FDA-approved Secukinumab alleviates glial activation and immune cell infiltration in MPTP-induced mouse model of Parkinson's disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article FDA-approved Secukinumab alleviates glial activation and immune cell infiltration in MPTP-induced mouse model of Parkinson's disease Qi Li, Xiaoxuan Han, Mengmeng Dong, Lipeng Bai, Wei Zhang, Wei Liu, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5315653/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Feb, 2025 Read the published version in Inflammation → Version 1 posted 10 You are reading this latest preprint version Abstract Background: The negative role of interleukin-IL-17A (IL-17A) in neurodegeneration diseases such as Alzheimer's disease (AD) and Parkinson's disease (PD) has been investigated. The effect of FDA-approval Secukinumab (SEC), which selectively targets IL‐17A, on the modification of PD remains unclear. This study investigated the protective effect of SEC in MPTP mice and explored its potential mechanism. Methods: We explored the neuroprotective effect of SEC by evaluating the loss of dopaminergic neurons, the activation of glial cells and the infiltration of immune cells in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced mouse model of PD. Results: We found that the treatment of SEC alleviated the loss of dopaminergic neurons and reversed behavioral deficits in MPTP mice. SEC treatment reduced the infiltration of peripheral leukocytes into the brain, especially CD4 + T cells, NK cells and monocyte-macrophages, attenuated the activation of glial cells and the expression of pro-inflammatory cytokines in MPTP mice. In addition, we found that the release of corresponding chemokines (CCL2, CXCL9), which recruit peripheral immune cells into the brain, was reduced. Conclusion: These results suggest that Secukinumab protects dopaminergic neurons and attenuates neuroinflammation in MPTP-induced model. SEC treatment in PD might be an effective therapeutic approach for clinical application in the future. Parkinson’s disease MPTP Secukinumab immune cells glial cells neuroinflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Highlights ● Secukinumab reduces the loss of dopaminergic neurons and axons in MPTP mice. ● Secukinumab inhibits the infiltration of peripheral immune cells into the brain in MPTP mice. ● Secukinumab inhibits the activation of glial cells and reduces neuroinflammation in MPTP mice. Introduction Parkinson’s disease (PD) is a neurodegenerative disease characterized by the progressive loss of dopaminergic neurons (de Lau LM and Breteler MM, 2006;Simon DK et al., 2020 ). The manifestation of PD includes severe motor and non-motor symptoms(Kalia LV and Lang AE, 2015;Schapira AHV et al., 2017 ). A classic toxic PD model is based on the administration of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), which has selective toxicity to dopaminergic neurons. Since MPTP can penetrate through the blood-brain barrier (BBB) to produce metabolites MPP+, which is responsible for progressive damage of dopaminergic neurons (DA) in the substantia nigra (SN), thus inciting neuroinflammatory cascade to worsen neuronal death(Langston JW, 2017 ). Interleukin-17A (IL-17A), mainly derived from Th17(a subtype of CD4 + T cells), is involved in the pathogenesis of PD(Cua DJ and Tato CM, 2010;Green HF et al., 2019 ;McGeachy MJ et al., 2019 ;Tahmasebinia F and Pourgholaminejad A, 2017 ;Yan Z et al., 2021 ). Previous studies show that IL-17A, a pro-inflammatory factor, accelerates neurodegeneration in PD. For example, IL-17A promoted the death of iPSC-derived midbrain neurons by binding to IL-17RA(Sommer A et al., 2018 ); IL-17A elevated TNF-α level and was able to exacerbate MPP+-induced DA neurons loss in microglia-neuron cocultures(Liu Z et al., 2019 ); Gate D et al found that Th17 cells enter into the brain via CXCR4-CXCL12 signaling and secret pro-inflammatory cytokine IL-17A, which induce the loss of DA neurons(Gate D et al., 2021 ). Secukinumab (SEC) is a monoclonal antibody that selectively targets IL-17A, which was approved by the U.S. Food and Drug Administration for the treatment of active ankylosing spondylitis and psoriatic arthritis(Baeten D et al., 2015 ;Frieder J et al., 2018 ). Additional studies confirmed the neuroprotective effects of SEC on the cuprizone-induced demyelination MS model and germinal matrix hemorrhage (GMH) animal model(Abdel-Maged AE et al., 2020 ;Liu SP et al., 2019 ). But the role of SEC in dopaminergic neurons loss has not been thoroughly studied. In our study, we investigated the protective effect of SEC and its impact on neuroinflammation in MPTP mice. Overall, we found SEC treatment has a protective effect on dopaminergic neurons by mediating immune cells infiltration and inflammatory response in the brain of MPTP mice. This study indicated that Secukinumab might be an effective medication against PD. Methods and Materials Experimental animals All animal experiments were reported in accordance with the Animal Research: Reporting in Vivo Experiments (ARRIVE) guidelines and were conducted in the Institute of Neurology, General Hospital of Tianjin Medical University. Male C57BL/6J mice(20-25g, 8–12 weeks)were purchased from Vital River Laboratory Animal Technology in Beijing and were approved by the Animal Care and Use Committee of Tianjin Medical University General Hospital. The reason for not selecting female mice is that estrogen affect the PD pathogenesis(Jurado-Coronel JC et al., 2018 ). All animals were given free access to food and water in a 12-hour light/dark cycle, and were randomly assigned to the experimental groups. C57/BL6 mice were sacrificed by chloral hydrate anesthesia. Efforts were made to minimize animal suffering and reduce the number of experiments. MPTP model and Drug administration 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) was used for Parkinson's disease model. C57BL/6J mice underwent an acute MPTP injection paradigm. MPTP (M0896 Sigma) was dissolved in saline, and mice were injected intraperitoneally at a dose of 20mg/kg, at 2 h interval, with a total of 80mg/kg, while control mice were administered an equal volume of saline. MPTP was injected on day 0 and the mice were sacrificed on day 7. Following MPTP administration period, mice were injected intraperitoneally with Secukinumab (SEC, Novartis; Cosyntex®) at 20mg/kg, three times, each other day, per week. Behavior test The motor coordination ability of different groups was evaluated by rod climbing test and rotating test. Pole climbing test: A straight pole with a diameter of 1 cm and a height of 50 cm was covered with gauze to prevent mice from slipping. Time was recorded while mice climbed from the top of the pole to the bottom of the pole. Rotarod testing: The rotarod treadmill is composed of 3 cm in diameter, 30 cm in length and covered by 20 cm non-slip surface at the bottom. At a constant speed of 40 RPM for 10 minutes. Time was recorded when the mice spent on the rotating rod (the interval between when they were placed on the rod and when they fell off the surface of the rod). Immunohistochemistry and Immunofluorescence Brain tissue samples for immunostaining were obtained 7d after MPTP. Mice were perfused with ice-cold PBS after anesthetized with 5% chloral hydrate (3ml/kg), then brains were removed and fixed in 4% paraformaldehyde (PFA) overnight. Brain tissues from all subject mice were embedded by OCT before 15% and 30% gradient dehydration. Fixed tissue was sectioned at 10µm on a freezing microtome, and the coronal position of the substania nigra region was selected. To analyze the number of TH + cell, we incubated brain sections in 0.3% Triton X-100 for 30min and 3% endogenous peroxidase for 15min, after washing with PBS for 5 min in three times respectively. Finally, Sections were blocked with 3% fetal bovine serum BSA for 1h and incubated with primary antibody TH (1:200 dilution; MAB318; EMS Millipore) for 4° overnight. On the second day, the secondary antibody biotinylated (GK500705; Gene Tech) was added after the primary antibody was washed away with PBS, then incubated for 1h at room temperature. After sections were colored by 3,3-diaminobenzidin (1:50, GK500705; Gene Tech), alcohol gradient on tissue dehydration xylene transparent, then covered by neutral resins. TH + cells of every fifth section in both sides of SNpc were counted and total number of TH + cells in five sections was used as a statistical value. To assess the effect of SEC administration on microglia and astrocyte activation in MPTP model, as well as observe the damage to axons, Immunofluorescence staining we selected Iba-1 (1:500; abcam); glial fibrillary acidic protein (GFAP 1:500; abcam) and TH (1:500 dilution; MAB318; EMS Millipore) as primary antibody at 4°C for 24 hours, Alexa Fluor 488 Donkey anti-Rabbit、Alexa Fluor 488 Donkey anti-Mouse、Alexa Fluor 564 Donkey anti-goat (1:500; Thermo Fisher Scientific) as second antibody was incubated at room temperature. After washing, nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI). The number of cells in three different fields in the same substantia nigra was calculated in every 5 tissue sections. Flow cytometry To make single-cell suspensions, mouse brain and spleen tissue was collected and processed. For brain, tissues were mechanically chopped into pieces and digested with collagenase IV 1mg/ mL at 37°C for 30 min, after washing in PBS, myelin debris were removed by centrifugation in 30% Percoll, single cells were then resuspended in 1% bovine serum albumin (BSA) followed by antibody labeling. Spleen were filtered by a 40µm filter and removed red blood cells by lysis buffer for 15min, after resuspended in 1% BSA buffer and prepared for antibody staining. In brief, we utilized fluorochrome-conjugated antibodies, all antibodies were stained at 4℃ for 30 min according to the instruction. The following antibodies were used: CD11b (101216, BioLegend), CD45 (103108, BioLegend), Ly-6G (127608, BioLegend), F4/80 (123116, BioLegend), CD3 ε (100326, BioLegend), CD4 (100422, BioLegend), CD8a (100708, BioLegend), CD19 (115530, BioLegend), NK1.1 (108710, BioLegend). Data collection on a FACSAria™ III Flow Cytometer and analysis using FlowJo™ Software (BD Life Sciences). qRT - PCR At day 7 following MPTP, RNA was extracted from brain tissue using Trizol Reagent (Thermo), and then converted into cDNA using TransScript First-Strand cDNA Synthesis SuperMix (AT301-03, TransGen Biotech), along with SYBR Green Master (Roche), and used in a real-time quantitative fluorescence PCR reaction. The primers are listed as follows: forward: reverse: IL-1β TCCAGGATGAGGACATGAGCAC GAACGTCACACACCAGCAGGTTA TNF-α ACGGCATGGATCTCAAAGAC GTGGGTGAGGAGCACGTAGT GAPDH GCCAAGGCTGTGGGCAAGGT TCTCCAGGCGGCACGTCAGA iNOS GACGAGACGGATAGGCAGAG CACATGCAAGGAAGGGAACT IL-17A GCTCCAGAAGGCCCTCAGA AGCTTTCCCTCCGCATTGA RORγt CGCGGAGCAGACACACTTA CCCTGGACCTCTGTTTTGGC IL-6 ACCGCTATGAAGTTCCTCTCTGCA AAGCCTCCGACTTGTGAAGTGGT CCL2 ATGCAGGTCTCTGTCACGCTTCTG GACACCTGCTGCTGGTGATTCTCTT CXCL9 ACAAATCCCTCAAAGACCTCAAACAG ATCTCCGTTCTTCAGTGTAGCAATG According to the dissolution curve and amplification curve obtained after the PCR reaction, data analysis was conducted at last. Cell culture and treatment The PC12 cells were cultured in DMEM (10% FBS; 100 µg/mL streptomycin; 100 U/mL penicillin) in a humidified atmosphere (5% CO 2 ; 37°C), which was changed every 2 days. To simulate PD in vitro, PC12 cells were exposed to MPP+ (50 µM) for 24 h. The SEC dosing experimental groups were divided into five groups: the blank group, the control group, the MPP + group, and groups with low (5 µM)and high (10µM) SEC doses. Cell Viability Cell viability was evaluated by Cell Counting Kit according to the manufacturer’s protocol. In brief, differentiated PC12 cells were treated with SEC(5µM or 10µM) for 2 h and then stimulated with MPP+ (50 µM) for an additional 22 h. The CCK8 reagent was added to each well and the mixture was incubated for 1 h. Next, the absorbance values of each well at 450 nm were detected using a microplate reader. Statistical analysis All experimental results were recorded as mean ± SEM for the data conforming to normal distribution. SPSS19.0 software was used for data inspection and analysis. For the comparison between two independent samples, a two-tailed unpaired Student’s t test is adopted. Comparisons between three or more groups of independent samples were performed using one-way analysis of variance (ANOVA) and Bonferroni ex post facto tests. P < 0.05 was set as statistically significant difference. Results Secukinumab reduces IL-17A expression and protects the neurological function in MPTP model To validate that SEC therapy specifically inhibits IL-17A expression in MPTP mice, we tested IL-17A expression in mouse’s brain using qRT-PCR and found that the expression of IL-17A, as well as an IL-17A transcription factor (RORγt), decreased significantly after SEC treatment compared with the MPTP group (Figure 1A). On the seventh day after intraperitoneal injection of MPTP, the number of DA neurons (TH-immunopositive cells) in the SN of the brain remarkably decreased, while SEC treatment had more TH+ neurons in comparison to the MPTP group (Figure 1B, C). The changes indicate that SEC may has a protective effect against the loss of dopaminergic neurons. Similarly, we confirmed DA neurons’ axons had structural abnormalities in MPTP mice. However, SEC treatment alleviated MPTP-induced axonal loss in the SN area (Figure 1D). To investigate if SEC therapy could reverse behavioral deficits in MPTP mice, each group of mice was examined on a climbing pole test and rotarod test to measure balance impairments. SEC-treated MPTP mice spent a shorter time on the climbing pole test than the MPTP group. In terms of the rotarod test, SEC-treated MPTP mice showed considerably longer falling time off the rod than the MPTP group (Figure 1E). Therefore, SEC treatment had a neuroprotective effect on MPTP mice, which lessened the death of dopaminergic neurons and improved the motor coordination of mice. Secukinumab reduces leukocyte infiltration in the brain after MPTP Evidence for the involvement of adaptive immunity in PD has been rapidly accruing over the last decade. Immune cells or other immunological components could enter the brain and either directly or indirectly contribute to disease pathogenesis. Recent studies found that IL-17A, mainly derived from Th17(a subtype of CD4+T cells), is involved in the progression of PD. Historically, IL-17A, rather than being a pro-inflammatory factor, also like a chemokine that recruits peripheral immune cells and mediates inflammatory responses(Gelderblom M et al., 2012;Gu C et al., 2013;Kang Z et al., 2010). Our results indicate that SEC, which pharmacologically inhibits IL-17A expression, protected dopaminergic neurons from MPTP injury, but the exact mechanism remains unclear. Therefore, we shed light on the changes of brain and peripheral immune infiltration after SEC treatment. Using flow cytometry, we analyzed the percentage of infiltrating leukocytes in the brain of mice. The gating strategy is shown (Figure 2A). Compared with the Sham group, the MPTP group significantly increased the percentage of lymphocytes (T cell, B cell, NK cells) and monocyte-macrophages, but not in neutrophils (Figure 2B). Of note, SEC treatment significantly ameliorated brain-infiltration of CD4 + T cells, NK cells, and monocyte-macrophages in MPTP mice (Figure 2B). Moreover, we observed the relative percentage of immune cells in the spleen via flow cytometry and found that SEC treatment decreased the percentage of NK cells and monocyte-macrophages in the spleen compared to the MPTP group, but not CD4 + Tcells (Figure 3A, B). Taken together, these results indicated that SEC treatment mediated leukocytes infiltration from peripheral to the central nervous system in MPTP mice. Secukinumab inhibits the activation of microglia and astrocyte Activating microglia and astrocytes, two types of resident brain cells, worsen neuroinflammation and cause the loss of DA neurons in PD(Ward RJ et al., 2022;Zang X et al., 2022). We therefore tested anti-inflammatory effects of SEC in glial cells following MPTP injection. In the SN area, we performed immunofluorescence of Iba1 and GFAP. SEC treatment significantly inhibited MPTP-induced activation of microglia (Figures 4A and B) and astrocytes (Figures 4C and D). Secukinumab reduces the release of inflammatory cytokines and chemokines in the brain after MPTP In this study, we also test whether SEC directly protects neurons death in MPTP model, treated cultured PC12 cells with MPP+ in vitro and tested CCK8 cell viability. The results showed that neurons suffered exacerbation of MPP+, and there is no remission with SEC directly (supplementary Figure S2). It indicates there has an indirectly way to protect neurons. To further identify the inflammatory environment in the CNS, we observed the expression of pro-inflammatory and anti-inflammatory factors in the brain. TNF-α, IL-1β and iNOS mRNA expression levels were both dramatically reduced with SEC treatment as compared to the MPTP group, while TGF-β was only marginally affected (Figure 5A). Additionally, we found changes in the expression level of chemokines in the brain, thus providing potential mechanism by which peripheral immune cells penetrate the CNS. Our findings demonstrated that the expression of CCL2 and CXCL9, which is the related chemokines of CD4+T cells, NK cells, and monocyte-macrophages, was considerably higher in the MPTP group than in the Sham group (Figure 5B). However, the expression of chemokines was significantly decreased after SEC treatment (Figure 5B). Taken together, these results suggest that SEC treatment also mediates proinflammatory factors production and chemokines expression, attenuating neuroinflammation responses in MPTP mice. After MPTP enters the mouse's brain, it further damages the blood-brain barrier, resulting in the infiltration of peripheral immune cells (T, B, NK cells, and monocyte-macrophages) into the brain. Secukinumab (SEC) can inhibit the expression of IL-17A, mediating immune cell infiltration and inflammatory response in the brain. This can protect dopaminergic neurons and lessen neuroinflammation (red dashed arrows indicate the process).SEC regulates peripheral immune infiltration via two pathways: 1) IL-17A itself acts as a chemokine, and SEC treatment reduces the infiltration of peripheral immune cells (blue dashed arrows indicate the process); 2) blocking IL-17A can lead to the reduction of peripheral immune cells via the indirect pathway of reducing chemokine release. This process could be triggered by interaction with glial cells and the potential mechanism has not been explored (green dotted arrows indicate this process). Discussion In this study, the application of FDA-approved Secukinumab (SEC) presented a protective effect against MPTP-induced neurotoxicity. Our results show that SEC treatment alleviated the death of dopaminergic neurons and reversed behavioral deficits in MPTP mice. Utilizing flow cytometry, we described SEC treatment reduced the infiltration of peripheral leukocytes into the brain, especially CD4 + T cells, NK cells, and monocyte-macrophages. We also explored the underlying mechanism of peripheral immune cells infiltration by identifying the corresponding chemokines (CCL2 and CXCL9) in the brain. Additionally, SEC attenuates the activation of glial cells and the release of inflammatory factors. These results demonstrate that SEC might be an effective therapeutic candidate medicine in MPTP mice. Our results are in line with published reports that PD animal models induce IL-17A production(Storelli E et al., 2019 ;Wu Y et al., 2022 ). More research supports that the pro-inflammatory cytokine IL-17A accelerates neurodegeneration