":true,"origin":"","legend":"\u003cp\u003eExpression profiles of \u003cem\u003eTaABI5-A4 \u003c/em\u003eby qPCR under different stress treatments for 0, 6, 12, 24 and 48 h, respectively, in three-leaf-stage transgenic rice lines; the control was a transgenic line with an empty vector. (a) 100 μM ABA stress treatment; (b) 150 mM NaCl stress treatment; (c) 300 mM mannitol stress treatment\u003c/p\u003e","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/bd116b3dfb500b48310b37dd.png"},{"id":61801323,"identity":"24f0153a-0ab7-4ab0-a6f5-d1cc2c64df39","added_by":"auto","created_at":"2024-08-05 17:41:32","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1348791,"visible":true,"origin":"","legend":"\u003cp\u003eExpression level of \u003cem\u003eGFP \u003c/em\u003eby qPCR\u003cem\u003e \u003c/em\u003ein transgenic rice lines at three-leaf stage (a), and expression level of fusion TaABI5-D-GFP in mature seeds of transgenic rice lines\u003cem\u003e \u003c/em\u003eby Western blotting (b). The positive control is a \u003cem\u003eTaABI5-D3-GFP \u003c/em\u003etransgenic line. ** and **** indicate significant differences between transgenic plants and positive control at \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01 and \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.0001, respectively. M: Prestained protein marker (10-180 kDa); 1: the negative control with an empty vector; 2: \u003cem\u003eTaABI5-A4a-GFP \u003c/em\u003etransformant; 3: \u003cem\u003eTaABI5-A4b-GFP \u003c/em\u003etransformant; 4: the positive control of \u003cem\u003eTaABI5-D3-GFP \u003c/em\u003etransformant.\u003c/p\u003e","description":"","filename":"Fig.8.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/9d04dbe0ee1f6b6e657ae058.png"},{"id":61801324,"identity":"1b760700-492a-4aae-855d-82b87d357f1a","added_by":"auto","created_at":"2024-08-05 17:41:32","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":3572343,"visible":true,"origin":"","legend":"\u003cp\u003eRNA-sequencing analysis of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines (a) Volcano plots represent differential expression genes; (b) KEGG analysis on up-regulated DEGs in T2 relative to T1; (c-d) GO analysis on up-regulated and down-regulated DEGs in T2 relative to T1; (e) Heatmap representing the relative abundance of genes in up-regulated and down-regulated DEGs in T2 relative to T1; (f) Validation for the relative expression levels of DEGs by qPCR. T1: \u003cem\u003eTaABI5-A4b-GFP \u003c/em\u003etransgenic rice; T2: \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic rice; Pathways related to stress and q-value \u0026lt; 0.05 are highlighted in red. **** represents significant differences at \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"Fig.9.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/20599d6b13534316c3620b9c.png"},{"id":61801083,"identity":"32673b36-1d47-43f0-863a-0fc4b0f53ab5","added_by":"auto","created_at":"2024-08-05 17:33:32","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":8902198,"visible":true,"origin":"","legend":"\u003cp\u003eProposed working model for \u003cem\u003eTaABI5-A4 \u003c/em\u003emediated PHS resistance. Overexpression of \u003cem\u003eTaABI5-A4 \u003c/em\u003eincreases endogenous abscisic acid content in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic rice, alters the expression of genes \u003cem\u003eERF113\u003c/em\u003e, \u003cem\u003eGSTU16\u003c/em\u003e, \u003cem\u003eGSL-OH\u003c/em\u003e and \u003cem\u003eESD4\u003c/em\u003e, and further promotes seed dormancy or germination\u003c/p\u003e","description":"","filename":"Fig.10.png","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/ccef764213f6708442d9c2a5.png"},{"id":61801087,"identity":"23be179f-7f9d-4e3f-8734-2e5d28ea29a1","added_by":"auto","created_at":"2024-08-05 17:33:33","extension":"pdf","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":906573,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4710390/v1/a0e0406578eb4a8c6c4af971.pdf"}],"financialInterests":"","formattedTitle":"Allelic variation of TaABI5-A4 Significantly Affects Seed Dormancy in Bread Wheat","fulltext":[{"header":"Key Message","content":"\u003cp\u003eWe identified a pivotal transcription factor \u003cem\u003eTaABI5-A4\u0026nbsp;\u003c/em\u003ethat is significantly associated with pre-harvest sprouting in wheat; its function in regulating seed dormancy was confirmed in transgenic rice.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003ePre-harvest sprouting (PHS) is the germination of seeds prior to maturity in the spike when there is excessive moisture before harvest. PHS tolerance of wheat is predominantly attributed to seed dormancy (Li et al. 2004; Gubler et al. 2005; Sun et al. 2012; Yang et al. 2014). The lack of seed dormancy in many wheat cultivars leads to PHS under humid weather conditions (Gubler et al. 2005). Therefore, it is important to understand the genetic mechanism of seed dormancy in wheat.\u003c/p\u003e \u003cp\u003eABA plays critical roles in plants to respond biotic and abiotic stresses, such as pathogens, low temperatures, drought, salinity, and osmotic stress (Lim et al. 2014; Gonzalez-Guzman et al. 2012; Wei et al. 2022), In the biosynthesis of ABA, many genes are associated with onset and maintenance of seed dormancy (Gubler et al. 2005; Feng et al. 2022; Lynch et al. 2022; Liu et al. 2023; Song et al. 2024). The ABA signaling pathway includes transcription factors of positive and negative regulators. The positive regulatory factors are \u003cem\u003eABI3\u003c/em\u003e, \u003cem\u003eABI4\u003c/em\u003e, and \u003cem\u003eABI5\u003c/em\u003e (Finkelstein and Lynch 2000), which affect seed development and ABA sensitivity, whereas null mutation of \u003cem\u003eabi3\u003c/em\u003e has weaker seed dormancy and ABA sensitivity than that of \u003cem\u003eabi4\u003c/em\u003e or \u003cem\u003eabi5\u003c/em\u003e (Finkelstein and Lynch 2000; Zhao et al. 2020; Xiao et al. 2021; Lynch et al. 2022). Negative regulators include \u003cem\u003eABI1\u003c/em\u003e, \u003cem\u003eABI2\u003c/em\u003e, and AIP2 E3 ligase for \u003cem\u003eABI3\u003c/em\u003e, RING E3 ligase and ABI5 binding protein (AFP) (Lopez-Molina et al. 2003; Zhang et al. 2005; Stone et al. 2006; Wei et al. 2022).\u003c/p\u003e \u003cp\u003eThe basic alkaline leucine zipper transcription factor \u003cem\u003eABI5\u003c/em\u003e is a critical factor in the regulation of seed maturation, dormancy and germination, and post-germination seedling growth (Finkelstein and Lynch 2000; Lopez-Molina and Chua 2000; Lopez-Molina et al. 2001, 2002; Finkelstein et al. 2002; Dai et al. 2013); it belongs to the \u003cem\u003eABI5\u003c/em\u003e/\u003cem\u003eABF\u003c/em\u003e/\u003cem\u003eAREB\u003c/em\u003e/\u003cem\u003eDPBF\u003c/em\u003e transcription factor family, binds to the cis-element ABRE, and regulates the expression of many downstream functional genes related to drought resistance and saline-alkali tolerance (Finkelstein and Lynch 2000; Lopez-Molina and Chua 2000). The plants of loss-of-function \u003cem\u003eabi5\u003c/em\u003e mutant are insensitive to ABA, whereas overexpression of \u003cem\u003eABI5\u003c/em\u003e displays hypersensitive to ABA (Finkelstein and Lynch 2000; Lopez-Molina and Chua 2000; Zhou et al. 2015). The ABI5 protein is activated to be a growth repressor by ABA, resulting in an increase in target promoter occupancy (Lopez-Molina et al. 2002). In addition, degradation of ABI5 protein via the 26S proteasome is inhibited by ABA (Lopez-Molina et al. 2001). The transcription level of \u003cem\u003eABI5\u003c/em\u003e was highest in late embryonic development and reached a peak during seed drying (Jakoby et al. 2002; Brocard-Gifford et al. 2004). As a transcription factor, ABI5 functions mainly through modulating the expression of target genes (Skubacz et al. 2016), such as ABI3, late embryo genesis abundant (LEA), DELLA, BRI1-EMSSUPPRESSOR1 (BES1), JASMONATEZIM-DOMAIN (JAZ) proteins, TaGATA1, INDUCER OF CBF EXPRESSION1 (ICE1), Pectin methylesterase (PME) and AFP to regulate ABA responses (Hu et al. 2019; Ju et al. 2019; Lim et al. 2013; Pan et al. 2018; Zhao et al. 2019; Xiang et al. 2024; Wei et al. 2022). \u003cem\u003eABI3\u003c/em\u003e acts together with \u003cem\u003eABI5\u003c/em\u003e to regulate embryonic gene expression and seed sensitivity to ABA (Lopez-Molina and Chua 2000; Nakamura and Toyama 2001), and ABI3 and ABI5 were degraded during seed germination by the proteasome (Arqyris et al. 2008; Lopez-Molina et al. 2001). \u003cem\u003eABI5\u003c/em\u003e is insensitive to growth arrest following germination as well as the \u003cem\u003eLEA\u003c/em\u003e, induced by ABA, and alters activity of the \u003cem\u003eLEA\u003c/em\u003e gene promoter during the later stage of seed development (Lopez-Molina and Chua 2000; Zou et al. 2007). AFP has functions in the development of seedlings, which is a new negative regulator of ABA signaling that facilitates the degradation of ABI5 (Lopez-Molina et al. 2003). During seed development and desiccation, the transcription and translation level of \u003cem\u003eAFP\u003c/em\u003e increased, ultimately plateauing in mature seeds (Lopez-Molina et al. 2003; Feng et al. 2019, 2022). HVA1 and HVA22 are ABA-induced genes in barley aleurone cells. \u003cem\u003eHvABI5\u003c/em\u003e, a barley bZIP transcription factor, can specifically recognize ABA response complex (ABRC) cis-elements in the promoters of HVA1 and HVA22 (Casaretto and Ho 2003).\u003c/p\u003e \u003cp\u003eMany evidences indicate the functions of ABI5 in seed dormancy formation and releasing in \u003cem\u003eArabidopsis\u003c/em\u003e (Finkelstein and Lynch 2000; Lopez-Molina and Chua 2000), whereas very few proofs are provided in wheat. \u003cem\u003eTaABI5s\u003c/em\u003e were isolated in wheat, one of which has the same sequence as \u003cem\u003eTaABF1\u003c/em\u003e, a homolog of \u003cem\u003eTaABI5\u003c/em\u003e (Johnson et al. 2008). \u003cem\u003eTaABF1\u003c/em\u003e interacts with PKABA1 (SnRK2-type kinase) to mediate ABA-suppressed and -induced gene expression in aleurone cells. \u003cem\u003eTaABI5s\u003c/em\u003e were expressed in developing grains, roots, and leaves (Ohnishi et al. 2008), whereas Zhou et al. (2017) showed that \u003cem\u003eTaABI5\u003c/em\u003e accumulated late in seed development and was expressed in seed only; the cultivar (SHW-L1) with PHS resistance has much higher transcription level of \u003cem\u003eTaABI5\u003c/em\u003e than the PHS-susceptible cultivar Chuanmai 32 (Zhou et al. 2017). In a transient assay in wheat aleurone cells, \u003cem\u003eTaABI5\u003c/em\u003e activated the promoter of \u003cem\u003eEm\u003c/em\u003e containing ABRE, an embryogenesis abundant protein gene, indicating that TaABI5 acts as a transcription factor in wheat seeds (Utsugi et al. 2020), and in rice transgenic lines, TaABI5 plays an important role in mature seeds, particularly before seed germination (Utsugi et al. 2020). Our previous studies showed that \u003cem\u003eTaABI5\u003c/em\u003e belongs to a multigene family, and many copies of \u003cem\u003eTaABI5\u003c/em\u003e were identified in wheat, and allelic variations of \u003cem\u003eTaABI5\u003c/em\u003e are potentially associated with seed dormancy in wheat (Wang 2019).\u003c/p\u003e \u003cp\u003eThe objectives of the present study were to: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) identify homologous sequences of \u003cem\u003eABI5\u003c/em\u003e in bread wheat, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) evaluate allelic variations of \u003cem\u003eTaABI5\u003c/em\u003e in Chinese wheat cultivars and RILs with different PHS tolerance to develop functional markers associated with PHS tolerance for marker-assisted breeding, (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) characterize the transcript expression level of \u003cem\u003eTaABI5-A4\u003c/em\u003e in wheat, and (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) confirm the function of \u003cem\u003eTaABI5-A4\u003c/em\u003e underlying seed dormancy or PHS tolerance in transgenic rice.