Responses of Parasitoids (Hymenoptera) of Diaspis boisduvalii (Hemiptera: Diaspididae) to Insecticides and Herbicides in Costa Rican banana plantations.

Responses of Parasitoids (Hymenoptera) of Diaspis boisduvalii (Hemiptera: Diaspididae) to Insecticides and Herbicides in Costa Rican banana plantations. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Responses of Parasitoids (Hymenoptera) of Diaspis boisduvalii (Hemiptera: Diaspididae) to Insecticides and Herbicides in Costa Rican banana plantations. Minor Solano-Gutiérrez, Paul Hanson, César Guillén-Sánchez This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3838716/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Armored scale insects (Hemiptera: Diaspididae) have been identified as pests worldwide. In Costa Rica, various armored scale insects are economically important in the production of agricultural and horticultural products for exportation. Diaspis boisduvalii Signoret is a primary insect pest in banana plantations, causing substantial economic losses and high control costs. In order to determine the effect of insecticide and herbicide use on percent parasitism of D. boisduvalii on banana ( Musa AAA “Cavendish”) in Costa Rica, six commercial plantations with varying insecticide and herbicide use were sampled over a five-month period. Pseudopetioles from the oldest pseudoleaf of banana plants infested with scale insects were collected monthly at each site. Each pseudopetiole fragment (55 cm 2 ) was stored in a well-ventilated glass tube and monitored daily for parasitoid emergence, percent parasitism, and sex ratio. Four parasitoid species from two families were identified. A gregarious ectoparasitoid Aphytis sp., a solitary endoparasitoid Coccobius sp. and a very rare hyperparasitoid Ablerus sp. (Aphelinidae), and a solitary endoparasitoid Plagiomerus peruviensis (Girault) (Encyrtidae). The study revealed a significant negative impact of insecticides ( p < .001), but species-specific responses to herbicides. Rather suprisingly, P. peruviensis showed a higher percent parasitism in plantations with herbicides than without herbicides, unlike the other parasitoids. Results from sex ratios suggest that P. peruviensis reproduces via thelytokous parthenogenesis. banana cultivation biological control weed management Aphytis Coccobius Plagiomerus Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Armored scale insects (Hemiptera: Diaspididae) have been identified as pests of perennial plant species worldwide (Miller and Davidson 2005 ; Mauchline et al. 2011 ). It is the largest family within the superfamily Coccoidea and has about 2600 described species in 395 genera (Normark et al. 2019 ). Outbreaks are most common in disturbed environments such as agricultural landscapes, especially if control by natural enemies is removed or reduced (Howard 2001 ; Ouvrard et al. 2013 ). In Costa Rica various armored scale insects have economic significance in the exportation of agricultural and horticultural products such as bananas, pineapples, ornamental plants and citrus (Malumphy 2015 ; Evans and Dooley 2013 ). Among these, the Boisduval scale ( Diaspis boisduvalii Signoret) stands out as a primary insect pest in banana plantations, causing substantial economic losses and incurring high control costs (Guillén and Laprade 2016 ). Boisduval scales can be found on the pseudostem, pseudopetioles, leaves and fruits of banana (Guillén et al. 2010 ; Guillén and Laprade 2016 ) and they are quarantined in most export destinations of Costa Rican bananas (Malumphy 2015 ; Guillén and Laprade 2016 ). For the management of this insect, polyethylene bags impregnated with insecticides and targeted applications of horticultural oils, potassium salts of fatty acids and insecticides are used (Guillén et al. 2010 ; Guillén and Laprade 2016 ). Little is known about biological control agents of this pest (Solano-Gutiérrez et al. 2019 ) despite the fact that most successes in the use of biological control have been obtained against scale insects, which are not easily controlled by insecticides (Dhaliwal and Arora 2001 ; Koul and Dhaliwal 2003 ). Parasitic wasps (Hymenoptera: Chalcidoidea) are among the main natural enemies of armored scale insects and are often successful in regulating their populations (Hunter and Wolley 2001 ; Schmidt and Polaszek 2007 ; Xiao et al. 2016 ; Amouroux et al. 2019 ; Ramos et al. 2018 ). Effective pest control by parasitoids often correlates positively with diversification of cover crops and reduction in insecticide use, thereby offering techniques for enhancing conservation biological control (Hawkins 1994; Begg et al. 2017 ; Zaviezo and Muñoz 2023 ). In contrast, the suppressive effect of residual insecticides on natural enemies is pronounced and negatively affects the community of parasitic wasps of armored scale insects (Raupp et al. 2001 ). Therefore, the objective of this work was to determine the effect of insecticide and herbicide use on percent parasitism of Diaspis boisduvalii in Costa Rican banana plantations. Materials and methods Study sites In order to determine the impact of insecticide use and weed management on parasitism of Diaspis boisduvalii in banana ( Musa AAA “Cavendish”), six plantations were sampled from April to August of 2018. The six sampling sites were commercial banana plantations, each with an area over 100 hectares, dedicated to export production, located on the Caribbean side of the country, and with varying use of insecticides and herbicides (Fig. 1 ). Insecticide use and weed management Weed management was classified as herbicide use or no herbicides use, according to the type of management at each sample site. Intensity of insecticide use was based on ground level insecticide and nematicide applications, where low insecticide use refers to sites that did not use these pesticides to control insects and nematodes at the time of sampling; sites with at least two applications, one each of the aforementioned pesticides, were considered as high intensity of insecticide use (Table 1 ). Aerial applications of fungicides were not considered since they are used to protect banana plants from diseases such as black sigatoka (Barraza et al. 2011 ; Bravo Durán et al. 2013 ; Brühl et al. 2023 ); all sites received weekly applications because current conditions do not easily allow a reduction in the use of fungicides to control the disease (De Bellaire et al. 2010 ). Additionally, at all sites polyethylene bags impregned with a mix of Buprofezin (2% by mass) and Bifenthrin (0.1% by mass) were used to cover the developing banana fruits. Table 1 Pesticides used for insect and nematode control, insecticide use intensity and weed management at the six sampling sites on the Caribbean slope of Costa Rica. Site Pesticides used* Insecticide use intensity Weed management 1 None Low Herbicides 2 Pyriproxyfen, Oxamyl High Herbicides 3 PSFA**, Terbufos High No herbicides 4 Horticultural oil, Oxamyl High No herbicides 5 Sulfur, Fluopyram, Oxamyl High No herbicides 6 None Low No herbicides *For insect and nematode control, ** Potassium Salts of Fatty Acids Insect identification Parasitoids were identified to genus level using keys to genera of Aphelinidae (Hanson 1995 ) and Encyrtidae (Noyes 1980 ). Plagiomerus (Encyrtidae) was identified to species level using Noyes ( 2023 ). Specimens were sexed by observing morphological differences in antennae and presence/absence of an ovipositor. The sex ratio was calculated as the proportion male/female. D. boisduvalii identification was performed using molecular techniques, where scales recovered during field sampling were stored in absolute ethanol and cold preserved (Morse and Normack 2006). DNA extraction was performed according to Brandfass and Karlovsky ( 2008 ), from four samples containing a single female scale insect and six samples containing groups of five females. Oligonucleotide primers were used to amplify regions of the EF1α gene, where the sense primer EF-1a(a) (GATGCTCCGGGGGACAYAGA) was paired with the antisense primer EF2 (ATGTGAGCGGTGTGGCAATCCAA) and the D2 and D3 expansion segments of the 28S gene by pairing the s3660 sense primer (GAGAGAGTTMAASAGTACGTGAA-AC) with the antisense primer 28b (TCGGAAGGAAGGAACCAGCTACTA), as proposed by Morse and Normack (2006), and by standard PCR protocols using a Veriti® programmable thermal cycler (Applied Biosystems, USA). Sequencing was done by Macrogen Inc, sequence editing was done by using the BioEdit program, and the consensus strand obtained was copied to the NCBI (National Center for Biotechnology Information) "Blast" web page to obtain the molecular identification and identity percentage with previously reported sequences. Parasitism determination Sampling was done randomly, but in a well distributed manner; twenty pseudopetioles were collected from the oldest pseudoleaf of banana plants infested with scale insects at each of the six banana plantations. This process was conducted at monthly intervals for five months, resulting in a total of 100 samples per site and 600 analyzed samples in total. The initial number of live healthy adult D. boisduvalii females with the third nymphal exuvia present in each pseudopetiole fragment (55 cm2) was recorded. These specimens were then stored in well-ventilated glass tubes and monitored daily for parasitoid emergence (Abell and Van Driesche 2012 ), identification, and determination of percent parasitism. The determination of percent parasitism was calculated by assessing the number of adult parasitoid insects from each species that emerged and comparing it to the total number of host scale insects initially present in the sample (Abd-Rabou et al. 2014 , Wiese et al. 2005 ). For parasitism by Aphytis sp., a correction of 3 parasitoids per female scale insect was applied. This correction factor was utilized because Aphytis sp. is a gregarious ectoparasitoid, and the findings indicated an average of 3 pupae per host (Table 2 ). Data analysis To test predictions regarding the relationships between weed management and intensity of insecticide use on parasitism of D. boisduvalii , a series of generalized linear models (glm) were developed. In these models, weed management and intensity of insecticide use served as predictors, while scale insect parasitism was the response variable, using a binomial distribution because of overdispersion in the dependent variable. The ‘glm’ function and likelihood ratio test/ANOVA type II for significance testing were performed. To improve the generalized linear models, parasitism was analyzed as proportion data of discrete counts and analyzed with logistic regression (Mangiafico 2016). Furthermore, to determine statistical differences between treatments, estimated marginal means were determined from glm models using the emmeans package 1.5.5 (Lenth 2022 ) and all pairwise comparisons of means were separated ( p < 0.05) through ‘cld’ function using the Šidák correction with the multcompView package 0.1-8 (Graves et al. 2019 ). All statistical analyses were performed in R 4.2.2 (R Core Team 2023). Results Four species of parasitoids from two families were identified: a gregarious ectoparasitoid Aphytis sp., a solitary endoparasitoid Coccobius sp., a very rare hyperparasitoid Ablerus sp. (all three belonging to the family Aphelinidae), and a solitary endoparasitoid Plagiomerus peruviensis (Encyrtidae). Aphytis sp. showed an average of 3 pupae per host, with a range of 1–6. In general, percent parasitism of D. boisduvalii showed a high dispersion with an average of 5.66% (range of 0-83.05%) by P. peruviensis , 9.28% (range of 0-75.76%) by Coccobius sp. and 1.07% (range of 0-42.11%) by Aphytis sp. (Table 2 ) Table 2 Number of parasitoid pupae per female scale insect, parasitism (%) and type of development for each of the primary parasitoid species of Diaspis boisduvalii in Costa Rican banana plantations. Parasitoid Parasitoid pupae / female scale Development Parasitism (%) n Mean (Sd) Range Mean (Sd) Range Plagiomerus 15 1 - Solitary endoparasitoid 5.66 (12.61) 0–83.05 Coccobius 15 1 - Solitary endoparasitoid 9.28 (11.71) 0–75.76 Aphytis 35 3 (± 1.28) 1–6 Gregararious ectoparasitoid 1.07 (4.18) 0–42.11 Sd = Standard deviation of the mean Sites with high insecticide use and no herbicides showed the lowest percent parasitism with an average of 10.41%. The highest rate of parasitism was at sites with low insecticide use and with use of herbicides ( p > 0.05), these sites having an average parasitism of 27.46%. However, there was no statistical difference between sites with high insecticide use and no herbicides versus high insecticides plus herbicide use ( p < 0.05). In the same manner, there was no statistical difference between sites with low insecticide use and no herbicides versus low insecticides plus herbicide use (Fig. 2 , Appendix: Table S2). In general, there was a statistical difference between sites with low and high insecticide use with an average percent parasitism of 24.94% and 11.35%, respectively (Appendix: Table S1). Parasitism remained consistently low in sites with high insecticide use, with a percent parasitism of 10.41 and 14.99% without and with herbicide use, respectively (Fig. 2 , Appendix: Table S2-3), and no significant differences were observed in the percent parasitism by each species due to herbicide use at these sites ( p = 0.173, p = 0.314, and p = 0.114 for P. peruviensis , Coccobius sp. and Aphytis sp., respectively; Appendix: Table S4). However, in sites with low insecticide use, the use of herbicides dramatically reduced the percent parasitism by Coccobius sp. ( p < 0.001), i.e. 0.89 and 18.76% with and without herbicide use, respectively (Fig. 3 b, Appendix: Table S4). In contrast, in areas where herbicides were used as a weed management method, a highly significant positive effect was observed on percent parasitism by Plagiomerus peruviensis ( p < 0.001), i.e. 26.52 and 1.17% with and without herbicide use, respectively (Fig. 3 a, Appendix: Table S4). Percent parasitism by Aphytis sp. on D. boisduvalii showed no significant differences with respect to herbicide use and remained low, with no parasitism recorded in sites where herbicide was used (Fig. 3 c, Appendix: Table S4). The sex ratios (male/female) of parasitoid adults emerging from adult female D. boisduvalii exhibited notable variation between parasitoid species. Only 15% of the emerging Coccobius sp. were male, signifying a highly skewed sex ratio towards females. Plagiomerus peruviensis displayed an extremely low sex ratio, with just 1% of the emerging adults being male. In contrast, Aphytis sp. exhibited a higher proportion of males, with a sex ratio of 27% males, and Ablerus sp. displayed a balanced sex ratio, with 1.06 males for every female (Fig. 4 ). Discussion Insecticides remain the most common pest management tool globally (Guedes et al. 2016 ). These compounds are applied in the environment to reduce target species populations, either by increasing mortality or decreasing fecundity (Guedes et al. 2016 ; Sánchez-Bayo 2021 ). The predominant method of banana cultivation in Costa Rica is through an agricultural monocrop system and depends on extensive use of synthetic pesticides that impact ecosystems (Brühl et al. 2023 ). In order to control pest populations such as D. boisduvalii and other banana pests, insecticides are commonly employed. This is done by using polyethylene bags to cover the banana fruit during its growth, these bags being impregnated with a mixture of insecticides, or by applying insecticides at ground level. In many cases, both methods are utilized. Additionally, at least two applications of insecticides or nematicides are used annually to regularly control nematode populations in almost all banana plantations (Polidoro et al 2008 ). Pesticides have adverse effects on living organisms, particularly impacting non-target species such as natural enemies of insect pests (Theiling and Croft 1988 ; Guedes et al. 2016 ; Schmidt-Jeffris 2023 ). This effect was dramatically observed in this study, where the intensity of insecticide use significantly affected the percent parasitism of D. boisduvalii ; parasitism varied from 24.94–11.35% in sites with low and high insecticide use, respectively (Fig. 2 , Appendix: Table S1). Insecticides are the most toxic pesticides to natural enemies, followed by herbicides (Theiling and Croft 1988 ). As mentioned above, insecticides negatively affected all parasitoids of D. boisduvalii , which was expected. However, the species-specific response among D. boisduvalii parasitoids in relation to herbicide use (Fig. 3 , Appendix: Table S4) was quite unexpected and is diffiucult to explain. Both Plagiomerus and Coccobius are koinobiont endoparasitoids, and therefore presumably pro-ovigenic and relatively short-lived. These two parasitoids might thus be expected to respond similarly to herbicides, which was not the case. Perhaps Plagiomerus is less affected by herbicides due to differences in its physiology or behavior, and its scarcity in herbicide-free plantations is simply an artifact. Interspecific competition can play a role in shaping community structure of parasitoids (Cusumano et al. 2016 ), but it seems unlikely that this explains the results for Plagiomerus given the relatively low levels of parasitism. In addition to their toxic effects, herbicides also have indirect effects by reducing the diversity of nectar resources upon which adult parasitoids depend (Shaw 2006 ; Wäckers et al. 2008; Snart et al. 2018 ; Zaviezo and Muñoz 2023 ). Mealybugs (Hemiptera: Pseudococcidae) are present in Costa Rican banana plantations (Palma-Jiménez et al. 2019 ), and honeydew from these insects could possibly serve as a sugar source for Plagiomerus in environments where associated plants are scarce, such as those where herbicides were used for weed management (Wäckers et al. 2008; Neerbos et al. 2019 ). Parasitoids of D. boisduvalii in banana plantations showed strikingly different sex ratios (Fig. 4 ). In the vast majority of Hymenoptera males develop from unfertilized (haploid) eggs, a phenomenom known as arrhenotokous parthenogenesis, while females develop from fertilized (diploid) eggs. The relatively low proportion of males in Aphytis sp. and Coccobius sp. might indicate the existence of local mate competion, whereby mating occurs between siblings prior to dispersal (Hamilton 1967 ). However, further investigation is required to test this possibility. On the other hand, the near absence of males in P. peruviensis suggests the existence of thelytokous parthenogensis, i.e. unmated females producing only daughters. The bacterial symbiont Cardinum has previously been implicated in thelytokous parthenogenesis in another species of Plagiomerus (Matalon et al. 2007 ), and it would be interesting to examine whether this is also the case in P. peruviensis . Whether thelytokoy could explain the better performance of P. peruviensis in environments with herbicides is an open question. In conclusion, our study revealed a significant impact of insecticides on the parasitoids of D. boisduvalii in Costa Rican banana plantations as well as species-specific responses of the parasitoid species with respect to herbicide use. The latter result was surprising and further research is required to determine if indeed P. peruviensis