Full text
56,524 characters
· extracted from
preprint-html
· click to expand
Anti-tumor effects of a novel cell penetrating peptide-based therapeutic approach to target Lactate Dehydrogenase C (LDHC) in triple negative breast cancer | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Anti-tumor effects of a novel cell penetrating peptide-based therapeutic approach to target Lactate Dehydrogenase C (LDHC) in triple negative breast cancer Hanan Qasem , View ORCID Profile Adviti Naik , View ORCID Profile Tricia Gomez , View ORCID Profile Janarthanan Ponraj , Umar Jafar , View ORCID Profile Martin Sikhondze , Remy Thomas , Khaled A Mahmoud , View ORCID Profile Julie Decock doi: https://doi.org/10.1101/2025.03.11.641612 Hanan Qasem a College of Health and Life Sciences (CHLS), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar b Translational Oncology Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site Adviti Naik b Translational Oncology Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Adviti Naik Tricia Gomez c Qatar Environment and Energy Research Institute (QEERI), Hamad Bin Khalifa University (HBKU), Qatar Foundation , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Tricia Gomez Janarthanan Ponraj c Qatar Environment and Energy Research Institute (QEERI), Hamad Bin Khalifa University (HBKU), Qatar Foundation , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Janarthanan Ponraj Umar Jafar a College of Health and Life Sciences (CHLS), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar b Translational Oncology Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site Martin Sikhondze b Translational Oncology Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Martin Sikhondze Remy Thomas b Translational Oncology Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site Khaled A Mahmoud c Qatar Environment and Energy Research Institute (QEERI), Hamad Bin Khalifa University (HBKU), Qatar Foundation , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site Julie Decock a College of Health and Life Sciences (CHLS), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar b Translational Oncology Research Center, Qatar Biomedical Research Institute (QBRI), Hamad Bin Khalifa University (HBKU), Qatar Foundation (QF) , Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Julie Decock For correspondence: jdecock{at}hbku.edu.qa Abstract Full Text Info/History Metrics Supplementary material Preview PDF ABSTRACT Background Lactate Dehydrogenase C (LDHC) is a promising candidate for therapeutic targeting thanks to its highly tumor-specific expression, immunogenicity, and pro-tumorigenic functions. Aberrant LDHC expression is associated with poor clinical outcomes in multiple cancers, including breast cancer. However, no specific LDHC inhibitors are currently available, highlighting the need for novel strategies to selectively target LDHC in tumor cells. This study explores the anti-tumor potential of cell-penetrating peptides (CPPs) to target LDHC in triple negative breast cancer (TNBC). Methods Four CPPs were evaluated for their ability to deliver LDHC siRNA to tumor cells, including the positively charged 10R peptide (10R) and three bifunctional peptides containing the integrin αvβ3 recognition motif Arg-Gly-Asp (RGD): 10R-RGD, cyclicRGD-10R (cRGD-10R), and internalizing RGD-10R (iRGD-10R). We characterized the physicochemical properties of all CPP:siRNA complexes, and determined their serum stability, cytotoxicity, cellular uptake, and LDHC silencing efficiency in vitro. The anti-tumor effects and cytotoxicity of cRGD-10R:siRNA and iRGD-10R:siRNA complexes were further assessed in a TNBC xenograft zebrafish model. Results All four CPPs formed stable nanocomplexes with favorable safety profiles. The 10R-RGD and cRGD-10R peptides demonstrated the most efficient LDHC knockdown, reduced the clonogenic ability of TNBC cells and enhanced their treatment response to the chemotherapeutic drug olaparib in vitro. Treatment of TNBC xenograft zebrafish with 10R-RGD:siRNA and cRGD-10R:siRNA complexes significantly reduced tumor burden without inducing major toxicity. Conclusion Our findings demonstrate that CPP-based siRNA delivery provides a novel and safe approach to target LDHC, either as a monotherapy or in combination with common anti-cancer drugs, to enhance treatment outcomes. INTRODUCTION Breast cancer is the most prevalent cancer and leading cause of mortality among women worldwide [ 1 ]. Triple negative breast cancer (TNBC), characterized by the lack of expression of the estrogen receptor, progesterone receptor, and Human Epidermal Growth Factor Receptor 2 (Her2), represents 10-20% of breast cancer cases, primarily affects young women and is associated with a poor prognosis and high metastatic potential [ 2 , 3 ]. Currently, the treatment options for patients with TNBC include chemotherapy, radiotherapy and more recently immunotherapy. While TNBC patients exhibit early pathological responses to chemotherapy, unfortunately, a significant portion of patients develop resistance and disease recurrence. In recent years, cancer treatment is shifting away from a one-size-fits-all approach towards precision medicine, where traditional treatments such as surgery, chemotherapy, and radiotherapy are complemented by personalized drug therapies [ 2 , 4 ]. Recent studies suggest that combining molecular targeting with chemotherapy represents a promising approach to treat TNBC [ 5 ]. For instance, the addition of mTOR inhibitors, such as temsirolimus or everolimus to doxorubicin and bevacizumab has significantly improved the objective response rate of TNBC patients with tumors that display aberrant activation of the PI3K/mTOR pathway [ 6 ]. In addition, combination treatment of carboplatin with the PARP inhibitor olaparib is associated with an overall response rate (ORR) of 88% in TNBC patients carrying BRCA mutations. In this context, specific targeting of cancer/testis antigens (CTAs) has gained interest thanks to their highly tumor-specific expression, immunogenic properties and multifaceted roles in promoting cancer hallmarks [ 7 – 10 ]. Aberrant expression of Lactate Dehydrogenase C (LDHC) is observed in different types of cancer, where it is associated with tumor progression, metastasis, and poor prognosis [ 11 – 13 ]. Previously, we demonstrated that knockdown of LDHC reduces long term survival of