and neuroinflammation in PD. For example, IL-17A contributes to PD development by activating microglia (Liu Z et al., 2019 ). According to Sommer et al findings from a pluripotent stem cell (iPSC) experiment, T lymphocytes increase cell death in PD induced iPSC-derived midbrain neurons (MBNs) mediated by IL-17 (Sommer A et al., 2018 ). Experimental and clinical evidence shows that Th17 enters into the brain via CXCR4-CXCL12 signaling and secrets pro-inflammatory cytokine IL-17A, which induces the loss of DA neurons (Gate D et al., 2021 ). In our study, Secukinumab (SEC), which selectively targets IL-17A, was selected to examine its effect on pathology in MPTP mice. We found that SEC treatment protected the dopaminergic neurons and reduced inflammatory factors expression and glial cells activation. Following the breaking of the dogma of "immune privilege" in the CNS, the agreement in the field is that the immune system is of relevance with PD neuroinflammation(Earls RH et al., 2019 ;Harms AS et al., 2017 ;Louveau A et al., 2015 ). However, the effect of SEC on leukocyte infiltration in MPTP mice remains elusive. Therefore, our study focused on the changes of brain and peripheral immune infiltration after SEC treatment in MPTP mice. To identify possible mechanism of peripheral leukocytes infiltration, we assessed the expression of chemokines CCL2 and CXCL9, which is related to the migration of T cells, NK cells, and macrophages, in the brain of MPTP mice(Fukuda Y et al., 2020 ;Loetscher P et al., 1994 ;Parillaud VR et al., 2017 ;Robinson EA et al., 1989 ). Given this, our results suggest that SEC treatment alleviated neuroinflammation partly by indirectly mediating the expression of chemokines in the brain of MPTP mice. Overall, SEC reduced the infiltration of peripheral leukocytes into the brain by alleviating related-chemokines expression to protect dopaminergic neurons following MPTP. However, we found no significant changes in CD8 + T, B cells, and neutrophils at the 1-week time point utilized in this study, more studies need to be conducted and select longer time points to examine the changes of these immune cells. Additionally, there are several limitations in our study. Firstly, it is better to elucidate the optimized SEC administration regimen. Secondly, our data do not illustrate the source of chemokines and the mechanism by which SEC treatment impacts their release. Finally, our results do not distinguish the effect of SEC treatment in MPTP mice by inhibiting IL-17A alone or other potential mechanisms. But our findings indicated that SEC therapy alleviates immune cell infiltration in MPTP mice and provides new evidence for future clinical application. Future studies are warranted for a more descriptive analysis of the role of CNS immune cells after SEC treatment in MPTP mice. Conclusion In summary, this study concludes the efficacy of SEC in the MPTP-induced neurotoxicity experimental model, indicating that SEC therapy inhibit the brain inflammatory response by regulating leukocyte infiltration and glial cell activation (Fig. 7). Taken together, our study provided that SEC may be a promising medication for clinical application in PD. Declarations Conflict of interest All authors declare no conflicts of interest. Author Contribution Authors contributionsQi Li a,1: Methodology, Validation, Formal analysis, SoftwareXiaoxuan Han a,1: Methodology, Visualization, Investigation, Writing - Original DraftMengmeng Dong a,1:, Investigation, Visualization, Writing - Review & EditingLipeng Bai: Software, Data CurationWei Zhang: Data Curation, Formal analysisWei Liu: Software, Formal analysisFei Wang*: SupervisionXiaodong Zhu*: Conceptualization, Resources, Funding acquisitionStatementQi Li a,1, Xiaoxuan Han a,1, Mengmeng Dong a,1, Lipeng Bai, , Wei Zhang, Wei Liu, Fei Wang*, Xiaodong Zhu*a Department of Neurology, Tianjin Neurological Institute, Tianjin Medical University General Hospital, Tianjin, China* Corresponding author. Department of Neurology, Tianjin Neurological Institute, Tianjin Medical University General Hospital, Anshan Road 154#, Tianjin, 300052, China. Primary corresponding author E-mail address: [email protected] (X. Zhu).1 These three authors contributed equally to this work. Acknowledgments This work was supported by Science & Technology Development Fund of Tianjin Education Commission for Higher Education under grants 2017ZD10. References Abdel-Maged AE, Gad AM, Rashed LA, Azab SS, Mohamed EA, Awad AS (2020), Repurposing of Secukinumab as Neuroprotective in Cuprizone-Induced Multiple Sclerosis Experimental Model via Inhibition of Oxidative, Inflammatory, and Neurodegenerative Signaling. Mol Neurobiol 57:3291-3306. Baeten D, Sieper J, Braun J, Baraliakos X, Dougados M, Emery P, Deodhar A, Porter B, et al. (2015), Secukinumab, an Interleukin-17A Inhibitor, in Ankylosing Spondylitis. N Engl J Med 373:2534-2548. Cua DJ, Tato CM (2010), Innate IL-17-producing cells: the sentinels of the immune system. Nat Rev Immunol 10:479-489. de Lau LM, Breteler MM (2006), Epidemiology of Parkinson's disease. Lancet Neurol 5:525-535. Earls RH, Menees KB, Chung J, Barber J, Gutekunst CA, Hazim MG, Lee JK (2019), Intrastriatal injection of preformed alpha-synuclein fibrils alters central and peripheral immune cell profiles in non-transgenic mice. J Neuroinflammation 16:250. Frieder J, Kivelevitch D, Menter A (2018), Secukinumab: a review of the anti-IL-17A biologic for the treatment of psoriasis. Ther Adv Chronic Dis 9:5-21. Fukuda Y, Asaoka T, Eguchi H, Yokota Y, Kubo M, Kinoshita M, Urakawa S, Iwagami Y, et al. (2020), Endogenous CXCL9 affects prognosis by regulating tumor-infiltrating natural killer cells in intrahepatic cholangiocarcinoma. Cancer Sci 111:323-333. Gate D, Tapp E, Leventhal O, Shahid M, Nonninger TJ, Yang AC, Strempfl K, Unger MS, et al. (2021), CD4(+) T cells contribute to neurodegeneration in Lewy body dementia. Science 374:868-874. Gelderblom M, Weymar A, Bernreuther C, Velden J, Arunachalam P, Steinbach K, Orthey E, Arumugam TV, et al. (2012), Neutralization of the IL-17 axis diminishes neutrophil invasion and protects from ischemic stroke. Blood 120:3793-3802. Green HF, Khosousi S, Svenningsson P (2019), Plasma IL-6 and IL-17A Correlate with Severity of Motor and Non-Motor Symptoms in Parkinson's Disease. J Parkinsons Dis 9:705-709. Gu C, Wu L, Li X (2013), IL-17 family: cytokines, receptors and signaling. Cytokine 64:477-485. Harms AS, Delic V, Thome AD, Bryant N, Liu Z, Chandra S, Jurkuvenaite A, West AB (2017), alpha-Synuclein fibrils recruit peripheral immune cells in the rat brain prior to neurodegeneration. Acta Neuropathol Commun 5:85. Jurado-Coronel JC, Cabezas R, Avila Rodriguez MF, Echeverria V, Garcia-Segura LM, Barreto GE (2018), Sex differences in Parkinson's disease: Features on clinical symptoms, treatment outcome, sexual hormones and genetics. Front Neuroendocrinol 50:18-30. Kalia LV, Lang AE (2015), Parkinson's disease. Lancet 386:896-912. Kang Z, Altuntas CZ, Gulen MF, Liu C, Giltiay N, Qin H, Liu L, Qian W, et al. (2010), Astrocyte-restricted ablation of interleukin-17-induced Act1-mediated signaling ameliorates autoimmune encephalomyelitis. Immunity 32:414-425. Langston JW (2017), The MPTP Story. J Parkinsons Dis 7:S11-S19. Liu SP, Huang L, Flores J, Ding Y, Li P, Peng J, Zuo G, Zhang JH, et al. (2019), Secukinumab attenuates reactive astrogliosis via IL-17RA/(C/EBPbeta)/SIRT1 pathway in a rat model of germinal matrix hemorrhage. CNS Neurosci Ther 25:1151-1161. Liu Z, Qiu AW, Huang Y, Yang Y, Chen JN, Gu TT, Cao BB, Qiu YH, et al. (2019), IL-17A exacerbates neuroinflammation and neurodegeneration by activating microglia in rodent models of Parkinson's disease. Brain Behav Immun 81:630-645. Loetscher P, Seitz M, Clark-Lewis I, Baggiolini M, Moser B (1994), Monocyte chemotactic proteins MCP-1, MCP-2, and MCP-3 are major attractants for human CD4+ and CD8+ T lymphocytes. FASEB J 8:1055-1060. Louveau A, Harris TH, Kipnis J (2015), Revisiting the Mechanisms of CNS Immune Privilege. Trends Immunol 36:569-577. McGeachy MJ, Cua DJ, Gaffen SL (2019), The IL-17 Family of Cytokines in Health and Disease. Immunity 50:892-906. Parillaud VR, Lornet G, Monnet Y, Privat AL, Haddad AT, Brochard V, Bekaert A, de Chanville CB, et al. (2017), Analysis of monocyte infiltration in MPTP mice reveals that microglial CX3CR1 protects against neurotoxic over-induction of monocyte-attracting CCL2 by astrocytes. J Neuroinflammation 14:60. Robinson EA, Yoshimura T, Leonard EJ, Tanaka S, Griffin PR, Shabanowitz J, Hunt DF, Appella E (1989), Complete amino acid sequence of a human monocyte chemoattractant, a putative mediator of cellular immune reactions. Proc Natl Acad Sci U S A 86:1850-1854. Schapira AHV, Chaudhuri KR, Jenner P (2017), Non-motor features of Parkinson disease. Nat Rev Neurosci 18:435-450. Simon DK, Tanner CM, Brundin P (2020), Parkinson Disease Epidemiology, Pathology, Genetics, and Pathophysiology. Clin Geriatr Med 36:1-12. Sommer A, Marxreiter F, Krach F, Fadler T, Grosch J, Maroni M, Graef D, Eberhardt E, et al. (2018), Th17 Lymphocytes Induce Neuronal Cell Death in a Human iPSC-Based Model of Parkinson's Disease. Cell Stem Cell 23:123-131 e126. Storelli E, Cassina N, Rasini E, Marino F, Cosentino M (2019), Do Th17 Lymphocytes and IL-17 Contribute to Parkinson's Disease? A Systematic Review of Available Evidence. Front Neurol 10:13. Tahmasebinia F, Pourgholaminejad A (2017), The role of Th17 cells in auto-inflammatory neurological disorders. Prog Neuropsychopharmacol Biol Psychiatry 79:408-416. Ward RJ, Dexter DT, Crichton RR (2022), Iron, Neuroinflammation and Neurodegeneration. Int J Mol Sci 23. Wu Y, Liu H, Wang Y, Sheng H, Chen Z, Xun D, Wu H, Xiao S, et al. (2022), DiHuangYin decoction protects dopaminergic neurons in a Parkinson's disease model by alleviating peripheral inflammation. Phytomedicine 105:154357. Yan Z, Yang W, Wei H, Dean MN, Standaert DG, Cutter GR, Benveniste EN, Qin H (2021), Dysregulation of the Adaptive Immune System in Patients With Early-Stage Parkinson Disease. Neurol Neuroimmunol Neuroinflamm 8. Zang X, Chen S, Zhu J, Ma J, Zhai Y (2022), The Emerging Role of Central and Peripheral Immune Systems in Neurodegenerative Diseases. Front Aging Neurosci 14:872134. Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterials.docx Cite Share Download PDF Status: Published Journal Publication published 26 Feb, 2025 Read the published version in Inflammation → Version 1 posted Editorial decision: Revision requested 15 Dec, 2024 Reviews received at journal 14 Nov, 2024 Reviews received at journal 07 Nov, 2024 Reviewers agreed at journal 28 Oct, 2024 Reviewers agreed at journal 28 Oct, 2024 Reviewers agreed at journal 25 Oct, 2024 Reviewers invited by journal 24 Oct, 2024 Editor assigned by journal 23 Oct, 2024 Submission checks completed at journal 23 Oct, 2024 First submitted to journal 23 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5315653","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":372173372,"identity":"38e1e25c-9745-425e-b91a-f4a8aa64f168","order_by":0,"name":"Qi Li","email":"","orcid":"","institution":"Tianjin Medical University General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Li","suffix":""},{"id":372173373,"identity":"570ec008-1a81-46e3-973f-feb7814284d0","order_by":1,"name":"Xiaoxuan Han","email":"","orcid":"","institution":"Tianjin Medical University General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiaoxuan","middleName":"","lastName":"Han","suffix":""},{"id":372173375,"identity":"ce67aa88-30fc-4114-ad65-0c7602dd1b77","order_by":2,"name":"Mengmeng Dong","email":"","orcid":"","institution":"Tianjin Medical University General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Mengmeng","middleName":"","lastName":"Dong","suffix":""},{"id":372173376,"identity":"d448e454-83c5-467d-a30d-f5bd0a168a6a","order_by":3,"name":"Lipeng Bai","email":"","orcid":"","institution":"Tianjin Medical University General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lipeng","middleName":"","lastName":"Bai","suffix":""},{"id":372173379,"identity":"d8e5e70c-b61f-493e-8512-07e14923552e","order_by":4,"name":"Wei Zhang","email":"","orcid":"","institution":"Tianjin Medical University General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Zhang","suffix":""},{"id":372173382,"identity":"f97559cd-750b-4065-9151-c75a797995bc","order_by":5,"name":"Wei Liu","email":"","orcid":"","institution":"Tianjin Medical University General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Liu","suffix":""},{"id":372173383,"identity":"1cf385f5-d95c-4819-a578-7d620c03634c","order_by":6,"name":"Fei Wang","email":"","orcid":"","institution":"Tianjin Medical University General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Fei","middleName":"","lastName":"Wang","suffix":""},{"id":372173384,"identity":"af2d037b-fc78-4156-9f45-623fb99701cd","order_by":7,"name":"Xiaodong Zhu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzklEQVRIiWNgGAWjYHAC48c/DGzkIGw24rSYGTMUpBnzkKLFQJrhw6HEHqK1yM9I3mBcYHAgfb/YGQOGD2WHGfhnN+DXwthzrODxDIM7uT3SOQaMM84dZpC4cwC/Fmb2HgMDHoNnYC3MvG2HGQwkEvBrYWPmMZDgMTiczgPS8pcYLTxAW6SBWhLAWhiJ0SLBc6zMcIZBmmHP7bSCgz3n0nkkbhDQAgyxzQ8+/LGRZ5+dvPHBjzJrOf4ZBLSggAMgl5KgfhSMglEwCkYBLgAAsVk+QzS3JFsAAAAASUVORK5CYII=","orcid":"","institution":"Tianjin Medical University General Hospital","correspondingAuthor":true,"prefix":"","firstName":"Xiaodong","middleName":"","lastName":"Zhu","suffix":""}],"badges":[],"createdAt":"2024-10-23 04:53:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5315653/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5315653/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10753-025-02267-8","type":"published","date":"2025-02-26T15:58:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":68266666,"identity":"6b7aa4d4-971b-48d2-b171-0b0399c81483","added_by":"auto","created_at":"2024-11-05 12:54:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1025344,"visible":true,"origin":"","legend":"\u003cp\u003eSEC attenuates the damage of DA neurons and axons and neurological deficit in mice receiving MPTP. Mice received MPTP intraperitoneally with a total of 80mg/kg/d. Mice in the MPTP+SEC group were intraperitoneally injected with 20mg/kg SEC every other day during the week. Meanwhile, the Sham group received saline treatment. A) The mRNA expression levels of IL-17A and transcription factors RORγt in the brain, n=3 B) The number of TH\u003csup\u003e+\u003c/sup\u003e cells in bilateral substantia nigra were quantified by staining 5 non-adjacent brain sections in the same part, n = 3-4. C) Immunohistochemical of TH immunoreactivity neurons in the substantia nigra of mouse brain sections. D) Representative images of DA neurons and axons immunofluorescent staining for TH. Scale bars 100μm. E) Behavior tests record the time of mice falling from the rotating rod and climbing the rod, n = 10. All data are expressed as mean ± SEM; * p \u0026lt; 0.05, ** p \u0026lt; 0.01, \u003csup\u003e#\u003c/sup\u003ep\u0026lt;0.001 (MPTP versus MPTP + SEC or Sham)\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5315653/v1/1791fed6ece62ed2001e25ec.png"},{"id":68265903,"identity":"7dbd81b3-2c08-4d22-90c3-befdf90d12e2","added_by":"auto","created_at":"2024-11-05 12:46:47","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":439412,"visible":true,"origin":"","legend":"\u003cp\u003eSEC attenuates brain infiltration of CD4+T cells, NK cells, and monocyte-macrophages in MPTP mice. At 7d after MPTP, brain tissue was collected and immune cells were isolated from mice receiving SEC or saline. A) Gating strategy of flow cytometry analysis for brain infiltration immune cells including CD4\u003csup\u003e+\u003c/sup\u003eT cells (CD45\u003csup\u003e+\u003c/sup\u003e CD3\u003csup\u003e+\u003c/sup\u003e CD4\u003csup\u003e+\u003c/sup\u003e), CD8\u003csup\u003e+\u003c/sup\u003eT (CD45\u003csup\u003e+\u003c/sup\u003e CD3\u003csup\u003e+\u003c/sup\u003e CD8\u003csup\u003e+\u003c/sup\u003e), B cells (CD45\u003csup\u003e+\u003c/sup\u003e CD3\u003csup\u003e-\u003c/sup\u003e CD19\u003csup\u003e+\u003c/sup\u003e), NK cells (CD45\u003csup\u003e+ \u003c/sup\u003eCD3\u003csup\u003e-\u003c/sup\u003e NK1.1\u003csup\u003e+\u003c/sup\u003e), neutrophils (CD45\u003csup\u003ehi\u003c/sup\u003e CD11b\u003csup\u003e+\u003c/sup\u003e Ly6G\u003csup\u003e+\u003c/sup\u003e) and monocyte-macrophages (CD45\u003csup\u003ehi\u003c/sup\u003e CD11b\u003csup\u003e+\u003c/sup\u003e F4/80\u003csup\u003e+\u003c/sup\u003e). B) Bar graphs show the percentage of total brain infiltration leukocytes in mice receiving SEC or saline treatment after MPTP, n=6-10. All data are expressed as mean ± SEM; \u003csup\u003e*\u003c/sup\u003e p \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e p \u0026lt; 0.01, \u003csup\u003e#\u003c/sup\u003ep\u0026lt;0.001(MPTP versus MPTP + SEC or Sham)\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5315653/v1/e2ab0fae431920fb26bba2fc.jpeg"},{"id":68265904,"identity":"bdb1a5b7-ba43-4bb4-a915-4dd0ba795a57","added_by":"auto","created_at":"2024-11-05 12:46:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":255776,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SEC treatment on peripheral leukocytes within the spleen after MPTP. A) Gating strategy of flow cytometry analysis for immune cells in the spleen including CD4\u003csup\u003e+\u003c/sup\u003eT cells (CD45\u003csup\u003e+\u003c/sup\u003e CD3\u003csup\u003e+\u003c/sup\u003e CD4\u003csup\u003e+\u003c/sup\u003e), CD8\u003csup\u003e+\u003c/sup\u003eT cells (CD45\u003csup\u003e+\u003c/sup\u003e CD3\u003csup\u003e+\u003c/sup\u003e CD8\u003csup\u003e+\u003c/sup\u003e), B cells (CD45\u003csup\u003e+\u003c/sup\u003e CD3\u003csup\u003e-\u003c/sup\u003e CD19\u003csup\u003e+\u003c/sup\u003e), NK cells (CD45\u003csup\u003e+ \u003c/sup\u003eCD3\u003csup\u003e-\u003c/sup\u003e NK1.1\u003csup\u003e+\u003c/sup\u003e), neutrophils (CD45\u003csup\u003ehi\u003c/sup\u003e CD11b\u003csup\u003e+\u003c/sup\u003e Ly6G\u003csup\u003e+\u003c/sup\u003e) and monocyte-macrophages (CD45\u003csup\u003ehi\u003c/sup\u003e CD11b\u003csup\u003e+\u003c/sup\u003e F4/80\u003csup\u003e+\u003c/sup\u003e). B) Bar graphs show the percentage of circulating leukocytes in whole spleen cells receiving SEC or saline treatment after MPTP, n=6-10. All data are expressed as mean ± SEM;\u003csup\u003e *\u003c/sup\u003e p \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e p \u0026lt; 0.01, \u003csup\u003e#\u003c/sup\u003ep\u0026lt;0.001 (MPTP versus MPTP + SEC or Sham)\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5315653/v1/c2a6f84df24c918cf38bc87a.png"},{"id":68265905,"identity":"3e6f59e7-8ee6-4c86-84c2-47e6c46f1e71","added_by":"auto","created_at":"2024-11-05 12:46:48","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1322142,"visible":true,"origin":"","legend":"\u003cp\u003eSEC treatment inhibits MPTP-induced glial cells activation. A, B) Immunofluorescence staining for microglia (Iba-1), bar graph shows the counts of positive cells containing substantia nigra in mice. C, D) Immunofluorescence staining for astrocyte (GFAP) and bar graph. n=3, all data are expressed as mean ± SEM; \u003csup\u003e**\u003c/sup\u003e p \u0026lt; 0.01, \u003csup\u003e#\u003c/sup\u003ep\u0026lt;0.001 (MPTP versus MPTP + SEC or Sham)\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5315653/v1/2652da3086fc53d9ebf49c88.jpeg"},{"id":68265899,"identity":"327500ac-ce30-4ec6-b606-5aed53c47927","added_by":"auto","created_at":"2024-11-05 12:46:47","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":283774,"visible":true,"origin":"","legend":"\u003cp\u003eSEC reduces the release of inflammatory cytokines and chemokines in the brain after MPTP. A) The mRNA expressions of pro-inflammatory factors TNF-α, IL-1β, IL-6 and iNOS as well as anti-inflammatory factors IL-10 and TGF-β were quantitatively analyzed, n=3-4. B) Quantitative analysis of the levels of mRNA expression in related chemokines CCL2 and CXCL9 in brain tissue, n=3-4. All data were expressed as mean ± SEM; \u003csup\u003e*\u003c/sup\u003e p \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e p \u0026lt; 0.01, \u003csup\u003e#\u003c/sup\u003ep\u0026lt;0.001 (MPTP versus MPTP + SEC or Sham)\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5315653/v1/c6dc0284f7f1ba26fbafe8ed.jpeg"},{"id":68265901,"identity":"c6973c05-3f5c-47d2-82fb-5ad6fc436214","added_by":"auto","created_at":"2024-11-05 12:46:47","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":353346,"visible":true,"origin":"","legend":"\u003cp\u003eSecukinumab protects dopaminergic neurons by reducing neuroinflammation.