A Mechanistic Approach to Elucidate the Molecular Basis of Amelioration of Perinatal Undernutrition Induced Cognitive Impairment Using Astaxanthin and DHA in the Adult Life of Albino Wistar Rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A Mechanistic Approach to Elucidate the Molecular Basis of Amelioration of Perinatal Undernutrition Induced Cognitive Impairment Using Astaxanthin and DHA in the Adult Life of Albino Wistar Rats Damodara Gowda K M, Megha Bhat, Pramukh Hegde, Praveen Rai, Monika Sadananda This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3322166/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Maternal nutrition has been recognized as a significant component of brain growth and maturation in most mammalian species. Here, we showed that the downregulation of BDNF, NT-3, CREB, and UCP2 gene expressions in perinatally undernourished animals in their adult life was mitigated by Astaxanthin and DHA. We also found that maternal undernutrition reduced the pups’ weight at birth considerably and remained decreased throughout the study. Maternal AsX and DHA supplementation ameliorated the undernutrition-induced learning impairment in NOR test and partially baited radial arm maze tasks. Furthermore, the expressions of Synapsin-1 and PSD-95 decreased in perinatally undernourished groups compared to control, and AsX-DHA treated groups at CA1, CA2, CA3, and DG, respectively. Our results identified a signalling pathway that mediates perinatal undernutrition stress-induced cognitive decline via intracellular signalling cascades like MAPK, PI3K, and PLC, triggering neuronal differentiation, survival, and plasticity, indicating the critical time for the reversal of undernutrition-induced cognitive impairment. Biological sciences/Neuroscience/Synaptic plasticity Biological sciences/Physiology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction The formation of the central nervous system is a complicated process that needs an enormous amount of energy as well as particular nutritional components. Maternal nutrition has been recognized as a significant component of brain growth and maturation in most mammalian species 1 . Previous studies reported that prenatal, and postnatal manipulations can program functional brain development in most mammalian species 2 . Heredity, nutrition, and living environment are the key elements involved in the functional development of the brain, with nutrition being a highly significant non-genetic aspect with a long-term influence on brain development 3 . Early life nutritional insufficiency results in long-term learning and memory deficits in adults. Therefore, the perinatal period is crucial for brain development. As we know, foetuses and new-borns depend upon placental blood and breast milk for their nutrient requirements, as a result, any condition that reduces placental blood flow and/or the quantity and/or quality of breast milk might result in foetal and neonatal malnutrition. The maternal diet would be one of the most important variables impacting brain development if the mother is free of hereditary abnormalities 4 . Hence availability of nutrients is important for brain growth and the development of optimal cognitive function 5 . According to a WHO report (2021), undernutrition is responsible for approximately 45% of deaths in children under five, primarily in low- and middle-income countries resulting from chronic undernutrition, poor socioeconomic conditions, maternal health, and inappropriate early childhood care 6 . Several approaches have been made to overcome the detrimental effects of undernutrition stress by giving nutritional supplements to mothers as well as to the progeny. Findings of these studies have revealed, availability of nutritional components plays important role in development of brain during foetal and neonatal stage. In particular, plant based and marine derived nutrients such as carotenoids, omega-3 fatty acids, flavonoids, vitamins etc have shown promising effects on improvement of brain function by various repair mechanisms. However, there is paucity in the available literature regarding the dietary approach using antioxidant in positively influencing the foetal programming of brain health in adult offspring’s suffered undernutrition in their prenatal and/or postnatal life. In this point of view, in the present study we have evaluated the effect of Astaxanthin (AsX) and DHA as dietary supplements to ameliorate the effect of pre, post and perinatal undernourishment induced stress in the adult life. Carotenoids have been studied for its influence on human health; xanthophyll AsX is one such carotenoid that has received a lot of interest recently.AsX (3,3’-dihydroxy-β,β’-carotene-4,4’-dione) is widely distributed in microorganisms and marine animals including, algae, yeast, salmon, trout, krill, shrimp, and crayfish 7 . AsX contains conjugated double bonds, hydroxyl and keto groups, which are responsible for its antioxidant properties 8 , 9 . Various biological activities of AsX have been reported such as anti-inflammatory, antiapoptosis, antioxidative, and neuroprotective 10 , 11 . In an amygdala kindling model of epilepsy, AsX treated rats were protected from hippocampal injury 12 . Also, it has been reported that AsX may modulate the brain-derived neurotrophic factor, a key growth factor of neuronal development in perinatally undernourished rats 4 . Docosahexaenoic acid (DHA) is an omega-3 polyunsaturated fatty acid (PUFA), most predominantly found in brain grey matter and in the retina of mammals. Several studies have reported the important role of DHA in the brain development, which includes, neuronal differentiation, formation of synapses, neurite growth, anti-apoptosis and antioxidant properties 13 , 14 , 15 , 16 . During the last trimester of pregnancy and neonatal period, DHA is preferentially transferred from maternal resources to foetus circulation via the placenta and breastfeeding; it rapidly accumulates in the foetal brain and plays a critical role in the initial stage of brain development. And the rate of accumulation of DHA in the foetus brain depends upon the maternal diet (breastfeeding) 17 , 13 . Recent study has shown that DHA depleted (70%) mice of the third generation of traumatic brain injury, exhibited accelerated neuronal death and slower cognitive and motor recovery when compared to normal control mice 18 . In a rodent model of traumatic brain injury, pre-injury DHA supplementation was found to reduce the injury response and enhance memory when compared to the non-DHA supplemented group 19 . Hippocampus is a crucial brain structure involved in spatial learning and memory formation in rodents and episodic memory in humans 20 . It is known that learning and memory rely on the strength of the synaptic connections between the neurons. In the hippocampus, neurotrophins play an important role in formation and maintenance of synaptic plasticity. Among them, neurotrophin-3 (NT-3) and brain-derived neurotrophic factor (BDNF) have been discovered to have essential roles in the neurobiological mechanisms of learning and memory. According to previous findings, BDNF plays a vital role in regulating synapse development, synaptic transmission, and plasticity mechanisms 21 , 22 . It has been reported that long-term exposure to NT-3 results in rapid long-lasting enhancement of synaptic transmission at cultured neuromuscular synapses and Schaffer collateral pathway 23 , 24 . Furthermore, it is found that NT-3 administration potentiates MF-CA3 synaptic transmission at the DG-CA3 hippocampal projection, a region crucial for memory consolidation and acquisition of many learning tasks 25 . As we know, long-term potentiation of synaptic plasticity mediates the neurobiological mechanisms of learning and memory. And long-term synaptic plasticity requires the production of new proteins, which is considered to be facilitated by the transcription factor cAMP response element-binding protein (CREB). CREB's binding to the CRE (cAMP response element) regulates the expression of several genes involved in plasticity. Several studies have reported the critical role of CREB in long-term facilitation of synaptic efficacy and memory 26 , 27 , 28 . Uncoupling protein-2 (UCP2) promotes scavenging of free radicles in neurons which is necessary for β- oxidation of fatty acids in neurons, which is essential for the development of neurons as well as hippocampal and adult synaptogenesis 29 . And it is also observed that long-lasting impairment in UCP2 expression during development may affect hippocampus-related adult behaviour 30 . Since the expression of these genes modulate the synapse development and plasticity in the central nervous system these genes can be considered as important biomarkers of learning and memory processes. Along with these genes, learning and memory formation, and synaptic plasticity are regulated by pre- and postsynaptic proteins. This study used the immunohistochemistry method to evaluate the changes in the expressions of Synapsin1 and Postsynaptic density protein 95 (PSD-95) as indicators of synaptic density. PSD-95 is a core synaptic scaffold component, highly enriched in postsynaptic density, and plays a crucial role in storing neuronal information 32,33 . Synapsin 1, a phosphoprotein, is localized to the cytoplasmic synaptic vesicle membrane in presynaptic terminals. It regulates the of no. of vesicles available, and neurotransmitters released in presynaptic terminals 34,35 . The current study is intended to evaluate the effect of dietary supplementation of FDA approved nutraceuticals, AsX and DHA in adult offspring undernourished during their prenatal and/or postnatal life using Albino Wistar rat model on a molecular basis. The hippocampus was the subject of our investigation because, as a component of the limbic system, it plays a significant role in cognition and behaviour. We hypothesized that altered gene and synaptic protein expressions in the hippocampus are responsible for the learning and memory deficit. AsX and DHA administration may modulate these deficiencies caused by pre, post, and perinatal undernutrition. Results Maternal AsX and DHA supplementation modulate the body weight of pups at birth and average litter size There was no significant effect of pre, post, and perinatal undernourishment on average number of pups born per dam. However, pups’ weight at birth was significantly reduced by maternal undernutrition, and this significant body weight depletion remained throughout the study. The body weight of the pups from all the experimental groups were measured at birth and throughout the lactation and adolescent period i.e., from PD-1 to PD-56. The same trend was observed in brain weight, measured at the end of the experiment (supplementary table 1). The birth weight