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant materials\u003c/h2\u003e \u003cp\u003eWheat line Zhou 8425B (germination index (GI%) 56.0) was used to amplify \u003cem\u003eTaABI5\u003c/em\u003e with universal primers. Nine other wheat cultivars were used for PCR amplification of \u003cem\u003eTaABI5\u003c/em\u003e sequences with specific primers, including five PHS-resistant cultivars, Xiaobaiyuhua, Yumai 18, Yangxiaomai, Xiaoyuhua and Xiaoyan 6, with GI values of 4.0, 7.2, 7.5, 9.2 and 13.7 respectively, and four PHS-susceptible cultivars, Jimai 19, Jing 411, Hengshui 7228 and Zhongyou 9507, with GI values of 58.4, 64.2, 68.4 and 70.8, respectively.\u003c/p\u003e \u003cp\u003eOne hundred and three Chinese wheat cultivars and advanced lines with different PHS tolerance from the China Autumn-sown Wheat Region (CAWR), representing more than 85% of wheat production areas in China, were used for an association study (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Among these, 18 cultivars and advanced lines had GI values less than 15, and 85 had GI values between 15\u0026ndash;71. GI was determined based on the average data across two cropping seasons at two locations, Anyang in Henan province and Beijing (Yang et al. 2014). Additionally, 200 RILs derived from the Yangxiaomai/Zhongyou 9507 cross also were used to validate the association between allelic variations of \u003cem\u003eTaABI5-A4\u003c/em\u003e and PHS tolerance. Yangxiaomai is a Chinese landrace wheat, with a low GI value (7.5), whereas Zhongyou 9507 had a high GI value (70.8).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePrimer design\u003c/h2\u003e \u003cp\u003eBased on the sequences of \u003cem\u003eTmABI5\u003c/em\u003e (accession number: AB238933.1), \u003cem\u003eOsABI5\u003c/em\u003e (EF199630.1), and \u003cem\u003eTaABI5\u003c/em\u003e (AB238934.1 and AB238932.1) in GenBank, universal primer sets TaABI5F1/R1 and TaABI5F2/R2 were designed to amplify full-length sequences of \u003cem\u003eTaABI5\u003c/em\u003e in Zhou 8425B. Three primer sets, TaABI5D3F/R, TaABI5A4F/R, and TaABI5D6F/R were used to amplify the sequences of \u003cem\u003eTaABI5-D3\u003c/em\u003e, \u003cem\u003eTaABI5-A4\u003c/em\u003e, and \u003cem\u003eTaABI5-D6\u003c/em\u003e, respectively. Two other primer pairs, TaABI5A4aF/R and TaABI5A4bF/R, were gene-specific markers used for identifying the allelic variants of \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e, respectively. The primer sets RT-TaABI5F/R and RT-TaABI5A4F/R were designed to analyze mRNA expression level of \u003cem\u003eTaABI5\u003c/em\u003e and \u003cem\u003eTaABI5-A4\u003c/em\u003e, respectively. The wheat \u003cem\u003eActin\u003c/em\u003e gene was used as an internal control and included in each reaction to normalize the expression level of \u003cem\u003eTaABI5\u003c/em\u003e and \u003cem\u003eTaABI5-A4\u003c/em\u003e genes; the expected PCR product was 410 bp in length (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sets used for characterization of \u003cem\u003eTaABI5\u003c/em\u003e allelic variants and transgenic lines\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer set\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAnnealing temperature (℃)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFragment size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCATCGGAGATGAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e948\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCACGGTTCTTGATCATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e56.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e948\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGATCAAGAACCGTGAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e56.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e606\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCACCAGATGCAGCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e606\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5D3F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCATCGGAGATGAGCAAGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e64.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1464\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5D3R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGTAGGAAAAAAAAGATCACGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1464\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5A4F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCATCGGAGATGAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e823\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5A4R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCGCTCTGTCGCCCATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e58.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e823\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5D6F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCATCGGAGATGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1384\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5D6R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATTGTTACAAGCAATTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e53.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1384\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5A4aF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCATCGGAGATGAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e494\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5A4aR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCAACCCCACCACCATTCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e64.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e494\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5A4bF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCATCGGAGATGAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e703\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaABI5A4aR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACCATCCCTGCGTACAAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e703\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRT-TaABI5F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCATCGGAGATGAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1174\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRT-TaABI5R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCACCAGATGCAGCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1174\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRT-TaABI5A4F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCATCGGAGATGAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e823\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRT-TaABI5A4R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCGCTCTGTCGCCCATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e58.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e823\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eActin F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTTCCTGGAATTGCTGATCGCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e62.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e410\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eActin R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATTATTTCATACAGCAGGCAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e410\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHpt557F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACACTACATGGCGTGATTTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e557\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHpt557R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCACYAYCGGCGAGTACTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e557\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eQ-TaABI5-A4F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCCGTCAAACCACCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e120\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eQ-TaABI5-A4R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCCCCTGCTGTTCGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e120\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eQ-GFP-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGAGAGGGTGAAGGTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e56.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e130\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eQ-GFP-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTTGAAAAGCATTGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e50.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e130\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePCR amplification and semi-quantitative RT-PCR analysis\u003c/h2\u003e \u003cp\u003eBecause \u003cem\u003eTaABI5\u003c/em\u003e has multiple copies of gene sequences, semi-quantitative RT-PCR was used for \u003cem\u003eTaABI5\u003c/em\u003e transcript expression analysis. PCR for gene cloning, molecular marker test, and semi-quantitative RT-PCR for gene transcript expression analysis of \u003cem\u003eTaABI5s\u003c/em\u003e and \u003cem\u003eTaABI5-A4\u003c/em\u003e were performed in an Applied Biosystems 2720 thermal cycler. Reactions had a total volume of 15 \u0026micro;l, including 1.5 \u0026micro;l of 10\u0026times;PCR buffer, 1.2 \u0026micro;l of 2.5 \u0026micro;M dNTP each, 4 pmol of each primer, 0.75 U of La\u003cem\u003eTaq\u003c/em\u003e polymerase (TaKaRa), and 30 ng of template DNA (cDNA), and brought to 15 \u0026micro;l with ddH\u003csub\u003e2\u003c/sub\u003eO. PCR amplification procedures were 94\u0026deg;C for 5 min, followed by 35 cycles of 94\u0026deg;C for 1 min, 56\u0026deg;C\u0026ndash;67\u0026deg;C for 45 s, and 72\u0026deg;C for 1 min, with a final extension of 72\u0026deg;C for 10 min. Amplified PCR and semi-quantitative RT-PCR products were separated on 1.5% agarose gels with the nucleic acid dye Gelview.\u003c/p\u003e \u003cp\u003ecDNA was synthesized from 5 \u0026micro;g of total RNA using M-MLV reverse transcriptase (TaKaRa) with random hexamer primer Oligod (T)\u003csub\u003e19\u003c/sub\u003e according to the manufacturer\u0026rsquo;s instructions. Semi-quantitative RT-PCR was performed in an Applied Biosystems 2720 thermal cycler. PCR cycling was performed at 94\u0026deg;C for 5 min, followed by 36 cycles of 94\u0026deg;C for 1 min, 57\u0026deg;C\u0026ndash;59\u0026deg;C for 30 s and 72\u0026deg;C for 45 s, with a final extension of 72\u0026deg;C for 10 min. Values were normalized with the amplification rate of the \u003cem\u003eActin\u003c/em\u003e gene as a constitutively expressed internal control. Three replications were carried out for each sample.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was conducted using PROC MIXED (SAS Institute, 8.0). In this study, two types of fragments were amplified using two dominant complementary STS markers TaABI5A4a and TaABI5A4b. These fragments were used to indicate genotype clusters as a categorical variable; mean GI values were derived from each cluster and used in testing the level of significance. GraphPad Prism 8 statistical software was used for data analysis to test significance of differences between clusters.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of transgenic rice materials\u003c/h2\u003e \u003cp\u003eSequences of \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e were cloned into the pCAMBIA1302-GFP vector by General Biology (Anhui) Co., Ltd (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.generalbiol.com\" target=\"_blank\"\u003ewww.generalbiol.com\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.generalbiol.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), respectively. The recombinant vectors were transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain EHA105 to genetically transform embryonic calli of rice (\u003cem\u003eOryza sativa\u003c/em\u003e L. ssp. \u003cem\u003ejaponica\u003c/em\u003e cv. Nipponbare) to create gene-overexpression rice plants following Feng et al. (2019).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of transgenic plants and phenotyping\u003c/h2\u003e \u003cp\u003eAll transgenic rice lines were planted at 28/24 ℃ under 16/8 h light/darkness in greenhouse. The genomic DNA was extracted from fresh leaves of 15 plants of each T1 line by the CTAB method. The positive transgenic lines were identified by PCR. The primer sets and amplified fragments are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. At least 10 positive transgenic lines for each genotype were grown in Rice Professional Cooperative in Yiwu city. The positive T2 transgenic rice lines of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e were analyzed for germination index, ABA sensitivity, exogenous ABA and GA contents, plant height, 100-grain weight, and stem length and diameter.