Uncovering the Unexpected Role of Proteasome Activator PA200 in Regulating Immunoproteasome Expression and Activity

Uncovering the Unexpected Role of Proteasome Activator PA200 in Regulating Immunoproteasome Expression and Activity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Uncovering the Unexpected Role of Proteasome Activator PA200 in Regulating Immunoproteasome Expression and Activity Marie Pierre Bousquet, Dušan Živković, Fatme Mourtada, Angelique Dafun, and 15 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6620945/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract The proteasome activator PA200 binds to the catalytic core of both standard proteasome (s20S) and the immunoproteasome (i20S); however, whether PA200 uses the same mechanisms to activate i20S remains unknown. Our cryo-EM structures of the singly- and doubly-capped i20S-PA200 complexes and in vitro assays revealed that binding of the first PA200 induces an allosteric widening of the opposite unbound α-ring, resulting in a higher binding occupancy of the i20S and its stronger activation compared to the s20S. We also showed that in cells and tissues that express PA200, s20S and i20S, PA200 interacts preferably with i20S. Intriguingly, the expression of PA200 and the catalytic subunits of the i20S are differentially regulated, with PA200 playing a potential role in controlling the i20S subunits’ expression. This suggests that i20S function is fine-tuned by differential expression of PA200, and reveals an additional layer of i20S regulation. Biological sciences/Biochemistry/Structural biology/Electron microscopy/Cryoelectron microscopy Biological sciences/Biochemistry/Proteolysis/Proteasome Biological sciences/Biochemistry/Proteomics/Protein–protein interaction networks Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The proteasome is a large macromolecular machinery that facilitates regulated proteolysis of protein substrates in the cell. It plays an essential role in maintaining protein homeostasis by degrading proteins that are either damaged or no longer needed by the cell. Additionally, the peptides generated by the proteolytic activity of the proteasome are also used as antigens for presentation on major histocompatibility complex (MHC) class I molecules to the immune system, i.e. CD8 T cells 1 . The proteome is composed of the catalytic core particle, i.e. the 20S proteasome, and a large number of associated proteasome regulators 2 . As such, the proteasome actually represents a family of distinct complexes that rapidly assemble and re-assemble to fine-tune protein degradation according to cellular needs 3 . The 20S proteasome is a barrel-shaped protease composed of two outer α and two inner β rings of seven subunits each 4 . Three of the seven β subunits form the active sites containing N-terminal threonine residues as active centers. These β1, β2, and β5 subunits of the standard 20S (s20S) proteasome possess caspase-like (C-L), trypsin-like (T-L), and chymotrypsin-like (CT-L) activities cleaving proteins after acidic, basic and hydrophobic amino acids, respectively 4 . In addition to the β1, β2, and β5 subunits, proteasomes can also contain an alternative set of catalytic subunits (β1i, β2i, β5i) resulting in formation of a distinct form of the proteasome called the immunoproteasome (i20S) 5 . In general, expression of β1i, β2i, β5i is induced upon viral infection or inflammatory signaling, and i20S plays an important role in anti-viral and anti-cancer immune responses 5 . In immune cells, the i20S is the predominant form of the proteasome 6,7 . The 20S core particle also binds to proteasome regulators, including the predominant 19S regulatory particle 8,9 , PA28αβ, PA28γ, and PA200 (also known as PSME4) 5 . While the cellular function of 19S, PA28αβ and PA28γ are well studied 3 , the function of PA200 is still enigmatic 10 . Accumulating evidence indicates that the cellular function of PA200 appears to be cell type and differentiation specific, and includes roles in DNA damage repair, chromatin remodeling 15–17 , aging 18 , differentiation 19 , and mitochondrial and protein stress responses 13,20–22 . PA200 exerts these effects by engaging the 20S catalytic core either on one side or on both sides forming singly- or doubly-capped 20S proteasome complexes 11,12 , as well as by binding to the free end of the 26S proteasome complex 13 . In all cases, PA200 binding results in activation of proteasome activity, although mechanism of activation remains unclear 11,14 . Recently, we and others have demonstrated that PA200 binds the i20S. This binding appears to play an important role in abrogating antitumor immunity in lung cancer by modulating i20S activity and the antigen diversity generated through i20S proteolysis 14 . However, the mechanisms that govern these effects, as well as molecular determinants of PA200 interactions with i20S remain unknow. Here, we investigated the interplay of PA200 and the immunoproteasome by combining structural analysis of i20S-PA200 complexes with biochemical and cellular analyses. We solved cryoEM structures of the i20S singly or doubly-capped by PA200, and observed that binding of the first PA200 molecule induces major structural rearrangements in i20S that result in enhanced formation of doubly-capped i20S–PA200 complex and increased activation. This represents a unique feature of the i20S-PA200 interactions as these large conformational changes were not observed in previous s20S-PA200 studies 11,12 . By analyzing cellular and tissue data, we discovered that regulation of the expression of PA200 and the catalytic subunits of the i20S depends on the cellular context. Furthermore, our data also suggest that PA200 regulates i20S gene expression, and thereby proteasome composition. Results Structural analysis of immunoproteasome-PA200 complexes We obtained high resolution structures for both singly- and doubly-capped i20S-PA200 complexes (2.85 Å and 2.89 Å resolution, respectively). Although the doubly-capped structure of the i20S-PA200 complex is similar to s20S-PA200 11,12,23 (Fig. 1 A, see Figure S1 for details on 3D classification), the structure shows a remarkable “bend” of the entire complex (Fig. 1 B-C) which has not been documented in proteasome structures before. The bend propagates from the “top” PA200 molecule, which is superimposed with the corresponding PA200 in recently solved s20S-PA200 structure (6REY.pdb) with minimal Root Mean Square Deviation (RMSD ~ 1.7 Å; Fig. 1 B). From that region, the structure of i20S-PA200 begins to “bend”, as indicated by the gradual increase in calculated RMSDs to its maximal value in the “bottom” PA200 (RMSD ~ 6.8 Å; Fig. 1 B). Thus, in the i20S-PA200 complex the entire axes of the complex bends when compared to s20S-PA200, resulting in major shift of the opposite unbound α-ring (Fig. 1 C). Importantly, the same structural shifting/tilting behavior was evident in singly-capped i20S-PA200 structures (Fig. 2 A and S2A-C), implying that binding of the first PA200 molecule is sufficient to induce this long-range allosteric change that is not further affected by the second PA200 binding event. PA200 binding to the “top” of i20S results in allosteric displacement of α-ring subunits at the opposing end of the i20S, as seen by comparing the previously reported structure of apo i20S and the i20S in our complex bound to a single PA200 molecule (Fig. 2 A). In contrast, the same comparison of the apo s20S and s20S bound to a single PA200 regulator shows almost perfect overlay (Fig. 2 B), indicating that the bending behavior is unique to i20S. Of note, we detected two molecules of inositol hexakisphosphates (IP6, phytic acid) binding to the positively charged grooves of PA200 (Figure S3), whereas previous structures of s20S-PA200 identified both IP6 and (5,6)-bisdiphosphoinositol tetrakisphosphate (5,6[PP]2-IP4) 11 , 12 , 23 . The exact role of this binding remains unclear. Proteasome activators typically bind to the α subunits of the 20S core to open the inner channel enabling substrate access. The i20S-PA200 complex shows a degree of channel opening comparable to that of the s20S-PA200 (28–32 Å; Fig. 2 C-D), which, as expected, is significantly higher than that of the apo s20S and i20S complexes, but remarkably larger than that of the only partially open s20S-PA28αβ 23 and i20S-PA28αβ 24 complexes (9–10 Å). This indicates that PA200 opens the gate of the s20S and i20S particles to a wider extent than PA28αβ. Detailed analysis of the catalytic sites also revealed significant differences when comparing the structures of the i20S and i20S-PA200 complexes (Fig. 2 E). In addition to subtle structural rearrangements within active sites of all three catalytic subunits (β1i, β2i, β5i), we also observed clear changes in electrostatics (Fig. 2 E) suggesting that PA200 binding induces long distance structural changes that ultimately result in changes is catalytic activity. Taken together, our high resolution cryo-EM structures of singly- and doubly-capped i20S-PA200 complexes showed that binding of a single PA200 induces long-range conformational changes that are transmitted across the entire i20S. These changes were not previously seen in s20S, suggesting that this represents i20S-specific behavior. Lastly, we hypothesize that the long-distance conformational changes triggered by the first PA200 molecule binding facilitate engagement of the second PA200 molecule, leading to enhanced occupancy. In parallel, PA200 binding introduces subtle changes in structure and electrostatics within the three active site. Together, these effects – enhanced occupancy and active site modulation – are likely to synergize, resulting in increased catalytic activity. PA200 binds and activates the i20S more efficiently than the s20S To examine PA200 binding to i20S further and compare it to s20S, we used mass photometry, a method that measures molecular weights of single molecules (> 40 kDa) in solution at nM concentrations 26 , 27 . For that, purified human i20S and s20S were incubated for 2 h with increasing amounts of recombinantly expressed and purified human PA200 at increasing PA200:20S molar ratios from 0 to 12. We detected free 20S, singly-capped and doubly-capped proteasome complexes (Fig. 3 A). As expected, the total occupancy of the 20S increased with the PA200 to 20S ratio. We observed a higher occupancy of the i20S by PA200, compared to the s20S (Fig. 3 B). This titration allowed us to estimate the K d s for PA200 binding to the i20S and the s20S (20–30 nM for the first binding event, and 40–60 nM for the second binding event; Figure S4). We next determined the activation of i20S vs. s20S by PA200 using fluorogenic peptides for the three active sites. Activities were determined for in vitro complexes at increasing PA200:20S molar ratios (ranging from 0 to 8). As expected from our mass photometry data, binding of PA200 to the i20S resulted in the activation of the three main types of 20S proteolytic activities, namely the CT-L, T-L, and C-L. In particular, the PA200-bound i20S was significantly more active towards CT-L and T-L sites than the PA200-capped s20S (Fig. 4). Moreover, while the baseline CT-L and T-L activities of the i20S and s20S were similar, the i20S showed very low C-L activity compared to the s20S (Fig. 4A), in line with published data 28 . It was suggested that the IP6 and 5,6[PP]2-IP4 identified in the s20S-PA200 structures could be involved in regulating the activity of PA200 10–12 . In order to test this hypothesis, we assessed the effect of phytic acid on the activity of the i20S and s20S in the presence and absence of PA200 using different fluorogenic substrates specific for the distinct active sites in an in vitro substrate assay 9 , 29 . Despite a slight but significant decrease of the CT-L activity (LLVY substrate) for both 20S subtypes, our results show a strong increase of the three activities that are specific of the i20S, namely β1i (PAL), β2i (LRR) and β5i (ANW), in the presence of IP6 (Figs. 4B-C). Our in vitro binding studies and activity assays, further support our conclusion that binding of the first PA200 induces an allosteric widening of the opposite unbound α-ring, resulting in a higher binding occupancy of the i20S compared to the s20S. This results in a more efficient and stronger activation of all three active sites compared to the s20S, and more specifically of the CT-L and T-L activities that favor the generation of MHC-I antigenic peptides 30 , 31 . Enriched binding of i20S to PA200 in tissues To examine whether PA200 preferentially engages i20S over s20S in cells and tissues, we examined our previously generated dataset from bovine testes (PXD027436) 29 that displays high levels of PA200 expression. Our interactome analysis of immunoprecipitated PA200 from bovine testes demonstrated enriched incorporation of the i20S subunits PSMB8-10 (Fig. 5 A, in blue) compared to their s20S counterpart subunits PSMB5-7 (Fig. 5 A, in yellow) into PA200-containing proteasome complexes. We confirmed enriched assembly of i20S with PA200 by comparing our PA200-pulldown data with an interactome obtained upon immunoprecipitation with an anti-α2 antibody that binds to an α subunit of the 20S proteasome and thereby pulls down all proteasome complexes within the tissue 9 , 32 . As shown in Fig. 5 B, the ratios of the i20S/s20S catalytic subunits were significantly higher in the anti-PA200-coIP compared to the anti-α2-coIP samples. Given the fact that the anti-α2 antibody captures all 20S-containing proteasome complexes 32 , these data confirm that PA200 preferentially binds to the i20S compared to the s20S, which is fully in line with our in vitro data on structural interactions and activation presented above. Regulation of i20S-PA200 interaction on the cellular level Under physiological conditions, the expression patterns of PA200 and the i20S seem to be distinct. More specifically, PA200 (PSME4) is highly expressed in adult and fetal reproductive organs such as ovaries and testes 33 , while the i20S subunits are abundantly expressed in immune cells such as monocytes, CD4, CD8, and natural killer (NK) cells (Figure S5). Therefore, we examined relationships between PA200 and i20S subunits’ expression and their regulation. To analyze the regulation of the i20S under conditions of PA200 induction, we used primary human lung fibroblasts (phLF) that were treated with TGF-β1 to upregulate PA200 19 . Vice versa , we investigated PA200 regulation under conditions of i20S activation in interferon gamma (IFNγ) stimulated phLF and upon infection of murine bone-marrow derived macrophages with Mycobacterium tuberculosis ( Mtb ) 34 . On the RNA level, TGF-β1 treatment upregulated PA200 in several primary lung fibroblast (phLF) lines but uniformly downregulated the three i20S catalytic subunits PSMB8-10 (Fig. 6 A). Elevated incorporation of PA200 reduced assembly of i20S subunits which was confirmed by an interactome analysis of TGF-β1-treated phLFs compared to untreated controls (Figs. 6 B-C), using the anti-α2 antibody for pulldown of all crosslinked proteasome complexes. phLFs were also stimulated with IFNγ, resulting in the upregulation of the i20S, as indicated by a significant increase in PSMB8-10 expression, but without any impact on PA200 mRNA levels as determined by RTqPCR (Fig. 6 D). Similarly, Mtb infected mouse macrophages strongly upregulated the i20S subunits PSMB8-10 but did not alter PA200 RNA expression (Fig. 6 E). These data support the notion that PA200 and the i20S are differentially regulated under conditions of differentiation, cytokine treatment and infection. Regulation of PA200 by the immunoproteasome and vice versa Given the differences in expression patterns, we wondered whether PA200 itself is involved in the regulation of the i20S and vice versa . To probe these questions, we used PA200 knockout (KO) human lung cancer cell lines A549 and H1299 27 . Genetic depletion of PA200 in A549 and H1299 reduced expression of the β1i catalytic subunit (PSMB9 gene) in both its pre-mature and mature forms (Figs. 7 A-B). These data were confirmed upon pulldown of 20S complexes using the anti-α2 antibody and interactome analysis demonstrating that the absence of PA200 impairs the assembly of β1i containing i20S complexes (Figure S6A). This resulted in an altered cellular composition of 20S complexes with reduced formation of intermediate proteasomes containing the two immunocatalytic subunits β1i and β5i (β1iβ5i i20S) and an increase in complexes harboring only the immunocatalytic subunit β5i (β5i i20S) (Figure S6A) 35 , 36 . Concerted and even more pronounced downregulation of the i20S catalytic subunits PSMB8 and PSMB9 was observed on the RNA level upon transient silencing of PA200 in A549 cells (Figure S6B). To analyze whether the i20S regulates PA200, we made use of primary mouse skin fibroblasts isolated from single i20S subunit KO mice 37 . In these cells we reconstituted the respective i20S subunits with a doxocycline-inducible lentiviral expression system (Fig. 7 C). Analysis of PA200 RNA expression in i20S single KO and reconstituted cells (virus + Dox), however, did not reveal any regulation of PA200 by single i20S subunits (Fig. 7 C). Our results suggest that PA200 regulates the relative amounts of i20S catalytic subunits and, thus, composition of i20S complexes, while the i20S single subunits do not affect PA200 expression. Discussion In this work, we characterized interaction of PA200 with the i20S and compared it to s20S-PA200 interactions using structural, proteomic and cell biological approaches. We observed that the structure of the singly-capped i20S-PA200 complex differs significantly from that of the s20S-PA200. Despite an overall very similar fold and opening of the gate, our structural analysis uncovered several striking differences. Firstly, we observed a general bend of the singly-capped i20S-PA200, not seen in the three recent s20S-PA200 structures 11 , 12 , 23 or in any other proteasome activator bound 20S complexes 23 , 24 , 40 . Second, this bend is accompanied by an increase of the outer diameter of the unbound side of the i20S compared to the s20S, displacing atoms up to 5.4 Å. Using mass photometry, we obtained evidence that the abundance of the singly- and doubly-capped complexes relative to the total proteasome particles was higher for the i20S compared to the s20S. Our data thus suggest that this allosteric bending increases the occupancy of the second PA200 molecule. Such preferred formation of doubly-capped PA200-i20S complexes would thereby indirectly shift the composition of mixed proteasome complexes 2 , which contain two different activators, in favor of the PA200-only containing proteasome complexes. Third, we detected differential allosteric effects on the catalytic active sites upon binding of PA200 to i20S. These structural shifts and higher occupancy levels were associated with an increased activation of the i20S compared to the s20S upon PA200 binding, as shown by in vitro activity assays. More precisely, we observed that PA200 induced a four- to ten-fold increase in trypsin- and chymotrypsin-like activities and a significant activation of the caspase-like activity, although this activity is generally low in the i20S. This is a significantly higher level of activation compared to s20S. These divergent data for PA200-mediated activation of i20S and s20S might partly explain the conflicting reports of previous cellular studies on the activation of all three proteolytic activities by PA200 (discussed in detail in 10 ). Lastly, we detected the presence of two phytic acid molecules in i20S-PA200 complexes whereas s20S-PA200 complexes associated with both IP6 and 5,6[PP]2-IP4. We show