of the pups born to pre and perinatally undernourished dams showed significant decrease compared to pups born to the dams fed with control diet. AsX and DHA supplementation to pre and perinatally undernourished dams significantly increased the body weight of the pups at birth (Fig. 2 A, C; C vs PreUN: p < 0.0001; C vs PeriUN: p < 0.0001; PreUN vs PreUN-AD: p < 0.0001; PeriUN vs PeriUN-AD: p < 0.0001, one-way ANOVA with Tukey’s multiple comparison). Even though, pups born to the undernourished dams supplemented with AsX and DHA showed lowered body weight at birth compared to controls (C vs PreUN-AD: p = 0.0018; C vs PeriUN-AD: p = 0.0177), when compared to undernourished groups, AsX and DHA supplemented groups showed significantly increased birth weight (PreUN vs PreUN-AD: p < 0.0001; PeriUN vs PeriUN-AD: p < 0.0001). Compared to control group pre, post, and perinatally undernourished offsprings showed significantly reduced body weight during lactation (PD-1 to PD-21) and postweaning period (PD-21 TO PD-57) indicating the effect of undernourishment on the body weight. AsX and DHA supplementation in all the three groups promoted the body weight. The two-way ANOVA with repeated measures revealed the significant effects for the treatment, time and time × treatment interaction. Tukey’s multiple comparison showed significant difference between the groups from PD-1 to PD-57(Fig. 1 D; Time effect: F [ 2.814, 84.41] = 2288; p < 0.0001; Treatment effect: F [ 5, 30] = 54.52; p < 0.0001; Interaction effect: F [ 35, 210] = 10.84; P < 0.0001, E; Time effect: F [ 3.322, 99.67] = 2238; p < 0.0001; Treatment effect: F [ 5, 30] = 90.39; p < 0.0001; Interaction effect: F [ 35, 210] = 13.28; p < 0.0001, F; Time effect: F [ 2.871, 86.13] = 2420; p < 0.0001; Treatment effect: F [ 5, 30] = 92.50; p < 0.0001; Interaction effect: F [ 35, 210] = 18.87; p < 0.0001). Further, we also observed that the brain weight of the offspring’s were significantly reduced in pre and perinatally undernourished groups. Maternal AsX and DHA supplementation enhanced brain weight (Supplementary Figure S1). Maternal AsX and DHA supplementation modulates cognitive decline following acute stress caused by maternal undernutrition AsX and DHA supplementation enhances recognition memory To evaluate the effect of pre, post and perinatal undernutrition on recognition memory, and to asses weather maternal AsX and DHA supplementation ameliorates the recognition memory, we performed NOR test. It included 3 sessions’ habituation, training and test (Fig. 2 A). Discrimination Index was calculated as a measure of discrimination between familiar and novel objects 31 . NOR test utilizes the innate preference of rodents to explore novel objects over the familiar ones in the environment. Repeated exposure to an object decreases exploration time as the object becomes familiar, and rodents will spend more time exploring the novel. Several previous studies have reported that protein malnutrition during the gestation and lactation period impairs recognition memory 32 33 34 . Total exploration time in the training session did not significantly differ between the objects and experimental groups (Supplementary Figure S2). Pre, post, and perinatal dietary supplementation of AsX and DHA enhanced recognition memory which was impaired by maternal undernutrition. In this study, we observed significantly decreased DI in undernourished groups compared to drug control (Fig. 2 B; DC vs. PreUN: p = 0.0006 0.0038, Fig. 3 C; DC vs. PostUN: p = 0.0006, Fig. 3 D; DC vs. PeriUN: p = 0.0020). With maternal undernourishment, dietary supplementation of AsX and DHA showed enhanced DI compared to the undernourished group. Perinatal undernourishment and AsX and DHA supplemented group showed significantly increased DI (Fig. 2 D; PeriUN vs. PeriUN-AD: p = 0.0243) when compared to the perinatally undernourished group indicating, AsX and DHA supplementation improved recognition memory in adult rats which were undernourished during their pre, post and perinatal period. Maternal AsX and DHA supplementation enhance learning in undernutrition-induced learning impairment in partially baited radial arm maze tasks All the experimental rats were given 12 days of training before retention. Food rewards were placed at the end of the 1st and 2nd arms as an adjacent choice and at the end of the 5th and 7th arms as a choice. Two-way ANOVA with repeated measures revealed the significant effect of treatment and interaction on experimental groups (Fig. 3 B; Interaction effect: F (25, 150) = 1.827, p = 0.0147; Treatment effect: F (5, 30) = 6.201, p = 0.0005; Fig. 3 C Interaction effect: F (25, 150) = 2.747, P < 0.0001; Treatment effect: F (5, 30) = 5.455, p = 0.0011; Fig. 3 D Interaction effect: F (25, 150) = 2.212, p = 0.0018; Treatment effect: F (5, 30) = 5.931, p = 0.0006). The percentage of correct choice (%CC) increased, and all the experimental groups showed a standard learning curve during acquisition. Maternal undernourishment resulted in a significant decrease of %CC in B-5 and B-6 (B-5; C vs. PreUN: p = 0.015, C vs. PostUN: ns, C vs. PeriUN: p = 0.028; B-6; C vs. PreUN: P = 0.008, C vs PostUN: p = 0.009, C vs PeriUN: p = ns). AsX-DHA supplementation significantly declined learning deficit only in B-6 in PostUN-AD rats (B-6; PostUN vs PostUN-AD: p = 0.011). These results suggested differential learning only in Blocks 5 and 6. Throughout the