is less affected by herbicide use than are Aphytis sp. and Coccobius sp. If this finding is confirmed, there remains the interesting question of what factors or mechanisms underlie the different susceptibilities to herbicides. It is also important to explore interactions between mealybugs, D. boisduvalii and parasitoid populations, as well as the influence of plant community composition. Studying the selectivity of each pesticide used in banana plantations to parasitoids is crucial for preserving natural enemies. Mitigating nontarget effects of pesticides and increasing vegetation diversity within banana agroecosystems are essential for the success of biological control and conservation. Declarations Author contribution All authors conceived and designed the research. MSG and CG conducted the research. PH contributed with insect identification. MSG carried out data analysis. MSG and PH wrote the manuscript. All authors reviewed and approved the manuscript. Acknowledgements The authors thank Marcos Rojas, Julio Rodríguez and Pedro Ávila for their help with field work. Authors also thank Miguel González and Jorge Sandoval from the Corporación Bananera Nacional de Costa Rica (CORBANA) for their support so that the research could be carried out. Funding This work was fully funded by the Corporación Bananera Nacional de Costa Rica (CORBANA), Department of Entomology. Data Availability The dataset and code generated in this study are available from the corresponding author. References Abd-Rabou S, Ahmed N, Evans GA (2014) Encarsia Forester [ sic ] (Hymenoptera: Aphelinidae) - Effective parasitoids of armored scale insects (Hemiptera: Diaspididae) in Egypt. Acta Zool Bulg 6:7-12. Abell KJ, Van Driesche RG (2012) Impact of latitude on synchrony of a scale ( Fiorinia externa ) (Hemiptera: Diaspididae) and its parasitoid ( Encarsia citrina ) (Hymenoptera: Aphelinidae) in the Eastern United States. Biol Control 63(3):339-347. https://doi.org/10.1016/j.biocontrol.2012.09.009 Amouroux P, Crochard D, Correa M, Groussier G, Kreiter P, Roman C, Zaviezo T (2019) Natural enemies of armored scales (Hemiptera: Diaspididae) and soft scales (Hemiptera: Coccidae) in Chile: Molecular and morphological identification. PLoS One 14(3):e0205475. https://doi.org/10.1371/journal.pone.0205475 Barraza D, Jansen K, de Joode BVW, Wesseling C (2011) Pesticide use in banana and plantain production and risk perception among local actors in Talamanca, Costa Rica. Environ Res 111(5):708-717. https://doi.org/10.1016/j.envres.2011.02.009 Begg GS, Cook SM, Dye R et al (2017) A functional overview of conservation biological control. Crop Protection 97:145-158. https://doi.org/10.1016/j.cropro.2016.11.008 Brandfass C, Karlovsky P (2008) Upscaled CTAB-based DNA extraction and realtime PCR assays for Fusarium culmorum and F. graminearum DNA in plant material with reduced sampling error. Int J Mol Sci 9(11):2306-2321. https://doi.org/10.3390/ijms9112306 Bravo Durán V, de la Cruz Malavassi E, Herrera Ledezma G, Ramírez Muñoz F (2013) Uso de plaguicidas en cultivos agrícolas como herramienta para el monitoreo de peligros en salud. Uniciencia, 27(1):351-376. Brühl CA, Arias Andres M, Echeverría-Sáenz S, Bundschuh M, Knäbel A, Mena F, Petschick LL, Ruepert C, Stehle S (2023) Pesticide use in banana plantations in Costa Rica – A review of environmental and human exposure, effects and potential risks. Environ Int 174:107877. https://doi.org/10.1016/j.envint.2023.107877 Cusumano A, Peri E, Colazza S (2016) Interspecific competition/facilitation among insect parasitoids. Curr Opin Insect Sci 14:12-16. https://doi.org/10.1016/j.cois.2015.11.006 De Bellaire LDL, Fouré E, Abadie C, Carlier J (2010) Black Leaf Streak Disease is challenging the banana industry. Fruits 65(6):327-342. https://doi.org/10.1051/fruits/2010034 Dhaliwal GS, Arora R (2001) Integrated Pest Management: Concepts and Approaches. Kalyani Publishers, New Delhi Evans GA, Dooley JW (2013) Potential invasive species of scale insects for the USA and Caribbean Basin. In: Peña JE. (eds). Potential invasive pests of agricultural crops (vol. 3). CABI Publishing, Oxford, pp. 320-341. Guedes RNC, Smagghe G, Stark JD, Desneux N (2016) Pesticide-induced stress in arthropod pests for optimized Integrated Pest Management programs. Annu Rev Entomol 61:43-62 https://doi.org/10.1146/annurev-ento-010715-023646 Guillén C, Laprade S (2016) Manejo y combate de la escama del banano ( Diaspis boisduvalii ). CORBANA. Hoja divulgativa Nº 9-2016. https://www.corbana.co.cr/wp-content/uploads/HD-n.%C2%B0-9-2016-Manejo-escamas.pdf Guillén C, Rodríguez A, Laprade S, Valle H, Segura R, Uva V, Sandoval J (2010) Biología y control de las cochinillas y escamas que atacan al banano. CORBANA. Hoja divulgativa Nº 5-2010. https://www.corbana.co.cr/wp-content/uploads/HD-n.%C2%B0-4-2013-Biolog%C3%ADa-y-control-escamas.pdf Graves S, Piepho H, Selzer L, Dorai-Raj LS (2019). multcompView: Visualizations of Paired Comparisons. R package version 0.1-8, https://CRAN.R-project.org/package=multcompView. Hamilton WD (1967) Extraordinary sex ratios. Science 156:477-488. https://doi: 10.1126/science.156.3774.477 Hanson PE (1995) The Chalcidoid families: Aphelinidae. In: Hanson PE, Gauld ID (eds.), The Hymenoptera of Costa Rica. Oxford University Press, Oxford, pp 282-289 Howard FW (2001) Sap-feeders on palms. In: Howard FW, Moore D, Giblin-Davis RM, Abad RG (eds) Insects on palms. CABI Publishing, Oxford, pp 109-232. Hunter MS, Wolley JB (2001) Evolution and behavioral ecology of heteronomous aphelinid parasitoids. Annu Rev Entomol 46(1):251-290. https://doi.org/10.1146/annurev.ento.46.1.251 Koul O, Dhaliwal GS (2003) Predators and parasitoids, an introduction. In: Koul O, Dhaliwal GS (eds) Predators and Parasitoids, 1st edn. Taylor & Francis, London, pp 1-15. https://doi.org/10.4324/9780203302569 Lenth R (2022). emmeans: Estimated Marginal Means, aka Least-Squares Means. R package version 1.7.5. https://CRAN.R-project.org/package=emmeans. Malumphy, C (2015) Arthropods intercepted on fresh pineapple fruit, Ananas comosus (L.) Merr. imported into England and Wales. Entomol Gaz 66:65–75. Mangiafico SS (2021) Summary and Analysis of Extension Program Evaluation in R, version 1.20.01. Rutgers Cooperative Extension, New Brunswick rcompanion.org/documents/RHandbookProgramEvaluation.pdf Matalon Y, Katzir N, Gottlieb Y, Portnoy V, Zchori-Fein E (2007) Cardinium in Plagiomerus diaspidis (Hymenoptera: Encyrtidae). J Invertebr Pathol 96(2):106-108. https://doi.org/10.1016/j.jip.2007.02.010 Mauchline N, Hallett I, Hill G, Casonato S (2011) Process of infection of armored scale insects (Diaspididae) by an entomopathogenic Cosmospora sp. J Invertebr Pathol 108(1):46-51. https://doi.org/10.1016/j.jip.2011.07.002 Miller DR, Davidson JA (2005) Armored scale insect pests of trees and shrubs (Hemiptera: Diaspididae). Cornell University Press, Ithaca Morse GE, Normark BB (2006) A molecular phylogenetic study of armoured scale insects (Hemiptera: Diaspididae). Syst Entomol 31(2):338-349. https://doi.org/10.1111/j.1365-3113.2005.00316.x Noyes JS (1980) A review of the genera of Neotropical Encyrtidae (Hymenoptera: Chalcidoidea). Bull Nat Hist Mus Entomol ser 41:107-253. Noyes JS (2023) Encyrtidae of Costa Rica (Hymenoptera: Chalcidoidea), 4. Taxon Monogr Neotrop Hymenop 2:1-921. Normark BB, Okusu A, Morse GE, Peterson DA, Itioka, T, Schneider SA (2019) Phylogeny and classification of armored scale insects (Hemiptera: Coccomorpha: Diaspididae). Zootaxa 4616(1):1-98. https://doi.org/10.11646/zootaxa.4616.1.1 Ouvrard D, Kondo T, Gullan PJ (2013) Scale insects: Major pests and management. In: Encyclopedia of Pest Management. Taylor and Francis, New York, pp 1–4. Palma-Jiménez M, Blanco-Meneses M, Guillén-Sánchez C (2019) Las cochinillas harinosas (Hemiptera: Pseudococcidae) y su impacto en el cultivo de Musáceas. Agron Mesoam 30(1):281-298 https://doi.org/10.15517/am.v30i1.32600 Polidoro BA, Dahlquist RM, Castillo LE, Morra MJ, Somarriba E, Bosque-Pérez NA (2008) Pesticide application practices, pest knowledge, and cost-benefits of plantain production in the Bribri-Cabécar Indigenous Territories, Costa Rica. Environ Res 108(1):98-106 https://doi.org/10.1016/j.envres.2008.04.003 R Core Team (2021) R: a language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. Retrieved from http:// www.R-project.org Ramos ASDJC, de Lemos RNS, Costa VA, Peronti ALBG, da Silva EA, Mondego JM, Moreira AA (2018) Hymenopteran parasitoids associated with scale insects (Hemiptera: Coccoidea) in tropical fruit trees in the eastern Amazon, Brazil. Fla Entomol 101(2):273-278. https://doi.org/10.1653/024.101.0219 Raupp, MJ, Holmes JJ, Sadof C, Shrewsbury P, Davidson JA (2001) Effects of cover sprays and residual pesticides on scale insects and natural enemies in urban forests. J. arboric 27(4):203-214. Sánchez-Bayo F (2021) Indirect effect of pesticides on insects and other arthropods. Toxics 9(8): 177. https://doi.org/10.3390/toxics9080177 Schmidt-Jeffris RA (2023) Nontarget pesticide impacts on pest natural enemies: progress and gaps in current knowledge. Curr Opin Insect Sci 58:101056. https://doi.org/10.1016/j.cois.2023.101056 Schmidt S, Polaszek A (2007) The Australian species of Encarsia Förster (Hymenoptera, Chalcidoidea: Aphelinidae), parasitoids of whiteflies (Hemiptera, Sternorrhyncha, Aleyrodidae) and armoured scale insects (Hemiptera, Coccoidea: Diaspididae). J Nat Hist 41(33-36):2099-2265. https://doi.org/10.1080/00222930701550766 Shaw MR (2006) Habitat considerations for parasitic wasps (Hymenoptera). J Insect Conserv 10:117-127. https://doi.org/10.1007/s10841-006-6288-1 Snart CJ, Kapranas A, Williams H, Barrett