here that IP6 further enhances the activation of the i20S by PA200, suggesting that it probably acts as a cofactor. Although the mechanism by which IP6 affects proteasome activity remains to be determined, we propose that this negatively charged molecule binds and neutralizes the positively charged substrate entry channels in PA200, which, in turn, promotes recognition and/or entry of basic substrates and alters substrate specificity. We confirmed that PA200 and i20S engage in cells and tissues by analyzing i20S-PA200 and s20S-PA200 complexes in testis, an organ that highly expresses PA200 and the i20S 29 . In that tissue, we discovered that PA200 preferentially binds i20S over s20S. However, the majority of tissues doesn’t co-express both PA200 and the i20S subunits, suggesting that PA200-mediated activation of i20S is highly context dependent. Along these lines, we showed that cellular conditions that upregulated PA200 ( e.g. the profibrotic cytokine TGF-β1) or the i20S ( e.g. IFNγ, bacterial infection) did not result in concerted transcriptional regulation, suggesting that expression of PA200 and the catalytic subunits of the i20S is differentially regulated. Previous studies have shown that bacterial or viral infections result in downregulation of PA200 10 . This raises the intriguing possibility that i20S function is fine-tuned by differential expression of proteasomal activators. For example, the PA28αβ activator, which is constitutively co-expressed with the i20S in immune cells 38 , 41 – 43 , has been shown to preferentially bind to the i20S 9 and activate its proteolytic activity to generate MHC-I antigenic peptides that activate CD8 T cell responses, e.g. upon viral infections 44 – 46 . The other member of the PA28 family of activators, i.e. PA28γ, is also able to bind and activate the i20S 9 , 47 . PA28γ, however, is exclusively expressed in the nucleus and thereby only binds to nuclear i20S. PA28γ has been shown to destroy antigenic peptides which are derived from nuclear pioneer translation products serving as an important source for tumor-derived antigenic peptides 48 . As PA28γ is upregulated in many types of tumors it may thereby help tumors to escape from immune surveillance 48 . This type of function was also recently proposed for PA200 based on the observation that addition of recombinant PA200 to cell extracts reduced inflammatory activation of the i20S 14 . In the same cells, PA200 bound strongly to cytokine-induced i20S in pulldown experiments, which is in line with our data. Our data clearly indicate that PA200 binding to the i20S results in prominent activation of β1i, β2i and β5i active sites compared to the s20S. While an increase of the CT-L and T-L activities would favor generation of MHC-I antigenic peptides, activation of the intrinsically low C-L activity in the i20S is detrimental for the production of proper MHC-I ligands and efficient antigen presentation 14 , 49 . Thus, the ability of PA200 to significantly increase the C-L activity of the i20S could at least partly explain the reduced diversity of presented antigenic peptides and the lack of response to immunotherapy observed in lung carcinoma 14 . In addition to the direct effect described above, whereby PA200 binding triggers long-range conformational changes resulting in i20S activation, we also show here that PA200 affects β1i expression. Hence, our data uncover a novel link between PA200 regulation and cellular composition of the proteasome that has not been reported before. This transcriptional regulation may have major implications for antigenic repertoire generation. As such, reduced expression of β1i in PA200 deficient cells might contribute to an altered MHC-I antigenic diversity 14 . Indeed, the replacement of a constitutive subunit by its immunosubunit counterpart, and vice versa , can result both in generation and destruction of specific antigenic epitopes 36 , 50 . A similar transcriptional regulation of i20S catalytic subunit expression has been demonstrated for PA28γ 51 . In conclusion, here we describe a unique “bent” conformation of the immunoproteasome induced by PA200 binding. This proteasome activator show preference for immunoproteasome over the standard proteasome, and the binding results in increased proteolytic activity in all three active sites (β1i, β2i and β5i). Intriguingly, we discovered that PA200 regulates i20S subunits’ expression, which constitutes another explanation for the reported role of PA200 in modulating anti-tumor immunity 14 . Our results thereby extend our understanding of PA200, and reveal new layers of i20S regulation. Materials and Methods Purification of s20S and i20S from HEK293-EBNA Cell Lines The procedure was done as described in 52 . Proteasome purification was done using MCP21 antibody, produced in-house from a hybridoma, grafted onto cyanogen bromide-activated Sepharose beads. HEK293-EBNA cells, expressing either i20S or s20S, were lysed in a pH 7.6 lysis buffer containing 20 mM Tris-HCl, 100 mM NaCl, 10 mM EDTA, 0.25% Triton X-100, and one tablet of protease and phosphatase inhibitors per 50 mL (cOmplete™ ULTRA Tablets Mini EDTA-free and PhosSTOP, Roche, Basel, Switzerland). Lysate was sonicated with a Vibracell sonicator (10 cycles of 30 s on and 1 min off, at 50% active cycle) and the lysate clarified by centrifugation at 16,000× g for 30 min, and the supernatant was filtered through a 0.22 µm membrane. The filtered lysate was incubated overnight with MCP21 antibody-grafted beads. The following day, the beads were washed with equilibration buffer (20 mM Tris-HCl, 1 mM EDTA, 10% glycerol, 100 mM NaCl, pH 7.6) and eluted using the same buffer supplemented with 3 M NaCl. The eluate was concentrated to 0.5 mL using 100 kDa MWCO centrifugal filters and applied to a size exclusion chromatography on a Superose 6 10/300 GL column with TSDG buffer (10 mM Tris-HCl pH 7.0, 1 M KCl, 10 mM NaCl, 5.5 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 10% glycerol). Proteasome enzymatic activity was assessed, and active fractions (eluted between 10–14 mL) were pooled. Buffer exchange with equilibration buffer and concentration were performed using 100 kDa MWCO centrifugal filters. Glycerol was added to a final concentration of 20% and aliquots were snap-frozen in liquid nitrogen and stored at − 80°C. Recombinant human PA200 Purification of recombinantly expressed human PA200 was done, as recently described 27 . The isolated PA200 was stored at a final concentration of 1 mg/ml to be used for cryo-EM analysis and other in vitro assays. Cryo EM analysis of i20S-PA200 complexes i20S was obtained commercially from R&D Systems (Catalog #: E-370, 10 microliter, 25 microgram: Human 20S Immunoproteasome Protein, CF E-370-025: R&D Systems ) and complexes were formed upon addition of 8x molar excess of PA200 upon overnight incubation. Before plunge freezing, QUANTIFOIL R2/1 copper grids (200 mesh) were cleaned using a glow-discharger (Leica EM ACE 200) at 8 mA for 60 seconds. 3uL of PA200-i20S sample (0.3 g/l) was added on the grids and plunge-frozen using a Vitrobot Mark IV (Thermo Fisher) set to 95% humidity and 4°C with 2 seconds for wait time, blot force 5 and 1 second for blotting time. Micrographs were acquired at 300 kV using a Titan Krios G4i (Thermo Fisher; HZ Munich, Germany) equipped with a Selectris energy filter and a Falcon4i direct electron detector. A dataset of 23355 micrographs was collected with 0.95 A pixel size and 1.5–2.5 µm under-focus in 60 frames accumulating 60 e/A^2 total dose. Image processing and volume reconstruction Cryo-EM datasets were processed using Cryo-EM Single Particle Ab-Initio Reconstruction and Classification (CryoSPARC 4.5.3) software 53 . Imported movies were subjected to motion correction, CTF estimation and manual exposure curation. Around 3% of micrographs were discarded because of unsatisfying CTF resolution estimation, astigmatism or frame motion. Next, a small subset of 200 micrographs was used for preliminary particle picking with a blob picker. After picking, nearly 40.000 particles were 4x binned, extracted with a box size of 100 pixels and 2D classified into 50 classes. 7 classes containing images of supposably full complex (the one with two caps, i.e. PA200 complexes) comprising 4627 particles were used in Ab-initio reconstruction and preliminary Homo refine jobs. The obtained volume was then used to generate 50 templates for template picking on the full dataset. Picked particles were inspected and 4768272 were again 4x binned and extracted with the box size of 100 pixels. Next, a couple of rounds of subsequent 2D classifications were made in 4 parallel groups containing similar numbers of particles. As most of the obtained sequential classes contained just the cup particles, only 532792 particles were used in further processing steps. Sequential 3-class Ab-initio, Hetero-refinement, and 3D classification resulted in three subpopulations for uncapped, 1-cap and 2-cap complexes holding 87822, 175565, and 156772 particles respectively. From the groups, preliminary binned volumes were refined and 3% of the best particles giving the highest CTF resolution estimation were used to train the neural network Topaz picker 54 . Trained model picking resulted in 607937 picked particles, after removal of duplicates. After 2D classification, 486195 particles were selected as believed to be images of the complex. The next steps were a couple of rounds of 3D classification and Hetero refinement to separate the particles of two different complexes, i.e. 1-cap with 225565 particles and 2-cap with 187565 particles. Both densities were NU-refined and Hetero-refined on two identical volumes from NU-refine iteratively. This procedure increased the resolution and was terminated when the resolution of NU-refinement was worse than the step before. The best resolution density was again locally refined and post-processed with DeepEMhancer 55 . Finally, 2.85Å and 2.89Å volumes were obtained for 1-cap and 2-cap complex, respectively. Model building and refinement The PA200 model from PDB 6REY was extracted and fitted into electron density map using Dock in map tool in PHENIX suite 56 . The backbone geometries and orientation of the side-chains were then refined and model was manually rebuilt using Coot 57 . We iteratively corrected steric clashes, Ramachandran and rotamer outliers manually in Coot followed by further refinement using phenix.real_space_refine. Detailed model evaluation was done using Molprobity 58 . Proteasome activity assays The proteasome substrate-based activity assays were performed in a 384-well black plate (Greiner Bio-One, UK). Purified 20S proteasome sample at 0.28 µM (either s20S or i20S) was mixed with 0.56 µM recombinant PA200 regulator in different ratios and left to interact for 30 min at room temperature (22°C). After they were allowed to interact, the complexes were diluted with 50 mM Tris HCl pH 7.6 to a concentration of 3 nM 20S. As a control, both s20S and i20S, was diluted to a concentration of 3 nM. All diluted samples were distributed into wells in aliquots of 20 µL, to which 20 µL of 400 µM fluorogenic peptide substrate was added (prepared in 50 mM Tris-HCl pH7.6): Suc-LLVY-AMC, Boc-LRR-AMC or z-LLE-AMC, to probe for chymotrypsin-, trypsin- or caspase-like activities, respectively. The final proteasome concentration in the reaction was 1.5 nM. The kinetic assays were performed at 37°C in a CLARIOstar Plus spectrofluorometer (BMG Labtech) over 60 min with one reading every 5 min, at 360 nm for excitation and 460 nm for emission. The slope of the kinetic assay (increase in fluorescence intensity over time) was used to measure proteasome activity. Only slopes at their steepest incline were considered (saturating conditions), after 15-minute temperature equilibration time. At least 5 timepoints were used for slope calculations. For analysis of the effects of phytic acid on proteasome function, 0.5 µM PA200 was incubated with 1.5 mM Inositol hexakisphosphate (or IP6, Sigma-Aldrich ref P8810) at room temperature for an hour. i20S (purified from HEK-EBNA cells) was then incubated with PA200 (with and without IP6) at 28 nM and 400 nM, respectively, at room temperature for another hour. The complexes were diluted with 50 mM Tris HCl pH 7.6 to a concentration of 2 nM i20S and assayed for activity in 384-well black plates, as described above using the following substrates: Suc-LLVY-AMC (Bachem), Ac-ANW-AMC (UBPBio), Ac-PAL-AMC (UBPBio), Boc-LRR-AMC (Enzo), z-LLE-AMC (UBPBio), Ac-nLPnLD-AMC (Biosynth), or Ac-GPLD-AMC (Biosynth) to probe for chymotrypsin-, β5i-, β1i-, trypsin- or caspase-like activities, respectively. Mass photometry Proteasome (i20S purified from HEK-EBNA, as described in Fabre et al 952 or s20S purchased from Enzo) was titrated with PA200 for mass photometry as follows: Tris 50 mM pH 7.6 was added to the empty tubes on ice, to compensate for different volumes cause by different theoretical protein ratios (1:0 to 1:12). 20S proteasomes were diluted to 0.2 g/L (0.28 µM) and added to each tube. Recombinantly produced human PA200 was then added to the tubes to form required ratios. Tubes were incubated for 2 h on ice. The complexes were diluted six times immediately before measurement on the Mass photometer (Refeyn Ltd). Acquisition was done using a large field of view, with 60 s recording and default video settings. The acquisition was calibrated using a standard mix of IgG (150 kDa) and thyroglobulin (660 kDa) in Tris-HCl buffer. The data was analyzed in DiscoverMP 1.2 using default settings. The histograms were manually fitted with Gaussian distribution and the counts for each population (PA200 approximately at 200 kDa, PA200 dimer at 400 kDa, 20S at 700 kDa, 20S-PA200 at 900kDa, and PA200-20S-PA200 at 1100 kDa) were recorded. Tables of counts vs nominal molecular weight were then processed in Excel (Microsoft Office) and graph visualisation and affinity calculation was done in GraphPad Prism. The experimental molar ratios were obtained based on the actual counts. The fractions of singly- and doubly-capped 20S in total binding site were calculated by obtaining the counts for the singly-capped 20S or 2 x doubly-capped 20S divided by the total possible 20S binding site, which was twice (i.e. two binding sites per 20S) the total 20S population (i.e. 20S alone, singly-, and doubly- capped 20S). These two fractions were then summed up to obtain the total 20S occupied binding site. With the fractions of singly- or doubly- capped 20S vs. the experimental molar ratio curves, non-linear fitting was done using Hill equation in GraphPad Prism giving the Kds and Bmax values at 95% confidence interval. Co-IP of proteasome complexes and proteomics - interactomics Co-immunoprecipitation was done using anti-PA200 antibodies or anti-α2 proteasome subunit antibodies for hPLF samples and for testis samples. The proteasome complex enrichment procedure for cultured cells is described in detail in 29 . Briefly, the material is homogenized using a Potter device (testis) or a cell scraper (hPLFs) in native buffer, then centrifuged to remove cell debris. Magnetic Protein G beads were incubated with anti-PA200 or anti-α2 proteasome subunit antibodies and the antibodies were then cross-linked to the beads via short 0.1% formaldehyde treatment. Clarified lysate was then incubated with the magnetic beads coated in antibodies overnight at 4°C. The beads were washed 4 times in lysis buffer, and enriched proteasome complexes are eluted from the beads using SDS. The samples were prepared for proteomics using S-Trap protocol, as described by the supplier (Protifi). LC-MS method with bioinformatic approach for interactomics is also described in 29 . Briefly, a standard nano-flow reverse phase LC-MS proteomic method was used, in DDA mode, on an Ultimate 3000 LC system and an Orbitrap Fusion MS instrument. Bottom-up LC-MSMS and Bottom-Up bioinformatic searches were done as described in the Appendix 1 of Zivkovic et al. 2022 29 , with the exception that the fasta-derived in silico library was human, from the Uniprot Proteome database. The proteomic search was done using the Proline suite, an easy-to-use, open source bioinformatic tool developed in-house 59 . For the analysis of the PA200 KO cell cultures, same lysis conditions, co-immunoprecipitation and protein digestion procedure was followed as described in detail in 29 , however, a different instrumental setup was used for the proteomic analysis. Digested peptide extracts were desalted on an Evotip C18 EV2001 tips (Evosep) and were analyzed by online nanoLC using an UltiMate 3000 RS nano-LC system (Thermo Scientific) coupled with a TimsTOF SCP mass spectrometer (Bruker). Peptides were separated on a C18 Aurora column (25 cm x 75 µm ID, IonOpticks) using a gradient ramping from 2–20% of B in 30 min, then to 37% of B in 3 min and to 85% of B in 2 min (solvent A: 0.1% Formic Acid (FA) in H2O; solvent B: 0.1% FA in Acetonitrile (ACN)), with a flow rate of 150 nL/min. MS acquisition was performed in DIA-PASEF mode on the precursor mass range [400-1,000] m/z and ion mobility 1/K0 [0.64–1.37]. The acquisition scheme was composed of 8 consecutive TIMS ramps using an accumulation time of 100 ms, with 3 MS/MS acquisition windows of 25 Th each. The resulting cycle time was 0.96 s. The collision energy was ramped linearly as a function of the ion mobility from 59 eV at 1/K0 = 1.6 Vs.cm − 2 to 20 eV at 1/K0 = 0.6Vs.cm − 2. The raw data was searched and quantified with DIA-NN 1.9, using a predicted library from UniProt human reference proteome. The result files were then imported into Proline 59 for validation and label-free quantitation with a False Discovery Rate (FDR) of ≤ 1.0%, peptide length range set at 7–30 and precursor charge states of 2 + and 3+. For statistics, a t-test p-value threshold of 0.01 was applied at both peptide and protein levels. Only specific peptides were used for quantification, and the median ratio fitting was chosen as the abundance summarizer method. Normalization, missing values inference (if strictly less than three values, 5% centile was applied), t-test and z-test (p-value Benjamini-Hochberg correction) were also applied. Cell isolation, culture and treatment A549 and H1299 non-small cell lung cancer cell lines were grown at 37°C and 5% CO 2 in a humidified incubator in DMEM/F12 or RPMI-1640 medium, respectively, with supplementation of 10% FBS and 100 U/mL penicillin/streptomycin. CRISPRCas9-mediated genomic depletion of PSME4 (gene name for PA200) has been described previously by us in detail 27 , 59 . Primary human lung fibroblasts (phLF) obtained from organ donors were used as described previously 19 . Cells were cultured in MCDB medium supplemented with 10% (v/v) FBS (Biochrome), 100 U/mL penicillin/streptomycin (Gibco, Thermo Fisher Scientific), 2 mM L-glutamine (Thermo Fisher Scientific), 5 µg/mL insulin (Thermo Fisher Scientific), 2 ng/mL basic-FGF (Thermo Fisher Scientific), and 0.5 ng/mL human EGF (Sigma-Aldrich). Cells were allowed to grow to 90% confluency before splitting. For subculturing, cells were rinsed with PBS, treated with 0.25% Trypsin-EDTA (Sigma) for 4–5 minutes at 37°C, re-suspended in fresh culture medium, and transferred to new dishes. All experiments were conducted using phLF between passages 3 and 5. Prior to treatment of phLF, 0.3 x 10 6 cells were seeded into 10 cm plates for 24 h. The cells were then synchronized by culturing them in modified MCDB medium (see above) containing 1% FBS for 24 h. Following synchronization, the medium was refreshed, 5 ng/ml TGF-β1 or 75 U/ml IFN𝛾 were added into the culture medium for 48 h. Cell harvest was achieved by washing the cells with PBS and then detaching the cells by adding 