acquisition, AsX-DHA-supplemented groups showed better learning than undernourished groups (Fig. B-D). Control rats attained 80% correct choice criteria after 11 days of training. At 12 days of training, Control rats reached 83.92 ± 9.18, Drug control rats achieved 82.67 ± 6.56, and Vehicle control rats reached 80.08 ± 5.69% correct choice, whereas undernourished rats failed to reach the criteria of learning (80% correct choice) at 12 days of training (Fig. 3 E-G). Undernourished groups showed a significantly decreased %CC on day 12th compared to control groups (C vs. PreUN: p = 0.030; C vs. PostUN: p = 0.001 and C vs. PeriUN: p < 0.0001). Pre and Post AsX-DHA supplemented groups did not show significantly increased %CC compared to the undernourished group on day 12th, indicating, AsX-DHA supplementation did not boost the learning in pre and postnatally undernourished rats. But perinatal supplementation of AsX-DHA improved learning by showing significantly enhanced %CC compared to PeriUN rats (PeriUN vs PeriUN-AD: p = 0.002). Effect of maternal undernourishment and ASX-DHA supplementation on retention To assess the effect of maternal undernutrition and AsX-DHA on the retention of learned information, we tested retention after ten days’ post-acquisition. During retention, subjects demonstrated a significantly decreased %CC, a significantly increased number of reference memory errors (RMEs), and the number of working memory errors (WMEs) in PreUN and PeriUN groups. Figure 4 : A) Representative track reports of experimental groups. The effect of undernourishment and AsX-DHA supplementation on %CC (B-D), number of reference memory errors (E-G), and number of working memory errors (H-J) in the retention test of partially baited radial arm maze task. In all the cases One-Way ANOVA with post hoc Tukey’s test was used. Values were represented as mean ± SEM (n = 6). Asterisks were used to represent significant differences, *p < 0.05, **p < 0.01. Similar to the acquisition, the retention test also observed a significant decline in %CC in VC-UN, Pre-UN, and PeriUN groups [Fig. 4 B; F (5, 30) = 8.883, p < 0.0001, Fig. 4 D; F (5, 30) = 8.635, p < 0.0001]. Compared to controls, PreUN and PeriUN groups showed decreased %CC (C vs. Pre-UN: p = 0.0008, C vs Peri-UN: p = 0.001). AsX-DHA-supplemented groups did not show any impairment in the retention test. The positive effect of AsX-DHA supplementation on %CC in the retention test was statistically significant in the PeriUN-AD group (PeriUN vs. PeriUN-AD: p = 0.006). Though we observed lower %CC in PostUN subjects on the 12th day of training, this trend has not continued the retention. Significant increase in the number of RMEs have been observed in undernourished groups [Fig. 4 E; F (5, 30) = 7.097: p = 0.0002, C vs. PreUN: p = 0.004; Fig. 4 G, F (5, 30) = 5.977: p = 0.0006, C vs. Peri-UN: p = 0.02]. Supplementation ameliorated impairment in PreUN and PeriUN groups as we have observed no significant increase in the number of RMEs in the ASX-DHA-supplemented group compared to controls (Fig. 4 E-G). Working memory impairment in undernourished rats was reinforced by AsX-DHA supplementation (Fig. 4 H-J). Postnatal undernourishment and AsX-DHA supplementation did not affect the number of WMEs. But Pre and Perinatal undernourishment negatively affected WMEs which was restored by AsX-DHA supplementation (C vs. PreUN: p = 0.006; C vs. Peri-UN: p = 0.006; Peri-UN vs. PeriUN-AD: p = 0.006). Effect of maternal undernourishment and AsX-DHA supplementation on BDNF, CREB, NT-3 and UCP-2 gene expression It has been shown that expression of BDNF, NT-3, CREB and UCP-2 genes modulate the synapse development, transmission and plasticity. We wanted to investigate whether pre, post and perinatal undernourishment alters the long-term expression of these genes in the hippocampus. Transcriptomic changes of these factors were studied by quantifying mRNA levels using real time RT-PCR. Figure 5 displays the hippocampus's relative expression of BDNF, NT-3, CREB, and UCP-2. In pre, post, and perinatally undernourished rats, BDNF mRNA levels decreased significantly when compared to their controls (Fig. 5 A-C; C vs. PreUN: p = 0.0003; C vs. PostUN: p < 0.0001; C vs. PostUN: p = 0.009). AsX-DHA supplemented groups showed significantly higher levels of BDNF compared to their undernourished counterparts except for PostUN-AD group (Fig. 5 A-C; PreUN vs. PreUN-AD: p = 0.001; PeriUN vs. PeriUN-AD: p = 0.005). Only PeriUN rats showed significantly lower levels of NT-3 compared to controls and PeriUN-AD rats, but in the case of pre and postnatal conditions, AsX-DHA supplementation increased the NT-3 expression, which was not significant (Fig. 5 D-F; C vs PeriUN: P = 0.028; PeriUN vs. PeriUN-AD: p = 0.001). Undernourishment resulted in significantly lower levels of CREB and UCP-2 mRNA, and in PreUN-AD and PeriUN-AD conditions significant increase in CREB and UCP-2 mRNA levels was observed (Fig. 5 G-I; C vs PreUN: p < 0.0001; C vs. PostUN: p < 0.0001; C vs. PeriUN: p < 0.0001; PreUN vs. PreUN-AD: p < 0.0001; PeriUN vs. PeriUN-AD: p = 0.004, Fig. 5 J-L; C vs PreUN: p = 0.0004; C vs PostUN: p = 0.0003; C vs PeriUN: p = 0.0001; PreUN vs. PreUN-AD: p = 0.003). Using the immunohistochemistry technique, we studied the expression of synapsin-1 (Fig. 6 A) and PSD-95 (Fig. 7 A) in the hippocampus's CA1, CA2, CA3, and DG regions. The results showed that the