DA, Hardy IC (2018) Sustenance and performance: nutritional reserves, longevity, and contest outcomes of fed and starved adult parasitoid wasps. Front Ecol Evol 6:12. https://doi.org/10.3389/fevo.2018.00012 Solano-Gutiérrez M, Guillen C, Conejo AM (2019) Identificación y aspectos biológicos de estadios inmaduros de Ceraeochrysa spp. (Neuroptera: Chrysopidae) depredador de la escama Diaspis boisduvalii (Hemiptera: Diaspididae) en banano. Corbana 45(65):123-130 Theiling KM, Croft BA (1988). Pesticide side-effects on arthropod natural enemies: a database summary. Agric Ecosyst Environ 21(3-4):191-218 https://doi.org/10.1016/0167-8809(88)90088-6 van Neerbos FAC, de Boer JG, Salis L, Tollenaar W, Kos M, Vet LEM, Harvey JA (2019) Honeydew composition and its effect on life-history parameters of hyperparasitoids. Ecol Entomol 45:278–289. https://doi.org/10.1111/een.12799 Wäckers Fl, van Rijn PCJ, Heimpel GE (2008) Honeydew as a food source for natural enemies: Making the best of a bad meal?. Biol Control 45(2):176-184 Wiese C, Amalin D, Coe R, Mannion C (2005) Effects of the parasitic wasp Coccobius fulvus on cycad aulacaspis scale, Aulacaspis yasumatsui , at Montgomery Botanical Center, Miami, Florida. Proc Fla State Hort Soc 118:319-321. Xiao Y, Mao R, Singleton L, Arthurs S (2016) Evaluation of reduced-risk insecticides for armored scales (Hemiptera: Diaspididae) infesting ornamental plants. J Agric Urban Entomol 32(1):71-90. https://doi.org/10.3954/JAUE16-07.1 Zaviezo T, Muñoz AE (2023) Conservation biological control of arthropod pests using native plants. Curr Opin Insect Sci 56:101022 https://doi.org/10.1016/j.cois.2023.101022 Supplementary Files Appendix.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3838716","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":266017829,"identity":"1f3a34cc-49ed-4c56-b008-f954061a4067","order_by":0,"name":"Minor Solano-Gutiérrez","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJElEQVRIie2RMUvEMBiGUwLpEq9rwmnvFwgNgTo43F9pueGW4nIgHUrJlFvE2eHwP7jcfKXQKaf/QAiuN/QGpYKDLa2CluqNgnmWF5Lv4eXjA8Bg+IvALkdd4jbiAxTUhtcp6oC2D6UNSw5Pni6PsqcYpC6yt5l+lm/Hznir9ettPjkTUJcgefyu+PloxhTIOcIXM34iPUyv59yj65ytNogTUCz6CvapAJtQgsgf01rxFEKErfOA1L/AEsGAkobS2bXKVCG7CleNYr/8oMBQksin+6YFIwQy0Sh4qIUz4dW7kB3n4J5johCkopizG4gXJCj6yoNiWsSp6zgR09WlO3WukLWvkvMJsZd3ZZn0lJbuGhB/eW2uPCB8YlW/DBgMBsP/5B1NfFmhUqsQgAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-5661-0890","institution":"Universidad de Costa Rica","correspondingAuthor":true,"prefix":"","firstName":"Minor","middleName":"","lastName":"Solano-Gutiérrez","suffix":""},{"id":266017830,"identity":"fe3eb8fc-eb7e-491f-8950-dd4f4e456814","order_by":1,"name":"Paul Hanson","email":"","orcid":"","institution":"Universidad de Costa Rica","correspondingAuthor":false,"prefix":"","firstName":"Paul","middleName":"","lastName":"Hanson","suffix":""},{"id":266017831,"identity":"773965be-fdc5-4b09-8b96-7e34ea7f1b5e","order_by":2,"name":"César Guillén-Sánchez","email":"","orcid":"","institution":"Universidad de Costa Rica","correspondingAuthor":false,"prefix":"","firstName":"César","middleName":"","lastName":"Guillén-Sánchez","suffix":""}],"badges":[],"createdAt":"2024-01-06 03:50:42","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-3838716/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3838716/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49484376,"identity":"862f84b6-01c7-4bb4-b56c-73a3545fae37","added_by":"auto","created_at":"2024-01-11 16:05:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":320925,"visible":true,"origin":"","legend":"\u003cp\u003eSampling sites. Highlighted area represents the Caribbean slope where bananas are grown and small circles indicate sites that were sampled.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3838716/v1/f7a217cfe283b1318ca0ac59.png"},{"id":49484375,"identity":"56fe1fa9-1e80-4b1a-8f77-24d901763473","added_by":"auto","created_at":"2024-01-11 16:05:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":139076,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of weed management (herbicide use) and insecticide use on percent parasitism of \u003cem\u003eDiaspis boisduvalii\u003c/em\u003e in Costa Rican banana plantations. Error bars represent standard error of the mean and different letters indicate significant statistical differences between treatments (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3838716/v1/f0f129591ffc7f1cbfde1398.png"},{"id":49484377,"identity":"cccfc909-6266-4fc0-abd1-27770450b5af","added_by":"auto","created_at":"2024-01-11 16:05:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":132084,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of herbicide use on percent parasitism of \u003cem\u003eDiaspis boisduvalii\u003c/em\u003e in banana plantations with low insecticide use. a) \u003cem\u003ePlagiomerus\u003c/em\u003e \u003cem\u003eperuviensis\u003c/em\u003e b) \u003cem\u003eCoccobius \u003c/em\u003esp. c) \u003cem\u003eAphytis\u003c/em\u003e sp. \u0026nbsp;Error bars represent standard error of the mean,\u003cstrong\u003e \u003c/strong\u003e• \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.1, \u003cstrong\u003e***\u003c/strong\u003e \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3838716/v1/8cba433a37cf4a7dea330f12.png"},{"id":49484378,"identity":"d0232e83-914a-42f4-893a-c8c4b682c85e","added_by":"auto","created_at":"2024-01-11 16:05:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":128028,"visible":true,"origin":"","legend":"\u003cp\u003eSex ratio for each of the parasitoid species of \u003cem\u003eDiaspis boisduvalii\u003c/em\u003e in Costa Rican banana plantations.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3838716/v1/1bdd780ee47c6414f21801cc.png"},{"id":51630819,"identity":"de4d9820-87f3-4d69-b453-56481732ee11","added_by":"auto","created_at":"2024-02-26 09:20:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":679507,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3838716/v1/afcca283-20ba-463e-a454-28a76ec0c05b.pdf"},{"id":49484374,"identity":"730e6146-189d-4699-aaa9-e934ef2189ea","added_by":"auto","created_at":"2024-01-11 16:05:00","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22194,"visible":true,"origin":"","legend":"","description":"","filename":"Appendix.docx","url":"https://assets-eu.researchsquare.com/files/rs-3838716/v1/6ba6af3be246b4845dd2bfd0.docx"}],"financialInterests":"","formattedTitle":"Responses of Parasitoids (Hymenoptera) of Diaspis boisduvalii (Hemiptera: Diaspididae) to Insecticides and Herbicides in Costa Rican banana plantations.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eArmored scale insects (Hemiptera: Diaspididae) have been identified as pests of perennial plant species worldwide (Miller and Davidson \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Mauchline et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). It is the largest family within the superfamily Coccoidea and has about 2600 described species in 395 genera (Normark et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Outbreaks are most common in disturbed environments such as agricultural landscapes, especially if control by natural enemies is removed or reduced (Howard \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Ouvrard et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In Costa Rica various armored scale insects have economic significance in the exportation of agricultural and horticultural products such as bananas, pineapples, ornamental plants and citrus (Malumphy \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Evans and Dooley \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Among these, the Boisduval scale (\u003cem\u003eDiaspis boisduvalii\u003c/em\u003e Signoret) stands out as a primary insect pest in banana plantations, causing substantial economic losses and incurring high control costs (Guill\u0026eacute;n and Laprade \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBoisduval scales can be found on the pseudostem, pseudopetioles, leaves and fruits of banana (Guill\u0026eacute;n et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Guill\u0026eacute;n and Laprade \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) and they are quarantined in most export destinations of Costa Rican bananas (Malumphy \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Guill\u0026eacute;n and Laprade \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). For the management of this insect, polyethylene bags impregnated with insecticides and targeted applications of horticultural oils, potassium salts of fatty acids and insecticides are used (Guill\u0026eacute;n et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Guill\u0026eacute;n and Laprade \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Little is known about biological control agents of this pest (Solano-Guti\u0026eacute;rrez et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) despite the fact that most successes in the use of biological control have been obtained against scale insects, which are not easily controlled by insecticides (Dhaliwal and Arora \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Koul and Dhaliwal \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eParasitic wasps (Hymenoptera: Chalcidoidea) are among the main natural enemies of armored scale insects and are often successful in regulating their populations (Hunter and Wolley \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Schmidt and Polaszek \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Xiao et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Amouroux et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ramos et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Effective pest control by parasitoids often correlates positively with diversification of cover crops and reduction in insecticide use, thereby offering techniques for enhancing conservation biological control (Hawkins 1994; Begg et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Zaviezo and Mu\u0026ntilde;oz \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In contrast, the suppressive effect of residual insecticides on natural enemies is pronounced and negatively affects the community of parasitic wasps of armored scale insects (Raupp et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Therefore, the objective of this work was to determine the effect of insecticide and herbicide use on percent parasitism of \u003cem\u003eDiaspis boisduvalii\u003c/em\u003e in Costa Rican banana plantations.