0.25% Trypsin-EDTA and incubating the plates for 5 minutes at 37°C. The process was stopped by adding culture media with 10% FBS, and the collected cells were then centrifuged in a 15 ml falcon tube at 5000 rpm for 5 minutes. Those cell pellets were washed once more with PBS in 1.5 ml Eppendorf tubes before their storage at -80° until further use. The method used for primary mouse skin fibroblast isolation was reported previously (doi: 10.3791/2033 ) with minor modifications regarding the culture medium where DMEM was supplied with 10% FBS (Capricorn) and the antibiotic 1×Antimycotic (Gibco, 15240062) was used. Bone-marrow derived mouse macrophages (BMDM) were generated from C3HeB/FeJ mice as previously described 60 . BMDMs then were cultured at 5 x 10 5 cells/well and incubated overnight in 24-well plates (Nunc-surface). Subsequently cells were infected with Mycobacterium tuberculosis H37Rv at a multiplicity of infection (MOI) of 3:1 for 24 h. Total RNA of cells lysed in Trizol (peqGOLD TriFast, VWR International) was extracted by use of DirectZol RNA MiniPrep (Zymo Research) according to the manufacturer’s instructions. For reverse transcription of RNA, the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Fisher Scientific) was used. RNA isolation of cells Total RNA from cells was extracted using phenol-chloroform extraction with TRIzol Reagent invitrogen). Cells were resuspended in TRIzol Reagent, followed by vigorous mixing with chloroform in Phasemaker tubes. The samples were then incubated for 5 minutes and centrifuged at 16,000 x g for 5 min at 4°C to achieve phase separation. The upper aqueous phase was carefully transferred to a new tube, and 500 µL of isopropanol was added. The samples were incubated for 10 minutes on ice. RNA was pelleted by centrifugation at 16,000 x g for 10 min at 4°C. The supernatant was discarded, and the RNA pellets were washed with 70% (v/v) ethanol. After drying on ice, the RNA pellet was dissolved in 30 µL of nuclease-free water and incubated in a heat block at 55°C for 10 min, and the RNA concentration was measured at 260 nm using the NanoDrop 1000 (ThermoFisher). Reverse transcription (RT) of mRNA and RT-qPCR For reverse transcription, 0.5 to 1 µg RNA was diluted to 14 µL with nuclease-free water and combined with a 6 µL mastermix of Maxima First Strand cDNA Synthesis Kit for RT-qPCR according to the manufacturer’s instructions (ThermoFisher). The reaction was terminated by heating at 85°C for 5 min. The samples were then diluted 1:5 with nuclease-free water. Quantitative real-time PCR was carried out using a SYBR Green LC480 system (Roche). Each well in the 96-well plate contained a mixture of 2.5 µL cDNA and 5 µL LC480 SYBR Green I Master mix (Roche), along with 2.5 µL of forward and reverse primers, resulting in a final concentration of 0.5 µM. All samples were measured in duplicate, and plates were centrifuged at 1000 rpm for 2 minutes before beginning the measurement, following the standard protocol of the Light Cycler 480II (Roche). Gene expression levels were normalized to the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT). Relative gene expression was calculated using the ΔΔCT method. Primer sequence table Target Forward primer sequence Reverse primer sequence PSME4 (PA200) CCA ACA GGA AAA GAA TGC CGA CCA GGG CAG GTT TCT TTG CT PSMB8 GCTATTCTGGAGGCGTTGTC AGGCCTCTTCTTCTCCTTGG PSMB9 ATG CTG ACT CGA CAG CCT TT GCA ATA GCG TCT GTG GTG AA PSMB10 AGC CCG TGA AGA GGT CTG G CAT AGC CTG CAC AGT TTC CTC C HPRT TGA AGG AGA TGG GAG GCC A AAT CCA GCA GGT CAG CAA AGA A Protein extraction and quantification followed by SDS-PAGE and Western blot analysis In order to evaluate intact and active proteasome complexes, cell pellets were lysed under non-denaturing conditions. Cell pellets were resuspended in OK40 buffer (50 mM Tris-HCl, 5 mM MgCl 2 10% Glycerol, 0.05% NP-40, 2mM ATP) containing a 1x cOmplete™ protease inhibitor cocktail (Roche) and 1x phosphoSTOP (Roche) and lysed through vigorous pipetting followed by a 20 min incubation on ice with additional vigorous pipetting and vortexing. The lysates were then centrifuged at 15,000 rpm for 20 min at 4°C. The supernatant was transferred to new tubes for immediate protein concentration determination using a BCA assay. A bovine serum albumin (BSA) calibration curve, with concentrations ranging from 0 to 2 µg/µL in PBS, was used as a standard for protein quantification. To perform the assay, 20 µL of BSA standard, 2 µL of protein lysate or pure lysis buffer diluted 18 µL in PBS were combined with 200 µL of BCA reagent, following the manufacturer’s instructions (Thermo Fisher Scientific). After a 30-minute incubation at 37°C, absorbance was measured at 562 nm using a plate reader for subsequent protein concentration calculation. 15 µg of protein were used per sample for western blotting, and 25 µg for ABP assay. Protein extracts were diluted to equal volumes with Milli-Q® water, then mixed with 6x Laemmli sample buffer. The protein mixture was heated to 95°C for 10 min to denature the proteins. For protein electrophoresis, samples were loaded onto 12% SDS polyacrylamide gels. Protein samples, along with a Protein Marker (#26616, ThermoFisher) were loaded onto SDS polyacrylamide gels. Electrophoresis was carried out using Bio-Rad gel running chambers. Following electrophoresis, proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Bio-Rad) using the tank immunoblotting method. The membrane was first activated in pure methanol, and the transfer was carried out at a constant current of 250 mA for 90 min or an overnight transfer of 40 mA for 960 min. To block nonspecific binding, the PVDF membrane was incubated in Roti®-Block solution (Carl Roth) for 1 h. The membrane was then incubated with the primary antibody, diluted in Roti-Block solution, either overnight at 4°C or for 1 h at room temperature (RT). Afterwards, the membrane was washed three times with PBST (PBS, 1% Tween-20) for 5 min each and incubated with a horseradish peroxidase-conjugated secondary antibody, diluted 1:20,000 in PBST, for 60 min at RT on a shaker. The membrane was then washed three more times with PBST for approximately 20 min in total, and proteins were detected using a chemiluminescent substrate according to the manufacturer's instructions. Protein signals were detected with the iBright CL750 (ThermoFisher). The following antibodies were used: anti-LMP2 (ab242061, Abcam), anti-LMP7 (ab3329, Abcam), anti-MECL1 (ab183506, Abcam), anti-TurboGFP (TA150041, OriGene), anti-GAPDH (14C10, Cell Signaling), anti-PA200 (NBP1-22236, Novus Biologicals). Lentivirus design and production Lentiviruses were constructed using the pCW57-MCS1-P2A-MCS2 (GFP) transfer vector (#80924, Addgene). The cDNAs for the three different immunoproteasome subunits LMP7, LMP2 and MECL-1 were amplified from mouse embryonic fibroblasts using primers containing restriction sites for Nhe I-mediated cloning into the vector. The vector pCW57-MCS1-P2A-MCS2 (GFP) was linearized with the restriction enzyme NheI (NEB, #R3131), whose restriction site is located upstream of the P2A region. The cDNAs of the individual immunoproteasome subunits were then integrated into the linearized vector after digestion with NheI using the NEBuilder® HiFi DNA Assembly Master Mix (NEB, #E2621). The construct allows inducible expression of the gene of interest by addition of Doxycycline (Dox). The activity of the tetracycline response element (TRE) promoter is inhibited by a reverse Tetracycline repressor (rTetR), which is expressed by a downstream hPGK promoter, when Dox is absent. In contrast, addition of Dox allows the release of the rTetR from the TRE promoter thereby allowing expression of the gene of interest. The turboGFP gene is driven independently of Dox by the hPGK promoter and allows sorting of lentivirus - infected cells. 5×10 6 293 HEK-T cells were seeded into 10-cm cell culture plates 24 h prior to the transfection of plasmid. Before plasmid transfection, fresh and pre-warmed DMEM supplied with 10% FBS, 25 mM HEPES and 1% L-glutamine was added to the culture plate. 8 µg of transfer plasmid (pCW57-MCS1-P2A-MCS2 (GFP) was used as control, pCW57-LMP2-P2A-GFP, pCW57-LMP7-P2A-GFP or pCW57-MECL1-P2A-GFP) together with 6 µg pSPAX2 (Addgene) and 4 µg pMD2.G (Addgene) were transfected using PEI (Merck, 919012). Cell culture medium was replaced after 8 h of transfection, and lentivirus-containing medium was collected 48 h after medium replacement. Collected lentivirus-containing medium was filtered with 0.45 µm sterile filters prior to use and stored at -80°C. Lentivirus infection and Dox induction For Lentivirus infection, 3×10 5 WT or immunoproteasome-deficient skin fibroblasts were seeded into 6-cm plates 24 h before infection. On the day of infection, either empty lentivirus or lentivirus containing the cDNAs of β1i (PSMB9), β5i (PSMB8), or β2i (PSMB10) were added to the plates with a multiplicity of infection (MOI) of 3 for 48 h. Simultaneously, polybrene (Merck, TR-1003) with a final concentration of 8 µg/ml was added to the medium to enhance infection efficiency. After 48 h, fibroblasts were then washed with PBS to remove residual polybrene and lentivirus. Afterwards, 1 µg/ml Doxycycline (Dox) (Merck, D5207) was applied to infected cells for 96 h to induce expression of the target gene and turbo GFP. Dox was added to medium every 48 h. Abbreviations s20S - standard 20S proteasome i20S - immunoproteasome (20S) phLF - primary human lung fibroblasts GFP - green fluorescent protein TGF-β1 - transforming growth factor β1 IFNγ - interferon-γ Mtb - Mycobacterium tuberculosis WT - wildtype KO - knockout Dox - doxycycline CT-L - chymotrypsin-like T-L - trypsin-like C-L - caspase-like RT – room temperature BSA - bovine serum albumin RT - Reverse transcription HPRT - hypoxanthine-guanine phosphoribosyltransferase RPL19 - ribosomal protein L19 Declarations Data Availability The mass spectrometry proteomics data concerning A549/H1299 PA200 KO cells and TGF-β treated phLF have been deposited to the ProteomeXchange Consortium via the PRIDE 6 2 partner repository with the dataset identifier PXD061729. The anti-PA200 and anti-α2 CoIP proteomics data in testes were previously deposited with the dataset identifier PXD027436 29 . Acknowledgements The study was supported by a BMBF grant to SM and GP (Nr. 16GW0287), a DFG/ANR grant to SM, JB, and MPB (ME2002/6-1, BE1305/9-1, and ANR-PA200_IN_IPF) and by grants from the French National Research Agency (ProFI projects: ANR-10-INBS-08 & ANR-24-INBS-0015), the Région Occitanie, and the REACT-EU program of the European Commision. The work is supported under the Polish Ministry and Higher Education project: “Support for research and development with the use of research infrastructure of the National Synchrotron Radiation Centre SOLARIS” under contract nr 1/SOL/2021/2. We gratefully acknowledge the provision of human biomaterial from the CPC-M bioArchive and its partners at the Asklepios Biobank Gauting and the Klinikum der Universität München. References Kloetzel, P. M. & Ossendorp, F. Proteasome and peptidase function in MHC-class-I-mediated antigen presentation. Curr Opin Immunol 16 , 76–81 (2004). Wang, X., Meul, T. & Meiners, S. Exploring the proteasome system: A novel concept of proteasome inhibition and regulation. Pharmacol Ther 211 , 107526 (2020). Coux, O., Zieba, B. A. & Meiners, S. The Proteasome System in Health and Disease. Adv Exp Med Biol 1233 , 55–100 (2020). Groll, M. et al. Structure of 20S proteasome from yeast at 2.4 A resolution. Nature 386 , 463–471 (1997). Stadtmueller, B. M. & Hill, C. P. Proteasome activators. Mol Cell 41 , 8–19 (2011). Inholz, K. et al. Proteasome composition in immune cells implies special immune-cell-specific immunoproteasome function. European Journal of Immunology 54 , 2350613 (2024). Kammerl, I. E. et al. Blood Immunoproteasome Activity Is Regulated by Sex, Age and in Chronic Inflammatory Diseases: A First Population-Based Study. Cells 10 , (2021). Bard, J. A. M. et al. Structure and Function of the 26S Proteasome. Annu Rev Biochem 87 , 697–724 (2018). Fabre, B. et al. Deciphering preferential interactions within supramolecular protein complexes: the proteasome case. Mol Syst Biol 11 , 771 (2015). Yazgili, A. S., Ebstein, F. & Meiners, S. The Proteasome Activator PA200/PSME4: An Emerging New Player in Health and Disease. Biomolecules 12 , (2022). Toste Rêgo, A. & da Fonseca, P. C. A. Characterization of Fully Recombinant Human 20S and 20S-PA200 Proteasome Complexes. Mol Cell 76 , 138–147.e5 (2019). Guan, H. et al. Cryo-EM structures of the human PA200 and PA200-20S complex reveal regulation of proteasome gate opening and two PA200 apertures. PLoS Biol 18 , e3000654 (2020). VerPlank, J. J., Gawron, J. M., Silvestri, N. J., Wrabetz, L. & Feltri, M. L. Knockout of PA200 improves proteasomal degradation and myelination in a proteotoxic neuropathy. Life Sci Alliance 7 , (2024). Javitt, A. et al. The proteasome regulator PSME4 modulates proteasome activity and antigen diversity to abrogate antitumor immunity in NSCLC. Nat Cancer 4 , 629–647 (2023). Qian, M.-X. et al. Acetylation-mediated proteasomal degradation of core histones during DNA repair and spermatogenesis. Cell 153 , 1012–1024 (2013). Blickwedehl, J. et al. Role for proteasome activator PA200 and postglutamyl proteasome activity in genomic stability. Proc Natl Acad Sci U S A 105 , 16165–16170 (2008). Blickwedehl, J. et al. Proteasomes and proteasome activator 200 kDa (PA200) accumulate on chromatin in response to ionizing radiation. Radiat Res 167 , 663–674 (2007). Jiang, T.-X. et al. Proteasome activator PA200 maintains stability of histone marks during transcription and aging. Theranostics 11 , 1458–1472 (2021). Welk, V. et al. Proteasome activator PA200 regulates myofibroblast differentiation. Sci Rep 9 , 15224 (2019). Welk, V. et al. Inhibition of Proteasome Activity Induces Formation of Alternative Proteasome Complexes. J Biol Chem 291 , 13147–13159 (2016). Douida, A. et al. The proteasome activator PA200 regulates expression of genes involved in cell survival upon selective mitochondrial inhibition in neuroblastoma cells. J Cell Mol Med 24 , 6716–6730 (2020). Aladdin, A. et al. The Proteasome Activators Blm10/PA200 Enhance the Proteasomal Degradation of N-Terminal Huntingtin. Biomolecules 10 , (2020). Zhao, J. et al. Structural insights into the human PA28-20S proteasome enabled by efficient tagging and purification of endogenous proteins. Proc. Natl. Acad. Sci. U. S. A. 119 , e2207200119 (2022). Chen, J. et al. Cryo-EM of mammalian PA28αβ-iCP immunoproteasome reveals a distinct mechanism of proteasome activation by PA28αβ. Nat Commun 12 , 739 (2021). Lesne, J. et al. Conformational maps of human 20S proteasomes reveal PA28- and immuno-dependent inter-ring crosstalks. Nat Commun 11 , 6140 (2020). Sonn-Segev, A. et al. Quantifying the heterogeneity of macromolecular machines by mass photometry. Nat Commun 11 , 1772 (2020). Yazgili, A. S. et al. The proteasome activator PA200 regulates tumor cell invasion. biorXiv 2024.12.17.628836 , (2024). Huber, E. M. et al. Immuno- and constitutive proteasome crystal structures reveal differences in substrate and inhibitor specificity. Cell 148 , 727–738 (2012). Živković, D. et al. Proteasome complexes experience profound structural and functional rearrangements throughout mammalian spermatogenesis. Proc Natl Acad Sci U S A 119 , e2116826119 (2022). Kniepert, A. & Groettrup, M. The unique functions of tissue-specific proteasomes. Trends Biochem Sci 39 , 17–24 (2014). Pishesha, N., Harmand, T. J. & Ploegh, H. L. A guide to antigen processing and presentation. Nature Reviews Immunology 22 , 751–764 (2022). Fabre, B. et al. Subcellular distribution and dynamics of active proteasome complexes unraveled by a workflow combining in vivo complex cross-linking and quantitative proteomics. Mol Cell Proteomics 12 , 687–699 (2013). Kim, M.-S. et al. A draft map of the human proteome. Nature 509 , 575–581 (2014). Chen, S. et al. Immunoproteasome dysfunction augments alternative polarization of alveolar macrophages. Cell Death Differ 23 , 1026–1037 (2016). Menneteau, T. et al. Mass Spectrometry-based Absolute Quantification of 20S Proteasome Status for Controlled Expansion of Human Adipose-derived Mesenchymal Stromal/Stem Cells. Mol Cell Proteomics 18 , 744–759 (2019). Guillaume, B. et al. Two abundant proteasome subtypes that uniquely process some antigens presented by HLA class I molecules. Proc Natl Acad Sci U S A 107 , 18599–18604 (2010). Kincaid, E. Z. et al. Mice completely lacking immunoproteasomes show major changes in antigen presentation. Nat Immunol 13 , 129–135 (2011). Fabre, B. et al. Label-free quantitative proteomics reveals the dynamics of proteasome complexes composition and stoichiometry in a wide range of human cell lines. J Proteome Res 13 , 3027–3037 (2014). Wang, X. et al. DNA sensing via the cGAS/STING pathway activates the immunoproteasome and adaptive T-cell immunity. EMBO J 42 , e110597 (2023). Thomas, T. A. & Smith, D. M. Proteasome activator 28γ (PA28γ) allosterically activates trypsin-like proteolysis by binding to the α-ring of the 20S proteasome. J. Biol. Chem. 298 , 102140 (2022). McCarthy, M. K. & Weinberg, J. B. The immunoproteasome and viral infection: a complex regulator of inflammation. Front Microbiol 6 , 21 (2015). Cascio, P. PA28αβ: The Enigmatic Magic Ring of the Proteasome? Biomolecules 4 , 566–584 (2014). Barton, L. F., Cruz, M., Rangwala, R., Deepe, G. S., Jr & Monaco, J. J. Regulation of immunoproteasome subunit expression in vivo following pathogenic fungal infection. J Immunol 169 , 3046–3052 (2002). Sijts, E. J. A. M. & Kloetzel, P. M. The role of the proteasome in the generation of MHC class I ligands and immune responses. Cell Mol Life Sci 68 , 1491–1502 (2011). Huber, E. M. & Groll, M. The Mammalian Proteasome Activator PA28 Forms an Asymmetric αβ Complex. Structure 25 , 1473–1480.e3 (2017). Vigneron, N. & Van den Eynde, B. J. Proteasome subtypes and regulators in the processing of antigenic peptides presented by class I molecules of the major histocompatibility complex. Biomolecules 4 , 994–1025 (2014). Cascio, P. PA28γ: New Insights on an Ancient Proteasome Activator. Biomolecules 11 , (2021). Boulpicante, M. et al. Tumors escape immunosurveillance by overexpressing the proteasome activator PSME3. Oncoimmunology 9 , 1761205 (2020). Basler, M. & Groettrup, M. On the Role of the Immunoproteasome in Protein Homeostasis. Cells 10 , (2021). Basler, M. et al. Why the structure but not the activity of the immunoproteasome subunit low molecular mass polypeptide 2 rescues antigen presentation. J. Immunol. 189 , 1868–1877 (2012). Yao, L. et al. The proteasome activator REGγ counteracts immunoproteasome expression and autoimmunity. J Autoimmun 103 , 102282 (2019). Dafun, A. S. et al. Establishing 20S Proteasome Genetic, Translational and Post-Translational Status from Precious Biological and Patient Samples with Top-Down MS. Cells 12 , (2023). Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods 14 , 290–296 (2017). Bepler, T. et al. Positive-unlabeled convolutional neural networks for particle picking in cryo-electron micrographs. Nat Methods 16 , 1153–1160 (2019). Sanchez-Garcia, R. et al. DeepEMhancer: a deep learning solution for cryo-EM volume post-processing. Commun Biol 4 , 874 (2021). Liebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr D Struct Biol 75 , 861–877 (2019). Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of coot. Acta Crystallogr. D Biol. Crystallogr. 