breast tumor cells, in particular of TNBC cells, through dysregulation of cell cycle progression and impairment of the DNA damage response pathway [ 14 ]. LDHC can thus be included in the expanding group of CTAs involved in regulating genomic integrity. Moreover, we found that targeting LDHC greatly improved treatment response to commonly used DNA damage response-related drugs such as cisplatin and olaparib. Gene therapy using RNA interference (RNAi)-based drugs has shown remarkable progress with numerous tumor-related RNAi drugs undergoing clinical trials [ 15 ]. For instance, RNAi therapeutics targeting anti-apoptosis genes, oncogenes and tumor signaling molecules such as Bcl-2, MYC, KRAS, AKT1 and STAT3 have entered phase II trials. Despite promising preclinical outcomes, RNAi-based therapy has yet to transition into clinical practice as several challenges remain to be addressed including stability, targeting ability, off-target effects, and toxicity. Advances in the development of cell penetrating peptides (CPPs) as delivery systems for RNAi-based therapy have aided to address some of these challenges. The use of CPPs improves RNAi serum stability and internalization efficiency. Additionally, CPPs containing the arginine-glycine-aspartic acid (RGD) tripeptide enhance tumor specificity through binding of integrins αvβ3 (INTαVβ3) [ 16 ]. The use of CPPs has demonstrated efficient delivery of siRNA cargo with notable anti-tumor activity. For example, cyclic-RGD:siEGFR reduced EGFR tumor expression by 50% and significantly decreased tumor size in glioblastoma (U87MG) xenograft mice [ 17 ]. Furthermore, multiple studies have reported that CPPs incorporating an internalizing RGD peptide (iRGD) enhance tumor penetration and improve anti-cancer therapeutic effects [ 18 , 19 ]. In this study, we investigated the delivery efficacy, anti-tumor activity and safety of four distinct CPPs targeting LDHC including polyarginine (10R), 10R-linear RGD (10R-RGD), cyclic-RGD-10R (cRGD-10R) and internalizing RGD-10R (iRGD-10R). All CPPs formed uniform, positively charged RNAi-nanocomplexes with good serum stability, efficient cellular uptake and effective LDHC knockdown in triple negative breast cancer cell lines. Each of the CPP:siRNA nanocomplexes was associated with a favorable safety profile in non-cancerous and cancerous cell lines. Administration of particularly the 10R-RGD and cRGD-10R peptide:siLDHC complexes decreased long term tumor cell survival and improved chemotherapy responses in vitro. Moreover, 10R-RGD and cRGD-10R based delivery of siLDHC significantly reduced tumor burden in TNBC xenograft zebrafish in the absence of toxicity. METHODS Cell penetrating peptides (CPPs) and siRNA CPPs were synthesized by ThermoFisher scientific (USA) using solid-phase peptide synthesis and purity was determined by high-performance liquid chromatography (HPLC). CPP sequences, purity and molecular weight are listed in Table 1 . CPPs were resuspended in RNase/DNase free water at 1mg/ml. Accell siLDHC#1 (A-008759-14-0020), siLDHC#2 (A-008759-15-0020) and siCTRL1 (D-001910-20) were obtained from Dharmacon (Lafayette, CO, USA) and resuspended at 100 µM. View this table: View inline View popup Download powerpoint Table 1: The biochemical properties of CPPs CPP:siRNA complex preparation CPP (1 mg/ml stock) and siRNA (100 µM stock) were mixed at various peptide:siRNA molar ratios (2.5:1, 5:1, 10:1) in 50 µl of Ultra-Pure DNase/RNase free water. After 45 min incubation at room temperature, Opti-MEM I Reduced Serum medium (Gibco, #11058-021) was added to achieve a final siRNA concentration of 200nM and CPP concentration of 30-60 nM. Gel retardation assay CPP:siRNA complex solutions at various peptide:siRNA molar ratios were supplemented with 1.25x formamide loading dye, and resolved on a 20% native polyacrylamide gel electrophoresis (PAGE) for 120 minutes at 120 V using 1X Tris-Boric-EDTA (TBE) buffer, alongside a 100bp DNA ladder (ThermoFisher Scientific,#SM024). The gels were stained with SYBR gold (Invitrogen, S11494) for 20 mins and analyzed under UV light using ChemiDoc (Bio-Rad). Unconjugated or naked siRNA was used as control. Physicochemical characterization of CPP:siRNA nanocomplexes Particle size, zeta potential, polydispersity index and conductivity were measured for each CPP:siRNA complex, diluted in 1ml Ultra-Pure DNAse/RNAse free water, using a Zetasizer Ultra ZSU5700 (Malvern Instruments, Inc., Worcestershire, UK) at a wavelength of 677nm with a constant angle of 90° at 37⸰C. Additionally, complex morphology and size was analyzed by transmission electron microscopy using the TALOSF200X microscope (ThermoFisher scientific). Briefly, 10-µL of sample suspension was applied onto a 300-mesh carbon-coated copper grid, negatively stained with uranyl acetate (Electron microscopy science, #22405), and air-dried prior to collecting images using the Talos F200C Transmission Electron Microscope (Thermo Fisher Scientific). Serum stability assay CPPs were complexed with siLDHC#2 at 5:1 peptide:siRNA molar ratio for 45 min at room temperature. Next, CPP:siRNA complexes and naked siRNA were incubated at 37 °C with 50% normal human serum (Invitrogen,#31876) or Ultra-Pure DNAse/RNAse free water for 6, 12 or 24 hours and frozen at −20 °C. Samples were centrifuged at 10,000 rpm for 5 min at 4°C and pellets were resuspended in 15 μl of Ultra-Pure DNAse/RNAse free water. Finally, samples were incubated with proteinase K (0.006 mM), CaCl 2 (0.3 mM) and Tris-HCl (3 mM, pH = 7.0) for 5.5-6 hours at 37 °C. Formamide loading buffer was added to the samples after which electrophoresis was performed using native 20% PAGE for 120 min at a constant voltage of 120 V. Gels were stained with SYBR Gold (Invitrogen, S11494) for 20 min, and analyzed using ChemiDoc TM XR (Bio-Rad). Cell culture MDA-MB-453, MDA-MB-468, BT-549, DU4475, HUVEC and IMR-90 were purchased from the American Tissue Culture Collection (ATCC). MDA-MB-468 and MDA-MB-453 cells were maintained in Dulbecco’s Minimum Essential Media (DMEM, Gibco, #10569-010) supplemented with 10% v/v fetal bovine serum (FBS, Gibco, #10082-147), 50 U/mL Penicillin and 50 µg/mL Streptomycin (Gibco, #15140-122). BT-549 cells were cultured in ATCC-formulated Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, A10491-01) supplemented with 10% (v/v) FBS (Gibco, #10082-147), 50 U/mL penicillin and 50 