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eGermination assays and ABA sensitivity tests\u003c/h2\u003e \u003cp\u003eFor germination assays, 100 seeds each T2 line were sterilized with 75% ethyl alcohol, and placed in petri dishes covered with damp filter paper at room temperature. Germination for each transgenic line was scored based on radical emergence every 24 h for 7 d for calculating the GI value (Sun et al. 2012). For the ABA sensitivity test, 30 seeds from each T2 line were sterilized with 75% ethyl alcohol and were incubated on filter paper with water or 50 \u0026micro;M ABA solution at room temperature for at least two weeks, then the germination rate was calculated (Sun et al. 2012). Each experiment was performed in three biological replications.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStress treatments and qPCR analysis\u003c/h2\u003e \u003cp\u003eFor stress treatments, 100 \u0026micro;M ABA, 150 \u0026micro;M NaCl solution and 300 \u0026micro;M mannitol solution were used to treat transgenic rice leaves at the three-leaf stage for 48 h (Feng et al. 2019; Liang et al. 2022). The samples were treated in greenhouse at 28/24 ℃ under 16/8 h light/darkness. Samples were collected at 0, 6, 12, 24, and 48 h post treatments, then frozen in liquid nitrogen to extract total RNA. Transgenic leaves from empty vector transformants were used as controls. Each experiment was performed in three biological replications.\u003c/p\u003e \u003cp\u003eThe expression characteristics of \u003cem\u003eTaABI5-A4\u003c/em\u003e gene were analyzed under different treatments (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and the primers were designed on Primer Premier 5 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.premierbiosoft.com/primerdesign/index.html\u003c/span\u003e\u003cspan address=\"http://www.premierbiosoft.com/primerdesign/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The TB Green Premix Ex Taq\u0026trade; Ⅱ (TaKaRa, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.generalbiol.com\" target=\"_blank\"\u003ewww.takarabiomed.com.cn\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.takarabiomed.com.cn\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used in PCR. Three biological replications were conducted for each sample and the relative expression level was calculated using the 2\u003csup\u003e\u0026minus;∆∆ct\u003c/sup\u003e method (Livak and Schmittgen 2001).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRNA sequencing analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from the mature seeds of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines, using TRIzol reagent according to the manufacturer\u0026rsquo;s instructions. RNA purity and quantification were evaluated using the NanoDrop 2000 spectrophotometer (Thermo Scientific USA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Then the libraries were constructed using VAHTS Universal V6 RNA-seq Library Prep Kit according to the manufacturer\u0026rsquo;s instructions, with each sample in three biological replications, and transcriptome sequencing and analysis were conducted by OE Biotech Co., Ltd. (Shanghai, China). Raw reads of fastp format were firstly processed using fastp and the low-quality reads were removed to obtain the clean reads. The clean reads were mapped to the rice reference genome (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://rice.uga.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/pseudomolecules/version_7.0/\u003c/span\u003e\u003cspan address=\"http://rice.uga.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/pseudomolecules/version_7.0/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) using HISAT2. FPKM of each gene was calculated and the read counts of each gene were obtained by HT Seq-count. Differential expression analysis was performed using the DESeq2. The Q value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and fold change\u0026thinsp;\u0026gt;\u0026thinsp;2 or foldchange\u0026thinsp;\u0026lt;\u0026thinsp;0.5 were set as the thresholds to determine significantly differentially expressed genes (DEGs). Based on the hypergeometric distribution, GO and KEGG pathway enrichment analysis of DEGs was performed to screen the significantly enriched terms by Bioinformatic analysis using the OECloud tools (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cloud.oebiotech.cn\u003c/span\u003e\u003cspan address=\"https://cloud.oebiotech.cn\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eFluorescent protein expression and Western blotting\u003c/h2\u003e \u003cp\u003eFresh leaves of positive \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice plants at 30 d after germination (DAG) were used to analyze the expression of GFP by qPCR; the primer sets and amplified fragments are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Each experiment was performed in three biological replications. The total protein of transgenic rice seeds was extracted by Plant Total Protein Extraction Kit (Sangon Biotech, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.sangon.com\u003c/span\u003e\u003cspan address=\"https://www.sangon.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e); the proteins were separated by 12% (w/v) SDS-PAGE gel electrophoresis, and transferred to PVDF membrane (Sangon Biotech). Anti-GFP (Shanghai Univ Technology, 1:2000 dilution) was used as a probe to detect the TaABI5-A fusion protein in transgenic rice.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eIdentification of new copies of\u003c/b\u003e \u003cb\u003eTaABI5\u003c/b\u003e \u003cb\u003ein wheat line 8425B\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe full-length sequence of \u003cem\u003eTaABI5\u003c/em\u003e was isolated from Zhou 8425B using a universal primer set (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). A total of 16 copies of \u003cem\u003eTaABI5\u003c/em\u003e from Zhou 8425B were detected based on the comparison of \u003cem\u003eABI5\u003c/em\u003e with the sequences deposited in the IWGSC and the 2005 Supplement of the Wheat Gene Catalogue. These copies were named \u003cem\u003eTaABI5-A1\u003c/em\u003e, \u003cem\u003eTaABI5-A2\u003c/em\u003e, \u003cem\u003eTaABI5-A3\u003c/em\u003e and \u003cem\u003eTaABI5-A4\u003c/em\u003e on the short arm of chromosome 3A, \u003cem\u003eTaABI5-B1\u003c/em\u003e, \u003cem\u003eTaABI5-B2\u003c/em\u003e, \u003cem\u003eTaABI5-B3\u003c/em\u003e, \u003cem\u003eTaABI5-B4\u003c/em\u003e and \u003cem\u003eTaABI5-B5\u003c/em\u003e on the short arm of chromosome 3B, \u003cem\u003eTaABI5-D1\u003c/em\u003e, \u003cem\u003eTaABI5-D2\u003c/em\u003e, \u003cem\u003eTaABI5-D3\u003c/em\u003e, \u003cem\u003eTaABI5-D4\u003c/em\u003e, \u003cem\u003eTaABI5-D5\u003c/em\u003e, \u003cem\u003eTaABI5-D6\u003c/em\u003e and \u003cem\u003eTaABI5-D7\u003c/em\u003e on the short arm of chromosome 3D, respectively. The results showed that \u003cem\u003eTaABI5\u003c/em\u003e was present in \u003cem\u003eTriticum aestivum\u003c/em\u003e as a multi-copy gene. Sequence analysis indicated that the 16 copies of \u003cem\u003eTaABI5\u003c/em\u003e had 84.43\u0026ndash;94.06% similarity with sequence AB238934.1 at the nucleotide level; the length of these copies ranged from 876 to 1556 bp. All sequences were deposited in GenBank under accession numbers MK287847 to MK287860 and MK334234 to MK334236 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/gene/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/gene/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eSelection of specific primers for identifying the allelic variation of\u003c/b\u003e \u003cb\u003eTaABI5\u003c/b\u003e \u003cb\u003eand sequences analysis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBased on the 16 copies of \u003cem\u003eTaABI5\u003c/em\u003e, gene specific primers were designed to amplify all copies of \u003cem\u003eTaABI5\u003c/em\u003e sequences. In total, three specific primer pairs, TaABI5D3F/R, TaABI5D6F/R, and TaABI5A4F/R, were identified to specifically amplify the sequences of \u003cem\u003eTaABI5-D3\u003c/em\u003e, \u003cem\u003eTaABI5-D6\u003c/em\u003e, and \u003cem\u003eTaABI5-A4\u003c/em\u003e, respectively. However, no specific primers could be designed for the other 13 copies of \u003cem\u003eTaABI5\u003c/em\u003e because of very high sequence similarities among them.\u003c/p\u003e \u003cp\u003eTen cultivars (Xiaobaiyuhua, Yumai 18, Yangxiaomai, Xiaoyuhua, Xiaoyan 6, Zhou 8425B, Jimai 19, Jing 411, Hengshui 7228, and Zhongyou 9507) with different levels of seed dormancy were selected to identify allelic variation of \u003cem\u003eTaABI5-D3\u003c/em\u003e, \u003cem\u003eTaABI5-D6\u003c/em\u003e, and \u003cem\u003eTaABI5-A4.\u003c/em\u003e In these ten cultivars, four variants were detected in \u003cem\u003eTaABI5-D3\u003c/em\u003e, designated \u003cem\u003eTaABI5-D3a\u003c/em\u003e, \u003cem\u003eTaABI5-D3b, TaABI5-D3c\u003c/em\u003e, and \u003cem\u003eTaABI5-D3d\u003c/em\u003e, respectively. Compared with the sequence of \u003cem\u003eTaABI5-D3a\u003c/em\u003e from Zhou 8425B, both \u003cem\u003eTaABI5-D3c\u003c/em\u003e and \u003cem\u003eTaABI5-D3d\u003c/em\u003e had two SNPs (A to G at position 449 bp changed His into Arg, and A to G at position 705 bp changed Asn into Asp), and \u003cem\u003eTaABI5-D3b\u003c/em\u003e had two SNPs (A to G at position 449 bp changed His into Arg, and T to C at position 1270 bp in the intron). In \u003cem\u003eTaABI5-D6\u003c/em\u003e, five allelic variants were detected, viz. \u003cem\u003eTaABI5-D6a\u003c/em\u003e, \u003cem\u003eTaABI5-D6b\u003c/em\u003e, \u003cem\u003eTaABI5-D6c\u003c/em\u003e, \u003cem\u003eTaABI5-D6d\u003c/em\u003e, and \u003cem\u003eTaABI5-D6e\u003c/em\u003e. Compared with the sequence of \u003cem\u003eTaABI5-D6a\u003c/em\u003e from Zhou 8425B, InDels and SNPs located in the first exon were identified in \u003cem\u003eTaABI5-D6b\u003c/em\u003e, \u003cem\u003eTaABI5-D6c\u003c/em\u003e, \u003cem\u003eTaABI5-D6d\u003c/em\u003e, and \u003cem\u003eTaABI5-D6e\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eThere were two allelic variants in \u003cem\u003eTaABI5-A4\u003c/em\u003e, i.e. \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e. Compared with the sequence of \u003cem\u003eTaABI5-A4a\u003c/em\u003e, \u003cem\u003eTaABI5-A4b\u003c/em\u003e had three SNPs (A to G at positions 269 bp and 473 bp, and C to T at position 686 bp) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). \u003cem\u003eTaABI5-A4a\u003c/em\u003e was detected in five PHS-resistant cultivars (Xiaobaiyuhua, Yumai 18, Yangxiaomai, Xiaoyuhua, and Xiaoyan 6), while \u003cem\u003eTaABI5-A4b\u003c/em\u003e was identified in five PHS-sensitive cultivars (Zhou 8425B, Jimai 19, Jing 411, Hengshui 7228, and Zhongyou 9507) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition, the sequence analysis showed that \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e could not encode full-length proteins, compared with full length of TaABI5 protein, as there is a stop codon at the position of 266th amino acid.