66 , 486–501 (2010). Williams, C. J. et al. MolProbity: More and better reference data for improved all-atom structure validation. Protein Sci 27 , 293–315 (2018). Bouyssié, D. et al. Proline: an efficient and user-friendly software suite for large-scale proteomics. Bioinformatics 36 , 3148–3155 (2020). Seluanov, A., Vaidya, A. & Gorbunova, V. Establishing primary adult fibroblast cultures from rodents. J Vis Exp (2010) doi:10.3791/2033. Brandenburg, J. et al. WNT6/ACC2-induced storage of triacylglycerols in macrophages is exploited by Mycobacterium tuberculosis. J Clin Invest 131 , (2021). Perez-Riverol, Y. et al. The PRIDE database and related tools and resources in 2019: improving support for quantification data. Nucleic Acids Res 47 , D442–D450 (2019). Additional Declarations There is NO Competing Interest. Supplementary Files Zivkovicetal2025UncoveringtheUnexpectedRoleofProteasomeActivatorPA200inRegulatingImmunoproteasomeSI.docx Supplementary Figures - Microsoft Word document Accesstorawdata.docx Access to raw data NCOMMS2537117Trs.pdf Reporting Summary Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6620945","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":463102358,"identity":"96fade98-8513-439b-8ec6-7a868d395f4f","order_by":0,"name":"Marie Pierre Bousquet","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABKklEQVRIie3SPUvDQBjA8ecoXJdI1hP1IwgngVSh0K+SQ0iX4NIlg0iC0CzFOYOYrxAX6XhHwOlK1gwdLEImh3TLUMRLfUOaoKPD/SF3IfDj4cIB6HT/NK4eY/uGgs9vPgGqturvhMstQfGv876ImEInOY4WK17B8tA8WKye0HzIksg7eV7fnV4MTI6u/V1iyzEVMZTG/s3Yoki6LJUvFhUPZHIWOyiULYS7kO29ZgaVGBM0zVhKPJsowtIC+qugheQlZBvIjJHE/bohSewNanGrSM5R2EYKNQUUoQbG0JCg8GwQgSLc6SAliJk6C5G4R5h0rVSWEyIfm7OwsJXkbq+qYTkyZxhV6/nwKInO7yv/8kr9sUy0kY/4++b8XL8vQzfZhTqdTqcDeAMguHKs65WfwgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-2680-8932","institution":"Université de Toulouse (UT), CNRS","correspondingAuthor":true,"prefix":"","firstName":"Marie","middleName":"Pierre","lastName":"Bousquet","suffix":""},{"id":463102359,"identity":"42c8320d-a7fa-4664-bdf6-b92ebc11d7a2","order_by":1,"name":"Dušan Živković","email":"","orcid":"","institution":"University of Oxford","correspondingAuthor":false,"prefix":"","firstName":"Dušan","middleName":"","lastName":"Živković","suffix":""},{"id":463102360,"identity":"4248325d-75fa-4f89-a109-aed6abfceba2","order_by":2,"name":"Fatme Mourtada","email":"","orcid":"","institution":"Research Center Borstel/Leibniz Lung Center, RG Immunology and Cell Biology, Airway Research Center North (ARCN)","correspondingAuthor":false,"prefix":"","firstName":"Fatme","middleName":"","lastName":"Mourtada","suffix":""},{"id":463102361,"identity":"f3c15b21-2d94-437d-b494-c60f7a036324","order_by":3,"name":"Angelique Dafun","email":"","orcid":"https://orcid.org/0000-0003-0559-850X","institution":"Institut de Pharmacologie et de Biologie Structurale (IPBS), Université de Toulouse, CNRS","correspondingAuthor":false,"prefix":"","firstName":"Angelique","middleName":"","lastName":"Dafun","suffix":""},{"id":463102362,"identity":"9438d129-8afd-46bb-8dcd-2e51e516210e","order_by":4,"name":"Ayse Yazgili","email":"","orcid":"","institution":"Comprehensive Pneumology Center (CPC), University Hospital of the Ludwig -Maximilians-University (LMU) and Helmholtz Center Munich","correspondingAuthor":false,"prefix":"","firstName":"Ayse","middleName":"","lastName":"Yazgili","suffix":""},{"id":463102363,"identity":"74e2f2b9-cede-49cc-a95c-9737e6d72106","order_by":5,"name":"Marijke Jansma","email":"","orcid":"","institution":"Molecular Targets and Therapeutics Center, Institute of Structural Biology, Helmholtz Munich, Neuherberg, Germany","correspondingAuthor":false,"prefix":"","firstName":"Marijke","middleName":"","lastName":"Jansma","suffix":""},{"id":463102364,"identity":"3d2e1406-3e7f-4627-9728-3995cabc3ace","order_by":6,"name":"Przemysław Grygier","email":"","orcid":"","institution":"Malopolska Centre of Biotechnology, Jagiellonian University","correspondingAuthor":false,"prefix":"","firstName":"Przemysław","middleName":"","lastName":"Grygier","suffix":""},{"id":463102365,"identity":"d8061566-a112-4ae9-b0e6-2e4a7e959215","order_by":7,"name":"Michał Rawski","email":"","orcid":"https://orcid.org/0000-0002-8553-7637","institution":"Jagiellonian University","correspondingAuthor":false,"prefix":"","firstName":"Michał","middleName":"","lastName":"Rawski","suffix":""},{"id":463102366,"identity":"ce2c8c5f-2b36-4414-a602-f67419edad5d","order_by":8,"name":"Anna Czarna","email":"","orcid":"","institution":"Malopolska Centre of Biotechnology, Jagiellonian University","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Czarna","suffix":""},{"id":463102367,"identity":"195c0e44-d2e0-4acb-9e37-bdd15eec5971","order_by":9,"name":"Stefan Bohn","email":"","orcid":"https://orcid.org/0000-0001-9196-622X","institution":"Institute of Structural Biology, Helmholtz Munich","correspondingAuthor":false,"prefix":"","firstName":"Stefan","middleName":"","lastName":"Bohn","suffix":""},{"id":463102368,"identity":"17332957-2a00-4c12-b42f-6995bdd98453","order_by":10,"name":"Krzysztof M. Zak","email":"","orcid":"","institution":"Molecular Targets and Therapeutics Center, Institute of Structural Biology, Helmholtz Munich","correspondingAuthor":false,"prefix":"","firstName":"Krzysztof","middleName":"M.","lastName":"Zak","suffix":""},{"id":463102369,"identity":"5862859e-0ae5-411d-806b-2f297aa6343e","order_by":11,"name":"Norbert Reiling","email":"","orcid":"https://orcid.org/0000-0001-6673-4291","institution":"Research Center Borstel/Leibniz Lung Center, RG Microbial Interface Biology","correspondingAuthor":false,"prefix":"","firstName":"Norbert","middleName":"","lastName":"Reiling","suffix":""},{"id":463102370,"identity":"f9d70054-cad8-4e0b-8623-7b62e0c02900","order_by":12,"name":"Linda Zemke","email":"","orcid":"","institution":"Research Center Borstel/Leibniz Lung Center, RG Microbial Interface Biology","correspondingAuthor":false,"prefix":"","firstName":"Linda","middleName":"","lastName":"Zemke","suffix":""},{"id":463102371,"identity":"6a1e80f8-71e4-4b4f-b25e-eb756980d53c","order_by":13,"name":"Kai Guo","email":"","orcid":"https://orcid.org/0000-0002-4291-4439","institution":"Research Center Borstel/Leibniz Lung Center, RG Immunology and Cell Biology, Airway Research Center North (ARCN)","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Guo","suffix":""},{"id":463102372,"identity":"0821e222-efc6-4726-b7ac-f65cadaf8229","order_by":14,"name":"Jürgen Behr","email":"","orcid":"","institution":"Department of Medicine V, LMU University Hospital, LMU Munich","correspondingAuthor":false,"prefix":"","firstName":"Jürgen","middleName":"","lastName":"Behr","suffix":""},{"id":463102373,"identity":"4526376e-8beb-44cd-8223-e43a4a32aa51","order_by":15,"name":"Odile Burlet-Schiltz","email":"","orcid":"","institution":"Institut de Pharmacologie et de Biologie Structurale (IPBS)","correspondingAuthor":false,"prefix":"","firstName":"Odile","middleName":"","lastName":"Burlet-Schiltz","suffix":""},{"id":463102374,"identity":"e6dfc57d-be5f-46e8-a78a-aa3b0a5b24b5","order_by":16,"name":"Grzegorz Popowicz","email":"","orcid":"https://orcid.org/0000-0003-2818-7498","institution":"Helmholtz Zentrum München","correspondingAuthor":false,"prefix":"","firstName":"Grzegorz","middleName":"","lastName":"Popowicz","suffix":""},{"id":463102375,"identity":"854f2906-6079-4694-9f46-f44b8d088469","order_by":17,"name":"Julien Marcoux","email":"","orcid":"https://orcid.org/0000-0001-7321-7436","institution":"CNRS","correspondingAuthor":false,"prefix":"","firstName":"Julien","middleName":"","lastName":"Marcoux","suffix":""},{"id":463102376,"identity":"6e7d02d0-7c16-4ba7-8042-9b95342d1d28","order_by":18,"name":"Silke Meiners","email":"","orcid":"https://orcid.org/0000-0003-3678-7995","institution":"Research Center Borstel/Leibniz Lung Center, RG Immunology and Cell Biology, Airway Research Center North (ARCN)","correspondingAuthor":false,"prefix":"","firstName":"Silke","middleName":"","lastName":"Meiners","suffix":""}],"badges":[],"createdAt":"2025-05-08 13:07:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6620945/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6620945/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83682231,"identity":"34a4a854-5100-4a86-8b0b-c703b828a74b","added_by":"auto","created_at":"2025-05-30 16:23:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":7170410,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCryo-EM analysis of the i20S-PA200 proteasome complex. \u003c/strong\u003eThe structure of doubly-capped i20S shares overall similarity to the s20S-PA200 structures reported before. (\u003cstrong\u003eA\u003c/strong\u003e) Overlay of the i20S-PA200 (blue) and s20S-PA200 (yellow, PDB: 6REY). The structures were aligned by the PA200 molecule at the top. The overall axis of the complex is bent. Root Mean Square Deviations (RMSD, in Å) between both structures are indicated for the two PA200 molecules and for each one of the α and β ring. (\u003cstrong\u003eB\u003c/strong\u003e) Comparisons of the i20S-PA200 and s20S-PA200 structures show a progressive increase of the RMSD from the top (first binding event) to the bottom of the barrel, reflecting the long-range allosteric bending of the barrel. (\u003cstrong\u003eC\u003c/strong\u003e) The \u003cu\u003eα\u003c/u\u003e subunits further away from the aligned PA200 molecule show a substantial displacement (up to 5.4 Å).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/6c188b2702d20e63b0d198e4.png"},{"id":83682194,"identity":"ebacfc24-76b6-47df-9672-0c2b06179408","added_by":"auto","created_at":"2025-05-30 16:23:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2568529,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBinding of PA200 induces channel opening of i20S, allosterically alters the catalytic site and widens the opposite unbound α-ring diameter\u003c/strong\u003e. Superimposition of the (\u003cstrong\u003eA\u003c/strong\u003e) unbound side of the singly-capped i20S-PA200 (white) with uncapped i20S (blue, PDB ID: 6AVO) and (\u003cstrong\u003eB\u003c/strong\u003e) unbound side of the singly-capped s20S-PA200 (grey, PDB ID: 6KWY) with the uncapped s20S (brown, PDB ID: 6RGQ), (\u003cstrong\u003eC\u003c/strong\u003e) Structure of i20S-PA200 in an open state caused by PA200 binding. (\u003cstrong\u003eD\u003c/strong\u003e) s20S-PA200 in open state (PDB ID 6REY), (\u003cstrong\u003eE\u003c/strong\u003e) Comparison of active sites of the capped (top) and uncapped (bottom) i20S colored by electrostatics (positive in blue and negative in red).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/a6f6de21cefc37666cf14296.png"},{"id":83682221,"identity":"05676487-dd00-4d7d-bb90-3c1903cb54d8","added_by":"auto","created_at":"2025-05-30 16:23:39","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":94192,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ei20S-PA200 particles are preferentially formed compared to s20S-PA200 complexes. (A)\u003c/strong\u003e Mass photometry allowed us to semi-quantify the relative abundances of free 20S (720 kDa), singly-capped 20S (930 kDa), and doubly-capped 20S (1,140 kDa). The used PA200:20S molar ratio was 8. \u003cstrong\u003e(B)\u003c/strong\u003e Titrations of PA200 to either s20S and i20S showed a higher total occupancy of the i20S. The total 20S occupied binding sites were calculated by summing the fractions of singly- and doubly-capped 20S (shown in Fig S3) and as detailed in the Materials and Methods section.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/2ff67188e16a24550eab56a4.png"},{"id":83682191,"identity":"96f4f0af-ee06-4c13-bed1-10f18943fc5c","added_by":"auto","created_at":"2025-05-30 16:23:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":172080,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePA200 activates better the i20S and is further activated by phytic acid\u003c/strong\u003e. (\u003cstrong\u003eA\u003c/strong\u003e) The three proteasome activities were assayed using isolated i20S and s20S incubated with increasing amounts of recombinantly expressed PA200 (molar ratios 1 to 8). The LLVY-AMC, LRR-AMC and LLE-AMC substrates were used to quantify the CT-L, T-L and C-L activities, respectively. The activity measured with the non-activated s20S was used as the reference activity. \u003cstrong\u003e(B-C)\u003c/strong\u003e Effect of phytic acid (IP6) on PA200-activated i20S (B) and s20S (C) catalytic activities using fluorogenic substrates specific for the distinct active sites of the i20S (LLVY, ANW, PAL, LRR substrates for𝛃5i, 𝛃5i, 𝛃1i, 𝛃2i, respectively). PA200 was incubated first with IP6 and then with 20S at final concentrations of 21.5 nM, 70 μM and 1.5 nM for PA200, IP6 and 20S, respectively. The activity measured with the non-activated s20S was used as the reference activity. The activity assays were performed in at least 4 replicates and the data are shown as mean values, the standard deviations, and the individual values of each replicate. Two-way ANOVA with Tukey’s multiple comparison test at 95% confidence interval was used with ns: no significance, *: p\u0026lt;0.05, **: p\u0026lt;0.01, ***: p\u0026lt;0.001, and ****: p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/4a451674b788bd0806da2325.png"},{"id":83682203,"identity":"65da9713-3b96-4e02-aebf-b890c6c9ccf4","added_by":"auto","created_at":"2025-05-30 16:23:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":179449,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEnrichment of i20S in PA200-containing proteasome complexes in testis.\u003c/strong\u003e \u003cstrong\u003eA)\u003c/strong\u003e Immunoprecipitation of PA200 in bovine testis and subsequent MS-based interactome analysis revealed enriched binding of the i20S catalytic subunits (β1i, β2i and β5i, i.e. PSMB8-10 respectively, labeled in yellow) compared to their s20S counterparts (β1, β2 and β5, i.e. PSMB5-7 respectively). The control co-IP was performed using the OX8 IgG1 unrelated monoclonal antibody directed against rat CD8 alpha, as published earlier (PXD027436)\u003ca href=\"https://paperpile.com/c/8TRL7z/Kd8D\"\u003e\u003csup\u003e29\u003c/sup\u003e\u003c/a\u003e \u003cstrong\u003eB) \u003c/strong\u003eQuantification of the ratios of the corresponding catalytic i20S/s20S subunits upon PA200 pulldown of testes tissue and compared to total 20S pulldown of the same testes’ samples using an anti-α2 antibody. i20S subunits are significantly enriched compared to their s20S counterparts. A paired, two-sided t-test was used with *: p\u0026lt;0.05, **: p\u0026lt;0.01, n=4.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/cbbeb95071163a8731d9045f.png"},{"id":83682569,"identity":"b4ddfce0-ef6e-4b9b-af2a-7215004a3691","added_by":"auto","created_at":"2025-05-30 16:31:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":454679,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInterplay between PA200 and i20S expression in physiological contexts.\u003c/strong\u003e RTqPCR-mediated quantification of PSME4 (PA200) and PSMB8-10 (β1i, β2i and β5i) in primary human lung fibroblasts (phLF) treated with \u003cstrong\u003e(A-C)\u003c/strong\u003e TGF-β1 or\u003cstrong\u003e (D)\u003c/strong\u003e IFNγ or in\u003cstrong\u003e (E) \u003c/strong\u003emouse macrophages infected by \u003cem\u003eMycobacterium tuberculosis Mtb\u003c/em\u003e. phLFs were treated with TGF-β1 or IFNγ for 24 hours using several phLF cell lines derived from different donors (8 independent experiments). Murine bone-marrow derived macrophages were infected with \u003cem\u003eMtb\u003c/em\u003e for 24 h at a ratio of 3:1 (4 independent experiments) and RTqPCR analysis was performed. For \u003cstrong\u003eA\u003c/strong\u003e, \u003cstrong\u003eD \u003c/strong\u003eand \u003cstrong\u003eE\u003c/strong\u003e, expression of the target gene was normalized to Hypoxanthine phosphoribosyltransferase (HPRT) and the respective untreated control using the 2\u003csup\u003e-ΔΔCT\u003c/sup\u003e method. The control was set to 1, as indicated with the dashed line. One sample t-test was applied with *: p\u0026lt;0.05, **: p\u0026lt;0.01, ***: p\u0026lt;0.001, ****: p\u0026lt;0.0001. \u003cstrong\u003e(B)\u003c/strong\u003e Volcano plot comparison of proteomic analyses of the proteasome co-immunoprecipitations (CoIPs) of phLFs treated with TGF-β1 (right) vs. vehicle-treated respective controls (left). Anti-α2 proteasome subunit antibody was used for the CoIPs. Paired t-test was used. Proteomic data was filtered to display only the proteasome complex subunits and proteasome-regulating proteins. Gene names PSMB8, PSMB9, PSMB10 and PSME4 are used instead of unique protein identifiers for ease of readability. \u003cstrong\u003e(C)\u003c/strong\u003e Variations of abundances of CoIPed PA200, immunosubunits and standard subunits upon TGF-β1 treatment, as determined by MS quantification (see Materials and Methods section). Data are shown as mean values, the standard deviations, and the individual values of each replicate (n=4).\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/58dc57c98cbf8e5c0d364b60.png"},{"id":83682233,"identity":"ba563992-8f80-4211-ac20-a8223602ab2f","added_by":"auto","created_at":"2025-05-30 16:23:40","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":315570,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePA200 depletion reduces immunoproteasome expression but immunoproteasome deficiency does not affect PA200 expression. \u003c/strong\u003eExpression of PA200 and i20S subunits in the lung cancer cell lines A549 \u003cstrong\u003e(A)\u003c/strong\u003e and H1299 \u003cstrong\u003e(B)\u003c/strong\u003e upon CrispRCas9-mediated depletion of PA200. Three different WT and PA200 KO clones were analyzed for expression of PA200 and PSMB8-10 as well as for the proteasomal α subunits 1-7. Blots were normalized to β-actin and densitometric analysis shows quantification of expression relative to average WT levels set to 1 (one-sample t-test, n=3). \u003cstrong\u003e(C) \u003c/strong\u003eprimary mouse skin fibroblasts were prepared from PSMB8, PSMB9, and PSMB10 KO mice and compared to cells isolated from WT mice. Single subunits were reconstituted into the respective KO cells using a Dox-inducible lentivirus expressing the single mouse i20S cDNA together with green-fluorescent protein (GFP). WT cells were infected with an empty GFP-expressing lentivirus. Expression of the i20S subunits was analyzed by immunoblotting for the respective subunits. Detection of GFP served as a control for effective Lenti-viral transduction of cells. PA200 (PSME4) RNA expression was analyzed by RTqPCR under each condition and expression was normalized to the house-keeping gene Ribosomal protein L19 (RPL19) and to the WT control using the 2\u003csup\u003e-ΔΔCT\u003c/sup\u003e method (one-sample t-test, n=3 independent experiments, data are shown as mean values, the standard deviations, and the individual values for reach replicate).\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/a9c7f921a34508da247f3b83.png"},{"id":83682576,"identity":"bf5d1294-4d60-4ef7-abb5-e31a90e41c37","added_by":"auto","created_at":"2025-05-30 16:31:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12483748,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/067dab7c-4635-4d1c-8528-caf26605bc7d.pdf"},{"id":83682204,"identity":"d9ed68be-68ef-421b-90b3-b0d67541a519","added_by":"auto","created_at":"2025-05-30 16:23:38","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4610660,"visible":true,"origin":"","legend":"Supplementary Figures - Microsoft Word document","description":"","filename":"Zivkovicetal2025UncoveringtheUnexpectedRoleofProteasomeActivatorPA200inRegulatingImmunoproteasomeSI.docx","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/738d5681d864f0f907055dfa.docx"},{"id":83682188,"identity":"5a4d3427-60f2-457c-ad21-a38a779574a5","added_by":"auto","created_at":"2025-05-30 16:23:36","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":14405,"visible":true,"origin":"","legend":"Access to raw data","description":"","filename":"Accesstorawdata.docx","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/d77eaad39c578ff52403d450.docx"},{"id":83682234,"identity":"f2ed3b33-10ba-4cde-99ee-1e38e55cd9a6","added_by":"auto","created_at":"2025-05-30 16:23:40","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1028707,"visible":true,"origin":"","legend":"Reporting Summary","description":"","filename":"NCOMMS2537117Trs.