µg/mL streptomycin (Gibco, #15140-122), and 0.023 IU/mL insulin (Sigma-Aldrich, #11070-73-8). DU4475 cells were maintained in ATCC-formulated Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, A10491-01) supplemented with 10% (v/v) FBS (Gibco, #10082-147, 50 U/mL Penicillin and 50 µg/mL Streptomycin (Gibco, #15140-12). HUVEC cells were maintained in EBM-2 (Lonza, cc-3156) supplemented with EGM TM -2 singleQuots supplements (Lonza, # CC-4176) and using collagen coated flask (Thermoscientific, #132606). IMR-90 cells were cultured in Minimum Essential Media (MEM, Gibco, #41090-028) supplemented with 10% v/v FBS (Gibco, #10082-14), 50 U/mL Penicillin and 50 µg/mL Streptomycin (Gibco, #15140-122), 1% sodium pyruvate (Gibco, #11360-039), 1% non-essential amino acids (Gibco, #11140-050). All cell lines were maintained at 37 °C and 5% CO 2 in a humidified incubator. Regular mycoplasma testing was conducted using a polymerase chain reaction (PCR)-based detection assay. Early passage cells (< P10) were used for all experiments. Cellular uptake of CPP:siRNA nanocomplexes To enable visualization of cellular uptake of the CPP:siRNA complexes in cancer cells, siRNA was pre-labeled with Cy™3 using the Silencer™ siRNA Labeling Kit (ThermoFisher scientific, #2960050). A total of 1×10 5 MDA-MB-468 breast cancer cells were plated per well in a 12-well plate and left overnight at 37 °C and 5% CO2. Next, cells were washed once with DPBS Gibco, #14190-094) and pre-incubated in Opti-MEM I Reduced Serum medium (Gibco, #11058-021) for 30 min after which 500µl of CPP:siRNA (400nM siRNA in Opti-MEM I Reduced Serum medium) was added to each well. After 6 hours, 500ul of complete, antibiotic-free DMEM media was added (final siRNA concentration= 200 nM). In parallel, cells were incubated with either 100pmol of siRNA alone (naked siRNA control) or were transfected with siRNA using lipofectamine 3000 (Thermo Fisher, #3000-001) according to the manufacturer’s guidelines. After 72 hours, cellular uptake of CPP:siRNA-Cy3 complexes was visualized using the Olympus IX73 microscope at 10X magnification. Flow cytometry analysis of integrin αvβ3 expression A range of breast cancer and non-cancerous cell lines with varying expression of integrin αvβ3 was selected to assess RGD-mediated cellular uptake and toxicity of CPP:siRNA complexes. Integrin αvβ3 expression was analyzed using flow cytometry, real time qRT-PCR, and western blotting. For flow cytometry, a total of 1×10 5 cells was incubated with 100 µl stain buffer (BD Bioscience, #554656), supplemented with 5μl of human FcR Blocking reagent (Miltenyi Biotec, #130-059-901). After 15 min incubation at 4°C, cells were incubated with mouse anti-human integrin αvβ3 BV421 conjugated antibody (BD Biosciences, #744088) at 1:20 for one hour followed by two washes with DPBS (Gibco, #14190-094) at 300 x g for 5 min at room temperature. Finally, integrin αvβ3 expression was analyzed on the BD LSRFortessa X-20 instrument (BD Biosciences). For each sample 10,000 events were recorded, and further analysis was performed using FlowJo™ Software (BD Biosciences, version 10.8). Expression analysis of LDHC and integrins using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) To assess the effect of CPP:siRNA treatment on LDHC expression, total RNA was isolated 72 hours after treatment using the RNeasy Mini kit (Qiagen, #74106). In addition, total RNA was extracted from a range of breast cancer and non-cancerous cell lines to determine the expression of integrin αv and integrin β3 . RNA quantity and purity was assessed using A260/A280 and A260/A230 measurements on a Nanodrop2000 spectrophotometer (ThermoFisher Scientific). Next, cDNA was synthesized from 1 µg of total RNA using the M-MLV Reverse Transcriptase kit (Invitrogen, #28025-013) according to the manufacturer’s guidelines. LDHC expression was quantified using a specific 5′FAM-3′MGB TaqMan gene expression primer/probe set (Hs00255650_m1, Applied Biosystems, Foster City, CA, USA). The mRNA expression of integrin αv and integrin β3 was quantified using 100ng of cDNA, specific SYBR-based qPCR primers (integrin αv F: 5-GGGACTCCTGCTACCTCTGT-3, integrin αv R: 5-GAAGAAACATCCGGGAAGACG-3, integrin β3 F: 5-ACTGGCAAGGATGCAGTGAA-3 and integrin β3 R: TTGGACACTCTGGCTCTTC-3) and the PowerUp SYBR Green master mix (Applied Biosystems, #A25742). All reactions were performed on the QuantStudio 7 Real-time PCR instrument (Applied Biosystems). Expression levels were normalized to the housekeeping gene RPLPO (TaqMan primer/probe 4333761F or SYBR primers F: TCCTCGTGGAAGTGACATCG, R: TGGATGATCTTAAGGAAGTAGTTGG) and differential gene expression was calculated using the 2 −ΔΔCt method. Western blotting of LDHC and integrins Western blotting was used to determine protein expression of LDHC, integrin αv and integrin β3 in various cell lines. Approximately 5×10 5 MDA-MB-468 cells were plated in 6-well plates, followed by incubation with CPP:siRNA (final siRNA conc = 200nM) for 72 hours after which protein lysates were isolated using RIPA buffer (Pierce, #89900) supplemented with a HALT protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, #87786). Protein lysates were centrifuged for 30 min at 20,000 x g and protein content of supernatants was determined using the BCA protein assay (Thermo Fisher Scientific, #23225). Protein samples were reduced and denatured in 4x Laemmli sample buffer (BioRad, #161-07470), loaded onto a 4–15% TGX gel (BioRad, #4561084) and transferred onto polyvinylidene fluoride (PVDF) membrane (BioRad, #1704156). Membranes were blocked in 5% non-fat dried milk/Tris-buffered saline with 0.1% Tween-20, washed and incubated overnight at 4 °C with the following primary antibodies diluted in blocking buffer; rabbit anti-human LDHC (Abcam, #ab52747, 1:1000), rabbit anti-human integrin αV (Cell signaling, #4711, 1:1000), rabbit anti-human integrin β3 (Cell signaling, #13166, 1:1000) and rabbit anti-human β-actin (Cell signaling, #4970, 1:1000). Next, membranes were washed, incubated with horseradish Peroxidase (HRP)-linked rabbit secondary antibody (Cell signaling, #7074, 1:5,000) for 1 h at room temperature, and proteins were detected by ECL Plus (Thermo Fisher Scientific, #32209) using the ChemiDoc XRS+ Imaging system (Bio-Rad). Images acquisition and densitometry analysis were performed using the IMAGE LAB software v6.1 (Bio-Rad). Cytotoxicity assay