percentage of positive areas significantly differed between the experimental groups. The expressions of synapsin-1 and PSD-95 decreased in undernourished groups compared to control and AsX-DHA treated groups at CA1, CA2, CA3, and DG regions, respectively. CA1-Synapsin 1 [Fig. 6 B. Control vs PreUN: p = 0.0003, PreUN vs PreUN-AD: p = 0.022; Control vs PostUN: p = 0.0002, PostUN vs PostUN-AD: p = 0.039; Control vs PeriUN: p < 0.0001, PeriUN vs PeriUN-AD: p < 0.0001], CA2-Synapsin-1 [Fig. 6 B. Control vs PreUN: p < 0.0001, PreUN vs PreUN-AD: p = 0.0001; Control vs PostUN: p < 0.0001, PostUN vs PostUN-AD: p = 0.0014; Control vs PeriUN: p < 0.0001, PeriUN vs PeriUN-AD: p = 0.0006], CA3-Synapsin-1 [Fig. 6 B. Control vs PreUN: p < 0.0001, PreUN vs PreUN-AD: p = 0.0007; Control vs PostUN: p < 0.0001: Control vs PeriUN: p < 0.0001, PeriUN vs PeriUN-AD: p < 0.0001], DG-Synapsin-1 [Fig. 6 B. Control vs PreUN: p < 0.0001, PreUN vs PreUN-AD: p = 0.0002; Control vs PostUN: p < 0.0001; Control vs PeriUN: p < 0.0001, PeriUN vs PeriUN-AD: p = 0.032]. CA1-PSD-95 [Fig. 6 B. Control vs PreUN: p < 0.0001, PreUN vs PreUN-AD: p < 0.0001; Control vs PostUN: p < 0.0001, PostUN vs PostUN-AD: p = 0.015; Control vs PeriUN: p < 0.0001, PeriUN vs PeriUN-AD: p = 0.0001], CA2-PSD-95[Fig. 6 B. Control vs PreUN: p < 0.0001, PreUN vs PreUN-AD: p < 0.0001; Control vs PostUN: p < 0.0001; Control vs PeriUN: p < 0.0001, PeriUN vs PeriUN-AD: p = 0.0003] CA3-PSD-95 [Fig. 6 B. Control vs PreUN: P < 0.0001, PreUN vs PreUN-AD: p < 0.0001; Control vs PostUN: p < 0.0001, PostUN vs PostUN-AD: p < 0.0001; Control vs PeriUN: p < 0.0001, PeriUN vs PeriUN-AD: p < 0.0001], DG-PSD-95 [Fig. 6 B. Control vs PreUN: p = 0.024; Control vs PostUN: p < 0.0001, PostUN vs PostUN-AD: p < 0.0001; Control vs PeriUN: p < 0.0001, PeriUN vs PeriUN-AD: p = 0.007]. However, our study showed that AsX-DHA-treated animals did not show a significantly increased percentage of positive area at CA3 and DG compared to the PostUN group. Similarly, PSD95 in AsX-DHA treated animals also did not show a significantly increased portion of positive area at CA2 in the PostUN group and DG in the PreUN group. Correlation OF behaviour with hippocampal protein levels The Pearson correlation between behavioural parameters (% CC, RME, WME, and DI) with the expression of synapsin-1 and PSD-95 in hippocampal subfields, CA1, CA2, CA3, and DG revealed a significant positive correlation between %CC retention and DI with synapsin-1 and PSD-95 expression and a significant negative correlation between RME and WME with synapsin-1 and PSD-95 (Table no. 1). On the other hand, the expression of PSD-95 in DG did not show a significant correlation with behavioural parameters (PSD-95: %CC retention: r = 0.504, P = 0.137; RME: r=-0.564, P = 0.318; WME: r=-0.367, P = 0.296; DI: r = 0.627, P = 0.052). Discussion From this study we illustrate that AsX-DHA supplementation ameliorates maternal undernutrition induced cognitive impairment associated with altered synaptic plasticity in the adult life of offsprings. Restricted dietary intake during pregnancy has a significant impact on foetal brain development. Many cellular processes occur from the first trimester to mid-gestation, including neuronal cell proliferation, differentiation, migration, and synapse formation. Especially dendritic arborisation and synaptogenesis take place in the 3rd trimester 35 . Insufficient nutrient intake during this period impairs neurocognitive development, especially concerning learning and memory, particularly regarding variation in the structural and functional aspects of the hippocampus 36 . With the addition of new neurons throughout life, hippocampus development in rodents occurs mostly in late gestation and the first two weeks after birth. As a result, it has been established that the hippocampus is especially vulnerable to changes in the environment during infancy 37 . A possible strategy to combat the harmful effects of maternal undernourishment is to manipulate the maternal diet during pregnancy. Our previous study revealed that a 30% reduction in maternal diet during pregnancy induces stress, which leads to adipose tissue dysfunction in adult life. Treatment with AsX and DHA significantly improved the stress of perinatal undernutrition-induced differential protein expression in adipose tissue 38 . The aim of this study was to assess the neuroprotective ability of AsX and DHA supplementation in pre, post and perinatally undernourished rats. Perinatal undernutrition can have profound and long-lasting effects on body weight regulation in the later stages of life. Perinatal undernutrition can lead to alterations in foetal growth and development, potentially resulting in low birth weight 39 . Low birth weight infants are at an increased risk of developing obesity and related metabolic disorders later in life. This phenomenon is referred to as the "foetal programming" hypothesis, which suggests that undernutrition during early life can lead to adaptations in metabolism and physiology that predispose individuals to obesity in an obesogenic environment 40 . Individuals who experienced undernutrition during the perinatal period may exhibit a phenomenon known as "catch-up growth," where they initially show rapid weight gain and increased adiposity during early childhood and adolescence 41 . This catch-up growth can increase the risk of obesity and metabolic syndrome in