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6620945/v1/10a887beaf429fde080ef7fd.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Uncovering the Unexpected Role of Proteasome Activator PA200 in Regulating Immunoproteasome Expression and Activity","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe proteasome is a large macromolecular machinery that facilitates regulated proteolysis of protein substrates in the cell. It plays an essential role in maintaining protein homeostasis by degrading proteins that are either damaged or no longer needed by the cell. Additionally, the peptides generated by the proteolytic activity of the proteasome are also used as antigens for presentation on major histocompatibility complex (MHC) class I molecules to the immune system, i.e. CD8 T cells\u003csup\u003e1\u003c/sup\u003e. The proteome is composed of the catalytic core particle,\u003cem\u003e i.e.\u003c/em\u003e the 20S proteasome, and a large number of associated proteasome regulators\u003csup\u003e2\u003c/sup\u003e. As such, the proteasome actually represents a family of distinct complexes that rapidly assemble and re-assemble to fine-tune protein degradation according to cellular needs\u003csup\u003e3\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe 20S proteasome is a barrel-shaped protease composed of two outer \u0026alpha; and two inner \u0026beta; rings of seven subunits each\u003csup\u003e4\u003c/sup\u003e. Three of the seven \u0026beta; subunits form the active sites containing N-terminal threonine residues as active centers. These \u0026beta;1, \u0026beta;2, and \u0026beta;5 subunits of the standard 20S (s20S) proteasome possess caspase-like (C-L), trypsin-like (T-L), and chymotrypsin-like (CT-L) activities cleaving proteins after acidic, basic and hydrophobic amino acids, respectively\u003csup\u003e4\u003c/sup\u003e. In addition to the \u0026beta;1, \u0026beta;2, and \u0026beta;5 subunits, proteasomes can also contain an alternative set of catalytic subunits (\u0026beta;1i, \u0026beta;2i, \u0026beta;5i) resulting in formation of a distinct form of the proteasome called the immunoproteasome (i20S)\u003csup\u003e5\u003c/sup\u003e. In general, expression of \u0026beta;1i, \u0026beta;2i, \u0026beta;5i is induced upon viral infection or inflammatory signaling, and i20S plays an important role in anti-viral and anti-cancer immune responses\u003csup\u003e5\u003c/sup\u003e. In immune cells, the i20S is the predominant form of the proteasome\u003csup\u003e6,7\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe 20S core particle also binds to proteasome regulators, including the predominant 19S regulatory particle\u003csup\u003e8,9\u003c/sup\u003e, PA28\u0026alpha;\u0026beta;, PA28\u0026gamma;, and PA200 (also known as PSME4)\u003csup\u003e5\u003c/sup\u003e. While the cellular function of 19S, PA28\u0026alpha;\u0026beta; and PA28\u0026gamma; are well studied\u003csup\u003e3\u003c/sup\u003e, the function of PA200 is still enigmatic\u003csup\u003e10\u003c/sup\u003e. Accumulating evidence indicates that the cellular function of PA200 appears to be cell type and differentiation specific, and includes roles in DNA damage repair, chromatin remodeling\u003csup\u003e15\u0026ndash;17\u003c/sup\u003e, aging\u003csup\u003e18\u003c/sup\u003e, differentiation\u003csup\u003e19\u003c/sup\u003e, and mitochondrial and protein stress responses\u003csup\u003e13,20\u0026ndash;22\u003c/sup\u003e. PA200 exerts these effects by engaging the 20S catalytic core either on one side or on both sides forming singly- or doubly-capped 20S proteasome complexes\u003csup\u003e11,12\u003c/sup\u003e, as well as by binding to the free end of the 26S proteasome complex\u003csup\u003e13\u003c/sup\u003e. In all cases, PA200 binding results in activation of proteasome activity, although mechanism of activation remains unclear\u003csup\u003e11,14\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eRecently, we and others have demonstrated that PA200 binds the i20S. This binding appears to play an important role in abrogating antitumor immunity in lung cancer by modulating i20S activity and the antigen diversity generated through i20S proteolysis\u003csup\u003e14\u003c/sup\u003e. However, the mechanisms that govern these effects, as well as molecular determinants of PA200 interactions with i20S remain unknow. Here, we investigated the interplay of PA200 and the immunoproteasome by combining structural analysis of i20S-PA200 complexes with biochemical and cellular analyses. We solved cryoEM structures of the i20S singly or doubly-capped by PA200, and observed that binding of the first PA200 molecule induces major structural rearrangements in i20S that result in enhanced formation of doubly-capped i20S\u0026ndash;PA200 complex and increased activation. This represents a unique feature of the i20S-PA200 interactions as these large conformational changes were not observed in previous s20S-PA200 studies\u003csup\u003e11,12\u003c/sup\u003e. By analyzing cellular and tissue data, we discovered that regulation of the expression of PA200 and the catalytic subunits of the i20S depends on the cellular context. Furthermore, our data also suggest that PA200 regulates i20S gene expression, and thereby proteasome composition.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e \u003ch2\u003eStructural analysis of immunoproteasome-PA200 complexes\u003c/h2\u003e \u003cp\u003eWe obtained high resolution structures for both singly- and doubly-capped i20S-PA200 complexes (2.85 \u0026Aring; and 2.89 \u0026Aring; resolution, respectively). Although the doubly-capped structure of the i20S-PA200 complex is similar to s20S-PA200\u003csup\u003e11,12,23\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, see Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e for details on 3D classification), the structure shows a remarkable \u0026ldquo;bend\u0026rdquo; of the entire complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C) which has not been documented in proteasome structures before. The bend propagates from the \u0026ldquo;top\u0026rdquo; PA200 molecule, which is superimposed with the corresponding PA200 in recently solved s20S-PA200 structure (6REY.pdb) with minimal Root Mean Square Deviation (RMSD\u0026thinsp;~\u0026thinsp;1.7 \u0026Aring;; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). From that region, the structure of i20S-PA200 begins to \u0026ldquo;bend\u0026rdquo;, as indicated by the gradual increase in calculated RMSDs to its maximal value in the \u0026ldquo;bottom\u0026rdquo; PA200 (RMSD\u0026thinsp;~\u0026thinsp;6.8 \u0026Aring;; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Thus, in the i20S-PA200 complex the entire axes of the complex bends when compared to s20S-PA200, resulting in major shift of the opposite unbound α-ring (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eImportantly, the same structural shifting/tilting behavior was evident in singly-capped i20S-PA200 structures (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and S2A-C), implying that binding of the first PA200 molecule is sufficient to induce this long-range allosteric change that is not further affected by the second PA200 binding event. PA200 binding to the \u0026ldquo;top\u0026rdquo; of i20S results in allosteric displacement of α-ring subunits at the opposing end of the i20S, as seen by comparing the previously reported structure of apo i20S and the i20S in our complex bound to a single PA200 molecule (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In contrast, the same comparison of the apo s20S and s20S bound to a single PA200 regulator shows almost perfect overlay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), indicating that the bending behavior is unique to i20S. Of note, we detected two molecules of inositol hexakisphosphates (IP6, phytic acid) binding to the positively charged grooves of PA200 (Figure S3), whereas previous structures of s20S-PA200 identified both IP6 and (5,6)-bisdiphosphoinositol tetrakisphosphate (5,6[PP]2-IP4)\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The exact role of this binding remains unclear.\u003c/p\u003e \u003cp\u003eProteasome activators typically bind to the α subunits of the 20S core to open the inner channel enabling substrate access. The i20S-PA200 complex shows a degree of channel opening comparable to that of the s20S-PA200 (28\u0026ndash;32 \u0026Aring;; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D), which, as expected, is significantly higher than that of the apo s20S and i20S complexes, but remarkably larger than that of the only partially open s20S-PA28αβ\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e and i20S-PA28αβ\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e complexes (9\u0026ndash;10 \u0026Aring;). This indicates that PA200 opens the gate of the s20S and i20S particles to a wider extent than PA28αβ.\u003c/p\u003e \u003cp\u003eDetailed analysis of the catalytic sites also revealed significant differences when comparing the structures of the i20S and i20S-PA200 complexes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In addition to subtle structural rearrangements within active sites of all three catalytic subunits (β1i, β2i, β5i), we also observed clear changes in electrostatics (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE) suggesting that PA200 binding induces long distance structural changes that ultimately result in changes is catalytic activity.\u003c/p\u003e \u003cp\u003eTaken together, our high resolution cryo-EM structures of singly- and doubly-capped i20S-PA200 complexes showed that binding of a single PA200 induces long-range conformational changes that are transmitted across the entire i20S. These changes were not previously seen in s20S, suggesting that this represents i20S-specific behavior. Lastly, we hypothesize that the long-distance conformational changes triggered by the first PA200 molecule binding facilitate engagement of the second PA200 molecule, leading to enhanced occupancy. In parallel, PA200 binding introduces subtle changes in structure and electrostatics within the three active site. Together, these effects \u0026ndash; enhanced occupancy and active site modulation \u0026ndash; are likely to synergize, resulting in increased catalytic activity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePA200 binds and activates the i20S more efficiently than the s20S\u003c/h2\u003e \u003cp\u003eTo examine PA200 binding to i20S further and compare it to s20S, we used mass photometry, a method that measures molecular weights of single molecules (\u0026gt;\u0026thinsp;40 kDa) in solution at nM concentrations\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. For that, purified human i20S and s20S were incubated for 2 h with increasing amounts of recombinantly expressed and purified human PA200 at increasing PA200:20S molar ratios from 0 to 12. We detected free 20S, singly-capped and doubly-capped proteasome complexes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). As expected, the total occupancy of the 20S increased with the PA200 to 20S ratio. We observed a higher occupancy of the i20S by PA200, compared to the s20S (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). This titration allowed us to estimate the K\u003csub\u003ed\u003c/sub\u003es for PA200 binding to the i20S and the s20S (20\u0026ndash;30 nM for the first binding event, and 40\u0026ndash;60 nM for the second binding event; Figure S4). We next determined the activation of i20S vs. s20S by PA200 using fluorogenic peptides for the three active sites. Activities were determined for \u003cem\u003ein vitro\u003c/em\u003e complexes at increasing PA200:20S molar ratios (ranging from 0 to 8). As expected from our mass photometry data, binding of PA200 to the i20S resulted in the activation of the three main types of 20S proteolytic activities, namely the CT-L, T-L, and C-L. In particular, the PA200-bound i20S was significantly more active towards CT-L and T-L sites than the PA200-capped s20S (Fig.\u0026nbsp;4). Moreover, while the baseline CT-L and T-L activities of the i20S and s20S were similar, the i20S showed very low C-L activity compared to the s20S (Fig.\u0026nbsp;4A), in line with published data\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIt was suggested that the IP6 and 5,6[PP]2-IP4 identified in the s20S-PA200 structures could be involved in regulating the activity of PA200\u003csup\u003e10\u0026ndash;12\u003c/sup\u003e. In order to test this hypothesis, we assessed the effect of phytic acid on the activity of the i20S and s20S in the presence and absence of PA200 using different fluorogenic substrates specific for the distinct active sites in an \u003cem\u003ein vitro\u003c/em\u003e substrate assay\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Despite a slight but significant decrease of the CT-L activity (LLVY substrate) for both 20S subtypes, our results show a strong increase of the three activities that are specific of the i20S, namely β1i (PAL), β2i (LRR) and β5i (ANW), in the presence of IP6 (Figs.\u0026nbsp;4B-C).\u003c/p\u003e \u003cp\u003eOur \u003cem\u003ein vitro\u003c/em\u003e binding studies and activity assays, further support our conclusion that binding of the first PA200 induces an allosteric widening of the opposite unbound α-ring, resulting in a higher binding occupancy of the i20S compared to the s20S. This results in a more efficient and stronger activation of all three active sites compared to the s20S, and more specifically of the CT-L and T-L activities that favor the generation of MHC-I antigenic peptides\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \n\u003ch3\u003eEnriched binding of i20S to PA200 in tissues\u003c/h3\u003e\n\u003cp\u003eTo examine whether PA200 preferentially engages i20S over s20S in cells and tissues, we examined our previously generated dataset from bovine testes (PXD027436)\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e that displays high levels of PA200 expression. Our interactome analysis of immunoprecipitated PA200 from bovine testes demonstrated enriched incorporation of the i20S subunits PSMB8-10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, in blue) compared to their s20S counterpart subunits PSMB5-7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, in yellow) into PA200-containing proteasome complexes. We confirmed enriched assembly of i20S with PA200 by comparing our PA200-pulldown data with an interactome obtained upon immunoprecipitation with an anti-α2 antibody that binds to an α subunit of the 20S proteasome and thereby pulls down all proteasome complexes within the tissue\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, the ratios of the i20S/s20S catalytic subunits were significantly higher in the anti-PA200-coIP compared to the anti-α2-coIP samples. Given the fact that the anti-α2 antibody captures all 20S-containing proteasome complexes\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, these data confirm that PA200 preferentially binds to the i20S compared to the s20S, which is fully in line with our \u003cem\u003ein vitro\u003c/em\u003e data on structural interactions and activation presented above.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eRegulation of i20S-PA200 interaction on the cellular level\u003c/h3\u003e\n\u003cp\u003eUnder physiological conditions, the expression patterns of PA200 and the i20S seem to be distinct. More specifically, PA200 (PSME4) is highly expressed in adult and fetal reproductive organs such as ovaries and testes\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, while the i20S subunits are abundantly expressed in immune cells such as monocytes, CD4, CD8, and natural killer (NK) cells (Figure S5). Therefore, we examined relationships between PA200 and i20S subunits\u0026rsquo; expression and their regulation. To analyze the regulation of the i20S under conditions of PA200 induction, we used primary human lung fibroblasts (phLF) that were treated with TGF-β1 to upregulate PA200\u003csup\u003e19\u003c/sup\u003e. \u003cem\u003eVice versa\u003c/em\u003e, we investigated PA200 regulation under conditions of i20S activation in interferon gamma (IFNγ) stimulated phLF and upon infection of murine bone-marrow derived macrophages with \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eMtb\u003c/em\u003e)\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. On the RNA level, TGF-β1 treatment upregulated PA200 in several primary lung fibroblast (phLF) lines but uniformly downregulated the three i20S catalytic subunits PSMB8-10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Elevated incorporation of PA200 reduced assembly of i20S subunits which was confirmed by an interactome analysis of TGF-β1-treated phLFs compared to untreated controls (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-C), using the anti-α2 antibody for pulldown of all crosslinked proteasome complexes. phLFs were also stimulated with IFNγ, resulting in the upregulation of the i20S, as indicated by a significant increase in PSMB8-10 expression, but without any impact on PA200 mRNA levels as determined by RTqPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Similarly, \u003cem\u003eMtb\u003c/em\u003e infected mouse macrophages strongly upregulated the i20S subunits PSMB8-10 but did not alter PA200 RNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). These data support the notion that PA200 and the i20S are differentially regulated under conditions of differentiation, cytokine treatment and infection.