To assess toxicity induced by CPP:siRNA treatment, breast cancer and non-cancerous cells were seeded at 1×10 4 cells per well in an opaque 96-well plate and allowed to adhere overnight at 37 °C and % CO2. Next, 100µl CPP:siRNA complexes (50% v/v Opti-MEM I Reduced Serum medium and complete, antibiotic-free DMEM media) were added for 72 hours at 37°C and 5% CO2. Cytotoxicity was assessed using the CellTiter-Glo® reagent (Promega, #G7572) following the manufacturer’s guidelines and luminescence was recorded using the GloMax®-Multi Detection system (Promega). Clonogenic assay To determine the effect of CPP:siRNA complexes on the long-term survival of breast cancer cells as single agents or in combination with Olaparib (Selleck Chemicals, #AZD2281), 1×10 4 MDA-MB-468 breast cancer cells were seeded per well in a 12-well plate. On the 2 nd and 7 th day after seeding, cells were treated with CPP:siRNA complexes (50% v/v Opti-MEM I Reduced Serum medium and complete, antibiotic-free DMEM media) and on the 11 th day after seeding, cells were treated with olaparib (30 µM). The concentration of olaparib and treatment duration was chosen as previously described [ 10 ]. Then, on the 14 th day, cells were washed with DPBS (Gibco, #14190-094) and stained with 1% crystal violet (Sigma-Aldrich, #C6158) in 25% methanol. Excess stain was washed away, and crystal violet was eluted with 10% sodium dodecyl sulfate (SDS) and absorbance was measured at 590 nm on the NanoQuant infinite F200 Pro instrument (Tecan). Zebrafish maintenance and breeding In vivo cytotoxicity and anti-tumor activity of CPP:siRNA complexes were determined using zebrafish. Wild type AB zebrafish (Danio rerio) were maintained in standard conditions at the zebrafish laboratory at Sidra Medicine, Doha, Qatar. Adult zebrafish were set up for breeding, embryos were collected and maintained in PTU-E3 media at 28.5 °C. Zebrafish embryo toxicity test CPP:siRNA complexes (final siRNA concentration 150, 200, 250nM) were injected into single-cell stage wild type AB zebrafish embryos. At 4 days post-fertilization (dpf), the survival rate and morphology of the injected zebrafish embryos were compared to untreated embryos using the Zeiss Stemi 2000-C Stereo microscope (Zeiss). Zebrafish morphology was defined as G1: severely affected, G2: mildly affected, G3: normal. Breast cancer xenograft zebrafish model The anti-tumor activity of the 10R-RGD:siRNA and cRGD-10R:siRNA complexes was assessed using a breast cancer xenograft zebrafish model. A total of 1 × 10 6 MDA-MB-468 breast cancer cells were pre-labeled with Vybrant™ CM-DiI Cell-Labeling Solution (#V-22888, ThermoFisher scientific) for 20 min at 37°C. Next, 1×10 3 Dil-labeled MDA-MB-468 cells (in 5nl complete DMEM media) were injected into the yolk sac of 48 hours post-fertilization (hpf) anesthetized zebrafish embryos using a Pico-Liter Microinjector. After microinjection, zebrafish embryos were maintained in PTU-E3 medium using 24 well plates at 34°C. After 24 hours post-injection (hpi), the embryos were imaged using the Zeiss AXIO Zoom.V16 microscope at 100x magnification and 560 nm, and embryos were selected based on size and location of tumor engraftment for further experiments. Next, CPP:siRNA complexes (final siRNA concentration 200nM in 25 µl of Ultra-Pure DNAse/RNAse free water with peptide:siRNA molar ratio of 5) were injected into the heart of the selected embryos at 32hpi. Finally, embryos were imaged at 72hpi using the Zeiss AXIO Zoom.V16 microscope at 100x magnification and 560 nm. A total of 60 z-stack images were acquired and processed into maximum intensity projection images using the ZEN black software. Average fluorescence intensity and area was determined using both ImageJ (v1.54g) and ZEN (v 3.10) software. Statistical analysis Normality of data was assessed using the Shapiro–Wilk test, and the one-way analysis of variance (ANOVA) or two-tailed unpaired t-test were used to compare groups. P value ≤ 0.05 was defined as statistically significant. Data are represented as mean ± standard error of mean (SEM). Statistical analyses and data representation were performed using GraphPad prism v10.0.0 (San Diego, CA, USA). RESULTS Assessment of CPP:siRNA complex formation, serum stability and physicochemical characterization of the nanocomplexes Gel retardation assays were used to determine the optimal ratio that is required to encapsulate the siRNA with minimum release and maximum binding ability. LDHC siRNA was incubated with each of the four CPPs at different peptide:siRNA molar ratios (2.5:1, 5:1, 10:1). As shown in Figure 1A , robust complex formation was observed for all CPPs at peptide:siRNA molar ratios of 5:1 and 10:1. The ability of the CPP:siRNA complexes to protect the siRNA from degradation was assessed using a serum stability assay (using 5:1 peptide:siRNA molar ratio), which showed that siRNA integrity was maintained over 24 hours in 50% human serum ( Figure 1B ). Download figure Open in new tab Figure 1. Assessment of CPP:siRNA complex formation and serum stability (A) Visualization of 10R:siLDHC#2, 10R-RGD:siLDHC#2, cRGD-10R:siLDHC#2 and iRGD-10R:siLDHC#2 complex formation at different peptide:siRNA molar ratios using gel retardation assay. (B) Serum stability assay of CPP:siLDHC#2 complexes (5:1 peptide:siRNA molar ratio) in 50% human serum. Dynamic light scattering (DLS) analysis showed that the four distinct CPP:siRNA complexes exhibit an average hydrodynamic diameter ranging between 129 and 168 nm, zeta potentials of 6.47±9.34 to 29.62±7.76 mV, and polydispersity indices below 0.25 ( Figure 2A ). Transmission electron microscopy (TEM) revealed the formation of uniform, circular nanocomplexes of expected, smaller size (56-95 nm) compared to hydrodynamic diameter measured by DLS ( Figure 2B ). Download figure Open in new tab Figure 2. Physicochemical characterization of CPP:siRNA complexes (A) Dynamic Light Scattering analysis of 10R:siLDHC#2, 10R-RGD:siLDHC#2, cRGD-10R:siLDHC#2 and iRGD-10R:siLDHC#2 complexes at peptide:siRNA molar ratio of 5:1. Complexes were diluted in Ultra-Pure DNAse/RNAse free water and analyzed at 677nm at room temperature with a constant angle of 90°. Values represent mean and standard error of mean (±SEM) from three independent replicates. (B) Representative negative stain TEM images of CPP:siLDHC#2 complexes. Bar chart represents means and standard