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eStudy sites\u003c/p\u003e \u003cp\u003eIn order to determine the impact of insecticide use and weed management on parasitism of \u003cem\u003eDiaspis boisduvalii\u003c/em\u003e in banana (\u003cem\u003eMusa\u003c/em\u003e AAA \u0026ldquo;Cavendish\u0026rdquo;), six plantations were sampled from April to August of 2018. The six sampling sites were commercial banana plantations, each with an area over 100 hectares, dedicated to export production, located on the Caribbean side of the country, and with varying use of insecticides and herbicides (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eInsecticide use and weed management\u003c/p\u003e \u003cp\u003eWeed management was classified as herbicide use or no herbicides use, according to the type of management at each sample site. Intensity of insecticide use was based on ground level insecticide and nematicide applications, where low insecticide use refers to sites that did not use these pesticides to control insects and nematodes at the time of sampling; sites with at least two applications, one each of the aforementioned pesticides, were considered as high intensity of insecticide use (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Aerial applications of fungicides were not considered since they are used to protect banana plants from diseases such as black sigatoka (Barraza et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Bravo Dur\u0026aacute;n et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Br\u0026uuml;hl et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e); all sites received weekly applications because current conditions do not easily allow a reduction in the use of fungicides to control the disease (De Bellaire et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Additionally, at all sites polyethylene bags impregned with a mix of Buprofezin (2% by mass) and Bifenthrin (0.1% by mass) were used to cover the developing banana fruits.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePesticides used for insect and nematode control, insecticide use intensity and weed management at the six sampling sites on the Caribbean slope of Costa Rica.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSite\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePesticides used*\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInsecticide use intensity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWeed management\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHerbicides\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePyriproxyfen, Oxamyl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHerbicides\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePSFA**, Terbufos\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo herbicides\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHorticultural oil, Oxamyl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo herbicides\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSulfur, Fluopyram, Oxamyl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo herbicides\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo herbicides\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e*For insect and nematode control, ** Potassium Salts of Fatty Acids\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eInsect identification\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eParasitoids were identified to genus level using keys to genera of Aphelinidae (Hanson \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1995\u003c/span\u003e) and Encyrtidae (Noyes \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1980\u003c/span\u003e). \u003cem\u003ePlagiomerus\u003c/em\u003e (Encyrtidae) was identified to species level using Noyes (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Specimens were sexed by observing morphological differences in antennae and presence/absence of an ovipositor. The sex ratio was calculated as the proportion male/female. \u003cem\u003eD. boisduvalii\u003c/em\u003e identification was performed using molecular techniques, where scales recovered during field sampling were stored in absolute ethanol and cold preserved (Morse and Normack 2006).\u003c/p\u003e \u003cp\u003eDNA extraction was performed according to Brandfass and Karlovsky (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), from four samples containing a single female scale insect and six samples containing groups of five females. Oligonucleotide primers were used to amplify regions of the EF1α gene, where the sense primer EF-1a(a) (GATGCTCCGGGGGACAYAGA) was paired with the antisense primer EF2 (ATGTGAGCGGTGTGGCAATCCAA) and the D2 and D3 expansion segments of the 28S gene by pairing the s3660 sense primer (GAGAGAGTTMAASAGTACGTGAA-AC) with the antisense primer 28b (TCGGAAGGAAGGAACCAGCTACTA), as proposed by Morse and Normack (2006), and by standard PCR protocols using a Veriti\u0026reg; programmable thermal cycler (Applied Biosystems, USA). Sequencing was done by Macrogen Inc, sequence editing was done by using the BioEdit program, and the consensus strand obtained was copied to the NCBI (National Center for Biotechnology Information) \"Blast\" web page to obtain the molecular identification and identity percentage with previously reported sequences.\u003c/p\u003e \u003cp\u003eParasitism determination\u003c/p\u003e \u003cp\u003eSampling was done randomly, but in a well distributed manner; twenty pseudopetioles were collected from the oldest pseudoleaf of banana plants infested with scale insects at each of the six banana plantations. This process was conducted at monthly intervals for five months, resulting in a total of 100 samples per site and 600 analyzed samples in total. The initial number of live healthy adult \u003cem\u003eD. boisduvalii\u003c/em\u003e females with the third nymphal exuvia present in each pseudopetiole fragment (55 cm2) was recorded. These specimens were then stored in well-ventilated glass tubes and monitored daily for parasitoid emergence (Abell and Van Driesche \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), identification, and determination of percent parasitism. The determination of percent parasitism was calculated by assessing the number of adult parasitoid insects from each species that emerged and comparing it to the total number of host scale insects initially present in the sample (Abd-Rabou et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Wiese et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). For parasitism by \u003cem\u003eAphytis\u003c/em\u003e sp., a correction of 3 parasitoids per female scale insect was applied. This correction factor was utilized because \u003cem\u003eAphytis\u003c/em\u003e sp. is a gregarious ectoparasitoid, and the findings indicated an average of 3 pupae per host (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eTo test predictions regarding the relationships between weed management and intensity of insecticide use on parasitism of \u003cem\u003eD. boisduvalii\u003c/em\u003e, a series of generalized linear models (glm) were developed. In these models, weed management and intensity of insecticide use served as predictors, while scale insect parasitism was the response variable, using a binomial distribution because of overdispersion in the dependent variable. The \u0026lsquo;glm\u0026rsquo; function and likelihood ratio test/ANOVA type II for significance testing were performed. To improve the generalized linear models, parasitism was analyzed as proportion data of discrete counts and analyzed with logistic regression (Mangiafico 2016). Furthermore, to determine statistical differences between treatments, estimated marginal means were determined from glm models using the \u003cem\u003eemmeans\u003c/em\u003e package 1.5.5 (Lenth \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and all pairwise comparisons of means were separated (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) through \u0026lsquo;cld\u0026rsquo; function using the Šid\u0026aacute;k correction with the \u003cem\u003emultcompView\u003c/em\u003e package 0.1-8 (Graves et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). All statistical analyses were performed in R 4.2.2 (R Core Team 2023).