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression of\u003c/b\u003e \u003cb\u003eTaABI5s\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eTaABI5-A4\u003c/b\u003e \u003cb\u003efrom Wanxianbaimaizi and Jing 411 at different seed developmental stages\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo evaluate the potential influence of \u003cem\u003eTaABI5\u003c/em\u003e and the specific copy of \u003cem\u003eTaABI5-A4\u003c/em\u003e in Jing 411 (GI\u0026thinsp;=\u0026thinsp;64.2) and Wanxianbaimaizi (GI\u0026thinsp;=\u0026thinsp;7.6), the expression patterns of Wanxianbaimaizi (\u003cem\u003eTaABI5-A4a\u003c/em\u003e) and Jing 411 (\u003cem\u003eTaABI5-A4b\u003c/em\u003e) were determined using semi-quantitative RT-PCR analysis. The transcript expression levels of \u003cem\u003eTaABI5\u003c/em\u003e showed an increasing trend in seeds from 10 to 30 days post-anthesis (DPA) with the highest level at 30 DPA and the lowest at 10 DPA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). In addition, the transcript expression levels of \u003cem\u003eTaABI5-A4\u003c/em\u003e and \u003cem\u003eTaABI5\u003c/em\u003e had the same trend in Wanxianbaimaizi (\u003cem\u003eTaABI5-A4a\u003c/em\u003e) and Jing 411 (\u003cem\u003eTaABI5-A4b\u003c/em\u003e) at 10, 20 and 30 DPA (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb), although Wanxianbaimaizi (\u003cem\u003eTaABI5-A4a\u003c/em\u003e) had higher transcript levels at all stages than Jing 411 (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThree PHS-resistant (Xiaoyan 6, Wanxianbaimai and Xiaobaiyuhua, \u003cem\u003eTaABI5-A4a\u003c/em\u003e) and three PHS-susceptible genotypes (Jing 411, Zhou 8425B and Hengshui 7228, \u003cem\u003eTaABI5-A4b\u003c/em\u003e) were chosen to analyze the transcript level by qPCR at mature seeds. Significantly higher transcript levels of \u003cem\u003eTaABI5\u003c/em\u003e and \u003cem\u003eTaABI5-A4\u003c/em\u003e were observed in the genotype \u003cem\u003eTaABI5-A4a\u003c/em\u003e than in \u003cem\u003eTaABI5-A4b\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eDevelopment and validation of gene-specific markers TaABI5A4a and TaABI5A4b for PHS resistance\u003c/h2\u003e \u003cp\u003eBased on the SNPs between the sequences of \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e, two complementary STS markers were developed, designated TaABI5A4a (primer set TaABI5A4aF/R) and TaABI5A4b (TaABI5A4bF/R), respectively, and used for association analysis with 103 wheat cultivars and advanced lines. It was first to amplify the cultivars with the primer set TaABI5A4F/R, and the PCR product was used as the template in the following PCR system. The primer set TaABI5A4aF/R produced a 494-bp fragment in the \u003cem\u003eTaABI5-A4a\u003c/em\u003e genotype and no PCR product in \u003cem\u003eTaABI5-A4b\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), while the primer set TaABI5A4bF/R generated a 703-bp fragment in the \u003cem\u003eTaABI5-A4b\u003c/em\u003e genotype (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb) and no PCR product in \u003cem\u003eTaABI5-A4a\u003c/em\u003e. Among the 103 cultivars and lines tested, 51 had \u003cem\u003eTaABI5-A4a\u003c/em\u003e presenting a 494-bp fragment and 52 contained \u003cem\u003eTaABI5-A4b\u003c/em\u003e with a 703-bp fragment (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e); \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e accounted for 49.5% and 50.5% with average GI values of 22.2 and 49.6, respectively. The GI values of the 103 lines were consistent across two years (\u003cem\u003er\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.966, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), with mean GI values and standard deviations of 36.1\u0026thinsp;\u0026plusmn;\u0026thinsp;20 in 2006 and 35.9\u0026thinsp;\u0026plusmn;\u0026thinsp;19 in 2007, respectively. The results indicated that the genotype \u003cem\u003eTaABI5-A4a\u003c/em\u003e were more resistant to PHS than \u003cem\u003eTaABI5-A4b\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAssociation analysis between \u003cem\u003eTaABI5-A4\u003c/em\u003e and GI values in 103 wheat cultivars and advanced lines with different PHS tolerance using the GIM model\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo. of lines\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAverage GI (%) values\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eF\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePhenotypic variance explained (%)\u003cem\u003eR\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e114.054*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e52.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e49.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e*Significant association between \u003cem\u003eTaABI5-A4\u003c/em\u003e and phenotypic values at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 level\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTo further confirm the association, 200 RILs from the cross of Yangxiaomai/Zhongyou 9507 were genotyped using TaABI5A4a and TaABI5A4b specific markers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Statistical analysis confirmed the significant association (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) of allelic variation of \u003cem\u003eTaABI5-A4a/TaABI5-A4b\u003c/em\u003e with GI values and PHS tolerance. In this population, \u003cem\u003eTaABI5-A4\u003c/em\u003e explained 42.3%, 60.8%, and 63.7% of the phenotypic variations in Shijiazhuang, Beijing and the averaged GI values of two environments, based on the test of two complimentary STS markers TaABI5A4a and TaABI5A4b (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAssociation analysis between \u003cem\u003eTaABI5-A4\u003c/em\u003e and GI values in 200 RILs using the GIM model\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTrait\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo. of\u003c/p\u003e \u003cp\u003elines\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAverage GI% values\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePhenotypic variance explained (%) \u003cem\u003eR\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBeijing GI value (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e130\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e310.001*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56.54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eShijiazhuang GI value (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e130\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e147.101*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e42.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e29.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAverage GI value (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e130\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e349.687*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e63.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e42.81\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e*Significant association between \u003cem\u003eTaABI5-A4\u003c/em\u003e and phenotypic values at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 level\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003ePhenotypic evaluation of transgenic rice lines\u003c/h2\u003e \u003cp\u003eFifteen transgenic rice plants (T1) for each of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e constructs were selected using hygromycin. The primers of hpt557F/R were used to identify transgenic events. The frequencies of positive \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice plants were 73% and 80%, respectively (Fig. S2).\u003c/p\u003e \u003cp\u003ePlant height, germination index, 100-grain weight, stem length and diameter of T2 lines were phenotyped and analyzed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The plant height of \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic lines (84.76 cm) was significantly higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) than that of the negative control with an empty vector (80.33 cm) and \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic lines (79.58 cm). The average GI values of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e, \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic lines and control plants were 57.7, 67.5, and 62.1, respectively, with significant differences (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The lengths of the first internodes of \u003cem\u003eTaABI5-A4a-GFP, TaABI5-A4b-GFP\u003c/em\u003e transgenic lines and control plants were 1.38 cm, 1.57 cm and 1.31 cm, and those of the second internodes were 3.09 cm, 3.65 cm and 3.32 cm, respectively. The data analysis showed that the lengths of the first and second internodes between \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic lines also were significantly different (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The length of the third internode of \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic line was 7.98 cm, with significant differences from the control (7.57 cm) and \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e (7.26 cm) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The diameters of the second and third internodes of \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic lines were 2.91 mm and 2.76 mm, 2.83 mm and 2.76 mm, respectively, all with significant differences (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, respectively). Analysis of variance indicated that the \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e genotype had significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) higher average GI values than the \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These showed that the \u003cem\u003eTaABI5-A4\u003c/em\u003e gene affected not only GI values in transgenic rice lines, but also plant height, internode length and diameters (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePhenotypic data of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlant height (cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e80.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e79.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e84.76\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGI% value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e62.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.74\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e67.54\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e100-grain weight (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLength of first internode (cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.38\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.51\u003csup\u003e****\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLength of second internode (cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3.09\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.65\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLength of third internode (cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.98\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiameter of first internode (mm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.09\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiameter of second internode (mm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.90\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiameter of third internode (mm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.76\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e*, **, *** and **** represent significant differences between transgenic plants and controls at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, respectively. Control stands for transgenic plants with an empty vector as a negative control\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eEndogenous ABA and GA contents were examined in mature seeds of the control, \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic lines by HPLC. The endogenous ABA in seeds of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e were 0.71 and 0.41 \u0026micro;g/g, respectively, and the endogenous GA contents were 9.82 and 12.14 \u0026micro;g/g, respectively, (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). These results indicated that the \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic rice line had significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) higher endogenous ABA and significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) lower endogenous GA contents in mature seeds than \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eABA sensitivity in transgenic rice lines\u003c/h2\u003e \u003cp\u003eIn order to determine the ABA responsiveness in the seeds of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e