error of mean (±SEM) from three independent experiments. CPP:siRNA complexes demonstrate good cellular uptake in breast cancer cells and exhibit favorable safety profile in vitro We assessed the cellular uptake efficacy of the various CPP:siRNA complexes using integrin αvβ3 positive MDA-MB-468 breast cancer cells ( Figure 3 ). The 10R-RGD:siRNA and cRGD-10R:siRNA complexes demonstrated the highest cellular uptake efficiency compared to the 10R:siRNA and iRGD-10R:siRNA complexes. Next, a range of triple negative breast cancer cell lines and two non-cancerous cell lines were used to investigate the potential presence of toxicity following treatment with the CPP:siRNA complexes. The cell lines were chosen based on their expression of integrins αv and β3 (Figure S1) to allow the simultaneous assessment of toxicity related to unspecific uptake or RGD-mediated cellular uptake. The breast cancer cell lines MDA-MB-468 and BT-549 were selected as integrin αvβ3 positive cancer cell line models, while the MDA-MB-453 and DU4475 breast cancer cell lines were chosen to represent integrin αvβ3 negative cancer cells. In addition, the integrin αvβ3 expressing IMR-90 and HUVEC cells were used to study the safety profiles of the CPP:siRNA complexes in non-cancerous cells. No significant cytotoxicity was observed in either the breast cancer cell lines or the non-cancerous cells, except for a minor toxicity of the 10R-RGD:siRNA complex in MDA-MB-468 cells (12% toxicity) and DU4475 cells (20% toxicity), suggesting that our CPP:siRNA complexes overall exhibit a favorable safety profile ( Figure 4 ). Lipofectamine-mediated cellular uptake of naked siRNA induced toxicity to varying degrees as commonly seen using liposome transfection [ 20 ]. Download figure Open in new tab Figure 3. Cellular uptake of CPP:siRNA complexes in MDA-MB-468 breast cancer cells Immunofluorescent imaging of Cy3-prelabeled CPP:siRNA complexes after 72 hours incubation. Blue, DAPI; red, Cy3-labeled siRNA. Download figure Open in new tab Figure 4. Treatment with CPP:siRNA complexes is associated with a favorable safety profile in vitro Breast cancer and non-cancerous cell lines were treated with CPP:siRNA complexes (5:1 molar ratio) for 72 hours, and cytotoxicity was determined using CellTiter-Glo luminescent cell viability assay. Lipofectamine-mediated transfection of naked siCTRL was used as a positive control for efficient cellular uptake, and CPPs alone were used to assess the toxicity of the peptides. Error bars represent standard error of mean (±SEM) from three independent experiments. Statistical analysis to assess reduction in cell viability was performed using the one-way ANOVA test with Dunnett correction. * p<0.05, ** p<0.01; **** p<0.0001. These findings are in line with previous studies reporting low cytotoxicity levels using CPPs [ 21 , 22 ]. siRNA delivery by CPPs efficiently reduces LDHC expression and clonogenic ability in triple negative breast cancer cells in vitro Given the robust complex formation, good cellular uptake and low cytotoxicity of the CPP:siRNA complexes, we next sought to evaluate their LDHC knockdown efficiency in the integrin αvβ3 positive, LDHC expressing triple negative breast cancer cell lines MDA-MB-468 and BT-549.We found that the 10R, 10R-RGD and cRGD-10R peptides complexed with siLDHC#2 significantly reduced LDHC mRNA expression in MDA-MB-468 cells, with a borderline reduction in LDHC expression using the iRGD-10R peptide ( Figure 5A ). On the other hand, more modest reductions in LDHC expression were seen in BT-549 cells ( Figure 5B ), which is likely the result of their lower endogenous LDHC expression and likely reduced silencing efficiency [ 10 ]. Notably, we obtained a greater reduction in LDHC expression using the CPP:siRNA complexes as compared to the naked siRNA. Furthermore, the knockdown efficiency of the CPP:siLDHC complexes was confirmed at protein level with the 10R-RGD:siLDHC#2 and cRGD-10R:siLDHC#2 complexes showing the highest efficiencies, reducing LDHC protein expression by 38% and 41% respectively ( Figure 5C ). The clonogenic assay was used to evaluate the effect of CPP-mediated LDHC silencing, LDHC in combination with olaparib, on the long-term survival of MDA-MB-468 cells. Based on the knockdown efficiency results, the 10R-RGD:siRNA and cRGD-10R:siRNA complexes were selected for further functional validation. In accordance with our previous observations [ 10 ], CPP-mediated silencing of LDHC alone significantly reduced the clonogenic ability of MDA-MB-468 triple negative breast cancer cells and improved treatment response to olaparib ( Figure 6 ). This decrease in clonogenicity highlights the therapeutic potential of targeting LDHC in TNBC. Download figure Open in new tab Figure 5. CPP:siRNA complexes demonstrate efficient LDHC knockdown in triple negative breast cancer cells in vitro (A) LDHC mRNA expression, normalized to RPLPO, of MDA-MB-468 and (B) BT-549 cells following treatment with CPP:siRNA complexes for 72 hours. (C) Representative images of LDHC protein expression of MDA-MB-468 cells treated with CPP:siRNA complexes for 72 hours. β-actin was used as loading control. Bar chart represent densitometry values from three independent experiments (mean±SEM). Statistical analysis was performed using the one-way ANOVA test with Dunnett correction for comparison of more than two groups and two-tailed unpaired t-test for comparison of two groups. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Download figure Open in new tab Figure 6. CPP:siLDHC treatment significantly reduces the clonogenic ability of MDA-MB-468 cells and potentiates olaparib treatment Representative images of clonogenic assay using 10R-RGD:siRNA and cRGD-10R:siRNA alone or in combination with olaparib short-term treatment (72 hours). Bar chart depicting crystal violet absorbance measurements from three independent experiments (mean ±SEM). Statistical analysis was performed using the one-way ANOVA test with Šídák correction. * p<0.05, ** p<0.01, *** p<0.001. 