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eFour species of parasitoids from two families were identified: a gregarious ectoparasitoid \u003cem\u003eAphytis\u003c/em\u003e sp., a solitary endoparasitoid \u003cem\u003eCoccobius\u003c/em\u003e sp., a very rare hyperparasitoid \u003cem\u003eAblerus\u003c/em\u003e sp. (all three belonging to the family Aphelinidae), and a solitary endoparasitoid \u003cem\u003ePlagiomerus peruviensis\u003c/em\u003e (Encyrtidae). \u003cem\u003eAphytis\u003c/em\u003e sp. showed an average of 3 pupae per host, with a range of 1\u0026ndash;6. In general, percent parasitism of \u003cem\u003eD. boisduvalii\u003c/em\u003e showed a high dispersion with an average of 5.66% (range of 0-83.05%) by \u003cem\u003eP. peruviensis\u003c/em\u003e, 9.28% (range of 0-75.76%) by \u003cem\u003eCoccobius\u003c/em\u003e sp. and 1.07% (range of 0-42.11%) by \u003cem\u003eAphytis\u003c/em\u003e sp. (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNumber of parasitoid pupae per female scale insect, parasitism (%) and type of development for each of the primary parasitoid species of \u003cem\u003eDiaspis boisduvalii\u003c/em\u003e in Costa Rican banana plantations.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eParasitoid\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eParasitoid pupae / female scale\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDevelopment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eParasitism (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003en\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMean (Sd)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRange\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMean (Sd)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eRange\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePlagiomerus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSolitary endoparasitoid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e5.66 (12.61)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0\u0026ndash;83.05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCoccobius\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSolitary endoparasitoid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e9.28 (11.71)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0\u0026ndash;75.76\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAphytis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3 (\u0026plusmn;\u0026thinsp;1.28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u0026ndash;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGregararious ectoparasitoid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.07 (4.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0\u0026ndash;42.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eSd\u0026thinsp;=\u0026thinsp;Standard deviation of the mean\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eSites with high insecticide use and no herbicides showed the lowest percent parasitism with an average of 10.41%. The highest rate of parasitism was at sites with low insecticide use and with use of herbicides (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), these sites having an average parasitism of 27.46%. However, there was no statistical difference between sites with high insecticide use and no herbicides versus high insecticides plus herbicide use (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the same manner, there was no statistical difference between sites with low insecticide use and no herbicides versus low insecticides plus herbicide use (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Appendix: Table S2). In general, there was a statistical difference between sites with low and high insecticide use with an average percent parasitism of 24.94% and 11.35%, respectively (Appendix: Table S1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eParasitism remained consistently low in sites with high insecticide use, with a percent parasitism of 10.41 and 14.99% without and with herbicide use, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Appendix: Table S2-3), and no significant differences were observed in the percent parasitism by each species due to herbicide use at these sites (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.173, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.314, and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.114 for \u003cem\u003eP. peruviensis\u003c/em\u003e, \u003cem\u003eCoccobius\u003c/em\u003e sp. and \u003cem\u003eAphytis\u003c/em\u003e sp., respectively; Appendix: Table S4). However, in sites with low insecticide use, the use of herbicides dramatically reduced the percent parasitism by \u003cem\u003eCoccobius\u003c/em\u003e sp. (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), i.e. 0.89 and 18.76% with and without herbicide use, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, Appendix: Table S4). In contrast, in areas where herbicides were used as a weed management method, a highly significant positive effect was observed on percent parasitism by \u003cem\u003ePlagiomerus peruviensis\u003c/em\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), i.e. 26.52 and 1.17% with and without herbicide use, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, Appendix: Table S4). Percent parasitism by \u003cem\u003eAphytis\u003c/em\u003e sp. on \u003cem\u003eD. boisduvalii\u003c/em\u003e showed no significant differences with respect to herbicide use and remained low, with no parasitism recorded in sites where herbicide was used (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, Appendix: Table S4).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe sex ratios (male/female) of parasitoid adults emerging from adult female \u003cem\u003eD. boisduvalii\u003c/em\u003e exhibited notable variation between parasitoid species. Only 15% of the emerging \u003cem\u003eCoccobius\u003c/em\u003e sp. were male, signifying a highly skewed sex ratio towards females. \u003cem\u003ePlagiomerus peruviensis\u003c/em\u003e displayed an extremely low sex ratio, with just 1% of the emerging adults being male. In contrast, \u003cem\u003eAphytis\u003c/em\u003e sp. exhibited a higher proportion of males, with a sex ratio of 27% males, and \u003cem\u003eAblerus\u003c/em\u003e sp. displayed a balanced sex ratio, with 1.06 males for every female (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eInsecticides remain the most common pest management tool globally (Guedes et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). These compounds are applied in the environment to reduce target species populations, either by increasing mortality or decreasing fecundity (Guedes et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; S\u0026aacute;nchez-Bayo \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The predominant method of banana cultivation in Costa Rica is through an agricultural monocrop system and depends on extensive use of synthetic pesticides that impact ecosystems (Br\u0026uuml;hl et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In order to control pest populations such as \u003cem\u003eD. boisduvalii\u003c/em\u003e and other banana pests, insecticides are commonly employed. This is done by using polyethylene bags to cover the banana fruit during its growth, these bags being impregnated with a mixture of insecticides, or by applying insecticides at ground level. In many cases, both methods are utilized. Additionally, at least two applications of insecticides or nematicides are used annually to regularly control nematode populations in almost all banana plantations (Polidoro et al \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Pesticides have adverse effects on living organisms, particularly impacting non-target species such as natural enemies of insect pests (Theiling and Croft \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e1988\u003c/span\u003e; Guedes et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Schmidt-Jeffris \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This effect was dramatically observed in this study, where the intensity of insecticide use significantly affected the percent parasitism of \u003cem\u003eD. boisduvalii\u003c/em\u003e; parasitism varied from 24.94\u0026ndash;11.35% in sites with low and high insecticide use, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Appendix: Table S1).\u003c/p\u003e \u003cp\u003eInsecticides are the most toxic pesticides to natural enemies, followed by herbicides (Theiling and Croft \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e1988\u003c/span\u003e). As mentioned above, insecticides negatively affected all parasitoids of \u003cem\u003eD. boisduvalii\u003c/em\u003e, which was expected. However, the species-specific response among \u003cem\u003eD. boisduvalii\u003c/em\u003e parasitoids in relation to herbicide use (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Appendix: Table S4) was quite unexpected and is diffiucult to explain. Both \u003cem\u003ePlagiomerus\u003c/em\u003e and \u003cem\u003eCoccobius\u003c/em\u003e are koinobiont endoparasitoids, and therefore presumably pro-ovigenic and relatively short-lived. These two parasitoids might thus be expected to respond similarly to herbicides, which was not the case. Perhaps \u003cem\u003ePlagiomerus\u003c/em\u003e is less affected by herbicides due to differences in its physiology or behavior, and its scarcity in herbicide-free plantations is simply an artifact. Interspecific competition can play a role in shaping community structure of parasitoids (Cusumano et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), but it seems unlikely that this explains the results for \u003cem\u003ePlagiomerus\u003c/em\u003e given the relatively low levels of parasitism.