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eRegulation of PA200 by the immunoproteasome and vice versa\u003c/h3\u003e\n\u003cp\u003eGiven the differences in expression patterns, we wondered whether PA200 itself is involved in the regulation of the i20S and \u003cem\u003evice versa\u003c/em\u003e. To probe these questions, we used PA200 knockout (KO) human lung cancer cell lines A549 and H1299\u003csup\u003e27\u003c/sup\u003e. Genetic depletion of PA200 in A549 and H1299 reduced expression of the β1i catalytic subunit (PSMB9 gene) in both its pre-mature and mature forms (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-B). These data were confirmed upon pulldown of 20S complexes using the anti-α2 antibody and interactome analysis demonstrating that the absence of PA200 impairs the assembly of β1i containing i20S complexes (Figure S6A). This resulted in an altered cellular composition of 20S complexes with reduced formation of intermediate proteasomes containing the two immunocatalytic subunits β1i and β5i (β1iβ5i i20S) and an increase in complexes harboring only the immunocatalytic subunit β5i (β5i i20S) (Figure S6A)\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Concerted and even more pronounced downregulation of the i20S catalytic subunits PSMB8 and PSMB9 was observed on the RNA level upon transient silencing of PA200 in A549 cells (Figure S6B). To analyze whether the i20S regulates PA200, we made use of primary mouse skin fibroblasts isolated from single i20S subunit KO mice\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In these cells we reconstituted the respective i20S subunits with a doxocycline-inducible lentiviral expression system (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Analysis of PA200 RNA expression in i20S single KO and reconstituted cells (virus\u0026thinsp;+\u0026thinsp;Dox), however, did not reveal any regulation of PA200 by single i20S subunits (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Our results suggest that PA200 regulates the relative amounts of i20S catalytic subunits and, thus, composition of i20S complexes, while the i20S single subunits do not affect PA200 expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this work, we characterized interaction of PA200 with the i20S and compared it to s20S-PA200 interactions using structural, proteomic and cell biological approaches. We observed that the structure of the singly-capped i20S-PA200 complex differs significantly from that of the s20S-PA200. Despite an overall very similar fold and opening of the gate, our structural analysis uncovered several striking differences. Firstly, we observed a general bend of the singly-capped i20S-PA200, not seen in the three recent s20S-PA200 structures\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e or in any other proteasome activator bound 20S complexes \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Second, this bend is accompanied by an increase of the outer diameter of the unbound side of the i20S compared to the s20S, displacing atoms up to 5.4 \u0026Aring;. Using mass photometry, we obtained evidence that the abundance of the singly- and doubly-capped complexes relative to the total proteasome particles was higher for the i20S compared to the s20S. Our data thus suggest that this allosteric bending increases the occupancy of the second PA200 molecule. Such preferred formation of doubly-capped PA200-i20S complexes would thereby indirectly shift the composition of mixed proteasome complexes\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e, which contain two different activators, in favor of the PA200-only containing proteasome complexes. Third, we detected differential allosteric effects on the catalytic active sites upon binding of PA200 to i20S. These structural shifts and higher occupancy levels were associated with an increased activation of the i20S compared to the s20S upon PA200 binding, as shown by \u003cem\u003ein vitro\u003c/em\u003e activity assays. More precisely, we observed that PA200 induced a four- to ten-fold increase in trypsin- and chymotrypsin-like activities and a significant activation of the caspase-like activity, although this activity is generally low in the i20S. This is a significantly higher level of activation compared to s20S. These divergent data for PA200-mediated activation of i20S and s20S might partly explain the conflicting reports of previous cellular studies on the activation of all three proteolytic activities by PA200 (discussed in detail in\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e). Lastly, we detected the presence of two phytic acid molecules in i20S-PA200 complexes whereas s20S-PA200 complexes associated with both IP6 and 5,6[PP]2-IP4. We show here that IP6 further enhances the activation of the i20S by PA200, suggesting that it probably acts as a cofactor. Although the mechanism by which IP6 affects proteasome activity remains to be determined, we propose that this negatively charged molecule binds and neutralizes the positively charged substrate entry channels in PA200, which, in turn, promotes recognition and/or entry of basic substrates and alters substrate specificity.\u003c/p\u003e \u003cp\u003eWe confirmed that PA200 and i20S engage in cells and tissues by analyzing i20S-PA200 and s20S-PA200 complexes in testis, an organ that highly expresses PA200 and the i20S\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. In that tissue, we discovered that PA200 preferentially binds i20S over s20S. However, the majority of tissues doesn\u0026rsquo;t co-express both PA200 and the i20S subunits, suggesting that PA200-mediated activation of i20S is highly context dependent. Along these lines, we showed that cellular conditions that upregulated PA200 (\u003cem\u003ee.g.\u003c/em\u003e the profibrotic cytokine TGF-β1) or the i20S (\u003cem\u003ee.g.\u003c/em\u003e IFNγ, bacterial infection) did not result in concerted transcriptional regulation, suggesting that expression of PA200 and the catalytic subunits of the i20S is differentially regulated.\u003c/p\u003e \u003cp\u003ePrevious studies have shown that bacterial or viral infections result in downregulation of PA200\u003csup\u003e10\u003c/sup\u003e. This raises the intriguing possibility that i20S function is fine-tuned by differential expression of proteasomal activators. For example, the PA28αβ activator, which is constitutively co-expressed with the i20S in immune cells\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e, has been shown to preferentially bind to the i20S\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e and activate its proteolytic activity to generate MHC-I antigenic peptides that activate CD8 T cell responses, \u003cem\u003ee.g.\u003c/em\u003e upon viral infections\u003csup\u003e\u003cspan additionalcitationids=\"CR45\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. The other member of the PA28 family of activators, \u003cem\u003ei.e.\u003c/em\u003e PA28γ, is also able to bind and activate the i20S\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. PA28γ, however, is exclusively expressed in the nucleus and thereby only binds to nuclear i20S. PA28γ has been shown to destroy antigenic peptides which are derived from nuclear pioneer translation products serving as an important source for tumor-derived antigenic peptides\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. As PA28γ is upregulated in many types of tumors it may thereby help tumors to escape from immune surveillance\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. This type of function was also recently proposed for PA200 based on the observation that addition of recombinant PA200 to cell extracts reduced inflammatory activation of the i20S\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. In the same cells, PA200 bound strongly to cytokine-induced i20S in pulldown experiments, which is in line with our data.\u003c/p\u003e \u003cp\u003eOur data clearly indicate that PA200 binding to the i20S results in prominent activation of β1i, β2i and β5i active sites compared to the s20S. While an increase of the CT-L and T-L activities would favor generation of MHC-I antigenic peptides, activation of the intrinsically low C-L activity in the i20S is detrimental for the production of proper MHC-I ligands and efficient antigen presentation\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Thus, the ability of PA200 to significantly increase the C-L activity of the i20S could at least partly explain the reduced diversity of presented antigenic peptides and the lack of response to immunotherapy observed in lung carcinoma\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn addition to the direct effect described above, whereby PA200 binding triggers long-range conformational changes resulting in i20S activation, we also show here that PA200 affects β1i expression. Hence, our data uncover a novel link between PA200 regulation and cellular composition of the proteasome that has not been reported before. This transcriptional regulation may have major implications for antigenic repertoire generation. As such, reduced expression of β1i in PA200 deficient cells might contribute to an altered MHC-I antigenic diversity\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Indeed, the replacement of a constitutive subunit by its immunosubunit counterpart, and \u003cem\u003evice versa\u003c/em\u003e, can result both in generation and destruction of specific antigenic epitopes\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e,\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. A similar transcriptional regulation of i20S catalytic subunit expression has been demonstrated for PA28γ\u003csup\u003e51\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn conclusion, here we describe a unique \u0026ldquo;bent\u0026rdquo; conformation of the immunoproteasome induced by PA200 binding. This proteasome activator show preference for immunoproteasome over the standard proteasome, and the binding results in increased proteolytic activity in all three active sites (β1i, β2i and β5i). Intriguingly, we discovered that PA200 regulates i20S subunits\u0026rsquo; expression, which constitutes another explanation for the reported role of PA200 in modulating anti-tumor immunity\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Our results thereby extend our understanding of PA200, and reveal new layers of i20S regulation.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePurification of s20S and i20S from HEK293-EBNA Cell Lines\u003c/h2\u003e \u003cp\u003eThe procedure was done as described in\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Proteasome purification was done using MCP21 antibody, produced in-house from a hybridoma, grafted onto cyanogen bromide-activated Sepharose beads. HEK293-EBNA cells, expressing either i20S or s20S, were lysed in a pH 7.6 lysis buffer containing 20 mM Tris-HCl, 100 mM NaCl, 10 mM EDTA, 0.25% Triton X-100, and one tablet of protease and phosphatase inhibitors per 50 mL (cOmplete\u0026trade; ULTRA Tablets Mini EDTA-free and PhosSTOP, Roche, Basel, Switzerland). Lysate was sonicated with a Vibracell sonicator (10 cycles of 30 s on and 1 min off, at 50% active cycle) and the lysate clarified by centrifugation at 16,000\u0026times; g for 30 min, and the supernatant was filtered through a 0.22 \u0026micro;m membrane. The filtered lysate was incubated overnight with MCP21 antibody-grafted beads. The following day, the beads were washed with equilibration buffer (20 mM Tris-HCl, 1 mM EDTA, 10% glycerol, 100 mM NaCl, pH 7.6) and eluted using the same buffer supplemented with 3 M NaCl. The eluate was concentrated to 0.5 mL using 100 kDa MWCO centrifugal filters and applied to a size exclusion chromatography on a Superose 6 10/300 GL column with TSDG buffer (10 mM Tris-HCl pH 7.0, 1 M KCl, 10 mM NaCl, 5.5 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 10% glycerol). Proteasome enzymatic activity was assessed, and active fractions (eluted between 10\u0026ndash;14 mL) were pooled. Buffer exchange with equilibration buffer and concentration were performed using 100 kDa MWCO centrifugal filters. Glycerol was added to a final concentration of 20% and aliquots were snap-frozen in liquid nitrogen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRecombinant human PA200\u003c/h3\u003e\n\u003cp\u003ePurification of recombinantly expressed human PA200 was done, as recently described\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. The isolated PA200 was stored at a final concentration of 1 mg/ml to be used for cryo-EM analysis and other \u003cem\u003ein vitro\u003c/em\u003e assays.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCryo EM analysis of i20S-PA200 complexes\u003c/h2\u003e \u003cp\u003ei20S was obtained commercially from R\u0026amp;D Systems (Catalog #: E-370, 10 microliter, 25 microgram: \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eHuman 20S Immunoproteasome Protein, CF E-370-025: R\u0026amp;D Systems\u003c/span\u003e) and complexes were formed upon addition of 8x molar excess of PA200 upon overnight incubation. Before plunge freezing, QUANTIFOIL R2/1 copper grids (200 mesh) were cleaned using a glow-discharger (Leica EM ACE 200) at 8 mA for 60 seconds. 3uL of PA200-i20S sample (0.3 g/l) was added on the grids and plunge-frozen using a Vitrobot Mark IV (Thermo Fisher) set to 95% humidity and 4\u0026deg;C with 2 seconds for wait time, blot force 5 and 1 second for blotting time. Micrographs were acquired at 300 kV using a Titan Krios G4i (Thermo Fisher; HZ Munich, Germany) equipped with a Selectris energy filter and a Falcon4i direct electron detector. A dataset of 23355 micrographs was collected with 0.95 A pixel size and 1.5\u0026ndash;2.5 \u0026micro;m under-focus in 60 frames accumulating 60 e/A^2 total dose.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eImage processing and volume reconstruction\u003c/h2\u003e \u003cp\u003eCryo-EM datasets were processed using Cryo-EM Single Particle Ab-Initio Reconstruction and Classification (CryoSPARC 4.5.3) software\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Imported movies were subjected to motion correction, CTF estimation and manual exposure curation. Around 3% of micrographs were discarded because of unsatisfying CTF resolution estimation, astigmatism or frame motion. Next, a small subset of 200 micrographs was used for preliminary particle picking with a blob picker. After picking, nearly 40.000 particles were 4x binned, extracted with a box size of 100 pixels and 2D classified into 50 classes. 7 classes containing images of supposably full complex (the one with two caps, i.e. PA200 complexes) comprising 4627 particles were used in Ab-initio reconstruction and preliminary Homo refine jobs. The obtained volume was then used to generate 50 templates for template picking on the full dataset. Picked particles were inspected and 4768272 were again 4x binned and extracted with the box size of 100 pixels. Next, a couple of rounds of subsequent 2D classifications were made in 4 parallel groups containing similar numbers of particles. As most of the obtained sequential classes contained just the cup particles, only 532792 particles were used in further processing steps. Sequential 3-class Ab-initio, Hetero-refinement, and 3D classification resulted in three subpopulations for uncapped, 1-cap and 2-cap complexes holding 87822, 175565, and 156772 particles respectively. From the groups, preliminary binned volumes were refined and 3% of the best particles giving the highest CTF resolution estimation were used to train the neural network Topaz picker\u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. Trained model picking resulted in 607937 picked particles, after removal of duplicates. After 2D classification, 486195 particles were selected as believed to be images of the complex. The next steps were a couple of rounds of 3D classification and Hetero refinement to separate the particles of two different complexes, i.e. 1-cap with 225565 particles and 2-cap with 187565 particles. Both densities were NU-refined and Hetero-refined on two identical volumes from NU-refine iteratively. This procedure increased the resolution and was terminated when the resolution of NU-refinement was worse than the step before. The best resolution density was again locally refined and post-processed with DeepEMhancer\u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. Finally, 2.85\u0026Aring; and 2.89\u0026Aring; volumes were obtained for 1-cap and 2-cap complex, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eModel building and refinement\u003c/h2\u003e \u003cp\u003eThe PA200 model from PDB 6REY was extracted and fitted into electron density map using Dock in map tool in PHENIX suite\u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. The backbone geometries and orientation of the side-chains were then refined and model was manually rebuilt using Coot\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. We iteratively corrected steric clashes, Ramachandran and rotamer outliers manually in Coot followed by further refinement using phenix.real_space_refine. Detailed model evaluation was done using Molprobity\u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eProteasome activity assays\u003c/h2\u003e \u003cp\u003eThe proteasome substrate-based activity assays were performed in a 384-well black plate (Greiner Bio-One, UK). Purified 20S proteasome sample at 0.28 \u0026micro;M (either s20S or i20S) was mixed with 0.56 \u0026micro;M recombinant PA200 regulator in different ratios and left to interact for 30 min at room temperature (22\u0026deg;C). After they were allowed to interact, the complexes were diluted with 50 mM Tris HCl pH 7.6 to a concentration of 3 nM 20S. As a control, both s20S and i20S, was diluted to a concentration of 3 nM. All diluted samples were distributed into wells in aliquots of 20 \u0026micro;L, to which 20 \u0026micro;L of 400 \u0026micro;M fluorogenic peptide substrate was added (prepared in 50 mM Tris-HCl pH7.6): Suc-LLVY-AMC, Boc-LRR-AMC or z-LLE-AMC, to probe for chymotrypsin-, trypsin- or caspase-like activities, respectively. The final proteasome concentration in the reaction was 1.5 nM. The kinetic assays were performed at 37\u0026deg;C in a CLARIOstar Plus spectrofluorometer (BMG Labtech) over 60 min with one reading every 5 min, at 360 nm for excitation and 460 nm for emission. The slope of the kinetic assay (increase in fluorescence intensity over time) was used to measure proteasome activity. Only slopes at their steepest incline were considered (saturating conditions), after 15-minute temperature equilibration time. At least 5 timepoints were used for slope calculations.\u003c/p\u003e \u003cp\u003eFor analysis of the effects of phytic acid on proteasome function, 0.5 \u0026micro;M PA200 was incubated with 1.5 mM Inositol hexakisphosphate (or IP6, Sigma-Aldrich ref P8810) at room temperature for an hour. i20S (purified from HEK-EBNA cells) was then incubated with PA200 (with and without IP6) at 28 nM and 400 nM, respectively, at room temperature for another hour. The complexes were diluted with 50 mM Tris HCl pH 7.6 to a concentration of 2 nM i20S and assayed for activity in 384-well black plates, as described above using the following substrates: Suc-LLVY-AMC (Bachem), Ac-ANW-AMC (UBPBio), Ac-PAL-AMC (UBPBio), Boc-LRR-AMC (Enzo), z-LLE-AMC (UBPBio), Ac-nLPnLD-AMC (Biosynth), or Ac-GPLD-AMC (Biosynth) to probe for chymotrypsin-, β5i-, β1i-, trypsin- or caspase-like activities, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMass photometry\u003c/h2\u003e \u003cp\u003eProteasome (i20S purified from HEK-EBNA, as described in Fabre et al\u003csup\u003e952\u003c/sup\u003e or s20S purchased from Enzo) was titrated with PA200 for mass photometry as follows: Tris 50 mM pH 7.6 was added to the empty tubes on ice, to compensate for different volumes cause by different theoretical protein ratios (1:0 to 1:12). 20S proteasomes were diluted to 0.2 g/L (0.28 \u0026micro;M) and added to each tube. Recombinantly produced human PA200 was then added to the tubes to form required ratios. Tubes were incubated for 2 h on ice. The complexes were diluted six times immediately before measurement on the Mass photometer (Refeyn Ltd). Acquisition was done using a large field of view, with 60 s recording and default video settings. The acquisition was calibrated using a standard mix of IgG (150 kDa) and thyroglobulin (660 kDa) in Tris-HCl buffer. The data was analyzed in DiscoverMP 1.2 using default settings. The histograms were manually fitted with Gaussian distribution and the counts for each population (PA200 approximately at 200 kDa, PA200 dimer at 400 kDa, 20S at 700 kDa, 20S-PA200 at 900kDa, and PA200-20S-PA200 at 1100 kDa) were recorded.\u003c/p\u003e \u003cp\u003eTables of counts vs nominal molecular weight were then processed in Excel (Microsoft Office) and graph visualisation and affinity calculation was done in GraphPad Prism.\u003c/p\u003e \u003cp\u003eThe experimental molar ratios were obtained based on the actual counts. The fractions of singly- and doubly-capped 20S in total binding site were calculated by obtaining the counts for the singly-capped 20S or 2 x doubly-capped 20S divided by the total possible 20S binding site, which was twice (i.e. two binding sites per 20S) the total 20S population (i.e. 20S alone, singly-, and doubly- capped 20S). These two fractions were then summed up to obtain the total 20S occupied binding site. With the fractions of singly- or doubly- capped 20S vs. the experimental molar ratio curves, non-linear fitting was done using Hill equation in GraphPad Prism giving the Kds and Bmax values at 95% confidence interval.