10R-RGD and cRGD-10R:siRNA complexes exhibit anti-tumor activity with minor toxicity in breast cancer xenograft zebrafish model Our promising in vitro results, showing good LDHC knockdown efficiency with reduced colony-forming ability and low cytotoxicity, prompted us to evaluate the toxicity of the CPP:siRNA nanocomplexes in vivo . Cytotoxicity was assessed through microinjection of 10R-RGD:siRNA and cRGD-10R:siRNA complexes (150, 200 and 250nM) into single-cell stage wild type AB zebrafish embryos. Minor toxicity was observed for both CPP:siRNA complexes at various doses ( Figure 7A ). No significant morphological abnormalities of the zebrafish embryos were observed after microinjection with either 10R-RGD:siRNA or cRGD-10R:siRNA complexes ( Figure 7B ). Download figure Open in new tab Figure 7. 10R-RGD and cRGD-10R:siRNA complexes exhibit anti-tumor effects in TNBC xenograft zebrafish model without inducing toxicity (A) Zebrafish mortality and (B) morphological abnormalities following treatment with 10R-RGD:siRNA and cRGD-10R:siRNA complexes. G1: severely affected, G2: mildly affected, G3: normal. (C) Diagram of TNBC xenograft zebrafish model, depicting TNBC cell injection in the yolk at 2 days post-fertilization (dpf) and CPP:siRNA intracardial treatment at 32 hours post-injection (hpi). (D) Change in tumor cell burden, measured as % change in fluorescence intensity following CPP:siRNA treatment. Representative images of fluorescent tumor cells at 24hpi and 72hpi. Scatter dot plots represent fluorescence intensity values from two independent experiments (mean ±SEM). Statistical analysis was performed using the two-tailed unpaired t-test. ** p<0.01, *** p<0.001. Next, the therapeutic potential of CPP-based siLDHC delivery was assessed using a TNBC xenograft zebrafish model ( Figure 7C ). Treatment of MDA-MB-468 xenograft zebrafish larvae with cRGD-10R and 10R-RGD:siLDHC nanocomplexes resulted in a significant reduction in tumor burden ( Figure 7D ), achieving up to 50% reduction in tumor size using the 10R-RGD complex. These findings are in line with our in vitro results that demonstrate a higher cellular uptake and LDHC knockdown efficiency using 10R-RGD:siRNA complexes compared to cRGD-10R:siRNA. DISCUSSION Over the last few decades, cancer treatment has made great strides with targeted therapy and immunotherapy improving the prognosis of patients with various cancer types. Targeted therapy with mTOR, CDK4/6 or PI3K inhibitors in combination with hormonal therapy has now entered the clinic for the treatment of advanced breast cancer patients with hormone receptor positive tumors [ 23 ]. Further, patients with Her2-enriched breast tumors benefit from combination treatment of chemotherapy with a variety of anti-Her2 treatment modalities [ 24 ]. Despite these advances in molecular targeting, treatment options for patients with triple negative breast cancer remain limited. While TNBC patients with BRCA1/2 mutations may benefit from PARP inhibitors, and the prognosis of patients with PD-L1 tumor expression may be improved by immune checkpoint blockade, the majority of TNBC patients still receive standard-of-care chemotherapy alongside radiotherapy and surgery [ 2 , 25 ]. Moreover, while TNBC patients often exhibit good pathological response rates following chemotherapy, their overall prognosis remains poor due to early cancer recurrence and the development of chemoresistance. Hence, there is an unmet need to find novel therapeutic targets to increase clinical outcomes for these patients. Previously, we found that targeting LDHC, a highly tumor-specific metabolic enzyme, significantly augments genomic integrity, reduces the clonogenic ability of breast tumor cells and enhances treatment responses to DNA damage repair-related drugs in vitro . Hence, we hypothesized that targeting of LDHC could be used to complement traditional cancer treatments to enhance anti-tumor efficacy. However, specific LDHC inhibitors and blocking antibodies are currently unavailable. Therefore, we explored the therapeutic potential of siRNA-based drugs to target LDHC tumor expression. To date, five siRNA-based drugs have been approved by the FDA for the treatment of liver diseases, of whom four utilize N-acetylgalactosamine (GalNAc) as a targeting ligand for the asialoglycoprotein receptor (ASGPR), predominantly expressed in hepatocytes [ 26 ]. Although no siRNA therapeutics have been approved for cancer treatment to date, numerous candidates are currently in phase I/II clinical trials [ 26 ]. In the present study, we used cell penetrating peptides as a delivery system for LDHC siRNA in triple negative breast cancer cells. More specifically, we explored the use of the integrin αVβ3 RGD binding motif to facilitate tumor homing and penetrance of the siRNA therapeutic. Four CPPs; 10R, 10R-RGD, cRGD-10R and iRGD-10R; were studied for siRNA complexing efficiency, serum stability and cytotoxicity in vitro . All four CPPs formed uniform structures with the siRNA molecules, resulting in positively charged nanocomplexes which enhance permeability and retention [ 27 ]. Complexing siRNA with the CPPs enhanced their persistence in human serum, indicating that the peptides were able to protect the siRNA from circulating RNA enzymes. Furthermore, no to minor toxicity was observed using the CPP:siRNA complexes in either breast cancer cells (αVβ3 negative or positive TNBCs) or non-cancerous cells (integrin αVβ3 positive IMR-90 and HUVEC cells), indicating a favorable safety profile with no adverse side effects. Comparative analysis of LDHC knockdown efficiency revealed that the 10R-RGD:siLDHC and cRGD-10R:siLDHC complexes more effectively reduced LDHC expression in MDA-MB-468 triple negative breast cancer cells (integrin αVβ3 positive), achieving up to a 40% reduction at the protein level and 63% at the mRNA level. These findings are in accordance with other preclinical studies reporting silencing efficiencies of approximately 70% using CPPs in cancer. For example, Van Asbeck et al reported knockdown efficiencies ranging from 70-85% using PF6 and PF14 encapsulated siRNA, while C6M1 conjugated siRNA targeted GAPDH in ovarian cells with a knockdown efficiency of about 70% [ 28 , 29 ]. Next, we evaluated the therapeutic potential of targeting LDHC in TNBC using CPP-siRNA based therapy. Based on our previous work, we investigated whether CPP:siLDHC treatment alone and in combination with olaparib impacts the clonogenic ability of TNBC cells. Similarly to our previous observations, CPP:siRNA-based targeting of LDHC, in particular using 10R-RGD:siLDHC and cRGD-10R:siLDHC, significantly reduced tumor cell clonogenic ability and greatly enhanced the anti-tumor effect of olaparib, indicating that