\u003c/p\u003e \u003cp\u003eIn addition to their toxic effects, herbicides also have indirect effects by reducing the diversity of nectar resources upon which adult parasitoids depend (Shaw \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; W\u0026auml;ckers et al. 2008; Snart et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zaviezo and Mu\u0026ntilde;oz \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Mealybugs (Hemiptera: Pseudococcidae) are present in Costa Rican banana plantations (Palma-Jim\u0026eacute;nez et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and honeydew from these insects could possibly serve as a sugar source for \u003cem\u003ePlagiomerus\u003c/em\u003e in environments where associated plants are scarce, such as those where herbicides were used for weed management (W\u0026auml;ckers et al. 2008; Neerbos et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eParasitoids of \u003cem\u003eD. boisduvalii\u003c/em\u003e in banana plantations showed strikingly different sex ratios (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In the vast majority of Hymenoptera males develop from unfertilized (haploid) eggs, a phenomenom known as arrhenotokous parthenogenesis, while females develop from fertilized (diploid) eggs. The relatively low proportion of males in \u003cem\u003eAphytis\u003c/em\u003e sp. and \u003cem\u003eCoccobius\u003c/em\u003e sp. might indicate the existence of local mate competion, whereby mating occurs between siblings prior to dispersal (Hamilton \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1967\u003c/span\u003e). However, further investigation is required to test this possibility. On the other hand, the near absence of males in \u003cem\u003eP. peruviensis\u003c/em\u003e suggests the existence of thelytokous parthenogensis, i.e. unmated females producing only daughters. The bacterial symbiont \u003cem\u003eCardinum\u003c/em\u003e has previously been implicated in thelytokous parthenogenesis in another species of \u003cem\u003ePlagiomerus\u003c/em\u003e (Matalon et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2007\u003c/span\u003e), and it would be interesting to examine whether this is also the case in \u003cem\u003eP. peruviensis\u003c/em\u003e. Whether thelytokoy could explain the better performance of \u003cem\u003eP. peruviensis\u003c/em\u003e in environments with herbicides is an open question.\u003c/p\u003e \u003cp\u003eIn conclusion, our study revealed a significant impact of insecticides on the parasitoids of \u003cem\u003eD. boisduvalii\u003c/em\u003e in Costa Rican banana plantations as well as species-specific responses of the parasitoid species with respect to herbicide use. The latter result was surprising and further research is required to determine if indeed \u003cem\u003eP. peruviensis\u003c/em\u003e is less affected by herbicide use than are \u003cem\u003eAphytis\u003c/em\u003e sp. and \u003cem\u003eCoccobius\u003c/em\u003e sp. If this finding is confirmed, there remains the interesting question of what factors or mechanisms underlie the different susceptibilities to herbicides. It is also important to explore interactions between mealybugs, \u003cem\u003eD. boisduvalii\u003c/em\u003e and parasitoid populations, as well as the influence of plant community composition. Studying the selectivity of each pesticide used in banana plantations to parasitoids is crucial for preserving natural enemies. Mitigating nontarget effects of pesticides and increasing vegetation diversity within banana agroecosystems are essential for the success of biological control and conservation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAuthor contribution\u003c/p\u003e\n\u003cp\u003eAll authors conceived and designed the research. MSG and CG conducted the research. PH contributed with insect identification. MSG carried out data analysis. MSG and PH wrote the manuscript. All authors reviewed and approved the manuscript.\u003c/p\u003e\n\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eThe authors thank Marcos Rojas, Julio Rodr\u0026iacute;guez and Pedro \u0026Aacute;vila for their help with field work. Authors also thank Miguel Gonz\u0026aacute;lez and Jorge Sandoval from the Corporaci\u0026oacute;n Bananera Nacional de Costa Rica (CORBANA) for their support so that the research could be carried out.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work was fully funded by the Corporaci\u0026oacute;n Bananera Nacional de Costa Rica (CORBANA), Department of Entomology.\u003c/p\u003e\n\u003cp\u003eData Availability\u003c/p\u003e\n\u003cp\u003eThe dataset and code generated in this study are available from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbd-Rabou S, Ahmed N, Evans GA (2014)\u003cem\u003e Encarsia\u003c/em\u003e Forester [\u003cem\u003esic\u003c/em\u003e] (Hymenoptera: Aphelinidae) - Effective parasitoids of armored scale insects (Hemiptera: Diaspididae) in Egypt. Acta Zool Bulg 6:7-12.\u003c/li\u003e\n\u003cli\u003eAbell KJ, Van Driesche RG (2012) Impact of latitude on synchrony of a scale (\u003cem\u003eFiorinia externa\u003c/em\u003e) (Hemiptera: Diaspididae) and its parasitoid (\u003cem\u003eEncarsia citrina\u003c/em\u003e) (Hymenoptera: Aphelinidae) in the Eastern United States. Biol Control 63(3):339-347. https://doi.org/10.1016/j.biocontrol.2012.09.009 \u003c/li\u003e\n\u003cli\u003eAmouroux P, Crochard D, Correa M, Groussier G, Kreiter P, Roman C, Zaviezo T (2019) Natural enemies of armored scales (Hemiptera: Diaspididae) and soft scales (Hemiptera: Coccidae) in Chile: Molecular and morphological identification. PLoS One 14(3):e0205475. https://doi.org/10.1371/journal.pone.0205475 \u003c/li\u003e\n\u003cli\u003eBarraza D, Jansen K, de Joode BVW, Wesseling C (2011) Pesticide use in banana and plantain production and risk perception among local actors in Talamanca, Costa Rica. Environ Res 111(5):708-717. https://doi.org/10.1016/j.envres.2011.02.009 \u003c/li\u003e\n\u003cli\u003eBegg GS, Cook SM, Dye R et al (2017) A functional overview of conservation biological control. Crop Protection 97:145-158. https://doi.org/10.1016/j.cropro.2016.11.008 \u003c/li\u003e\n\u003cli\u003eBrandfass C, Karlovsky P (2008) Upscaled CTAB-based DNA extraction and realtime PCR assays for \u003cem\u003eFusarium culmorum\u003c/em\u003e and \u003cem\u003eF. graminearum\u003c/em\u003e DNA in plant material with reduced sampling error. Int J Mol Sci 9(11):2306-2321. https://doi.org/10.3390/ijms9112306 \u003c/li\u003e\n\u003cli\u003eBravo Dur\u0026aacute;n V, de la Cruz Malavassi E, Herrera Ledezma G, Ram\u0026iacute;rez Mu\u0026ntilde;oz F (2013) Uso de plaguicidas en cultivos agr\u0026iacute;colas como herramienta para el monitoreo de peligros en salud. Uniciencia, 27(1):351-376.\u003c/li\u003e\n\u003cli\u003eBr\u0026uuml;hl CA, Arias Andres M, Echeverr\u0026iacute;a-S\u0026aacute;enz S, Bundschuh M, Kn\u0026auml;bel A, Mena F, Petschick LL, Ruepert C, Stehle S (2023) Pesticide use in banana plantations in Costa Rica \u0026ndash; A review of environmental and human exposure, effects and potential risks. Environ Int 174:107877. https://doi.org/10.1016/j.envint.2023.107877 \u003c/li\u003e\n\u003cli\u003eCusumano A, Peri E, Colazza S (2016) Interspecific competition/facilitation among insect parasitoids. Curr Opin Insect Sci 14:12-16. https://doi.org/10.1016/j.cois.2015.11.006 \u003c/li\u003e\n\u003cli\u003eDe Bellaire LDL, Four\u0026eacute; E, Abadie C, Carlier J (2010) Black Leaf Streak Disease is challenging the banana industry. Fruits 65(6):327-342. https://doi.org/10.1051/fruits/2010034 \u003c/li\u003e\n\u003cli\u003eDhaliwal GS, Arora R (2001) Integrated Pest Management: Concepts and Approaches. Kalyani Publishers, New Delhi\u003c/li\u003e\n\u003cli\u003eEvans GA, Dooley JW (2013) Potential invasive species of scale insects for the USA and Caribbean Basin. In: Pe\u0026ntilde;a JE. (eds). Potential invasive pests of agricultural crops (vol. 3). CABI Publishing, Oxford, pp. 320-341.\u003c/li\u003e\n\u003cli\u003eGuedes RNC, Smagghe G, Stark JD, Desneux N (2016) Pesticide-induced stress in arthropod pests for optimized Integrated Pest Management programs. Annu Rev Entomol 61:43-62 https://doi.org/10.1146/annurev-ento-010715-023646\u003c/li\u003e\n\u003cli\u003eGuill\u0026eacute;n C, Laprade S (2016) Manejo y combate de la escama del banano (\u003cem\u003eDiaspis boisduvalii\u003c/em\u003e). CORBANA. Hoja divulgativa N\u0026ordm; 9-2016. https://www.corbana.co.cr/wp-content/uploads/HD-n.%C2%B0-9-2016-Manejo-escamas.pdf \u003c/li\u003e\n\u003cli\u003eGuill\u0026eacute;n C, Rodr\u0026iacute;guez A, Laprade S, Valle H, Segura R, Uva V, Sandoval J (2010) Biolog\u0026iacute;a y control de las cochinillas y escamas que atacan al banano. CORBANA. Hoja divulgativa N\u0026ordm; 5-2010. https://www.corbana.co.cr/wp-content/uploads/HD-n.%C2%B0-4-2013-Biolog%C3%ADa-y-control-escamas.pdf \u003c/li\u003e\n\u003cli\u003eGraves S, Piepho H, Selzer L, Dorai-Raj LS (2019). multcompView: Visualizations of Paired Comparisons. R package version 0.1-8, https://CRAN.R-project.org/package=multcompView.\u003c/li\u003e\n\u003cli\u003eHamilton WD (1967) Extraordinary sex ratios. Science 156:477-488. https://doi: 10.1126/science.156.3774.477\u003c/li\u003e\n\u003cli\u003eHanson PE (1995) The Chalcidoid families: Aphelinidae. In: Hanson PE, Gauld ID (eds.), The Hymenoptera of Costa Rica. Oxford University Press, Oxford, pp 282-289\u003c/li\u003e\n\u003cli\u003eHoward FW (2001) Sap-feeders on palms. In: Howard FW, Moore D, Giblin-Davis RM, Abad RG (eds) Insects on palms. CABI Publishing, Oxford, pp 109-232.\u003c/li\u003e\n\u003cli\u003eHunter MS, Wolley JB (2001) Evolution and behavioral ecology of heteronomous aphelinid parasitoids. Annu Rev Entomol 46(1):251-290. https://doi.org/10.1146/annurev.ento.46.1.251 \u003c/li\u003e\n\u003cli\u003eKoul O, Dhaliwal GS (2003) Predators and parasitoids, an introduction. In: Koul O, Dhaliwal GS (eds) Predators and Parasitoids, 1st edn. Taylor \u0026amp; Francis, London, pp 1-15. https://doi.org/10.4324/9780203302569\u003c/li\u003e\n\u003cli\u003eLenth R (2022). emmeans: Estimated Marginal Means, aka Least-Squares Means. R package version 1.7.5. https://CRAN.R-project.org/package=emmeans.