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5315653/v1/773c74653656d8b32fad7921.png"},{"id":77623253,"identity":"ad81466f-0691-4bc3-8bc1-d523ef6e0d7b","added_by":"auto","created_at":"2025-03-03 16:11:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4176206,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5315653/v1/87c0ed88-ecf6-4705-a01e-2302bd5d40f3.pdf"},{"id":68266667,"identity":"b600157d-07a2-4b25-816a-1e33ca777398","added_by":"auto","created_at":"2024-11-05 12:54:47","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":582629,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-5315653/v1/15299b15713f3994bfe76977.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"FDA-approved Secukinumab alleviates glial activation and immune cell infiltration in MPTP-induced mouse model of Parkinson's disease","fulltext":[{"header":"Highlights","content":"\u003c/p\u003e\u003cp\u003e● Secukinumab reduces the loss of dopaminergic neurons and axons in MPTP mice.\u003c/p\u003e\u003cp\u003e● Secukinumab inhibits the infiltration of peripheral immune cells into the brain in MPTP mice.\u003c/p\u003e\u003cp\u003e● Secukinumab inhibits the activation of glial cells and reduces neuroinflammation in MPTP mice.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eParkinson\u0026rsquo;s disease (PD) is a neurodegenerative disease characterized by the progressive loss of dopaminergic neurons (de Lau LM and Breteler MM, 2006;Simon DK et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The manifestation of PD includes severe motor and non-motor symptoms(Kalia LV and Lang AE, 2015;Schapira AHV et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). A classic toxic PD model is based on the administration of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), which has selective toxicity to dopaminergic neurons. Since MPTP can penetrate through the blood-brain barrier (BBB) to produce metabolites MPP+, which is responsible for progressive damage of dopaminergic neurons (DA) in the substantia nigra (SN), thus inciting neuroinflammatory cascade to worsen neuronal death(Langston JW, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eInterleukin-17A (IL-17A), mainly derived from Th17(a subtype of CD4\u0026thinsp;+\u0026thinsp;T cells), is involved in the pathogenesis of PD(Cua DJ and Tato CM, 2010;Green HF et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e;McGeachy MJ et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2019\u003c/span\u003e;Tahmasebinia F and Pourgholaminejad A, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e;Yan Z et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Previous studies show that IL-17A, a pro-inflammatory factor, accelerates neurodegeneration in PD. For example, IL-17A promoted the death of iPSC-derived midbrain neurons by binding to IL-17RA(Sommer A et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e); IL-17A elevated TNF-α level and was able to exacerbate MPP+-induced DA neurons loss in microglia-neuron cocultures(Liu Z et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e); Gate D et al found that Th17 cells enter into the brain via CXCR4-CXCL12 signaling and secret pro-inflammatory cytokine IL-17A, which induce the loss of DA neurons(Gate D et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Secukinumab (SEC) is a monoclonal antibody that selectively targets IL-17A, which was approved by the U.S. Food and Drug Administration for the treatment of active ankylosing spondylitis and psoriatic arthritis(Baeten D et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e;Frieder J et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Additional studies confirmed the neuroprotective effects of SEC on the cuprizone-induced demyelination MS model and germinal matrix hemorrhage (GMH) animal model(Abdel-Maged AE et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e;Liu SP et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). But the role of SEC in dopaminergic neurons loss has not been thoroughly studied. In our study, we investigated the protective effect of SEC and its impact on neuroinflammation in MPTP mice.\u003c/p\u003e \u003cp\u003eOverall, we found SEC treatment has a protective effect on dopaminergic neurons by mediating immune cells infiltration and inflammatory response in the brain of MPTP mice. This study indicated that Secukinumab might be an effective medication against PD.\u003c/p\u003e"},{"header":"Methods and Materials","content":"\u003cp\u003eExperimental animals\u003c/p\u003e \u003cp\u003e All animal experiments were reported in accordance with the Animal Research: Reporting in Vivo Experiments (ARRIVE) guidelines and were conducted in the Institute of Neurology, General Hospital of Tianjin Medical University. Male C57BL/6J mice(20-25g, 8\u0026ndash;12 weeks)were purchased from Vital River Laboratory Animal Technology in Beijing and were approved by the Animal Care and Use Committee of Tianjin Medical University General Hospital. The reason for not selecting female mice is that estrogen affect the PD pathogenesis(Jurado-Coronel JC et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). All animals were given free access to food and water in a 12-hour light/dark cycle, and were randomly assigned to the experimental groups. C57/BL6 mice were sacrificed by chloral hydrate anesthesia. Efforts were made to minimize animal suffering and reduce the number of experiments.\u003c/p\u003e \u003cp\u003eMPTP model and Drug administration\u003c/p\u003e \u003cp\u003e1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) was used for Parkinson's disease model. C57BL/6J mice underwent an acute MPTP injection paradigm. MPTP (M0896 Sigma) was dissolved in saline, and mice were injected intraperitoneally at a dose of 20mg/kg, at 2 h interval, with a total of 80mg/kg, while control mice were administered an equal volume of saline. MPTP was injected on day 0 and the mice were sacrificed on day 7.\u003c/p\u003e \u003cp\u003eFollowing MPTP administration period, mice were injected intraperitoneally with Secukinumab (SEC, Novartis; Cosyntex\u0026reg;) at 20mg/kg, three times, each other day, per week.\u003c/p\u003e \u003cp\u003eBehavior test\u003c/p\u003e \u003cp\u003eThe motor coordination ability of different groups was evaluated by rod climbing test and rotating test.\u003c/p\u003e \u003cp\u003ePole climbing test: A straight pole with a diameter of 1 cm and a height of 50 cm was covered with gauze to prevent mice from slipping. Time was recorded while mice climbed from the top of the pole to the bottom of the pole.\u003c/p\u003e \u003cp\u003eRotarod testing: The rotarod treadmill is composed of 3 cm in diameter, 30 cm in length and covered by 20 cm non-slip surface at the bottom. At a constant speed of 40 RPM for 10 minutes. Time was recorded when the mice spent on the rotating rod (the interval between when they were placed on the rod and when they fell off the surface of the rod).\u003c/p\u003e \u003cp\u003eImmunohistochemistry and Immunofluorescence\u003c/p\u003e \u003cp\u003eBrain tissue samples for immunostaining were obtained 7d after MPTP. Mice were perfused with ice-cold PBS after anesthetized with 5% chloral hydrate (3ml/kg), then brains were removed and fixed in 4% paraformaldehyde (PFA) overnight. Brain tissues from all subject mice were embedded by OCT before 15% and 30% gradient dehydration. Fixed tissue was sectioned at 10\u0026micro;m on a freezing microtome, and the coronal position of the substania nigra region was selected. To analyze the number of TH\u0026thinsp;+\u0026thinsp;cell, we incubated brain sections in 0.3% Triton X-100 for 30min and 3% endogenous peroxidase for 15min, after washing with PBS for 5 min in three times respectively. Finally, Sections were blocked with 3% fetal bovine serum BSA for 1h and incubated with primary antibody TH (1:200 dilution; MAB318; EMS Millipore) for 4\u0026deg; overnight. On the second day, the secondary antibody biotinylated (GK500705; Gene Tech) was added after the primary antibody was washed away with PBS, then incubated for 1h at room temperature. After sections were colored by 3,3-diaminobenzidin (1:50, GK500705; Gene Tech), alcohol gradient on tissue dehydration xylene transparent, then covered by neutral resins. TH\u0026thinsp;+\u0026thinsp;cells of every fifth section in both sides of SNpc were counted and total number of TH\u0026thinsp;+\u0026thinsp;cells in five sections was used as a statistical value.\u003c/p\u003e \u003cp\u003eTo assess the effect of SEC administration on microglia and astrocyte activation in MPTP model, as well as observe the damage to axons, Immunofluorescence staining we selected Iba-1 (1:500; abcam); glial fibrillary acidic protein (GFAP 1:500; abcam) and TH (1:500 dilution; MAB318; EMS Millipore) as primary antibody at 4\u0026deg;C for 24 hours, Alexa Fluor 488 Donkey anti-Rabbit、Alexa Fluor 488 Donkey anti-Mouse、Alexa Fluor 564 Donkey anti-goat (1:500; Thermo Fisher Scientific) as second antibody was incubated at room temperature. After washing, nuclei were counterstained with 4\u0026prime;,6-diamidino-2-phenylindole (DAPI). The number of cells in three different fields in the same substantia nigra was calculated in every 5 tissue sections.