CPP:siLDHC therapy could provide a promising strategy for the treatment of TNBC. To validate the clinical significance of CPP:siLDHC-based therapy, the anti-tumor activity and safety profiles of 10R-RGD:siLDHC and cRGD-10R:siLDHC delivery were investigated in a TNBC xenograft zebrafish model. Both complexes significantly reduced tumor burden, with the 10R-RGD complex achieving up to a 50% reduction in tumor size, without inducing major morphological abnormalities or death. CONCLUSION In conclusion, we identified two CPP:siRNA nanocomplexes; 10R-RGD:siLDHC and cRGD-10R:siLDHC; that persist in serum and effectively target LDHC in triple negative breast cancer, exhibiting significant anti-tumor activity and a favorable safety profile in vitro and in vivo. These findings corroborate LDHC as a promising target for TNBC therapy and highlight the potential of CPP:siRNA-based drugs as a novel therapeutic approach for cancer therapy. DECLARATIONS ETHICS APPROVAL AND CONSENT TO PARTICIPATE All animal work was performed according to the Ministry of Public Health (MOPH), Qatar animal research guidelines under an approved protocol by the Institutional Animal Care and Use Committee (protocol SIDRA-2024-005), and adhered to the ARRIVE guidelines. AVAILABILITY OF DATA AND MATERIALS All data that supports the findings of this study are included in this published article. Additional data can be provided upon request from the corresponding author. COMPETING INTERESTS The authors declare that they have no competing interests. AUTHOR CONTRIBUTIONS HQ: Formal Analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing; AN: Formal Analysis, Investigation, Methodology, Visualization, Writing – review & editing; TG: Formal Analysis, Writing – review & editing; JP: Formal Analysis, Writing – review & editing; UJ: Formal Analysis, Investigation, Writing – review & editing; MS: Investigation, Writing – review & editing; RT: Investigation, Writing – review & editing; KAM: Methodology, Writing – review & editing; JD: Conceptualization, Formal Analysis, Funding acquisition, Project Administration, Supervision, Visualization, Writing – original draft, Writing – review & editing. All authors read and approved the final manuscript. FUNDING This work was supported by grants from the Qatar Biomedical Research Institute (VR94-IGP3-2020, VR94-IGP6-2024), and made possible from the funding received for the project, Validation of LDHC as a novel Target for Precision Medicine in Breast Cancer (#VPR-TG01-003), awarded by the Hamad Bin Khalifa Vice President Office. The findings herein reflect the work and are solely the responsibility of the authors. ACKNOWLEDGEMENTS We would like to thank Dr Sahar Da’as and her team from the Zebrafish Core Facility, Sidra Medicine, Qatar for their invaluable contributions to the xenograft zebrafish work. We would like to acknowledge the HBKU Materials Core Lab for their valuable support and resources provided. References [1]. ↵ F. Bray , M. Laversanne , H. Sung , J. Ferlay , R.L. Siegel , I. Soerjomataram , A. Jemal , Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries , CA Cancer J Clin 74 ( 2024 ) 229 – 263 . doi: 10.3322/caac.21834 . OpenUrl CrossRef [2]. ↵ Z. Chen , Y. Liu , M. Lyu , C.H. Chan , M. Sun , X. Yang , S. Qiao , Z. Chen , S. Yu , M. Ren , A. Lu , G. Zhang , F. Li , Y. Yu , Classifications of triple-negative breast cancer: insights and current therapeutic approaches , Cell Biosci 15 ( 2025 ) 13 . doi: 10.1186/s13578-025-01359-0 . OpenUrl CrossRef PubMed [3]. ↵ M. Zubair , S. Wang , N. Ali , Advanced Approaches to Breast Cancer Classification and Diagnosis , Front Pharmacol 11 ( 2020 ) 632079 . doi: 10.3389/fphar.2020.632079 . OpenUrl CrossRef PubMed [4]. ↵ G. Palma , G. Frasci , A. Chirico , E. Esposito , C. Siani , C. Saturnino , C. Arra , G. Ciliberto , A. Giordano , M. D’Aiuto , Triple negative breast cancer: looking for the missing link between biology and treatments , Oncotarget 6 ( 2015 ) 26560 – 26574 . OpenUrl CrossRef PubMed [5]. ↵ J.-R. Jhan , E.R. Andrechek , Triple-negative breast cancer and the potential for targeted therapy , Pharmacogenomics 18 ( 2017 ) 1595 – 1609 . doi: 10.2217/pgs-2017-0117 . OpenUrl CrossRef PubMed [6]. ↵ R.L.B. Costa , H.S. Han , W.J. Gradishar , Targeting the PI3K/AKT/mTOR pathway in triple-negative breast cancer: a review , Breast Cancer Res Treat 169 ( 2018 ) 397 – 406 . doi: 10.1007/s10549-018-4697-y . OpenUrl CrossRef PubMed [7]. ↵ S. Ren , Z. Zhang , M. Li , D. Wang , R. Guo , X. Fang , F. Chen , Cancer testis antigen subfamilies: Attractive targets for therapeutic vaccine (Review) , Int J Oncol 62 ( 2023 ) 71 . doi: 10.3892/ijo.2023.5519 . OpenUrl CrossRef PubMed [8]. R. Thomas , G. Al-Khadairi , J. Roelands , W. Hendrickx , S. Dermime , D. Bedognetti , J. Decock , NY-ESO-1 Based Immunotherapy of Cancer: Current Perspectives , Front Immunol 9 ( 2018 ) 947 . doi: 10.3389/fimmu.2018.00947 . OpenUrl CrossRef PubMed [9]. R. Thomas , H. Shaath , A. Naik , S.M. Toor , E. Elkord , J. Decock , Identification of two HLA-A*0201 immunogenic epitopes of lactate dehydrogenase C (LDHC): potential novel targets for cancer immunotherapy , Cancer Immunol Immunother 69 ( 2020 ) 449 – 463 . doi: 10.1007/s00262-020-02480-4 . OpenUrl CrossRef PubMed [10]. ↵ G. Al-Khadairi , J. Decock , Cancer Testis Antigens and Immunotherapy: Where Do We Stand in the Targeting of PRAME? , Cancers 11 ( 2019 ) 984 . doi: 10.3390/cancers11070984 . OpenUrl CrossRef PubMed [11]. ↵ Y. Hua , C. Liang , J. Zhu , C. Miao , Y. Yu , A. Xu , J. Zhang , P. Li , S. Li , M. Bao , J. Yang , C. Qin , Z. Wang , Expression of lactate dehydrogenase C correlates with poor prognosis in renal cell carcinoma , Tumour Biol 39 ( 2017 ) 1010428317695968 . doi: 10.1177/1010428317695968 . OpenUrl CrossRef PubMed [12]. Z. Cui , Y. Chen , M. Hu , Y. Lin , S. Zhang , L. Kong , Y. Chen , Diagnostic and prognostic value of the cancer-testis antigen lactate dehydrogenase C4 in breast cancer , Clin Chim Acta 503 ( 2020 ) 203 – 209 . doi: 10.1016/j.cca.2019.11.032 . OpenUrl CrossRef [13]. ↵ Z. Cui , Y. Li , Y. Gao , L. Kong , Y. Lin , Y. Chen , Cancer-testis antigen lactate dehydrogenase C4 in hepatocellular carcinoma: a promising biomarker for early diagnosis, efficacy evaluation and prognosis prediction , Aging (Albany NY ) 12 ( 2020 ) 19455 – 19467 . doi: 10.18632/aging.103879 . OpenUrl CrossRef PubMed [14]. ↵ A. Naik , J. Decock , Targeting of lactate dehydrogenase C dysregulates the cell cycle and sensitizes breast cancer cells to DNA damage response targeted therapy , Mol Oncol 16 ( 2022 ) 885 – 903 . doi: 10.1002/1878-0261.13024 . OpenUrl CrossRef PubMed [15]. ↵ Z. Tian , G. Liang , K. Cui , Y. Liang , Q. Wang , S. Lv , X. Cheng , L. Zhang , Insight Into the Prospects for RNAi Therapy of Cancer , Front Pharmacol 12 ( 2021 ) 644718 . doi: 10.3389/fphar.2021.644718 . OpenUrl CrossRef PubMed [16]. ↵ S. Fu , X. Xu , Y. Ma , S. Zhang , S. Zhang , RGD peptide-based non-viral gene delivery vectors targeting integrin αvβ3 for cancer therapy , J Drug Target 27 ( 2019 ) 1 – 11 . doi: 10.1080/1061186X.2018.1455841 . OpenUrl CrossRef PubMed [17]. ↵ S. He , B. Cen , L. Liao , Z. Wang , Y. Qin , Z. Wu , W. Liao , Z. Zhang , A. Ji , A tumor-targeting cRGD-EGFR siRNA conjugate and its anti-tumor effect on glioblastoma in vitro and in vivo , Drug Deliv 24 ( 2017 ) 471 – 481 . doi: 10.1080/10717544.2016.1267821 . OpenUrl CrossRef PubMed [18]. ↵ M. Li , Z. Tang , D. Zhang , H. Sun , H. Liu , Y. Zhang , Y. Zhang , X. Chen , Doxorubicin-loaded polysaccharide nanoparticles suppress the growth of murine colorectal carcinoma and inhibit the metastasis of murine mammary carcinoma in rodent models , Biomaterials 51 ( 2015 ) 161 – 172 . doi: 10.1016/j.biomaterials.2015.02.002 . OpenUrl CrossRef PubMed [19]. ↵ J. Huang , W. Lai , Q. Wang , Q. Tang , C. Hu , M. Zhou , F. Wang , D. Xie , Q. Zhang , W. Liu , Z. Zhang , R. Zhang , Effective Triple-Negative Breast Cancer Targeted Treatment Using iRGD-Modified RBC Membrane-Camouflaged Nanoparticles , Int J Nanomedicine 16 ( 2021 ) 7497 – 7515 . doi: 10.2147/IJN.S321071 . OpenUrl CrossRef PubMed [20]. ↵ S.J.H. Soenen , A.R. Brisson , M. De Cuyper , Addressing the problem of cationic lipid-mediated toxicity: the magnetoliposome model , Biomaterials 30 ( 2009 ) 3691 – 3701 . doi: 10.1016/j.biomaterials.2009.03.040 . OpenUrl CrossRef PubMed Web of Science [21]. ↵ A.A. Mokhtarieh , S. Kim , Y. Lee , B.H. Chung , M.K. Lee , Novel cell penetrating peptides with multiple motifs composed of RGD and its analogs , Biochem Biophys Res Commun 432 ( 2013 ) 359 – 364 . doi: 10.1016/j.bbrc.2013.01.096 . OpenUrl CrossRef PubMed [22]. ↵ Y. Ye , L. Zhu , Y. Ma , G. Niu , X. Chen , Synthesis and evaluation of new iRGD peptide analogs for tumor optical imaging , Bioorg Med Chem Lett 21 ( 2011 ) 1146 – 1150 . doi: 10.1016/j.bmcl.2010.12.112 . OpenUrl CrossRef PubMed [23]. ↵ P. du Rusquec , C. Blonz , J.S. Frenel , M. Campone , Targeting the PI3K/Akt/mTOR pathway in estrogen-receptor positive HER2 negative advanced breast cancer , Ther Adv Med Oncol 12 ( 2020 ) 1758835920940939 . doi: 10.1177/1758835920940939 . OpenUrl CrossRef PubMed [24]. ↵ M. Brandão , N.F. Pondé , F. Poggio , N. Kotecki , M. Salis , M. Lambertini , E. de Azambuja , Combination therapies for the treatment of HER2-positive breast cancer: current and future prospects , Expert Rev Anticancer Ther 18 ( 2018 ) 629 – 649 . doi: 10.1080/14737140.2018.1477596 . OpenUrl CrossRef PubMed [25]. ↵ Y. Yao , Y. Chu , B. Xu , Q. Hu , Q. Song , Radiotherapy after surgery has significant survival benefits for patients with triple-negative breast cancer , Cancer Med 8 ( 2019 ) 554 – 563 . doi: 10.1002/cam4.1954 . OpenUrl CrossRef PubMed [26]. ↵ H. Motamedi , M.M. Ari , A. Alvandi , R. Abiri , Principle, application and challenges of development siRNA-based therapeutics against bacterial and viral infections: a comprehensive review , Front Microbiol 15 ( 2024 ) 1393646 . doi: 10.3389/fmicb.2024.1393646 . OpenUrl CrossRef PubMed [27]. ↵ J. Fang , H. Nakamura , H. Maeda , The EPR effect: Unique features of tumor blood vessels for drug delivery, factors involved, and limitations and augmentation of the effect , Adv Drug Deliv Rev 63 ( 2011 ) 136 – 151 . doi: 10.1016/j.addr.2010.04.009 . OpenUrl CrossRef PubMed [28]. ↵ M. Jafari , W. Xu , R. Pan , C.M. Sweeting , D.N. Karunaratne , P. Chen , Serum stability and physicochemical characterization of a novel amphipathic peptide C6M1 for siRNA delivery , PLoS One 9 ( 2014 ) e97797 . doi: 10.1371/journal.pone.0097797 . OpenUrl CrossRef PubMed [29]. ↵ A.H. van Asbeck , A. Beyerle , H. McNeill , P.H.M. Bovee-Geurts , S. Lindberg , W.P.R. Verdurmen , M. Hällbrink , U. Langel , O. Heidenreich , R. Brock , Molecular parameters of siRNA--cell penetrating peptide nanocomplexes for efficient cellular delivery , ACS Nano 7 ( 2013 ) 3797 – 3807 . doi: 10.1021/nn305754c . OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted March 13, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Anti-tumor effects of a novel cell penetrating peptide-based therapeutic approach to target Lactate Dehydrogenase C (LDHC) in triple negative breast cancer Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Anti-tumor effects of a novel cell penetrating peptide-based therapeutic approach to target Lactate Dehydrogenase C (LDHC) in triple negative breast cancer Hanan Qasem , Adviti Naik , Tricia Gomez , Janarthanan Ponraj , Umar Jafar , Martin Sikhondze , Remy Thomas , Khaled A Mahmoud , Julie Decock bioRxiv 2025.03.11.641612; doi: https://doi.org/10.1101/2025.03.11.641612 Share This Article: Copy Citation Tools Anti-tumor effects of a novel cell penetrating peptide-based therapeutic approach to target Lactate Dehydrogenase C (LDHC) in triple negative breast cancer Hanan Qasem , Adviti Naik , Tricia Gomez , Janarthanan Ponraj , Umar Jafar , Martin Sikhondze , Remy Thomas , Khaled A Mahmoud , Julie Decock bioRxiv 2025.03.11.641612; doi: https://doi.org/10.1101/2025.03.11.641612 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cancer Biology Subject Areas All Articles Animal Behavior and Cognition (7616) Biochemistry (17625) Bioengineering (13852) Bioinformatics (41825) Biophysics (21397) Cancer Biology (18524) Cell Biology (25417) Clinical Trials (138) Developmental Biology (13350) Ecology (19858) Epidemiology (2067) Evolutionary Biology (24277) Genetics (15581) Genomics (22459) Immunology (17698) Microbiology (40278) Molecular Biology (17134) Neuroscience (88400) Paleontology (666) Pathology (2823) Pharmacology and Toxicology (4812) Physiology (7632) Plant Biology (15106) Scientific Communication and Education (2042) Synthetic Biology (4281) Systems Biology (9807) Zoology (2266)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.