lines, GI values of the seeds were evaluated in water and in 50 \u0026micro;M ABA solution, respectively. The results showed a much lower GI value in seeds of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e than that in \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e lines, indicating that \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic rice lines had higher ABA sensitivity than \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo understand the expression level of \u003cem\u003eTaABI5-A4\u003c/em\u003e on abiotic stress response, we examined the relative gene expression in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic lines under different stress conditions. The plants at the three-leaf stage were treated with ABA (100 \u0026micro;M), salt (150 mM NaCl) and drought (300 mM mannitol to mimic dehydration) at 0, 6, 12, 24, 48 h post treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The expression levels of \u003cem\u003eTaABI5-A4\u003c/em\u003e in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic rice were higher than those in \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e after 6 or 12 h treatment with NaCl, whereas the expression levels of \u003cem\u003eTaABI5-A4\u003c/em\u003e in the \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e lines were lower than those in the \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e lines after 12\u0026ndash;48 h treatment with manntiol. After 24 h in the ABA treatment, the expression levels of \u003cem\u003eTaABI5-A4\u003c/em\u003e in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e lines were higher than those in \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e, which is consistent with ABA sensitivity tests, indicating that the \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic plants were more sensitive to exogenous ABA than the \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eEffect of decreased accumulation of spliced mRNA caused by nonsense-mediated decay (NMD) on phenotypic changes\u003c/h2\u003e \u003cp\u003eAlthough the sequences of \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e have premature nonsense codons at the position of 266th amino acid, \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines had significantly different GI values, ABA sensitivities, and contents of endogenous ABA and GA. \u003cem\u003eTaABI5-D3\u003c/em\u003e encodes a full-length protein and its DNA sequence has the most similarity (99.07%) with the sequences of \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e; therefore, \u003cem\u003eTaABI5-D3\u003c/em\u003e was chosen as the positive control to verify whether the premature nonsense codon affects the transcription level and even the translation level. The \u003cem\u003eGFP\u003c/em\u003e transcription level and TaABI5-A4-GFP fusion protein level in transgenic rice lines were analyzed with qPCR and Western blotting (WB). In the two-week-old leaves of transgenic rice plants, the transcription expression level of \u003cem\u003eGFP\u003c/em\u003e was very much higher in the positive control with the \u003cem\u003eTaABI5-D3-GFP\u003c/em\u003e than those in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e lines (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and the expression in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e lines were significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) higher than that in \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea). This result indicated that the much lower accumulation of fully spliced RNA in the \u003cem\u003eTaABI5-A4a/b-GFP\u003c/em\u003e transgenic lines was caused by nonsense-mediated decay (NMD). Moreover, WB analysis was performed using an Anti-GFP monoclonal antibody to detect the expression level of GFP fusion protein in transgenic rice seeds. The result showed that GFP fusion protein was only detected in the positive control, rather than in transgenic \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). These indicated that it was decreased accumulation of spliced mRNA, but fusion protein, that led to phenotypic changes between \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of mRNA accumulation of\u003c/b\u003e \u003cb\u003eTaABI5-A4\u003c/b\u003e \u003cb\u003ein transgenic rice on the expression of level\u003c/b\u003e \u003cb\u003eERF13\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eGSL-OH\u003c/b\u003e \u003cb\u003eassociated with seed dormancy\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn order to identify the downstream genes regulated by transcription factor \u003cem\u003eTaABI5\u003c/em\u003e, we performed RNA sequencing (RNA-seq) using mature seeds of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines. A total of 68 DEGs were identified in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic lines compared with \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e lines, including 26 up-regulated and 42 down-regulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ea). Compared with \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic lines, the up-regulated DEGs in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e lines belong to the pathways of regulation for response to stress, abiotic stimulus and metabolic process based on GO and KEGG analysis, whereas the down-regulated DEGs in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic lines are involved in the protein metabolic process (Figs.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eb, c and d). Among them, we found \u003cem\u003eERF113/At5g13330\u003c/em\u003e (LOC_Os08g30100), \u003cem\u003eGSTU16\u003c/em\u003e (LOC_Os10g38360) and \u003cem\u003eGSL-OH\u003c/em\u003e (LOC_Os03g08460) in the up-regulated DEGs, and \u003cem\u003eESD4\u003c/em\u003e (LOC_Os01g16730) in the down-regulated DEGs (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ee), which may be involved in seed dormancy and germination.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe further examined the transcript expression levels of \u003cem\u003eRAP2.6L\u003c/em\u003e, \u003cem\u003eGSTU16\u003c/em\u003e and \u003cem\u003eGSL-OH\u003c/em\u003e with qPCR in mature seeds. The results confirmed significantly higher expression levels of these three genes in \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic rice lines than those in \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ef). However, \u003cem\u003eESD4\u003c/em\u003e could not be detected by qPCR due to the extremely low expression, which was a significantly down-regulated gene in RNA-seq.\u0026nbsp;These results further verified the up/down-regulated DEGs in the RNA-seq from the mature seeds of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMany genes are known to be involved in ABA biosynthesis (Gubler et al. 2005). Among them, \u003cem\u003eLEC2\u003c/em\u003e, \u003cem\u003eABI3\u003c/em\u003e, \u003cem\u003eABI5\u003c/em\u003e, \u003cem\u003eVp-1\u003c/em\u003e, \u003cem\u003eAFP\u003c/em\u003e, and \u003cem\u003eFUS3\u003c/em\u003e are related to seed dormancy and PHS resistance, and have dual effects of inhibiting seed germination and promoting embryo maturation (Li et al. 2004). \u003cem\u003eABI3\u003c/em\u003e is crucial in establishing dormancy and tolerance to desiccation during seed development (Lopez-Molina et al. 2002) and is required for appropriate \u003cem\u003eABI5\u003c/em\u003e expression (Finkelstein and Lynch 2000), because \u003cem\u003eABI5\u003c/em\u003e acts in the downstream of \u003cem\u003eABI3\u003c/em\u003e (Lopez-Molina et al. 2003). In wheat, the \u003cem\u003eTaVp-1\u003c/em\u003e homolog \u003cem\u003eABI3\u003c/em\u003e is associated with seed dormancy and STS markers Vp1B3 and Vp1A3 have been developed and validated (Yang et al. 2007, 2014). In this study, allelic variants of \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e were detected and validated, and gene-specific markers of \u003cem\u003eTaABI5\u003c/em\u003e (TaABI5A4a and TaABI5A4b) were significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) associated with seed dormancy in wheat lines. The 103 wheat cultivars used in this study also was used to validate the STS marker Vp1A3 associated with seed dormancy (Yang et al. 2014), whereas much higher phenotypic variation was explained by TaABI5A4a and TaABI5A4b in this study (\u003cem\u003eR\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;52.6%). Moreover, the RIL population of Yangxiaomai\u0026times;Zhongyou 9507 was also used to validate the STS marker Tamyb10D (\u003cem\u003eR\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;22.6%) (Wang et al., 2014), while the \u003cem\u003eTaABI5-A4\u003c/em\u003e gene explained much higher (\u003cem\u003eR\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;63.7%) phenotypic variation in this population than Tamyb10D. These results indicate that \u003cem\u003eTaABI5-A4\u003c/em\u003e is very likely to be a major-effect gene for seed dormancy in ABA signal pathway in wheat. It is very worthwhile to understand the molecular mechanism of \u003cem\u003eTaABI5-A4\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn \u003cem\u003eTaAIB5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaAIB5-A4b-GFP\u003c/em\u003e transgenic rice lines, the transcript expression levels of \u003cem\u003eTaABI5-A4\u003c/em\u003e showed different sensitivities to ABA due to different CDS sequences of \u003cem\u003eTaAIB5-A4a\u003c/em\u003e and \u003cem\u003eTaAIB5-A4b\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Compared with the mature seeds of \u003cem\u003eTaAIB5-A4b-GFP\u003c/em\u003e, \u003cem\u003eTaAIB5-A4a-GFP\u003c/em\u003e showed higher transcript expression level of \u003cem\u003eTaABI5A4\u003c/em\u003e and \u003cem\u003eGFP\u003c/em\u003e, more ABA sensitivity, higher endogenous ABA content and lower GI value. But no GFP fusion protein was detected by WB in the mature seeds of \u003cem\u003eTaAIB5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaAIB5-A4b-GFP\u003c/em\u003e transgenic lines. These results further indicate that although there is no full-length \u003cem\u003eTaABI5-A4\u003c/em\u003e protein due to the premature termination codon at the position of 266th amino acid, \u003cem\u003eTaABI5-A4\u003c/em\u003e mRNA or some truncated proteins could affect the phenotypes of transgenic lines. Nonsense-mediated decay (NMD) is a mechanism in which abnormal mRNAs containing premature translation termination codons are efficiently eliminated so that production of undesirable truncated proteins is avoided (Culbertson 1999; Hentze and Kulozik 1999), and NMD occurs in rice waxy RNA containing a premature nonsense codon (Isshiki et al. 2001). In this study, transcription of \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e was obviously observed in transgenic rice lines, but no GFP fusion proteins were detected by WB (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). The NMD for \u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e is also present, thus it must be the transcriptional regulation of \u003cem\u003eTaABI5-A4\u003c/em\u003e that plays a critical function, leading to phenotypic differences between transgenic\u003cem\u003eTaABI5-A4a\u003c/em\u003e and \u003cem\u003eTaABI5-A4b\u003c/em\u003e rice lines.