\u003c/p\u003e \u003cp\u003eFlow cytometry\u003c/p\u003e \u003cp\u003eTo make single-cell suspensions, mouse brain and spleen tissue was collected and processed. For brain, tissues were mechanically chopped into pieces and digested with collagenase IV 1mg/ mL at 37\u0026deg;C for 30 min, after washing in PBS, myelin debris were removed by centrifugation in 30% Percoll, single cells were then resuspended in 1% bovine serum albumin (BSA) followed by antibody labeling. Spleen were filtered by a 40\u0026micro;m filter and removed red blood cells by lysis buffer for 15min, after resuspended in 1% BSA buffer and prepared for antibody staining. In brief, we utilized fluorochrome-conjugated antibodies, all antibodies were stained at 4℃ for 30 min according to the instruction. The following antibodies were used: CD11b (101216, BioLegend), CD45 (103108, BioLegend), Ly-6G (127608, BioLegend), F4/80 (123116, BioLegend), CD3 ε (100326, BioLegend), CD4 (100422, BioLegend), CD8a (100708, BioLegend), CD19 (115530, BioLegend), NK1.1 (108710, BioLegend). Data collection on a FACSAria\u0026trade; III Flow Cytometer and analysis using FlowJo\u0026trade; Software (BD Life Sciences).\u003c/p\u003e \u003cp\u003eqRT - PCR\u003c/p\u003e \u003cp\u003eAt day 7 following MPTP, RNA was extracted from brain tissue using Trizol Reagent (Thermo), and then converted into cDNA using TransScript First-Strand cDNA Synthesis SuperMix (AT301-03, TransGen Biotech), along with SYBR Green Master (Roche), and used in a real-time quantitative fluorescence PCR reaction. The primers are listed as follows:\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward:\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse:\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCAGGATGAGGACATGAGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAACGTCACACACCAGCAGGTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGGCATGGATCTCAAAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGGTGAGGAGCACGTAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAAGGCTGTGGGCAAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCCAGGCGGCACGTCAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eiNOS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACGAGACGGATAGGCAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACATGCAAGGAAGGGAACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-17A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCCAGAAGGCCCTCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCTTTCCCTCCGCATTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRORγt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCGGAGCAGACACACTTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCTGGACCTCTGTTTTGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCGCTATGAAGTTCCTCTCTGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGCCTCCGACTTGTGAAGTGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCL2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGCAGGTCTCTGTCACGCTTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACACCTGCTGCTGGTGATTCTCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCXCL9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAAATCCCTCAAAGACCTCAAACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTCCGTTCTTCAGTGTAGCAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAccording to the dissolution curve and amplification curve obtained after the PCR reaction, data analysis was conducted at last.\u003c/p\u003e \u003cp\u003eCell culture and treatment\u003c/p\u003e \u003cp\u003eThe PC12 cells were cultured in DMEM (10% FBS; 100 \u0026micro;g/mL streptomycin; 100 U/mL penicillin) in a humidified atmosphere (5% CO\u003csub\u003e2\u003c/sub\u003e; 37\u0026deg;C), which was changed every 2 days. To simulate PD in vitro, PC12 cells were exposed to MPP+ (50 \u0026micro;M) for 24 h. The SEC dosing experimental groups were divided into five groups: the blank group, the control group, the MPP\u0026thinsp;+\u0026thinsp;group, and groups with low (5 \u0026micro;M)and high (10\u0026micro;M) SEC doses.\u003c/p\u003e \u003cp\u003eCell Viability\u003c/p\u003e \u003cp\u003eCell viability was evaluated by Cell Counting Kit according to the manufacturer\u0026rsquo;s protocol. In brief, differentiated PC12 cells were treated with SEC(5\u0026micro;M or 10\u0026micro;M) for 2 h and then stimulated with MPP+ (50 \u0026micro;M) for an additional 22 h. The CCK8 reagent was added to each well and the mixture was incubated for 1 h. Next, the absorbance values of each well at 450 nm were detected using a microplate reader.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll experimental results were recorded as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM for the data conforming to normal distribution. SPSS19.0 software was used for data inspection and analysis. For the comparison between two independent samples, a two-tailed unpaired Student\u0026rsquo;s t test is adopted. Comparisons between three or more groups of independent samples were performed using one-way analysis of variance (ANOVA) and Bonferroni ex post facto tests. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was set as statistically significant difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eSecukinumab reduces IL-17A expression and protects the neurological function in MPTP model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo validate that SEC therapy specifically inhibits IL-17A expression in MPTP mice, we tested IL-17A expression in mouse\u0026rsquo;s brain using qRT-PCR and found that the expression of IL-17A, as well as an IL-17A transcription factor (ROR\u0026gamma;t), decreased significantly after SEC treatment compared with the MPTP group (Figure 1A). On the seventh day after intraperitoneal injection of MPTP, the number of DA neurons (TH-immunopositive cells) in the SN of the brain remarkably decreased, while\u0026nbsp;SEC treatment had more TH+ neurons in comparison to the MPTP group\u0026nbsp;(Figure 1B, C). The changes indicate that SEC may has a protective effect against the loss of dopaminergic neurons. Similarly, we confirmed DA neurons\u0026rsquo; axons had structural abnormalities in MPTP mice. However, SEC treatment alleviated MPTP-induced axonal loss in the SN area (Figure 1D).\u003c/p\u003e\n\u003cp\u003eTo investigate if SEC therapy could reverse behavioral deficits in MPTP mice, each group of mice was examined on a climbing pole test and rotarod test to measure balance impairments. SEC-treated MPTP mice spent a shorter time on the climbing pole test than the MPTP group. In terms of the rotarod test, SEC-treated MPTP mice showed considerably longer falling time off the rod than the MPTP group\u0026nbsp;(Figure 1E). Therefore, SEC treatment had a neuroprotective effect on MPTP mice, which lessened the death of dopaminergic neurons and improved the motor coordination of mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSecukinumab reduces leukocyte infiltration in the brain after MPTP\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEvidence for the involvement of adaptive immunity in PD has been rapidly accruing over the last decade. Immune cells or other immunological components could enter the brain and either directly or indirectly contribute to disease pathogenesis. Recent studies found that IL-17A, mainly derived from Th17(a subtype of CD4+T cells), is involved\u0026nbsp;in the progression of PD. Historically, IL-17A, rather than being a pro-inflammatory factor, also like a chemokine that recruits peripheral immune cells and mediates inflammatory responses(Gelderblom M et al., 2012;Gu C et al., 2013;Kang Z et al., 2010). Our results indicate that SEC, which pharmacologically inhibits IL-17A expression, protected dopaminergic neurons from MPTP injury, but the exact mechanism remains unclear. Therefore, we shed light on the changes of brain and peripheral immune infiltration after SEC treatment. Using flow cytometry, we analyzed the percentage of infiltrating leukocytes in the brain of mice. The gating strategy is shown (Figure 2A). Compared with the Sham group, the MPTP group significantly increased the percentage of lymphocytes (T cell, B cell, NK cells) and monocyte-macrophages, but not in neutrophils (Figure 2B). Of note, SEC treatment significantly ameliorated brain-infiltration of CD4\u003csup\u003e+\u003c/sup\u003eT cells, NK cells, and monocyte-macrophages in MPTP mice (Figure 2B).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Moreover, we observed the relative percentage of immune cells in the spleen via flow cytometry and found that SEC treatment decreased the percentage of NK cells and monocyte-macrophages in the spleen compared to the MPTP group, but not CD4\u003csup\u003e+\u003c/sup\u003eTcells (Figure 3A, B). Taken together, these results indicated that SEC treatment mediated leukocytes infiltration from peripheral to the central nervous system in MPTP mice.