\u003c/li\u003e\n\u003cli\u003eMalumphy, C (2015) Arthropods intercepted on fresh pineapple fruit, \u003cem\u003eAnanas comosus\u003c/em\u003e (L.) Merr. imported into England and Wales. Entomol Gaz 66:65\u0026ndash;75. \u003c/li\u003e\n\u003cli\u003eMangiafico SS (2021) Summary and Analysis of Extension Program Evaluation in R, version 1.20.01. Rutgers Cooperative Extension, New Brunswick rcompanion.org/documents/RHandbookProgramEvaluation.pdf \u003c/li\u003e\n\u003cli\u003eMatalon Y, Katzir N, Gottlieb Y, Portnoy V, Zchori-Fein E (2007) \u003cem\u003eCardinium\u003c/em\u003e in \u003cem\u003ePlagiomerus diaspidis \u003c/em\u003e(Hymenoptera: Encyrtidae). J Invertebr Pathol 96(2):106-108. https://doi.org/10.1016/j.jip.2007.02.010 \u003c/li\u003e\n\u003cli\u003eMauchline N, Hallett I, Hill G, Casonato S (2011) Process of infection of armored scale insects (Diaspididae) by an entomopathogenic \u003cem\u003eCosmospora\u003c/em\u003e sp. J Invertebr Pathol 108(1):46-51. https://doi.org/10.1016/j.jip.2011.07.002\u003c/li\u003e\n\u003cli\u003eMiller DR, Davidson JA (2005) Armored scale insect pests of trees and shrubs (Hemiptera: Diaspididae). Cornell University Press, Ithaca\u003c/li\u003e\n\u003cli\u003eMorse GE, Normark BB (2006) A molecular phylogenetic study of armoured scale insects (Hemiptera: Diaspididae). Syst Entomol 31(2):338-349. https://doi.org/10.1111/j.1365-3113.2005.00316.x \u003c/li\u003e\n\u003cli\u003eNoyes JS (1980) A review of the genera of Neotropical Encyrtidae (Hymenoptera: Chalcidoidea). Bull Nat Hist Mus Entomol ser 41:107-253.\u003c/li\u003e\n\u003cli\u003eNoyes JS (2023) Encyrtidae of Costa Rica (Hymenoptera: Chalcidoidea), 4. Taxon Monogr Neotrop Hymenop 2:1-921.\u003c/li\u003e\n\u003cli\u003eNormark BB, Okusu A, Morse GE, Peterson DA, Itioka, T, Schneider SA (2019) Phylogeny and classification of armored scale insects (Hemiptera: Coccomorpha: Diaspididae). Zootaxa 4616(1):1-98. https://doi.org/10.11646/zootaxa.4616.1.1 \u003c/li\u003e\n\u003cli\u003eOuvrard D, Kondo T, Gullan PJ (2013) Scale insects: Major pests and management. In: Encyclopedia of Pest Management. Taylor and Francis, New York, pp 1\u0026ndash;4.\u003c/li\u003e\n\u003cli\u003ePalma-Jim\u0026eacute;nez M, Blanco-Meneses M, Guill\u0026eacute;n-S\u0026aacute;nchez C (2019) Las cochinillas harinosas (Hemiptera: Pseudococcidae) y su impacto en el cultivo de Mus\u0026aacute;ceas. Agron Mesoam 30(1):281-298 https://doi.org/10.15517/am.v30i1.32600 \u003c/li\u003e\n\u003cli\u003ePolidoro BA, Dahlquist RM, Castillo LE, Morra MJ, Somarriba E, Bosque-P\u0026eacute;rez NA (2008) Pesticide application practices, pest knowledge, and cost-benefits of plantain production in the Bribri-Cab\u0026eacute;car Indigenous Territories, Costa Rica. Environ Res 108(1):98-106 https://doi.org/10.1016/j.envres.2008.04.003 \u003c/li\u003e\n\u003cli\u003eR Core Team (2021) R: a language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. Retrieved from http:// www.R-project.org \u003c/li\u003e\n\u003cli\u003eRamos ASDJC, de Lemos RNS, Costa VA, Peronti ALBG, da Silva EA, Mondego JM, Moreira AA (2018) Hymenopteran parasitoids associated with scale insects (Hemiptera: Coccoidea) in tropical fruit trees in the eastern Amazon, Brazil. Fla Entomol 101(2):273-278. https://doi.org/10.1653/024.101.0219 \u003c/li\u003e\n\u003cli\u003eRaupp, MJ, Holmes JJ, Sadof C, Shrewsbury P, Davidson JA (2001) Effects of cover sprays and residual pesticides on scale insects and natural enemies in urban forests. J. arboric 27(4):203-214. \u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez-Bayo F (2021) Indirect effect of pesticides on insects and other arthropods. Toxics 9(8): 177. https://doi.org/10.3390/toxics9080177 \u003c/li\u003e\n\u003cli\u003eSchmidt-Jeffris RA (2023) Nontarget pesticide impacts on pest natural enemies: progress and gaps in current knowledge. Curr Opin Insect Sci 58:101056. https://doi.org/10.1016/j.cois.2023.101056 \u003c/li\u003e\n\u003cli\u003eSchmidt S, Polaszek A (2007) The Australian species of \u003cem\u003eEncarsia \u003c/em\u003eF\u0026ouml;rster (Hymenoptera, Chalcidoidea: Aphelinidae), parasitoids of whiteflies (Hemiptera, Sternorrhyncha, Aleyrodidae) and armoured scale insects (Hemiptera, Coccoidea: Diaspididae). J Nat Hist 41(33-36):2099-2265. https://doi.org/10.1080/00222930701550766 \u003c/li\u003e\n\u003cli\u003eShaw MR (2006) Habitat considerations for parasitic wasps (Hymenoptera). J Insect Conserv 10:117-127. https://doi.org/10.1007/s10841-006-6288-1 \u003c/li\u003e\n\u003cli\u003eSnart CJ, Kapranas A, Williams H, Barrett DA, Hardy IC (2018) Sustenance and performance: nutritional reserves, longevity, and contest outcomes of fed and starved adult parasitoid wasps. Front Ecol Evol 6:12. https://doi.org/10.3389/fevo.2018.00012 \u003c/li\u003e\n\u003cli\u003eSolano-Guti\u0026eacute;rrez M, Guillen C, Conejo AM (2019) Identificaci\u0026oacute;n y aspectos biol\u0026oacute;gicos de estadios inmaduros de \u003cem\u003eCeraeochrysa\u003c/em\u003e spp. (Neuroptera: Chrysopidae) depredador de la escama \u003cem\u003eDiaspis boisduvalii\u003c/em\u003e (Hemiptera: Diaspididae) en banano. Corbana 45(65):123-130\u003c/li\u003e\n\u003cli\u003eTheiling KM, Croft BA (1988). Pesticide side-effects on arthropod natural enemies: a database summary. Agric Ecosyst Environ 21(3-4):191-218 https://doi.org/10.1016/0167-8809(88)90088-6 \u003c/li\u003e\n\u003cli\u003evan Neerbos FAC, de Boer JG, Salis L, Tollenaar W, Kos M, Vet LEM, Harvey JA (2019) Honeydew composition and its effect on life-history parameters of hyperparasitoids. Ecol Entomol 45:278\u0026ndash;289. https://doi.org/10.1111/een.12799 \u003c/li\u003e\n\u003cli\u003eW\u0026auml;ckers Fl, van Rijn PCJ, Heimpel GE (2008) Honeydew as a food source for natural enemies: Making the best of a bad meal?. Biol Control 45(2):176-184\u003c/li\u003e\n\u003cli\u003eWiese C, Amalin D, Coe R, Mannion C (2005) Effects of the parasitic wasp \u003cem\u003eCoccobius fulvus\u003c/em\u003e on cycad aulacaspis scale, \u003cem\u003eAulacaspis yasumatsui\u003c/em\u003e, at Montgomery Botanical Center, Miami, Florida. Proc Fla State Hort Soc 118:319-321.\u003c/li\u003e\n\u003cli\u003eXiao Y, Mao R, Singleton L, Arthurs S (2016) Evaluation of reduced-risk insecticides for armored scales (Hemiptera: Diaspididae) infesting ornamental plants. J Agric Urban Entomol 32(1):71-90. https://doi.org/10.3954/JAUE16-07.1 \u003c/li\u003e\n\u003cli\u003eZaviezo T, Mu\u0026ntilde;oz AE (2023) Conservation biological control of arthropod pests using native plants. Curr Opin Insect Sci 56:101022 https://doi.org/10.1016/j.cois.2023.101022 \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"banana cultivation, biological control, weed management, Aphytis, Coccobius, Plagiomerus","lastPublishedDoi":"10.21203/rs.3.rs-3838716/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3838716/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eArmored scale insects (Hemiptera: Diaspididae) have been identified as pests worldwide. In Costa Rica, various armored scale insects are economically important in the production of agricultural and horticultural products for exportation. \u003cem\u003eDiaspis boisduvalii\u003c/em\u003e Signoret is a primary insect pest in banana plantations, causing substantial economic losses and high control costs. In order to determine the effect of insecticide and herbicide use on percent parasitism of \u003cem\u003eD. boisduvalii\u003c/em\u003e on banana (\u003cem\u003eMusa\u003c/em\u003e AAA “Cavendish”) in Costa Rica, six commercial plantations with varying insecticide and herbicide use were sampled over a five-month period. Pseudopetioles from the oldest pseudoleaf of banana plants infested with scale insects were collected monthly at each site. Each pseudopetiole fragment (55 cm\u003csup\u003e2\u003c/sup\u003e) was stored in a well-ventilated glass tube and monitored daily for parasitoid emergence, percent parasitism, and sex ratio. Four parasitoid species from two families were identified. A gregarious ectoparasitoid \u003cem\u003eAphytis\u003c/em\u003e sp., a solitary endoparasitoid \u003cem\u003eCoccobius\u003c/em\u003e sp. and a very rare hyperparasitoid \u003cem\u003eAblerus\u003c/em\u003e sp. (Aphelinidae), and a solitary endoparasitoid \u003cem\u003ePlagiomerus peruviensis\u003c/em\u003e (Girault) (Encyrtidae). The study revealed a significant negative impact of insecticides (\u003cem\u003ep\u003c/em\u003e \u0026lt; .001), but species-specific responses to herbicides. Rather suprisingly, \u003cem\u003eP.\u003c/em\u003e \u003cem\u003eperuviensis \u003c/em\u003eshowed a higher percent parasitism in plantations with herbicides than without herbicides, unlike the other parasitoids. Results from sex ratios suggest that \u003cem\u003eP. peruviensis\u003c/em\u003e reproduces via thelytokous parthenogenesis.\u003c/p\u003e","manuscriptTitle":"Responses of Parasitoids (Hymenoptera) of Diaspis boisduvalii (Hemiptera: Diaspididae) to Insecticides and Herbicides in Costa Rican banana plantations.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-11 16:04:55","doi":"10.21203/rs.3.rs-3838716/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"875e5b62-b51d-4239-82d3-fe1ea9225b68","owner":[],"postedDate":"January 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-26T09:20:49+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-11 16:04:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3838716","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3838716","identity":"rs-3838716","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}