adulthood. However, the effects may differ depending on the interplay between genetic predisposition and environmental factors 40 . Efforts to mitigate the impact of perinatal undernutrition on body weight by improving maternal nutrition during pregnancy are essential to support optimal foetal development. The present study used FDA-approved nutraceuticals, Astaxanthin, and DHA to mitigate undernourishment-induced disorders. The potential impact of perinatal undernutrition on cognitive function, particularly recognition memory, is significant. Recognition memory is the ability to identify previously encountered stimuli, and it plays a crucial role in daily functioning, learning, and decision-making. Maternal undernutrition induced recognition memory impairment in NOR task was restored by maternal AsX-DHA supplementation in the adulthood. NOR test assesses the natural ability of rodents to recognize the novel object in the environment 42 . Research suggests that perinatal undernutrition cause significant effects on recognition memory later in life 43 . Animal studies have demonstrated that animals subjected to perinatal undernutrition exhibit impairments in various memory tasks, including recognition memory 33 . These impairments arise from disruptions in neural circuitry, altered synaptic plasticity, and changes in neurotransmitter systems 44 . Nutritional deficiencies during critical brain development periods can alter the formation and maintenance of neural connections. This can result in suboptimal communication between brain regions involved in memory processing, leading to deficits in recognition memory performance. Additionally, perinatal undernutrition can impact the levels of neurotrophic factors and neurotransmitters that are crucial for synaptic plasticity and memory consolidation 45 . Adequate maternal nutrition can contribute to optimal brain development and cognitive function, particularly during critical developmental periods. The present study confirmed the potential ameliorative effect of AsX and DHA on perinatal undernutrition-induced recognition memory. Perinatal undernutrition has the potential to impact spatial learning and memory in later life due to its influence on brain development and neural circuitry. Maternal undernourishment had a discernible impact on the retention of RMEs and WMEs in the RAM task 46 . Offspring born to pre, post and perinatally undernourished mothers exhibited higher rates of memory errors, suggesting a potential impairment in spatial memory and working memory functions. However, the study also introduced a possible avenue for intervention. AsX-DHA supplementation showed promise in mitigating the harmful effects of maternal undernourishment on memory performance. Offspring who received the supplementation demonstrated reduced rates of RMEs and WMEs, approaching levels comparable to those in the control group. This study underscores maternal nutrition's importance in shaping offspring's cognitive outcomes. Furthermore, the potential benefits of AsX-DHA supplementation in ameliorating memory deficits are noteworthy. Brain-Derived Neurotrophic Factor (BDNF) is a protein that plays a crucial role in promoting the growth, survival, and maintenance of neurons in the brain. It is also involved in synaptic plasticity, learning, and memory 47 . In perinatal undernutrition, inadequate nutritional intake during the period surrounding childbirth can profoundly affect the levels and functions of BDNF in the brain throughout an individual's life, influencing their cognitive and neurological development. Sufficient nutrition during these periods is essential for the average growth and maturation of the brain. Perinatal undernutrition can affect BDNF levels during early developmental stages, including foetal development and infancy 48 . These early disruptions can set the stage for long-term cognitive and neurological consequences. Reduced BDNF levels resulting from undernutrition can impair the brain's ability to adapt and form new connections in response to experiences and learning opportunities 49 . This can lead to deficits in cognitive functions such as attention, memory, and learning. The effects of perinatal undernutrition on BDNF can persist into adulthood and even influence aging processes. Efforts to mitigate the impact of perinatal undernutrition on BDNF levels and associated cognitive outcomes include providing optimal nutrition during pregnancy, infancy, and childhood. In our previous study, we found significantly reduced hippocampal BDNF protein level in perinatally undernourished rats which was modulated by AsX supplementation 4 . The current study demonstrated a significant upregulation of hippocampal BDNF by AsX-DHA in the pre and perinatally undernourished offspring. NT-3 is a growth factor that plays a vital role in developing and maintaining neurons in the nervous system. During early developmental stages, including foetal growth and infancy, NT-3 is essential for promoting neurons' development, differentiation, and survival 50 . Adequate nutrition during this period is crucial for supporting the production and availability of NT-3 51 . Perinatal undernutrition leads to altered NT-3 expression and signalling, which may disrupt the normal development of neural circuits and connections, leading to long-lasting effects on sensory, motor, and cognitive functions. Reduced NT-3 levels due to