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSecukinumab inhibits the activation of microglia and astrocyte\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eActivating microglia and astrocytes, two types of resident brain cells, worsen neuroinflammation and cause the loss of DA neurons in PD(Ward RJ et al., 2022;Zang X et al., 2022). We therefore tested anti-inflammatory effects of SEC in glial cells following MPTP injection. In the SN area, we performed immunofluorescence of Iba1 and GFAP. SEC treatment significantly inhibited MPTP-induced activation of microglia (Figures 4A and B) and astrocytes (Figures 4C and D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSecukinumab\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ereduces the release of inflammatory cytokines and chemokines in the brain after MPTP\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, we also test whether SEC directly protects neurons death in MPTP model, treated cultured PC12 cells with MPP+ in vitro and tested CCK8 cell viability. The results showed that neurons suffered exacerbation of MPP+, and there is no remission with SEC directly (supplementary Figure S2). It indicates there has an indirectly way to protect neurons. To further identify the inflammatory environment in the CNS, we observed the expression of pro-inflammatory and anti-inflammatory factors in the brain. TNF-\u0026alpha;, IL-1\u0026beta; and iNOS mRNA expression levels were both dramatically reduced with SEC treatment as compared to the MPTP group, while TGF-\u0026beta; was only marginally affected (Figure 5A). Additionally, we found changes in the expression level of chemokines in the brain, thus providing potential mechanism by which peripheral immune cells penetrate the CNS. Our findings demonstrated that the expression of CCL2 and CXCL9, which is the related chemokines of CD4+T cells, NK cells, and monocyte-macrophages, was considerably higher in the MPTP group than in the Sham group (Figure 5B). However, the expression of chemokines was significantly decreased after SEC treatment (Figure 5B). Taken together, these results suggest that SEC treatment also mediates proinflammatory factors production and chemokines expression, attenuating neuroinflammation responses in MPTP mice.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter MPTP enters the mouse\u0026apos;s brain, it further damages the blood-brain barrier, resulting in the infiltration of peripheral immune cells (T, B, NK cells, and monocyte-macrophages) into the brain. Secukinumab (SEC) can inhibit the expression of IL-17A, mediating immune cell infiltration and inflammatory response in the brain. This can protect dopaminergic neurons and lessen neuroinflammation (red dashed arrows indicate the process).SEC regulates peripheral immune infiltration via two pathways: 1) IL-17A itself acts as a chemokine, and SEC treatment reduces the infiltration of peripheral immune cells (blue dashed arrows indicate the process); 2) blocking IL-17A can lead to the reduction of peripheral immune cells via the indirect pathway of reducing chemokine release. This process could be triggered by interaction with glial cells and the potential mechanism has not been explored (green dotted arrows indicate this process).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, the application of FDA-approved Secukinumab (SEC) presented a protective effect against MPTP-induced neurotoxicity. Our results show that SEC treatment alleviated the death of dopaminergic neurons and reversed behavioral deficits in MPTP mice. Utilizing flow cytometry, we described SEC treatment reduced the infiltration of peripheral leukocytes into the brain, especially CD4\u003csup\u003e+\u003c/sup\u003eT cells, NK cells, and monocyte-macrophages. We also explored the underlying mechanism of peripheral immune cells infiltration by identifying the corresponding chemokines (CCL2 and CXCL9) in the brain. Additionally, SEC attenuates the activation of glial cells and the release of inflammatory factors. These results demonstrate that SEC might be an effective therapeutic candidate medicine in MPTP mice.\u003c/p\u003e \u003cp\u003eOur results are in line with published reports that PD animal models induce IL-17A production(Storelli E et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e;Wu Y et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). More research supports that the pro-inflammatory cytokine IL-17A accelerates neurodegeneration and neuroinflammation in PD. For example, IL-17A contributes to PD development by activating microglia (Liu Z et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). According to Sommer et al findings from a pluripotent stem cell (iPSC) experiment, T lymphocytes increase cell death in PD induced iPSC-derived midbrain neurons (MBNs) mediated by IL-17 (Sommer A et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Experimental and clinical evidence shows that Th17 enters into the brain via CXCR4-CXCL12 signaling and secrets pro-inflammatory cytokine IL-17A, which induces the loss of DA neurons (Gate D et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In our study, Secukinumab (SEC), which selectively targets IL-17A, was selected to examine its effect on pathology in MPTP mice. We found that SEC treatment protected the dopaminergic neurons and reduced inflammatory factors expression and glial cells activation.\u003c/p\u003e \u003cp\u003eFollowing the breaking of the dogma of \"immune privilege\" in the CNS, the agreement in the field is that the immune system is of relevance with PD neuroinflammation(Earls RH et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e;Harms AS et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e;Louveau A et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, the effect of SEC on leukocyte infiltration in MPTP mice remains elusive. Therefore, our study focused on the changes of brain and peripheral immune infiltration after SEC treatment in MPTP mice. To identify possible mechanism of peripheral leukocytes infiltration, we assessed the expression of chemokines CCL2 and CXCL9, which is related to the migration of T cells, NK cells, and macrophages, in the brain of MPTP mice(Fukuda Y et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e;Loetscher P et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1994\u003c/span\u003e;Parillaud VR et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e;Robinson EA et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). Given this, our results suggest that SEC treatment alleviated neuroinflammation partly by indirectly mediating the expression of chemokines in the brain of MPTP mice. Overall, SEC reduced the infiltration of peripheral leukocytes into the brain by alleviating related-chemokines expression to protect dopaminergic neurons following MPTP. However, we found no significant changes in CD8\u0026thinsp;+\u0026thinsp;T, B cells, and neutrophils at the 1-week time point utilized in this study, more studies need to be conducted and select longer time points to examine the changes of these immune cells.\u003c/p\u003e \u003cp\u003eAdditionally, there are several limitations in our study. Firstly, it is better to elucidate the optimized SEC administration regimen. Secondly, our data do not illustrate the source of chemokines and the mechanism by which SEC treatment impacts their release. Finally, our results do not distinguish the effect of SEC treatment in MPTP mice by inhibiting IL-17A alone or other potential mechanisms. But our findings indicated that SEC therapy alleviates immune cell infiltration in MPTP mice and provides new evidence for future clinical application. Future studies are warranted for a more descriptive analysis of the role of CNS immune cells after SEC treatment in MPTP mice.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this study concludes the efficacy of SEC in the MPTP-induced neurotoxicity experimental model, indicating that SEC therapy inhibit the brain inflammatory response by regulating leukocyte infiltration and glial cell activation (Fig.\u0026nbsp;7). Taken together, our study provided that SEC may be a promising medication for clinical application in PD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of interest\u003c/h2\u003e \u003cp\u003eAll authors declare no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAuthors contributionsQi Li a,1: Methodology, Validation, Formal analysis, SoftwareXiaoxuan Han a,1: Methodology, Visualization, Investigation, Writing - Original DraftMengmeng Dong a,1:, Investigation, Visualization, Writing - Review \u0026amp; EditingLipeng Bai: Software, Data CurationWei Zhang: Data Curation, Formal analysisWei Liu: Software, Formal analysisFei Wang*: SupervisionXiaodong Zhu*: Conceptualization, Resources, Funding acquisitionStatementQi Li a,1, Xiaoxuan Han a,1, Mengmeng Dong a,1, Lipeng Bai, , Wei Zhang, Wei Liu, Fei Wang*, Xiaodong Zhu*a Department of Neurology, Tianjin Neurological Institute, Tianjin Medical University General Hospital, Tianjin, China* Corresponding author. Department of Neurology, Tianjin Neurological Institute, Tianjin Medical University General Hospital, Anshan Road 154#, Tianjin, 300052, China. Primary corresponding author E-mail address:
[email protected] (X. Zhu).1 These three authors contributed equally to this work.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThis work was supported by Science \u0026amp; Technology Development Fund of Tianjin Education Commission for Higher Education under grants 2017ZD10.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAbdel-Maged AE, Gad AM, Rashed LA, Azab SS, Mohamed EA, Awad AS (2020), Repurposing of Secukinumab as Neuroprotective in Cuprizone-Induced Multiple Sclerosis Experimental Model via Inhibition of Oxidative, Inflammatory, and Neurodegenerative Signaling. Mol Neurobiol 57:3291-3306.\u003c/li\u003e\n \u003cli\u003eBaeten D, Sieper J, Braun J, Baraliakos X, Dougados M, Emery P, Deodhar A, Porter B, et al. (2015), Secukinumab, an Interleukin-17A Inhibitor, in Ankylosing Spondylitis. N Engl J Med 373:2534-2548.\u003c/li\u003e\n \u003cli\u003eCua DJ, Tato CM (2010), Innate IL-17-producing cells: the sentinels of the immune system. Nat Rev Immunol 10:479-489.\u003c/li\u003e\n \u003cli\u003ede Lau LM, Breteler MM (2006), Epidemiology of Parkinson\u0026apos;s disease. Lancet Neurol 5:525-535.\u003c/li\u003e\n \u003cli\u003eEarls RH, Menees KB, Chung J, Barber J, Gutekunst CA, Hazim MG, Lee JK (2019), Intrastriatal injection of preformed alpha-synuclein fibrils alters central and peripheral immune cell profiles in non-transgenic mice. J Neuroinflammation 16:250.\u003c/li\u003e\n \u003cli\u003eFrieder J, Kivelevitch D, Menter A (2018), Secukinumab: a review of the anti-IL-17A biologic for the treatment of psoriasis. Ther Adv Chronic Dis 9:5-21.