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eCo-IP of proteasome complexes and proteomics - interactomics\u003c/h2\u003e \u003cp\u003eCo-immunoprecipitation was done using anti-PA200 antibodies or anti-α2 proteasome subunit antibodies for hPLF samples and for testis samples. The proteasome complex enrichment procedure for cultured cells is described in detail in \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBriefly, the material is homogenized using a Potter device (testis) or a cell scraper (hPLFs) in native buffer, then centrifuged to remove cell debris. Magnetic Protein G beads were incubated with anti-PA200 or anti-α2 proteasome subunit antibodies and the antibodies were then cross-linked to the beads via short 0.1% formaldehyde treatment. Clarified lysate was then incubated with the magnetic beads coated in antibodies overnight at 4\u0026deg;C. The beads were washed 4 times in lysis buffer, and enriched proteasome complexes are eluted from the beads using SDS. The samples were prepared for proteomics using S-Trap protocol, as described by the supplier (Protifi).\u003c/p\u003e \u003cp\u003eLC-MS method with bioinformatic approach for interactomics is also described in\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Briefly, a standard nano-flow reverse phase LC-MS proteomic method was used, in DDA mode, on an Ultimate 3000 LC system and an Orbitrap Fusion MS instrument. Bottom-up LC-MSMS and Bottom-Up bioinformatic searches were done as described in the Appendix 1 of Zivkovic et al. 2022\u003csup\u003e29\u003c/sup\u003e, with the exception that the fasta-derived \u003cem\u003ein silico\u003c/em\u003e library was human, from the Uniprot Proteome database. The proteomic search was done using the Proline suite, an easy-to-use, open source bioinformatic tool developed in-house\u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFor the analysis of the PA200 KO cell cultures, same lysis conditions, co-immunoprecipitation and protein digestion procedure was followed as described in detail in\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e, however, a different instrumental setup was used for the proteomic analysis.\u003c/p\u003e \u003cp\u003eDigested peptide extracts were desalted on an Evotip C18 EV2001 tips (Evosep) and were analyzed by online nanoLC using an UltiMate 3000 RS nano-LC system (Thermo Scientific) coupled with a TimsTOF SCP mass spectrometer (Bruker). Peptides were separated on a C18 Aurora column (25 cm x 75 \u0026micro;m ID, IonOpticks) using a gradient ramping from 2\u0026ndash;20% of B in 30 min, then to 37% of B in 3 min and to 85% of B in 2 min (solvent A: 0.1% Formic Acid (FA) in H2O; solvent B: 0.1% FA in Acetonitrile (ACN)), with a flow rate of 150 nL/min. MS acquisition was performed in DIA-PASEF mode on the precursor mass range [400-1,000] m/z and ion mobility 1/K0 [0.64\u0026ndash;1.37]. The acquisition scheme was composed of 8 consecutive TIMS ramps using an accumulation time of 100 ms, with 3 MS/MS acquisition windows of 25 Th each. The resulting cycle time was 0.96 s. The collision energy was ramped linearly as a function of the ion mobility from 59 eV at 1/K0\u0026thinsp;=\u0026thinsp;1.6 Vs.cm\u0026thinsp;\u0026minus;\u0026thinsp;2 to 20 eV at 1/K0\u0026thinsp;=\u0026thinsp;0.6Vs.cm\u0026thinsp;\u0026minus;\u0026thinsp;2. The raw data was searched and quantified with DIA-NN 1.9, using a predicted library from UniProt human reference proteome. The result files were then imported into Proline\u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e for validation and label-free quantitation with a False Discovery Rate (FDR) of \u0026le;\u0026thinsp;1.0%, peptide length range set at 7\u0026ndash;30 and precursor charge states of 2\u0026thinsp;+\u0026thinsp;and 3+. For statistics, a t-test p-value threshold of 0.01 was applied at both peptide and protein levels. Only specific peptides were used for quantification, and the median ratio fitting was chosen as the abundance summarizer method. Normalization, missing values inference (if strictly less than three values, 5% centile was applied), t-test and z-test (p-value Benjamini-Hochberg correction) were also applied.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eCell isolation, culture and treatment\u003c/h2\u003e \u003cp\u003eA549 and H1299 non-small cell lung cancer cell lines were grown at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e in a humidified incubator in DMEM/F12 or RPMI-1640 medium, respectively, with supplementation of 10% FBS and 100 U/mL penicillin/streptomycin.\u003c/p\u003e \u003cp\u003eCRISPRCas9-mediated genomic depletion of PSME4 (gene name for PA200) has been described previously by us in detail\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e,\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePrimary human lung fibroblasts (phLF) obtained from organ donors were used as described previously\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Cells were cultured in MCDB medium supplemented with 10% (v/v) FBS (Biochrome), 100 U/mL penicillin/streptomycin (Gibco, Thermo Fisher Scientific), 2 mM L-glutamine (Thermo Fisher Scientific), 5 \u0026micro;g/mL insulin (Thermo Fisher Scientific), 2 ng/mL basic-FGF (Thermo Fisher Scientific), and 0.5 ng/mL human EGF (Sigma-Aldrich). Cells were allowed to grow to 90% confluency before splitting. For subculturing, cells were rinsed with PBS, treated with 0.25% Trypsin-EDTA (Sigma) for 4\u0026ndash;5 minutes at 37\u0026deg;C, re-suspended in fresh culture medium, and transferred to new dishes. All experiments were conducted using phLF between passages 3 and 5. Prior to treatment of phLF, 0.3 x 10\u003csup\u003e6\u003c/sup\u003e cells were seeded into 10 cm plates for 24 h. The cells were then synchronized by culturing them in modified MCDB medium (see above) containing 1% FBS for 24 h. Following synchronization, the medium was refreshed, 5 ng/ml TGF-β1 or 75 U/ml IFN\u0026#120574; were added into the culture medium for 48 h. Cell harvest was achieved by washing the cells with PBS and then detaching the cells by adding 0.25% Trypsin-EDTA and incubating the plates for 5 minutes at 37\u0026deg;C. The process was stopped by adding culture media with 10% FBS, and the collected cells were then centrifuged in a 15 ml falcon tube at 5000 rpm for 5 minutes. Those cell pellets were washed once more with PBS in 1.5 ml Eppendorf tubes before their storage at -80\u0026deg; until further use.\u003c/p\u003e \u003cp\u003eThe method used for \u003cem\u003eprimary mouse skin fibroblast\u003c/em\u003e isolation was reported previously (doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3791/2033\u003c/span\u003e\u003cspan address=\"10.3791/2033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) with minor modifications regarding the culture medium where DMEM was supplied with 10% FBS (Capricorn) and the antibiotic 1\u0026times;Antimycotic (Gibco, 15240062) was used.\u003c/p\u003e \u003cp\u003eBone-marrow derived mouse macrophages (BMDM) were generated from C3HeB/FeJ mice as previously described\u003csup\u003e\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. BMDMs then were cultured at 5 x 10\u003csup\u003e5\u003c/sup\u003e cells/well and incubated overnight in 24-well plates (Nunc-surface). Subsequently cells were infected with \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e H37Rv at a multiplicity of infection (MOI) of 3:1 for 24 h. Total RNA of cells lysed in Trizol (peqGOLD TriFast, VWR International) was extracted by use of DirectZol RNA MiniPrep (Zymo Research) according to the manufacturer\u0026rsquo;s instructions. For reverse transcription of RNA, the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Fisher Scientific) was used.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation of cells\u003c/h2\u003e \u003cp\u003eTotal RNA from cells was extracted using phenol-chloroform extraction with TRIzol Reagent invitrogen). Cells were resuspended in TRIzol Reagent, followed by vigorous mixing with chloroform in Phasemaker tubes. The samples were then incubated for 5 minutes and centrifuged at 16,000 x g for 5 min at 4\u0026deg;C to achieve phase separation. The upper aqueous phase was carefully transferred to a new tube, and 500 \u0026micro;L of isopropanol was added. The samples were incubated for 10 minutes on ice. RNA was pelleted by centrifugation at 16,000 x g for 10 min at 4\u0026deg;C. The supernatant was discarded, and the RNA pellets were washed with 70% (v/v) ethanol. After drying on ice, the RNA pellet was dissolved in 30 \u0026micro;L of nuclease-free water and incubated in a heat block at 55\u0026deg;C for 10 min, and the RNA concentration was measured at 260 nm using the NanoDrop 1000 (ThermoFisher).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eReverse transcription (RT) of mRNA and RT-qPCR\u003c/h2\u003e \u003cp\u003eFor reverse transcription, 0.5 to 1 \u0026micro;g RNA was diluted to 14 \u0026micro;L with nuclease-free water and combined with a 6 \u0026micro;L mastermix of Maxima First Strand cDNA Synthesis Kit for RT-qPCR according to the manufacturer\u0026rsquo;s instructions (ThermoFisher). The reaction was terminated by heating at 85\u0026deg;C for 5 min. The samples were then diluted 1:5 with nuclease-free water.\u003c/p\u003e \u003cp\u003eQuantitative real-time PCR was carried out using a SYBR Green LC480 system (Roche). Each well in the 96-well plate contained a mixture of 2.5 \u0026micro;L cDNA and 5 \u0026micro;L LC480 SYBR Green I Master mix (Roche), along with 2.5 \u0026micro;L of forward and reverse primers, resulting in a final concentration of 0.5 \u0026micro;M. All samples were measured in duplicate, and plates were centrifuged at 1000 rpm for 2 minutes before beginning the measurement, following the standard protocol of the Light Cycler 480II (Roche). Gene expression levels were normalized to the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT). Relative gene expression was calculated using the ΔΔCT method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003ePrimer sequence table\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePSME4 (PA200)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCA ACA GGA AAA GAA TGC CGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCA GGG CAG GTT TCT TTG CT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePSMB8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTATTCTGGAGGCGTTGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGCCTCTTCTTCTCCTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePSMB9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATG CTG ACT CGA CAG CCT TT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCA ATA GCG TCT GTG GTG AA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePSMB10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGC CCG TGA AGA GGT CTG G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAT AGC CTG CAC AGT TTC CTC C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHPRT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGA AGG AGA TGG GAG GCC A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAT CCA GCA GGT CAG CAA AGA A\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eProtein extraction and quantification followed by SDS-PAGE and Western blot analysis\u003c/h2\u003e \u003cp\u003eIn order to evaluate intact and active proteasome complexes, cell pellets were lysed under non-denaturing conditions. Cell pellets were resuspended in OK40 buffer (50 mM Tris-HCl, 5 mM MgCl\u003csub\u003e2\u003c/sub\u003e 10% Glycerol, 0.05% NP-40, 2mM ATP) containing a 1x cOmplete\u0026trade; protease inhibitor cocktail (Roche) and 1x phosphoSTOP (Roche) and lysed through vigorous pipetting followed by a 20 min incubation on ice with additional vigorous pipetting and vortexing. The lysates were then centrifuged at 15,000 rpm for 20 min at 4\u0026deg;C. The supernatant was transferred to new tubes for immediate protein concentration determination using a BCA assay. A bovine serum albumin (BSA) calibration curve, with concentrations ranging from 0 to 2 \u0026micro;g/\u0026micro;L in PBS, was used as a standard for protein quantification. To perform the assay, 20 \u0026micro;L of BSA standard, 2 \u0026micro;L of protein lysate or pure lysis buffer diluted 18 \u0026micro;L in PBS were combined with 200 \u0026micro;L of BCA reagent, following the manufacturer\u0026rsquo;s instructions (Thermo Fisher Scientific). After a 30-minute incubation at 37\u0026deg;C, absorbance was measured at 562 nm using a plate reader for subsequent protein concentration calculation.\u003c/p\u003e \u003cp\u003e15 \u0026micro;g of protein were used per sample for western blotting, and 25 \u0026micro;g for ABP assay. Protein extracts were diluted to equal volumes with Milli-Q\u0026reg; water, then mixed with 6x Laemmli sample buffer. The protein mixture was heated to 95\u0026deg;C for 10 min to denature the proteins. For protein electrophoresis, samples were loaded onto 12% SDS polyacrylamide gels. Protein samples, along with a Protein Marker (#26616, ThermoFisher) were loaded onto SDS polyacrylamide gels. Electrophoresis was carried out using Bio-Rad gel running chambers. Following electrophoresis, proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Bio-Rad) using the tank immunoblotting method. The membrane was first activated in pure methanol, and the transfer was carried out at a constant current of 250 mA for 90 min or an overnight transfer of 40 mA for 960 min. To block nonspecific binding, the PVDF membrane was incubated in Roti\u0026reg;-Block solution (Carl Roth) for 1 h. The membrane was then incubated with the primary antibody, diluted in Roti-Block solution, either overnight at 4\u0026deg;C or for 1 h at room temperature (RT). Afterwards, the membrane was washed three times with PBST (PBS, 1% Tween-20) for 5 min each and incubated with a horseradish peroxidase-conjugated secondary antibody, diluted 1:20,000 in PBST, for 60 min at RT on a shaker. The membrane was then washed three more times with PBST for approximately 20 min in total, and proteins were detected using a chemiluminescent substrate according to the manufacturer's instructions. Protein signals were detected with the iBright CL750 (ThermoFisher). The following antibodies were used: anti-LMP2 (ab242061, Abcam), anti-LMP7 (ab3329, Abcam), anti-MECL1 (ab183506, Abcam), anti-TurboGFP (TA150041, OriGene), anti-GAPDH (14C10, Cell Signaling), anti-PA200 (NBP1-22236, Novus Biologicals).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eLentivirus design and production\u003c/h2\u003e \u003cp\u003eLentiviruses were constructed using the pCW57-MCS1-P2A-MCS2 (GFP) transfer vector (#80924, Addgene). The cDNAs for the three different immunoproteasome subunits LMP7, LMP2 and MECL-1 were amplified from mouse embryonic fibroblasts using primers containing restriction sites for Nhe I-mediated cloning into the vector. The vector pCW57-MCS1-P2A-MCS2 (GFP) was linearized with the restriction enzyme NheI (NEB, #R3131), whose restriction site is located upstream of the P2A region. The cDNAs of the individual immunoproteasome subunits were then integrated into the linearized vector after digestion with NheI using the NEBuilder\u0026reg; HiFi DNA Assembly Master Mix (NEB, #E2621). The construct allows inducible expression of the gene of interest by addition of Doxycycline (Dox). The activity of the tetracycline response element (TRE) promoter is inhibited by a reverse Tetracycline repressor (rTetR), which is expressed by a downstream hPGK promoter, when Dox is absent. In contrast, addition of Dox allows the release of the rTetR from the TRE promoter thereby allowing expression of the gene of interest. The turboGFP gene is driven independently of Dox by the hPGK promoter and allows sorting of lentivirus - infected cells.\u003c/p\u003e \u003cp\u003e5\u0026times;10\u003csup\u003e6\u003c/sup\u003e 293 HEK-T cells were seeded into 10-cm cell culture plates 24 h prior to the transfection of plasmid. Before plasmid transfection, fresh and pre-warmed DMEM supplied with 10% FBS, 25 mM HEPES and 1% L-glutamine was added to the culture plate. 8 \u0026micro;g of transfer plasmid (pCW57-MCS1-P2A-MCS2 (GFP) was used as control, pCW57-LMP2-P2A-GFP, pCW57-LMP7-P2A-GFP or pCW57-MECL1-P2A-GFP) together with 6 \u0026micro;g pSPAX2 (Addgene) and 4 \u0026micro;g pMD2.G (Addgene) were transfected using PEI (Merck, 919012). Cell culture medium was replaced after 8 h of transfection, and lentivirus-containing medium was collected 48 h after medium replacement. Collected lentivirus-containing medium was filtered with 0.45 \u0026micro;m sterile filters prior to use and stored at -80\u0026deg;C.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eLentivirus infection and Dox induction\u003c/h2\u003e \u003cp\u003eFor Lentivirus infection, 3\u0026times;10\u003csup\u003e5\u003c/sup\u003e WT or immunoproteasome-deficient skin fibroblasts were seeded into 6-cm plates 24 h before infection. On the day of infection, either empty lentivirus or lentivirus containing the cDNAs of β1i (PSMB9), β5i (PSMB8), or β2i (PSMB10) were added to the plates with a multiplicity of infection (MOI) of 3 for 48 h. Simultaneously, polybrene (Merck, TR-1003) with a final concentration of 8 \u0026micro;g/ml was added to the medium to enhance infection efficiency. After 48 h, fibroblasts were then washed with PBS to remove residual polybrene and lentivirus. Afterwards, 1 \u0026micro;g/ml Doxycycline (Dox) (Merck, D5207) was applied to infected cells for 96 h to induce expression of the target gene and turbo GFP. Dox was added to medium every 48 h.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e "},{"header":"Abbreviations","content":"\u003cp\u003e\u003cem\u003es20S - standard 20S proteasome\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ei20S - immunoproteasome (20S)\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ephLF - primary human lung fibroblasts\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGFP - green fluorescent protein\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTGF-\u0026beta;1 - transforming growth factor \u0026beta;1\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIFN\u0026gamma; - interferon-\u0026gamma;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMtb - Mycobacterium tuberculosis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eWT - wildtype\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKO - knockout\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDox - doxycycline\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCT-L - chymotrypsin-like\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eT-L - trypsin-like\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eC-L - caspase-like\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRT \u0026ndash; room temperature\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eBSA - bovine serum albumin\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRT - Reverse transcription\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHPRT - hypoxanthine-guanine phosphoribosyltransferase\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRPL19 - ribosomal protein L19\u003c/em\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003eData Availability\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe mass spectrometry proteomics data concerning A549/H1299 PA200 KO cells and TGF-\u0026beta; treated phLF have been deposited to the ProteomeXchange Consortium via the PRIDE\u003csup\u003e6\u003c/sup\u003e\u003csup\u003e2\u003c/sup\u003e partner repository with the dataset identifier PXD061729. The anti-PA200 and anti-\u0026alpha;2 CoIP proteomics data in testes were previously deposited with the dataset identifier PXD027436\u003csup\u003e29\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThe study was supported by a BMBF grant to SM and GP (Nr. 16GW0287), a DFG/ANR grant to SM, JB, and MPB (ME2002/6-1, BE1305/9-1, and ANR-PA200_IN_IPF) and by grants from the French National Research Agency (ProFI projects: ANR-10-INBS-08 \u0026amp; ANR-24-INBS-0015), the R\u0026eacute;gion Occitanie, and the REACT-EU program of the European Commision. The work is supported under the Polish Ministry and Higher Education project: \u0026ldquo;Support for research and development with the use of research infrastructure of the National Synchrotron Radiation Centre SOLARIS\u0026rdquo; under contract nr 1/SOL/2021/2. \u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eWe gratefully acknowledge the provision of human biomaterial from the CPC-M bioArchive and its partners at the Asklepios Biobank Gauting and the Klinikum der Universit\u0026auml;t M\u0026uuml;nchen.