undernutrition contribute to an increased vulnerability to neurodegenerative diseases and cognitive decline in later years 52 . The disruptions in neural connectivity and plasticity caused by perinatal undernutrition can contribute to age-related cognitive impairments. Adequate maternal nutrition provides the necessary nutrients for producing and releasing NT-3, supporting healthy neuronal development. This study evaluated the neuroprotective ability of AsX and DHA supplementation in pre, post, and perinatally undernourished rats on NT-3 levels, providing promising positive results. Therefore, early cognitive stimulation by a nutrient-rich diet, AsX and DHA, contribute to maintaining healthy NT-3 levels and promoting optimal brain function. The cAMP response element-binding protein (CREB). is a transcription factor that plays a pivotal role in regulating gene expression in response to various cellular signals 53 . It is imperative in the brain to mediate synaptic plasticity, learning, memory, and other cognitive processes. CREB is essential for adequately developing neural circuits and establishing synaptic connections in the brain. During early developmental stages, CREB activation helps to guide the formation and maturation of neuronal networks 54 . It involves in long-term potentiation (LTP) and long-term depression (LTD), fundamental mechanisms underlying memory formation 55 . Perinatal undernutrition hindered CREB-mediated synaptic plasticity, potentially impairing the brain's ability to adapt and encode new information. This would lead to deficits in learning, memory, and cognitive flexibility and lasting effects on mental and neurological functions. The impact of perinatal undernutrition on CREB involves intricate interactions between nutritional status, hormonal regulation, and cellular signalling pathways. CREB activity is regulated by factors such as cAMP (cyclic AMP) and Ca 2+ (calcium) signalling 56 . Undernutrition can disrupt these signalling pathways, reducing CREB activation and altering gene expression. The current study demonstrated the benefits of AsX and DHA in supporting CREB-mediated synaptic plasticity and cognitive function. Uncoupling Protein-2 (UCP-2) is a mitochondrial protein crucial for regulating energy balance, metabolism, and oxidative stress. It is primarily found in various tissues, including adipose tissue, skeletal muscle, and the brain 57 . The relationship between perinatal undernutrition, UCP-2, and cognitive function is complex and multifaceted. Perinatal undernutrition can lead to mitochondrial dysfunction in various tissues, including the brain. UCP-2 is involved in maintaining mitochondrial function by regulating the proton gradient. Impairments in UCP-2 activity due to undernutrition could contribute to mitochondrial dysfunction and affect cognitive function 58 . It was reported that undernutrition can lead to oxidative stress, negatively impacting various cellular processes, including cognitive function 59 . UCP-2 is linked to the regulation of ROS production in mitochondria. Therefore, alterations in its activity due to undernutrition might influence oxidative stress levels in brain cells. UCP-2 also influences neurotransmitter function in the brain. Disruptions in UCP-2 activity could affect neurotransmitter release and signalling, thus impacting cognitive function 60 . Mitochondrial function, which UCP-2 is linked to, has been shown to influence synaptic plasticity 61 . Therefore, alterations in UCP-2 activity due to undernutrition could impact synaptic plasticity and, subsequently, cognitive function. The specific effects of perinatal undernutrition on UCP-2 and cognitive function would likely depend on various factors, including the severity and duration of undernutrition, the timing of nutrient deprivation, and genetic factors. The present study illustrated the impact of prenatal, postnatal, and perinatal undernutrition on UCP-2 activity and its amelioration by AsX and DHA. Synapsins are a family of proteins that play a crucial role in regulating neurotransmitter release and synapse formation. They are primarily associated with presynaptic terminals and are involved in the assembly and stabilization of synaptic vesicles 62 . In the hippocampus, synapsin expression is not uniform across its different regions. The hippocampus has several sub regions, including the dentate gyrus and CA1, CA2, and CA3 regions. Among these, the highest expression of synapsins is generally observed in the mossy fibres of the CA3 region, which are the axons of dentate gyrus granule cells that project to the CA3 pyramidal cells 63 . Synapsin proteins are abundant in these mossy fibre terminals; contribute to the regulation of neurotransmitter release and synaptic plasticity. The Synapsin expression varies depending on the developmental stage, synaptic activity, and other factors 64 . Therefore, while the CA3 mossy fibers typically show higher Synapsin expression in the hippocampus, the precise distribution and levels of synapsin proteins can be influenced by specific experimental conditions or pathological states. However, our study found that AsX-DHA-treated animals did not show a significantly increased percentage of positive area at CA3 and DG compared to the PostUN group. This indicates that perinatal undernutrition stress preferentially causes the inhibition of synapsin-1 at CA3 and DG, even in the presence of