\u003c/li\u003e\n \u003cli\u003eFukuda Y, Asaoka T, Eguchi H, Yokota Y, Kubo M, Kinoshita M, Urakawa S, Iwagami Y, et al. (2020), Endogenous CXCL9 affects prognosis by regulating tumor-infiltrating natural killer cells in intrahepatic cholangiocarcinoma. Cancer Sci 111:323-333.\u003c/li\u003e\n \u003cli\u003eGate D, Tapp E, Leventhal O, Shahid M, Nonninger TJ, Yang AC, Strempfl K, Unger MS, et al. (2021), CD4(+) T cells contribute to neurodegeneration in Lewy body dementia. Science 374:868-874.\u003c/li\u003e\n \u003cli\u003eGelderblom M, Weymar A, Bernreuther C, Velden J, Arunachalam P, Steinbach K, Orthey E, Arumugam TV, et al. (2012), Neutralization of the IL-17 axis diminishes neutrophil invasion and protects from ischemic stroke. Blood 120:3793-3802.\u003c/li\u003e\n \u003cli\u003eGreen HF, Khosousi S, Svenningsson P (2019), Plasma IL-6 and IL-17A Correlate with Severity of Motor and Non-Motor Symptoms in Parkinson\u0026apos;s Disease. J Parkinsons Dis 9:705-709.\u003c/li\u003e\n \u003cli\u003eGu C, Wu L, Li X (2013), IL-17 family: cytokines, receptors and signaling. Cytokine 64:477-485.\u003c/li\u003e\n \u003cli\u003eHarms AS, Delic V, Thome AD, Bryant N, Liu Z, Chandra S, Jurkuvenaite A, West AB (2017), alpha-Synuclein fibrils recruit peripheral immune cells in the rat brain prior to neurodegeneration. Acta Neuropathol Commun 5:85.\u003c/li\u003e\n \u003cli\u003eJurado-Coronel JC, Cabezas R, Avila Rodriguez MF, Echeverria V, Garcia-Segura LM, Barreto GE (2018), Sex differences in Parkinson\u0026apos;s disease: Features on clinical symptoms, treatment outcome, sexual hormones and genetics. Front Neuroendocrinol 50:18-30.\u003c/li\u003e\n \u003cli\u003eKalia LV, Lang AE (2015), Parkinson\u0026apos;s disease. Lancet 386:896-912.\u003c/li\u003e\n \u003cli\u003eKang Z, Altuntas CZ, Gulen MF, Liu C, Giltiay N, Qin H, Liu L, Qian W, et al. (2010), Astrocyte-restricted ablation of interleukin-17-induced Act1-mediated signaling ameliorates autoimmune encephalomyelitis. Immunity 32:414-425.\u003c/li\u003e\n \u003cli\u003eLangston JW (2017), The MPTP Story. J Parkinsons Dis 7:S11-S19.\u003c/li\u003e\n \u003cli\u003eLiu SP, Huang L, Flores J, Ding Y, Li P, Peng J, Zuo G, Zhang JH, et al. (2019), Secukinumab attenuates reactive astrogliosis via IL-17RA/(C/EBPbeta)/SIRT1 pathway in a rat model of germinal matrix hemorrhage. CNS Neurosci Ther 25:1151-1161.\u003c/li\u003e\n \u003cli\u003eLiu Z, Qiu AW, Huang Y, Yang Y, Chen JN, Gu TT, Cao BB, Qiu YH, et al. (2019), IL-17A exacerbates neuroinflammation and neurodegeneration by activating microglia in rodent models of Parkinson\u0026apos;s disease. Brain Behav Immun 81:630-645.\u003c/li\u003e\n \u003cli\u003eLoetscher P, Seitz M, Clark-Lewis I, Baggiolini M, Moser B (1994), Monocyte chemotactic proteins MCP-1, MCP-2, and MCP-3 are major attractants for human CD4+ and CD8+ T lymphocytes. FASEB J 8:1055-1060.\u003c/li\u003e\n \u003cli\u003eLouveau A, Harris TH, Kipnis J (2015), Revisiting the Mechanisms of CNS Immune Privilege. Trends Immunol 36:569-577.\u003c/li\u003e\n \u003cli\u003eMcGeachy MJ, Cua DJ, Gaffen SL (2019), The IL-17 Family of Cytokines in Health and Disease. Immunity 50:892-906.\u003c/li\u003e\n \u003cli\u003eParillaud VR, Lornet G, Monnet Y, Privat AL, Haddad AT, Brochard V, Bekaert A, de Chanville CB, et al. (2017), Analysis of monocyte infiltration in MPTP mice reveals that microglial CX3CR1 protects against neurotoxic over-induction of monocyte-attracting CCL2 by astrocytes. J Neuroinflammation 14:60.\u003c/li\u003e\n \u003cli\u003eRobinson EA, Yoshimura T, Leonard EJ, Tanaka S, Griffin PR, Shabanowitz J, Hunt DF, Appella E (1989), Complete amino acid sequence of a human monocyte chemoattractant, a putative mediator of cellular immune reactions. Proc Natl Acad Sci U S A 86:1850-1854.\u003c/li\u003e\n \u003cli\u003eSchapira AHV, Chaudhuri KR, Jenner P (2017), Non-motor features of Parkinson disease. Nat Rev Neurosci 18:435-450.\u003c/li\u003e\n \u003cli\u003eSimon DK, Tanner CM, Brundin P (2020), Parkinson Disease Epidemiology, Pathology, Genetics, and Pathophysiology. Clin Geriatr Med 36:1-12.\u003c/li\u003e\n \u003cli\u003eSommer A, Marxreiter F, Krach F, Fadler T, Grosch J, Maroni M, Graef D, Eberhardt E, et al. (2018), Th17 Lymphocytes Induce Neuronal Cell Death in a Human iPSC-Based Model of Parkinson\u0026apos;s Disease. Cell Stem Cell 23:123-131 e126.\u003c/li\u003e\n \u003cli\u003eStorelli E, Cassina N, Rasini E, Marino F, Cosentino M (2019), Do Th17 Lymphocytes and IL-17 Contribute to Parkinson\u0026apos;s Disease? A Systematic Review of Available Evidence. Front Neurol 10:13.\u003c/li\u003e\n \u003cli\u003eTahmasebinia F, Pourgholaminejad A (2017), The role of Th17 cells in auto-inflammatory neurological disorders. Prog Neuropsychopharmacol Biol Psychiatry 79:408-416.\u003c/li\u003e\n \u003cli\u003eWard RJ, Dexter DT, Crichton RR (2022), Iron, Neuroinflammation and Neurodegeneration. Int J Mol Sci 23.\u003c/li\u003e\n \u003cli\u003eWu Y, Liu H, Wang Y, Sheng H, Chen Z, Xun D, Wu H, Xiao S, et al. (2022), DiHuangYin decoction protects dopaminergic neurons in a Parkinson\u0026apos;s disease model by alleviating peripheral inflammation. Phytomedicine 105:154357.\u003c/li\u003e\n \u003cli\u003eYan Z, Yang W, Wei H, Dean MN, Standaert DG, Cutter GR, Benveniste EN, Qin H (2021), Dysregulation of the Adaptive Immune System in Patients With Early-Stage Parkinson Disease. Neurol Neuroimmunol Neuroinflamm 8.\u003c/li\u003e\n \u003cli\u003eZang X, Chen S, Zhu J, Ma J, Zhai Y (2022), The Emerging Role of Central and Peripheral Immune Systems in Neurodegenerative Diseases. Front Aging Neurosci 14:872134.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"inflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ifla","sideBox":"Learn more about [Inflammation](https://www.springer.com/journal/10753)","snPcode":"10753","submissionUrl":"https://submission.nature.com/new-submission/10753/3","title":"Inflammation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Parkinson’s disease, MPTP, Secukinumab, immune cells, glial cells, neuroinflammation","lastPublishedDoi":"10.21203/rs.3.rs-5315653/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5315653/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eThe negative role of\u003cstrong\u003e \u003c/strong\u003einterleukin-IL-17A (IL-17A) in neurodegeneration diseases such as Alzheimer's disease (AD) and Parkinson's disease (PD) has been investigated. The effect of FDA-approval Secukinumab (SEC), which selectively targets IL‐17A, on the modification of PD remains unclear. This study investigated the protective effect of SEC in MPTP mice and explored its potential mechanism. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eWe explored the neuroprotective effect of SEC by evaluating the loss of dopaminergic neurons, the activation of glial cells and the infiltration of immune cells in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced mouse model of PD.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eWe found that the treatment of SEC alleviated the loss of dopaminergic neurons and reversed behavioral deficits in MPTP mice. SEC treatment reduced the infiltration of peripheral leukocytes into the brain, especially CD4\u003csup\u003e+\u003c/sup\u003eT cells, NK cells and monocyte-macrophages, attenuated the activation of glial cells and the expression of pro-inflammatory cytokines in MPTP mice. In addition, we found that the release of corresponding chemokines (CCL2, CXCL9), which recruit peripheral immune cells into the brain, was reduced.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThese results suggest that Secukinumab protects dopaminergic neurons and attenuates neuroinflammation in MPTP-induced model. SEC treatment in PD might be an effective therapeutic approach for clinical application in the future.\u003c/p\u003e","manuscriptTitle":"FDA-approved Secukinumab alleviates glial activation and immune cell infiltration in MPTP-induced mouse model of Parkinson's disease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-05 12:46:42","doi":"10.21203/rs.3.rs-5315653/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-12-15T07:44:34+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-14T17:56:06+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-07T09:28:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"47769785389973766424504665584747436702","date":"2024-10-28T17:42:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"67734778219623123267621332190277481654","date":"2024-10-28T05:28:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"79766752525257762326377191159447502602","date":"2024-10-25T07:03:39+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-24T22:57:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-23T23:20:37+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-10-23T23:19:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Inflammation","date":"2024-10-23T04:49:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"inflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ifla","sideBox":"Learn more about [Inflammation](https://www.springer.com/journal/10753)","snPcode":"10753","submissionUrl":"https://submission.nature.com/new-submission/10753/3","title":"Inflammation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6b37bc97-bbaa-4382-90bf-3980db5b03a4","owner":[],"postedDate":"November 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-03T16:09:07+00:00","versionOfRecord":{"articleIdentity":"rs-5315653","link":"https://doi.org/10.1007/s10753-025-02267-8","journal":{"identity":"inflammation","isVorOnly":false,"title":"Inflammation"},"publishedOn":"2025-02-26 15:58:20","publishedOnDateReadable":"February 26th, 2025"},"versionCreatedAt":"2024-11-05 12:46:42","video":"","vorDoi":"10.1007/s10753-025-02267-8","vorDoiUrl":"https://doi.org/10.1007/s10753-025-02267-8","workflowStages":[]},"version":"v1","identity":"rs-5315653","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5315653","identity":"rs-5315653","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.