\u003c/em\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKloetzel, P. M. \u0026amp; Ossendorp, F. Proteasome and peptidase function in MHC-class-I-mediated antigen presentation. \u003cem\u003eCurr Opin Immunol\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 76\u0026ndash;81 (2004).\u003c/li\u003e\n\u003cli\u003eWang, X., Meul, T. \u0026amp; Meiners, S. Exploring the proteasome system: A novel concept of proteasome inhibition and regulation. \u003cem\u003ePharmacol Ther\u003c/em\u003e \u003cstrong\u003e211\u003c/strong\u003e, 107526 (2020).\u003c/li\u003e\n\u003cli\u003eCoux, O., Zieba, B. A. \u0026amp; Meiners, S. The Proteasome System in Health and Disease. \u003cem\u003eAdv Exp Med Biol\u003c/em\u003e \u003cstrong\u003e1233\u003c/strong\u003e, 55\u0026ndash;100 (2020).\u003c/li\u003e\n\u003cli\u003eGroll, M. \u003cem\u003eet al.\u003c/em\u003e Structure of 20S proteasome from yeast at 2.4 A resolution. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e386\u003c/strong\u003e, 463\u0026ndash;471 (1997).\u003c/li\u003e\n\u003cli\u003eStadtmueller, B. M. \u0026amp; Hill, C. P. Proteasome activators. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 8\u0026ndash;19 (2011).\u003c/li\u003e\n\u003cli\u003eInholz, K. \u003cem\u003eet al.\u003c/em\u003e Proteasome composition in immune cells implies special immune-cell-specific immunoproteasome function. \u003cem\u003eEuropean Journal of Immunology\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 2350613 (2024).\u003c/li\u003e\n\u003cli\u003eKammerl, I. E. \u003cem\u003eet al.\u003c/em\u003e Blood Immunoproteasome Activity Is Regulated by Sex, Age and in Chronic Inflammatory Diseases: A First Population-Based Study. \u003cem\u003eCells\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eBard, J. A. M. \u003cem\u003eet al.\u003c/em\u003e Structure and Function of the 26S Proteasome. \u003cem\u003eAnnu Rev Biochem\u003c/em\u003e \u003cstrong\u003e87\u003c/strong\u003e, 697\u0026ndash;724 (2018).\u003c/li\u003e\n\u003cli\u003eFabre, B. \u003cem\u003eet al.\u003c/em\u003e Deciphering preferential interactions within supramolecular protein complexes: the proteasome case. \u003cem\u003eMol Syst Biol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 771 (2015).\u003c/li\u003e\n\u003cli\u003eYazgili, A. S., Ebstein, F. \u0026amp; Meiners, S. The Proteasome Activator PA200/PSME4: An Emerging New Player in Health and Disease. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eToste R\u0026ecirc;go, A. \u0026amp; da Fonseca, P. C. A. Characterization of Fully Recombinant Human 20S and 20S-PA200 Proteasome Complexes. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e76\u003c/strong\u003e, 138\u0026ndash;147.e5 (2019).\u003c/li\u003e\n\u003cli\u003eGuan, H. \u003cem\u003eet al.\u003c/em\u003e Cryo-EM structures of the human PA200 and PA200-20S complex reveal regulation of proteasome gate opening and two PA200 apertures. \u003cem\u003ePLoS Biol\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, e3000654 (2020).\u003c/li\u003e\n\u003cli\u003eVerPlank, J. J., Gawron, J. M., Silvestri, N. J., Wrabetz, L. \u0026amp; Feltri, M. L. Knockout of PA200 improves proteasomal degradation and myelination in a proteotoxic neuropathy. \u003cem\u003eLife Sci Alliance\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, (2024).\u003c/li\u003e\n\u003cli\u003eJavitt, A. \u003cem\u003eet al.\u003c/em\u003e The proteasome regulator PSME4 modulates proteasome activity and antigen diversity to abrogate antitumor immunity in NSCLC. \u003cem\u003eNat Cancer\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 629\u0026ndash;647 (2023).\u003c/li\u003e\n\u003cli\u003eQian, M.-X. \u003cem\u003eet al.\u003c/em\u003e Acetylation-mediated proteasomal degradation of core histones during DNA repair and spermatogenesis. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e153\u003c/strong\u003e, 1012\u0026ndash;1024 (2013).\u003c/li\u003e\n\u003cli\u003eBlickwedehl, J. \u003cem\u003eet al.\u003c/em\u003e Role for proteasome activator PA200 and postglutamyl proteasome activity in genomic stability. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e105\u003c/strong\u003e, 16165\u0026ndash;16170 (2008).\u003c/li\u003e\n\u003cli\u003eBlickwedehl, J. \u003cem\u003eet al.\u003c/em\u003e Proteasomes and proteasome activator 200 kDa (PA200) accumulate on chromatin in response to ionizing radiation. \u003cem\u003eRadiat Res\u003c/em\u003e \u003cstrong\u003e167\u003c/strong\u003e, 663\u0026ndash;674 (2007).\u003c/li\u003e\n\u003cli\u003eJiang, T.-X. \u003cem\u003eet al.\u003c/em\u003e Proteasome activator PA200 maintains stability of histone marks during transcription and aging. \u003cem\u003eTheranostics\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1458\u0026ndash;1472 (2021).\u003c/li\u003e\n\u003cli\u003eWelk, V. \u003cem\u003eet al.\u003c/em\u003e Proteasome activator PA200 regulates myofibroblast differentiation. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 15224 (2019).\u003c/li\u003e\n\u003cli\u003eWelk, V. \u003cem\u003eet al.\u003c/em\u003e Inhibition of Proteasome Activity Induces Formation of Alternative Proteasome Complexes. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e291\u003c/strong\u003e, 13147\u0026ndash;13159 (2016).\u003c/li\u003e\n\u003cli\u003eDouida, A. \u003cem\u003eet al.\u003c/em\u003e The proteasome activator PA200 regulates expression of genes involved in cell survival upon selective mitochondrial inhibition in neuroblastoma cells. \u003cem\u003eJ Cell Mol Med\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 6716\u0026ndash;6730 (2020).\u003c/li\u003e\n\u003cli\u003eAladdin, A. \u003cem\u003eet al.\u003c/em\u003e The Proteasome Activators Blm10/PA200 Enhance the Proteasomal Degradation of N-Terminal Huntingtin. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eZhao, J. \u003cem\u003eet al.\u003c/em\u003e Structural insights into the human PA28-20S proteasome enabled by efficient tagging and purification of endogenous proteins. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e119\u003c/strong\u003e, e2207200119 (2022).\u003c/li\u003e\n\u003cli\u003eChen, J. \u003cem\u003eet al.\u003c/em\u003e Cryo-EM of mammalian PA28\u0026alpha;\u0026beta;-iCP immunoproteasome reveals a distinct mechanism of proteasome activation by PA28\u0026alpha;\u0026beta;. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 739 (2021).\u003c/li\u003e\n\u003cli\u003eLesne, J. \u003cem\u003eet al.\u003c/em\u003e Conformational maps of human 20S proteasomes reveal PA28- and immuno-dependent inter-ring crosstalks. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 6140 (2020).\u003c/li\u003e\n\u003cli\u003eSonn-Segev, A. \u003cem\u003eet al.\u003c/em\u003e Quantifying the heterogeneity of macromolecular machines by mass photometry. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1772 (2020).\u003c/li\u003e\n\u003cli\u003eYazgili, A. S. \u003cem\u003eet al.\u003c/em\u003e The proteasome activator PA200 regulates tumor cell invasion. \u003cem\u003ebiorXiv\u003c/em\u003e \u003cstrong\u003e2024.12.17.628836 \u003c/strong\u003e, (2024).\u003c/li\u003e\n\u003cli\u003eHuber, E. M. \u003cem\u003eet al.\u003c/em\u003e Immuno- and constitutive proteasome crystal structures reveal differences in substrate and inhibitor specificity. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e148\u003c/strong\u003e, 727\u0026ndash;738 (2012).\u003c/li\u003e\n\u003cli\u003eŽivković, D. \u003cem\u003eet al.\u003c/em\u003e Proteasome complexes experience profound structural and functional rearrangements throughout mammalian spermatogenesis. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e119\u003c/strong\u003e, e2116826119 (2022).\u003c/li\u003e\n\u003cli\u003eKniepert, A. \u0026amp; Groettrup, M. The unique functions of tissue-specific proteasomes. \u003cem\u003eTrends Biochem Sci\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 17\u0026ndash;24 (2014).\u003c/li\u003e\n\u003cli\u003ePishesha, N., Harmand, T. J. \u0026amp; Ploegh, H. L. A guide to antigen processing and presentation. \u003cem\u003eNature Reviews Immunology\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 751\u0026ndash;764 (2022).\u003c/li\u003e\n\u003cli\u003eFabre, B. \u003cem\u003eet al.\u003c/em\u003e Subcellular distribution and dynamics of active proteasome complexes unraveled by a workflow combining in vivo complex cross-linking and quantitative proteomics. \u003cem\u003eMol Cell Proteomics\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 687\u0026ndash;699 (2013).\u003c/li\u003e\n\u003cli\u003eKim, M.-S. \u003cem\u003eet al.\u003c/em\u003e A draft map of the human proteome. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e509\u003c/strong\u003e, 575\u0026ndash;581 (2014).\u003c/li\u003e\n\u003cli\u003eChen, S. \u003cem\u003eet al.\u003c/em\u003e Immunoproteasome dysfunction augments alternative polarization of alveolar macrophages. \u003cem\u003eCell Death Differ\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1026\u0026ndash;1037 (2016).\u003c/li\u003e\n\u003cli\u003eMenneteau, T. \u003cem\u003eet al.\u003c/em\u003e Mass Spectrometry-based Absolute Quantification of 20S Proteasome Status for Controlled Expansion of Human Adipose-derived Mesenchymal Stromal/Stem Cells. \u003cem\u003eMol Cell Proteomics\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 744\u0026ndash;759 (2019).\u003c/li\u003e\n\u003cli\u003eGuillaume, B. \u003cem\u003eet al.\u003c/em\u003e Two abundant proteasome subtypes that uniquely process some antigens presented by HLA class I molecules. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e, 18599\u0026ndash;18604 (2010).\u003c/li\u003e\n\u003cli\u003eKincaid, E. Z. \u003cem\u003eet al.\u003c/em\u003e Mice completely lacking immunoproteasomes show major changes in antigen presentation. \u003cem\u003eNat Immunol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 129\u0026ndash;135 (2011).\u003c/li\u003e\n\u003cli\u003eFabre, B. \u003cem\u003eet al.\u003c/em\u003e Label-free quantitative proteomics reveals the dynamics of proteasome complexes composition and stoichiometry in a wide range of human cell lines. \u003cem\u003eJ Proteome Res\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 3027\u0026ndash;3037 (2014).\u003c/li\u003e\n\u003cli\u003eWang, X. \u003cem\u003eet al.\u003c/em\u003e DNA sensing via the cGAS/STING pathway activates the immunoproteasome and adaptive T-cell immunity. \u003cem\u003eEMBO J\u003c/em\u003e \u003cstrong\u003e42\u003c/strong\u003e, e110597 (2023).\u003c/li\u003e\n\u003cli\u003eThomas, T. A. \u0026amp; Smith, D. M. Proteasome activator 28\u0026gamma; (PA28\u0026gamma;) allosterically activates trypsin-like proteolysis by binding to the \u0026alpha;-ring of the 20S proteasome. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e298\u003c/strong\u003e, 102140 (2022).\u003c/li\u003e\n\u003cli\u003eMcCarthy, M. K. \u0026amp; Weinberg, J. B. The immunoproteasome and viral infection: a complex regulator of inflammation. \u003cem\u003eFront Microbiol\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 21 (2015).\u003c/li\u003e\n\u003cli\u003eCascio, P. PA28\u0026alpha;\u0026beta;: The Enigmatic Magic Ring of the Proteasome? \u003cem\u003eBiomolecules\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 566\u0026ndash;584 (2014).\u003c/li\u003e\n\u003cli\u003eBarton, L. F., Cruz, M., Rangwala, R., Deepe, G. S., Jr \u0026amp; Monaco, J. J. Regulation of immunoproteasome subunit expression in vivo following pathogenic fungal infection. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e169\u003c/strong\u003e, 3046\u0026ndash;3052 (2002).\u003c/li\u003e\n\u003cli\u003eSijts, E. J. A. M. \u0026amp; Kloetzel, P. M. The role of the proteasome in the generation of MHC class I ligands and immune responses. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e \u003cstrong\u003e68\u003c/strong\u003e, 1491\u0026ndash;1502 (2011).\u003c/li\u003e\n\u003cli\u003eHuber, E. M. \u0026amp; Groll, M. The Mammalian Proteasome Activator PA28 Forms an Asymmetric \u0026alpha;\u0026beta; Complex. \u003cem\u003eStructure\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 1473\u0026ndash;1480.e3 (2017).\u003c/li\u003e\n\u003cli\u003eVigneron, N. \u0026amp; Van den Eynde, B. J. Proteasome subtypes and regulators in the processing of antigenic peptides presented by class I molecules of the major histocompatibility complex. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 994\u0026ndash;1025 (2014).\u003c/li\u003e\n\u003cli\u003eCascio, P. PA28\u0026gamma;: New Insights on an Ancient Proteasome Activator. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eBoulpicante, M. \u003cem\u003eet al.\u003c/em\u003e Tumors escape immunosurveillance by overexpressing the proteasome activator PSME3. \u003cem\u003eOncoimmunology\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 1761205 (2020).\u003c/li\u003e\n\u003cli\u003eBasler, M. \u0026amp; Groettrup, M. On the Role of the Immunoproteasome in Protein Homeostasis. \u003cem\u003eCells\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eBasler, M. \u003cem\u003eet al.\u003c/em\u003e Why the structure but not the activity of the immunoproteasome subunit low molecular mass polypeptide 2 rescues antigen presentation. \u003cem\u003eJ. Immunol.\u003c/em\u003e \u003cstrong\u003e189\u003c/strong\u003e, 1868\u0026ndash;1877 (2012).\u003c/li\u003e\n\u003cli\u003eYao, L. \u003cem\u003eet al.\u003c/em\u003e The proteasome activator REG\u0026gamma; counteracts immunoproteasome expression and autoimmunity. \u003cem\u003eJ Autoimmun\u003c/em\u003e \u003cstrong\u003e103\u003c/strong\u003e, 102282 (2019).\u003c/li\u003e\n\u003cli\u003eDafun, A. S. \u003cem\u003eet al.\u003c/em\u003e Establishing 20S Proteasome Genetic, Translational and Post-Translational Status from Precious Biological and Patient Samples with Top-Down MS. \u003cem\u003eCells\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, (2023).\u003c/li\u003e\n\u003cli\u003ePunjani, A., Rubinstein, J. L., Fleet, D. J. \u0026amp; Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. \u003cem\u003eNat Methods\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 290\u0026ndash;296 (2017).\u003c/li\u003e\n\u003cli\u003eBepler, T. \u003cem\u003eet al.\u003c/em\u003e Positive-unlabeled convolutional neural networks for particle picking in cryo-electron micrographs. \u003cem\u003eNat Methods\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1153\u0026ndash;1160 (2019).\u003c/li\u003e\n\u003cli\u003eSanchez-Garcia, R. \u003cem\u003eet al.\u003c/em\u003e DeepEMhancer: a deep learning solution for cryo-EM volume post-processing. \u003cem\u003eCommun Biol\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 874 (2021).\u003c/li\u003e\n\u003cli\u003eLiebschner, D. \u003cem\u003eet al.\u003c/em\u003e Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. \u003cem\u003eActa Crystallogr D Struct Biol\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e, 861\u0026ndash;877 (2019).\u003c/li\u003e\n\u003cli\u003eEmsley, P., Lohkamp, B., Scott, W. G. \u0026amp; Cowtan, K. Features and development of coot. \u003cem\u003eActa Crystallogr. D Biol. Crystallogr.\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 486\u0026ndash;501 (2010).\u003c/li\u003e\n\u003cli\u003eWilliams, C. J. \u003cem\u003eet al.\u003c/em\u003e MolProbity: More and better reference data for improved all-atom structure validation. \u003cem\u003eProtein Sci\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 293\u0026ndash;315 (2018).\u003c/li\u003e\n\u003cli\u003eBouyssi\u0026eacute;, D. \u003cem\u003eet al.\u003c/em\u003e Proline: an efficient and user-friendly software suite for large-scale proteomics. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 3148\u0026ndash;3155 (2020).\u003c/li\u003e\n\u003cli\u003eSeluanov, A., Vaidya, A. \u0026amp; Gorbunova, V. Establishing primary adult fibroblast cultures from rodents. J Vis Exp (2010) doi:10.3791/2033. \u003c/li\u003e\n\u003cli\u003eBrandenburg, J. \u003cem\u003eet al.\u003c/em\u003e WNT6/ACC2-induced storage of triacylglycerols in macrophages is exploited by Mycobacterium tuberculosis. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003ePerez-Riverol, Y. \u003cem\u003eet al.\u003c/em\u003e The PRIDE database and related tools and resources in 2019: improving support for quantification data. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, D442\u0026ndash;D450 (2019).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6620945/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6620945/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe proteasome activator PA200 binds to the catalytic core of both standard proteasome (s20S) and the immunoproteasome (i20S); however, whether PA200 uses the same mechanisms to activate i20S remains unknown. Our cryo-EM structures of the singly- and doubly-capped i20S-PA200 complexes and \u003cem\u003ein vitro\u003c/em\u003e assays revealed that binding of the first PA200 induces an allosteric widening of the opposite unbound α-ring, resulting in a higher binding occupancy of the i20S and its stronger activation compared to the s20S. We also showed that in cells and tissues that express PA200, s20S and i20S, PA200 interacts preferably with i20S. Intriguingly, the expression of PA200 and the catalytic subunits of the i20S are differentially regulated, with PA200 playing a potential role in controlling the i20S subunits’ expression. This suggests that i20S function is fine-tuned by differential expression of PA200, and reveals an additional layer of i20S regulation.\u003c/p\u003e","manuscriptTitle":"Uncovering the Unexpected Role of Proteasome Activator PA200 in Regulating Immunoproteasome Expression and Activity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-30 16:23:18","doi":"10.21203/rs.3.rs-6620945/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"3a4dc8a6-28e3-46d7-b8e3-1091ef208e67","owner":[],"postedDate":"May 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":49173910,"name":"Biological sciences/Biochemistry/Structural biology/Electron microscopy/Cryoelectron microscopy"},{"id":49173911,"name":"Biological sciences/Biochemistry/Proteolysis/Proteasome"},{"id":49173912,"name":"Biological sciences/Biochemistry/Proteomics/Protein\u0026#x2013;protein interaction networks"}],"tags":[],"updatedAt":"2026-05-07T11:42:21+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-30 16:23:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6620945","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6620945","identity":"rs-6620945","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}