\u003c/p\u003e \u003cp\u003eThe significantly different phenotypes between \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines were not only in ABA sensitivity, endogenous ABA content, and GI value, but also in endogenous GA content, plant height, internode length and diameter (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The balance of ABA and GA levels and sensitivity is a major regulator of dormancy status. The changes of ABA sensitivity and endogenous ABA and GA contents were observed in seeds of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines. Both embryo sensitivity to ABA and GA metabolism plays an important role in the expression of dormancy of the developing sorghum grain (Benech-Arnold and Rodr\u0026iacute;guez 2018). Meanwhile, with a greater embryo sensitivity to ABA and higher expression of \u003cem\u003eSbABA-INSENSITIVE 4\u003c/em\u003e (\u003cem\u003eSbABI4\u003c/em\u003e) and \u003cem\u003eSbABA-INSENSITIVE 5\u003c/em\u003e (\u003cem\u003eSbABI5\u003c/em\u003e), dormant grains accumulate less active GA4 due to more active GA catabolism (Renata et al. 2013). Moreover, plant height is especially affected by hormones like GA (Eshed and Lippman 2019), and GA is the most important hormone for plant height regulation (Kong et al. 2023). The transgenic lines with higher endogenous ABA content have lower endogenous GA content, leading to shorter plant height, shorter internode length and thicker internode diameter (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and b). Based on the function of GA described above (Renata et al. 2013; Eshed and Lippman 2019; Kong et al. 2023), significantly different phenotypes between \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic rice lines have a reasonable explanation.\u003c/p\u003e \u003cp\u003eAs a transcription factor, \u003cem\u003eTaABI5\u003c/em\u003e probably participates in the regulation of the expression of multiple genes. For instance, the NF-YC9 directly binds to ABI5, which facilitates the function of ABI5 to bind and activate the promoter of a target gene EM6, further positively regulates the response to ABA (Bi et al. 2017). Furthermore, the RNA-seq results revealed that the genes \u003cem\u003eERF113/At5g13330\u003c/em\u003e (LOC_Os08g30100), \u003cem\u003eGSTU16\u003c/em\u003e (LOC_Os10g38360), \u003cem\u003eGSL-OH\u003c/em\u003e (LOC_Os03g08460) and \u003cem\u003eESD4\u003c/em\u003e (LOC_Os01g16730), which respond to ABA stimulus and may be involved in seed dormancy and germination (Liu et al. 2012; Krishnaswamy et al. 2011; Griffiths et al. 1998; Hansen et al. 2008; Chang et al. 2022; Cui et al. 2022), were differentially expressed between \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e and \u003cem\u003eTaABI5-A4b-GFP\u003c/em\u003e transgenic rice lines. A working model for \u003cem\u003eTaABI5-A4\u003c/em\u003e was predicated according to the data of RNA-seq for mature seeds of TaABI5-A4a/b-GFP transgenic lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). Overexpression of \u003cem\u003eTaABI5-A4\u003c/em\u003e increased the endogenous ABA content in mature seeds of \u003cem\u003eTaABI5-A4a-GFP\u003c/em\u003e transgenic rice. ABA is perceived and bound by ABA receptors PYR/PYL/PCAR; these receptors can form a complex with PP2C, thereby leading to the relief of inhibition of PP2C to the SnRK2s, and then activating SnRK2s (Chen et al. 2020; Cutler et al. 2010; Lin et al. 2021; Soma et al. 2020). Activated SnRK2s in turn activate downstream transcription factors such as ABI5 and its homologs ABRE-binding factors (ABFs), which activate ABA-responsive genes (Fujii et al. 2007; Nakashima et al. 2009), resulting in the change of seed dormancy (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). In addition, the ethylene response factor \u003cem\u003eERF96\u003c/em\u003e increases the content of GSH (Jiang et al. 2020), thus enhances the antioxidative defense function (Van 2013). Therefore, increasing transcript expression level of ERF113 due to the overexpression of \u003cem\u003eTaABI5-A4\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e) can lead to the changes of GSH homeostasis in the regulation of ABA signaling regulated by GST (Zhang et al. 2019), and peroxidation of GSH can be catalyzed by GSTs (Wagner et al. 2002), which promotes removal of ROS and leads to seed dormancy (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). Transcript expression level of \u003cem\u003eGSL-OH\u003c/em\u003e also increased as shown in the RNA-seq data, which could catalyze the 2-hydroxybut-3-enyl glucosinolate, and have biological activities including toxicity to \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e, and enhance the seed dormancy (Griffiths et al. 1998; Hansen et al. 2008) (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). The \u003cem\u003eESD4\u003c/em\u003e was significantly decreased based on RNA-seq data; it has negative roles in response to ABA in seed dormancy (Chang et al. 2022), and \u003cem\u003eesd4-3\u003c/em\u003e mutant is ABA-hypersensitive (Cui et al. 2022), and the decreased transcript expression level of \u003cem\u003eESD4\u003c/em\u003e may also result in much high seed dormancy (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contribution statement\u0026nbsp;\u003c/strong\u003eY Han and Z Wang performed the experiments. YJ Zhang and JD Liu constructed the RIL population. Y Yang designed the experiment and assisted in writing the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the\u0026nbsp;Key Projects of Inner Mongolia Natural Science Foundation (2023ZD08), Universities directly under the Inner Mongolia Autonomous Region\u0026nbsp;Basal Research Fund (BR231519), and the National Natural Science Foundation of China (31960424).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003eThe authors declare no conflicts of interest in regard to this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical standards\u0026nbsp;\u003c/strong\u003eWe declare that these experiments comply with the ethical standards in China where they were performed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArqyris J, Dahal P, Hayashi E, Still DW, Bradford KJ (2008) Genetic variation for lettuce seed thermoinhibition is associated with temperature-sensitive expression of abscisic acid, gibberellin and ethylene biosynthesis, metabolism and response genes. Plant Physiol 148(2):926\u0026ndash;947. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.108.125807\u003c/span\u003e\u003cspan address=\"10.1104/pp.108.125807\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenech-Arnold RL, Rodr\u0026iacute;guez MV (2018) Pre-harvest sprouting and grain dormancy in \u003cem\u003eSorghum bicolor\u003c/em\u003e: What Have We Learned? Front Plant Sci 9:811. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2018.00811\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2018.00811\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBi C, Ma Y, Wang XF, Zhang DP (2017) Overexpression of the transcription factor NF-YC9 confers abscisic acid hypersensitivity in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Mol Biol 95(4\u0026ndash;5):425\u0026ndash;439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11103-017-0661-1\u003c/span\u003e\u003cspan address=\"10.1007/s11103-017-0661-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrocard-Gifford I, Lynch TJ, Garcia ME, Malhotra B, Finkelstein RR (2004) The \u003cem\u003eArabidopsis thaliana Abscisic Acid-insensitive8\u003c/em\u003e locus encodes a novel protein mediating abscisic acid and sugar responses essential for growth. Plant Cell 16:406\u0026ndash;421. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.018077\u003c/span\u003e\u003cspan address=\"10.1105/tpc.018077\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasaretto J, Ho TH (2003) The transcription factors HvABI5 and HvVP1 are required for the abscisic acid induction of gene expression in barley aleurone cells. Plant Cell 15:271\u0026ndash;284. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.007096\u003c/span\u003e\u003cspan address=\"10.1105/tpc.007096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang YN, Wang Z, Ren Z, Wang CH, Wang P, Zhu JK, Li X, Duan CG (2022) NUCLEAR PORE ANCHOR and EARLY IN SHORT DAYS 4 negatively regulate abscisic acid signaling by inhibiting Snf1-related protein kinase2 activity and stability in \u003cem\u003eArabidopsis\u003c/em\u003e. J Integr Plant Biol 64(11):2060\u0026ndash;2074. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jipb.13349\u003c/span\u003e\u003cspan address=\"10.1111/jipb.13349\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen K, Li GJ, Bressan RA, Song CP, Zhu JK, Zhao Y (2020) Abscisic acid dynamics, signaling, and functions in plants. J Integr Plant Biol 62:25\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jipb.12899\u003c/span\u003e\u003cspan address=\"10.1111/jipb.12899\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui X, Lv M, Cao Y, Li Z, Liu Y, Ren Z, Zhang H (2022) NUA and ESD4 negatively regulate ABA signaling during seed germination. Stress Biol 2(1):38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s44154-022-00062-1\u003c/span\u003e\u003cspan address=\"10.1007/s44154-022-00062-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCulbertson MR (1999) RNA surveillance. Unforeseen consequences for gene expression, inherited genetic disorders and cancer. Trends Genet 15(2):74\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0168-9525(98)01658-8\u003c/span\u003e\u003cspan address=\"10.1016/s0168-9525(98)01658-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61:651\u0026ndash;679. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-arplant-042809-112122\u003c/span\u003e\u003cspan address=\"10.1146/annurev-arplant-042809-112122\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai MQ, Xue Q, Mccray T, Margavage K, Chen F, Lee JH, Nezames CD, Guo LQ, Terzaghi W, Wan JM, Deng XW, Wang HY (2013) The PP6 phosphatase regulates ABI5 phosphorylation and abscisic acid signaling in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell 25:517\u0026ndash;534. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.112.105767\u003c/span\u003e\u003cspan address=\"10.1105/tpc.112.105767\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEshed Y, Lippman ZB (2019) Revolutions in agriculture chart a course for targeted breeding of old and new crops. Science 366(6466):eaax0025. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.aax0025\u003c/span\u003e\u003cspan address=\"10.1126/science.aax0025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng YM, Han Y, Han B, Zhao YY, Yang Y, Xing YP (2022) A 4 bp InDel in the promoter of wheat gene \u003cem\u003eTaAFP-B\u003c/em\u003e affecting seed dormancy confirmed in transgenic rice. Front Plant Sci 13:837805. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2022.837805\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2022.837805\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng YM, Liu M, Wang Z, Zhao XL, Han B, Xing YP, Wang MY, Yang Y (2019) A 4-bp deletion in the 5\u0026rsquo;UTR of \u003cem\u003eTaAFP-B\u003c/em\u003e is associated with seed dormancy in common wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L). BMC Plant Biol 19:349. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12870-019-1950-4\u003c/span\u003e\u003cspan address=\"10.1186/s12870-019-1950-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFinkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell 14(Suppl):s15\u0026ndash;s45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.010441\u003c/span\u003e\u003cspan address=\"10.1105/tpc.010441\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFinkelstein RR, Lynch TJ (2000) The \u003cem\u003eArabidopsis\u003c/em\u003e abscisic acid response gene \u003cem\u003eABI5\u003c/em\u003e encodes a basic leucine zipper transcription factor. Plant Cell 12:599\u0026ndash;609. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.12.4.599\u003c/span\u003e\u003cspan address=\"10.1105/tpc.12.4.599\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujii H, Verslues PE, Zhu JK (2007) Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell 19:485\u0026ndash;494. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.106.048538\u003c/span\u003e\u003cspan address=\"10.1105/tpc.106.048538\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonzalez-Guzman M, Pizzio GA, Antoni R, Vera-Sirera F, Merilo E, Bassel GW, Fern\u0026aacute;ndez MA, Holdsworth MJ, Perez-Amador MA, Kollist H, Rodriguez PL (2012) \u003cem\u003eArabidopsis\u003c/em\u003e PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid. Plant Cell 24(6):2483\u0026ndash;2496. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.112.098574\u003c/span\u003e\u003cspan address=\"10.1105/tpc.112.098574\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGriffiths DW, Birch ANE, Hillman JR (1998) Antinutritional compounds in the \u003cem\u003eBrassicaceae\u003c/em\u003e-analysis, biosynthesis, chemistry and dietary effects. J Hortic Sci Biotechnol 73:1\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/14620316.1998.11510937\u003c/span\u003e\u003cspan address=\"10.1080/14620316.1998.11510937\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGubler F, Millar AA, Jacobsen JV (2005) Dormancy release, ABA and pre-harvest sprouting. Curr Opin Plant Biol 8(2):183\u0026ndash;187. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pbi.2005.01.011\u003c/span\u003e\u003cspan address=\"10.1016/j.pbi.2005.01.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHansen BG, Kerwin RE, Ober JA, Lambrix VM, Mitchell-Olds T, Gershenzon J, Halkier BA, Kliebenstein DJ (2008) A novel 2-oxoacid-dependent dioxygenase involved in the formation of the goiterogenic 2-hydroxybut-3-enyl glucosinolate and generalist insect resistance in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Physiol 148(4):2096\u0026ndash;2108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.108.129981\u003c/span\u003e\u003cspan address=\"10.1104/pp.108.129981\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHentze MW, Kulozik AE (1999) A perfect message: RNA surveillance and nonsense-mediated decay. Cell 96(3):307\u0026ndash;310. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0092-8674(00)80542-5\u003c/span\u003e\u003cspan address=\"10.1016/s0092-8674(00)80542-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Y, Han X, Yang ML, Zhang MH, Pan JJ, Yu DQ (2019) The transcription factor INDUCER OF CBF EXPRESSION1 interacts with ABSCISIC ACID INSENSITIVE5 and DELLA proteins to Fine-tune abscisic acid signaling during seed germination in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell 31(7):1520\u0026ndash;1538. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.18.00825\u003c/span\u003e\u003cspan address=\"10.1105/tpc.18.00825\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsshiki M, Yamamoto Y, Satoh H, Shimamoto K (2001) Nonsense-mediated decay of mutant \u003cem\u003ewaxy\u003c/em\u003e mRNA in rice. Plant Physiol 125(3):1388\u0026ndash;1395. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.125.3.1388\u003c/span\u003e\u003cspan address=\"10.1104/pp.125.3.1388\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj T, Parcy F (2002) bZIP transcription factors in \u003cem\u003eArabidopsis\u003c/em\u003e. Trends Plant Sci 7:106\u0026ndash;111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s1360-1385(01)02223-3\u003c/span\u003e\u003cspan address=\"10.1016/s1360-1385(01)02223-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang L, Yang J, Liu CX, Chen ZP, Yao ZC, Cao SQ (2020) Overexpression of ethylene response factor \u003cem\u003eERF96\u003c/em\u003e gene enhances selenium tolerance in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Physiol Biochem 149:294\u0026ndash;300. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plaphy.2020.02.024\u003c/span\u003e\u003cspan address=\"10.1016/j.plaphy.2020.02.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson RR, Shin M, Shen JQ (2008) The wheat PKABA1-interacting factor TaABF1 mediates both abscisic acid-suppressed and abscisic acid-induced gene expression in bombarded aleurone cells. Plant Mol Biol 68:93\u0026ndash;103. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11103-008-9354-0\u003c/span\u003e\u003cspan address=\"10.1007/s11103-008-9354-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJu L, Jing YX, Shi PT, Liu J, Chen JS, Yan JJ, Chu JF, Chen KM, Sun JQ (2019) JAZ proteins modulate seed germination through interaction with ABI5 in bread wheat and \u003cem\u003eArabidopsis\u003c/em\u003e. New Phytol 223(1):246\u0026ndash;260. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.15757\u003c/span\u003e\u003cspan address=\"10.1111/nph.15757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong XC, Wang F, Wang ZY, Gao XH, Geng SF, Deng ZY, Zhang S, Fu MX, Cui DD, Liu SS, Che YQ, Liao RY, Yin LJ, Zhou P, Wang K, Ye XG, Liu DC, Fu XD, Mao L, Li AL (2023) Grain yield improvement by genome editing of \u003cem\u003eTaARF12\u003c/em\u003e that decoupled peduncle and rachis development trajectories via differential regulation of gibberellin signalling in wheat. Plant Biotechnol J 21(10):1990\u0026ndash;2001. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/pbi.14107\u003c/span\u003e\u003cspan address=\"10.1111/pbi.14107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrishnaswamy S, Verma S, Rahmab MH, Kav NNV (2011) Functional characterization of four APETALA2-family genes (\u003cem\u003eRAP2.6\u003c/em\u003e, \u003cem\u003eRAP2.6L\u003c/em\u003e, \u003cem\u003eDREB19\u003c/em\u003e and \u003cem\u003eDREB26\u003c/em\u003e) in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Mol Biol 75(1/2):107\u0026ndash;127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11103-010-9711-7\u003c/span\u003e\u003cspan address=\"10.1007/s11103-010-9711-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi CD, Ni PX, Francki M, Hunter A, Zhang Y, Schibeci D, Li H, Tarr A, Wang J, Cakir M, Yu J, Bellgard M, Lance R, Appels R (2004) Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison. Funct Integr Genom 4:84\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10142-004-0104-3\u003c/span\u003e\u003cspan address=\"10.1007/s10142-004-0104-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Y, Xia JQ, Jiang YS, Bao YZ, Chen HC, Wang DJ, Zhang D, Yu J, Cang J (2022) Genome-wide identification and analysis of \u003cem\u003ebZIP\u003c/em\u003e gene family and resistance of \u003cem\u003eTaABI5\u003c/em\u003e (\u003cem\u003eTabZIP96\u003c/em\u003e) under freezing stress in wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e). Int J Mol Sci 4:2351. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms23042351\u003c/span\u003e\u003cspan address=\"10.3390/ijms23042351\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim S, Park J, Lee N, Jeong J, Toh S, Watanabe A, Kim J, Kang H, Kim DH, Kawakami N, Choi G (2013) ABA-insensitive3, ABA-insensitive5, and DELLAs interact to activate the expression of \u003cem\u003eSOMNUS\u003c/em\u003e and other high-temperature-inducible genes in imbibed seeds in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell 25(12):4863\u0026ndash;4878. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.113.118604\u003c/span\u003e\u003cspan address=\"10.1105/tpc.113.118604\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim SD, Lee C, Jang CS (2014) The rice RING E3 ligase, OsCTR1, inhibits trafficking to the chloroplasts of OsCP12 and OsRP1, and its overexpression confers drought tolerance in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell Environ 37(5):1097\u0026ndash;1113. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/pce.12219\u003c/span\u003e\u003cspan address=\"10.1111/pce.12219\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Z, Li Y, Wang YB, Liu XL, Ma L, Zhang ZJ, Mu C, Zhang Y, Peng L, Xie SJ, Song CP, Shi HZ, Zhu JK, Wang PC (2021) Initiation and amplification of SnRK2 activation in abscisic acid signaling. Nat Commun 12(1):2456. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-021-22812-x\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-22812-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu PQ, Sun F, Gao R, Dong HS (2012) \u003cem\u003eRAP2.6L\u003c/em\u003e overexpression delays waterlogging induced premature senescence by increasing stomatal closure more than antioxidant enzyme activity. Plant Mol Biol 79(6):609\u0026ndash;622. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11103-012-9936-8\u003c/span\u003e\u003cspan address=\"10.1007/s11103-012-9936-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu SP, Li L, Wang WL, Xia GM, Liu SW (2023) TaSRO1 interacts with TaVP1 to modulate seed dormancy and pre-harvest sprouting resistance in wheat. J Integr Plant Biol 66(1):36\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jipb.13600\u003c/span\u003e\u003cspan address=\"10.1111/jipb.13600\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2\u003csup\u003e\u0026ndash;∆∆CT\u003c/sup\u003e method. Methods 25:402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez-Molina L, Chua NH (2000) A null mutation in a bZIP factor confers ABA-insensitivity in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Plant Cell Physiol 41:541\u0026ndash;547. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/pcp/41.5.541\u003c/span\u003e\u003cspan address=\"10.1093/pcp/41.5.541\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez-Molina L, Mongrand S, Mclachlin DT, Chait BT, Chua NH (2002) ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during germination. Plant J 32:317\u0026ndash;328. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-313x.2002.01430.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-313x.2002.01430.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez-Molina L, Mongrand S, Chua NH (2001) A post-germination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in \u003cem\u003eArabidopsis\u003c/em\u003e. Proc Natl Acad Sci USA 98:4782\u0026ndash;4787. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.081594298\u003c/span\u003e\u003cspan address=\"10.1073/pnas.081594298\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez-Molina L, Mongrand S, Kinoshita N, Chua NH (2003) AFP is a novel negative regulator of ABA signaling that promotes ABI5 protein degradation. Genes Dev 17:410\u0026ndash;418. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/gad.1055803\u003c/span\u003e\u003cspan address=\"10.1101/gad.1055803\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLynch T, N\u0026eacute;e G, Chu A, Kr\u0026uuml;ger T, Finkemeier I, Finkelstein RR (2022) ABI5 binding protein2 inhibits ABA responses during germination without ABA-INSENSITIVE5 degradation. Plant Physiol 189(2):666\u0026ndash;678. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/plphys/kiac096\u003c/span\u003e\u003cspan address=\"10.1093/plphys/kiac096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura S, Toyama T (2001) Isolation of a \u003cem\u003eVP1\u003c/em\u003e homologue from wheat and analysis of its expression in embryos of dormant and non-dormant cultivars. J Exp Bot 52:875\u0026ndash;876. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jexbot/52.357.875\u003c/span\u003e\u003cspan address=\"10.1093/jexbot/52.357.875\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakashima K, Fujita Y, Kanamori N, Katagiri T, Umezawa T, Kidokoro S, Maruyama K, Yoshida T, Ishiyama K, Kobayashi M, Shinozaki K, Yamaguchi-Shinozaki K (2009) Three \u003cem\u003eArabidopsis\u003c/em\u003e SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. Plant Cell Physiol 50:1345\u0026ndash;1363. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/pcp/pcp083\u003c/span\u003e\u003cspan address=\"10.1093/pcp/pcp083\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhnishi N, Himi E, Yamasaki Y, Noda K (2008) Differential expression of three ABA-insensitive five binding protein (AFP)-like genes in wheat. Genes Genet Syst 83:167\u0026ndash;177. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1266/ggs.83.167\u003c/span\u003e\u003cspan address=\"10.1266/ggs.83.167\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan JJ, Wang HP, Hu YR, Yu DQ (2018) \u003cem\u003eArabidopsis\u003c/em\u003e VQ18 and VQ26 proteins interact with ABI5 transcription factor to negatively modulate ABA response during seed germination. Plant J 95(3):529\u0026ndash;544. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/tpj.13969\u003c/span\u003e\u003cspan address=\"10.1111/tpj.13969\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenata C, Daniel CC, Luis BAR, Ver\u0026oacute;nica RM (2013) In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy. J Exp Bot 18:5721\u0026ndash;5735. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/ert347\u003c/span\u003e\u003cspan address=\"10.1093/jxb/ert347\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkubacz A, Daszkowska-Golec A, Szarejko I (2016) The role and regulation of ABI5 (ABA-Insensitive 5) in plant development, abiotic stress responses and phytohormone crosstalk. Front Plant Sci 7:1884. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2016.01884\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2016.01884\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoma F, Takahashi F, Suzuki T, Shinozaki K, Yamaguchi-Shinozaki K (2020) Plant Raf-like kinases regulate the mRNA population upstream of ABA-unresponsive SnRK2 kinases under drought stress. Nat Commun 11(1):1373. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-020-15239-3\u003c/span\u003e\u003cspan address=\"10.1038/s41467-020-15239-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong RF, Hu XY, Liu WC, Yuan HM (2024) ABA functions in low phosphate-induced anthocyanin accumulation through the transcription factor ABI5 in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant Cell Rep 43(2):55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00299-024-03146-6\u003c/span\u003e\u003cspan address=\"10.1007/s00299-024-03146-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStone SL, Williams LA, Farmer L (2006) Keep on going a RING E3 ligase essential for \u003cem\u003eArabidopsis\u003c/em\u003e growth and development, is involved in abscisic acid signaling. Plant Cell 18:3415\u0026ndash;3428. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.106.046532\u003c/span\u003e\u003cspan address=\"10.1105/tpc.106.046532\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun YW, Jones HD, Yang Y, Dreisigacker S, Li SM, Chen XM, Shewry PR, Xia LQ (2012) Haplotype analysis of \u003cem\u003eViviparous-1\u003c/em\u003e gene in CIMMYT elite bread wheat germplasm. Euphytica 186:25\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10681-011-0482-2\u003c/span\u003e\u003cspan address=\"10.1007/s10681-011-0482-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUtsugi S, Ashikawa I, Nakamura S, Shibasaka M (2022) TaABI5, a wheat homolog of \u003cem\u003eArabidopsis thaliana\u003c/em\u003e ABA insensitive 5, controls seed germination. J Plant Res 133(2):245\u0026ndash;256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10265-020-01166-3\u003c/span\u003e\u003cspan address=\"10.1007/s10265-020-01166-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Hoewyk D (2013) A tale of two toxicities: malformed selenoproteins and oxidative stress both contribute to selenium stress in plants. Ann Bot 112(6):965\u0026ndash;972. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aob/mct163\u003c/span\u003e\u003cspan address=\"10.1093/aob/mct163\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWagner U, Edwards R, Dixon DP, Mauch F (2002) Probing the diversity of the \u003cem\u003eArabidopsis\u003c/em\u003e glutathione \u003cem\u003eS\u003c/em\u003e-Transferase gene family. Plant Mol Biol 49:515\u0026ndash;532. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/a:1015557300450\u003c/span\u003e\u003cspan address=\"10.1023/a:1015557300450\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang SL, Chen YB, Qu FL, He SM, Huang XJ, Jiang HQ, Jin TB, Wan SG, Xing JL (2014) Association between leukocyte telomere length and glioma risk: a case-control study. Neuro Oncol 16(4):505\u0026ndash;512. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/neuonc/not240\u003c/span\u003e\u003cspan address=\"10.1093/neuonc/not240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z (2019) Isolation of \u003cem\u003eTaABI5\u003c/em\u003e and development of a STS marker for pre-harvest sprouting resistance in Chinese bread wheat. Inner Mongolia Agricultural University\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei JK, Li XJ, Song P, Wang YG, Ma JZ (2022) Studies on the interactions of AFPs and bZIP transcription factor ABI5. Biochem Biophys Res Commun 590:75\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2021.12.046\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2021.12.046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang Y, Zhao CY, Li Q, Niu YX, Pan YT, Li GD, Cheng Y, Zhang AY (2024) Pectin methylesterase 31 is transcriptionally repressed by ABI5 to negatively regulate ABA-mediated inhibition of seed germination. Front Plant Sci 15:1336689. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2024.1336689\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2024.1336689\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao CS, Liu Yu J, Chen WS, Yang J, Cheng MP, Watt C, Cheng JY, Wang ZZ, Tan Z, Li ML, Wang JR (2021) Characterization and expression QTL analysis of \u003cem\u003eTaABI4\u003c/em\u003e, a pre-harvest sprouting related gene in wheat. Cold Spring Harb Lab 31:188\u0026ndash;198. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/2020.09.18.303065\u003c/span\u003e\u003cspan address=\"10.1101/2020.09.18.303065\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Ma YZ, Xu ZS, Chen XM, He ZH, Yu Z, Wilkinson M, Jones DH, Shewry RP, Xia LQ (2007) Isolation and characterization of \u003cem\u003eViviparous-1\u003c/em\u003e genes in wheat varieties with distinct pre-harvest sprouting tolerance and ABA sensitivity. J Exp Bot 58:2863\u0026ndash;2871. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erm073\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erm073\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Zhang CL, Liu SX, Sun YQ, Meng JY, Xia LQ (2014) Characterization of the rich haplotypes of \u003cem\u003eViviparous-1A\u003c/em\u003e in Chinese wheats and development of a novel sequence-tagged site marker for pre-harvest sprouting resistance. Mol Breed 33:75\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11032-013-9935-8\u003c/span\u003e\u003cspan address=\"10.1007/s11032-013-9935-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang LP, Wu M, Teng YJ, Jia SH, Yu DS, Wei T, Chen CB, Song WQ (2019) Overexpression of the glutathione peroxidase 5 (\u003cem\u003eRcGPX5\u003c/em\u003e) gene from \u003cem\u003eRhodiola crenulata\u003c/em\u003e increases drought tolerance in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e. Front Plant Sci 9:1950. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2018.01950\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2018.01950\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes Dev 19:1532\u0026ndash;1543. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/gad.1318705\u003c/span\u003e\u003cspan address=\"10.1101/gad.1318705\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao HY, Nie KL, Zhou HP, Yan XJ, Zhan QD, Zheng Y, Song CP (2020) ABI5 modulates seed germination via feedback regulation of the expression of the PYR/PYL/RCAR ABA receptor genes. New Phytol 228(2):596\u0026ndash;608. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.16713\u003c/span\u003e\u003cspan address=\"10.1111/nph.16713\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao X, Dou LR, Gong ZZ, Wang XF, Mao TL (2019) BES1 hinders ABSCISIC ACID INSENSITIVE5 and promotes seed germination in \u003cem\u003eArabidopsis\u003c/em\u003e. New Phytol 221(2):908\u0026ndash;918. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.15437\u003c/span\u003e\u003cspan address=\"10.1111/nph.15437\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou K, Yang J, Wang ZX, Wang JR (2017) Sequence analysis and expression profiles of \u003cem\u003eTaABI5\u003c/em\u003e, a pre-harvest sprouting resistance gene in wheat. Genes Genom 39:161\u0026ndash;171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13258-016-0483-6\u003c/span\u003e\u003cspan address=\"10.1007/s13258-016-0483-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou XN, Hao HM, Zhang YG, Bai YL, Zhu WB, Qin YX, Yuan FF, Zhao FY, Wang MY, Hu JJ, Xu H, Guo AG, Zhao HX, Zhao Y, Cao CL, Yang YQ, Schumaker KS, Guo Y, Xie CG (2015) SOS2-LIKE PROTEIN KINASE5, an SNF1-RELATED PROTEIN KINASE3-Type protein kinase, is important for abscisic acid responses in \u003cem\u003eArabidopsis\u003c/em\u003e through phosphorylation of ABSCISIC ACID-INSENSITIVE5. Plant Physiol 168(2):659\u0026ndash;676. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.114.255455\u003c/span\u003e\u003cspan address=\"10.1104/pp.114.255455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou MJ, Guan YC, Ren HB, Zhang F, Chen F (2007) Characterization of alternative splicing products of bZIP transcription factors OsABI5. Biochem Biophys Res Commun 360:307\u0026ndash;313. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2007.05.226\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2007.05.226\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":false,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"ABA sensitivity, Plant height, Seed dormancy, TaABI5-A4, Triticum aestivum","lastPublishedDoi":"10.21203/rs.3.rs-4710390/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4710390/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eABI5\u0026nbsp;is a critical\u0026nbsp;transcription\u0026nbsp;factor in regulation of crop seed maturation, dormancy, germination and post-germination. Sixteen\u0026nbsp;copies of homologous sequences\u0026nbsp;of\u0026nbsp;ABI5\u0026nbsp;were\u0026nbsp;identified\u0026nbsp;in\u0026nbsp;Chinese\u0026nbsp;wheat\u0026nbsp;line Zhou 8425B.\u0026nbsp;Cultivars of two haplotypes\u0026nbsp;TaABI5-A4a\u0026nbsp;and\u0026nbsp;TaABI5-A4bshowed significantly different seed dormancy. Based on\u0026nbsp;two\u0026nbsp;SNPs\u0026nbsp;between the sequences of\u0026nbsp;TaABI5-A4a\u0026nbsp;and\u0026nbsp;TaABI5-A4b, two complementary dominant sequence-tagged site (STS) markers were developed and validated in a natural population of 103 Chinese wheat cultivars and advanced lines and 200\u0026nbsp;recombinant inbred lines (RILs) derived from the Yangxiaomai/Zhongyou 9507 cross; the STS markers can be used efficiently and reliably to evaluate the dormancy of wheat seeds.\u0026nbsp;The transcription level of\u0026nbsp;TaABI5-A4b\u0026nbsp;was significantly increased in\u0026nbsp;TaABI5-A4a-GFPtransgenic rice lines compared with that in\u0026nbsp;TaABI5-A4b-GFP.\u0026nbsp;The average seed germination index of\u0026nbsp;TaABI5-A4a-GFP\u0026nbsp;transgenic rice lines were significantly lower than those of\u0026nbsp;TaABI5-A4b-GFP. In addition,\u0026nbsp;seeds of\u0026nbsp;TaABI5-A4a-GFP\u0026nbsp;transgenic lines had higher ABA sensitivity and endogenous ABA content, lower endogenous GA content and plant height, and thicker stem internodes than those of\u0026nbsp;TaABI5-A4b-GFP.\u0026nbsp;Allelic variation of\u0026nbsp;TaABI5-A4\u0026nbsp;affected wheat seed dormancy and the gene function was confirmed in transgenic rice. The transgenic rice lines of\u0026nbsp;TaABI5-A4a\u0026nbsp;and\u0026nbsp;TaABI5-A4b\u0026nbsp;had significantly different sensitivities to ABA and contents of endogenous ABA and GA in mature seeds, thereby influencing the seed dormancy, plant height and stem internode length and diameter.\u003c/p\u003e","manuscriptTitle":"Allelic variation of TaABI5-A4 Significantly Affects Seed Dormancy in Bread Wheat","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-05 17:33:27","doi":"10.21203/rs.3.rs-4710390/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor revisions","date":"2024-08-19T22:09:25+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-07-22T00:09:04+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-11T00:55:02+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-10T03:53:15+00:00","index":"","fulltext":""},{"type":"submitted","content":"Theoretical and Applied Genetics","date":"2024-07-09T04:25:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"387b6bab-a9cc-42cb-b927-3c638014fe04","owner":[],"postedDate":"August 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-30T16:05:55+00:00","versionOfRecord":{"articleIdentity":"rs-4710390","link":"https://doi.org/10.1007/s00122-024-04753-3","journal":{"identity":"theoretical-and-applied-genetics","isVorOnly":false,"title":"Theoretical and Applied Genetics"},"publishedOn":"2024-09-28 15:57:00","publishedOnDateReadable":"September 28th, 2024"},"versionCreatedAt":"2024-08-05 17:33:27","video":"","vorDoi":"10.1007/s00122-024-04753-3","vorDoiUrl":"https://doi.org/10.1007/s00122-024-04753-3","workflowStages":[]},"version":"v1","identity":"rs-4710390","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4710390","identity":"rs-4710390","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00