nutraceuticals, Astaxanthin, and DHA 64 . Post-Synsptic Density-95 (PSD95) is a protein primarily located in the postsynaptic density of neurons, a specialized region involved in synaptic signalling and plasticity. While PSD95 is widely distributed throughout the brain, including various regions of the hippocampus, its expression levels can vary across different subregions of the hippocampus 64 . Studies have shown that PSD95 expression is particularly prominent in the CA1 region of the hippocampus, which is known for its role in learning and memory processes. However, it is worth noting that PSD95 is also expressed in other hippocampus regions, albeit at varying levels. Overall, while PSD95 can be found in different parts of the hippocampus 65 . The current study demonstrated that the PSD95 in AsX-DHA treated animals did not show a significantly increased percentage of positive area at CA2 in the PostUN group and DG in the PreUN group. This revealed that PSD95 was suppressed by postnatal undernutrition stress at CA2, and prenatal undernutrition suppresses the expression of PSD95 at DG in the presence of Astaxanthin and DHA. The proposed of mechanism of action of AsX and DHA supplementation on the upregulation of BDNF, NT-3, CREB and UCP2 gene expressions is shown in figure-8. The BDNF, NT-3 signalling pathway regulates intracellular signalling cascades like MAPK, PI3K, and PLC, triggering effects like neuronal differentiation, survival, and plasticity. CREB is a crucial molecule that initiates transcriptional activation of other genes encoding proteins, potentially playing a significant role in structural and functional changes in information storage. Adaptive bio-energetic stress response (ABSR) encompassing several signalling channels and organelles is triggered by mild uncoupling caused by activation of endogenous uncoupling proteins (UCPs). The ABSR includes the activation of kinases and transcription factors, including the cyclic AMP response element-binding protein (CREB), and induces the production of genes that code for proteins that improve stress resistance and neuroplasticity, including the immediate early gene products such as Fos and Arc; BDNF. Signalling pathway was drawn using Biorender.com CONCLUSION Maternal undernourishment appeared to have a discernible impact on offspring’s health. Offspring’s born to undernourished mothers exhibited cognitive dysfunction. Understanding the complex mechanisms underlying these effects is crucial for developing effective strategies to prevent and manage the consequences of perinatal undernutrition on future health. The study concludes that perinatal undernutrition has a far-reaching impact on learning and memory and the levels of genes responsible for cognitive function, such as BDNF, NT-3, CREB, and UCP-2 levels and their functions. While research in this area is ongoing, it is evident that perinatal undernutrition causes profound and lasting effects on cognitive development, as evidenced by the decline in the expression of Synapsin and PSD-95. However, the precise role of these markers and their impact on cognitive function within this context requires further investigation at the level of epigenetic modification. The potential benefits of Astaxanthin-DHA supplementation in ameliorating memory deficits and cognitive dysfunction in the adult life of offspring are noteworthy and warrant deeper investigation. Materials and Methods All the experiments were performed following the National Institute of Health Guide for the Care and Use of Laboratory Animals, revised in 2011, and associated guidelines and study protocol were approved by the Institutional Animal Ethics Committee, KS Hegde Medical Academy, Nitte (Deemed to be University), Mangalore. Animals: 30 Female and 10 Male Albino Wistar Rats of 2 months old weighing 150–200 gm were procured from our institutional animal house. Rats were housed in polypropylene cages, and paddy husk was used as bedding material. Animals were maintained under controlled temperature (23 ± 2°C) and humidity (50 ± 5%), 12:12 hour light and dark cycle with food and water available ad libitum . The schematic representation of the study design and timeline is shown in Fig. 9 . Experimental Setup and Drug Treatment: Female rats were kept for breeding with male rats in 3 (Females):1(Male) ratio. Once pregnancy was confirmed by vaginal smear test, males were separated from female rats and pregnant dams were divided into the following 10 groups. Group-I: (Control) Dams received standard feed and water ad libitum and Group-II (Drug Control) was comprised of dams treated perinatally with Astaxanthin (24mg/kg/day) + DHA (500 mg/kg/day). Group- III (Vehicle Control) Dams treated perinatally with olive oil at a dose of 1 ml/kg body weight. Group- IV (Vehicle Control-UN) perinatally undernourished dams treated with olive oil at a dose of 1 mL/kg body weight. Group-V (PreUN) and VI (PreUN-AD) comprised of prenatally undernourished dams and dams treated prenatally with Astaxanthin (24mg/kg/day) + DHA (500 mg/kg/day) respectively. Group-VII (PostUN) and VIII (PostUN-AD) postnatally undernourished dams and treated postnatally with Astaxanthin (24mg/kg/day) + DHA (500 mg/kg/day) respectively. Group-IX (PeriUN) and X (PeriUN-AD) was comprised of perinatally undernourished dams, and dams treated perinatally with Astaxanthin (24mg/kg/day) + DHA (500 mg/kg/day), respectively. Perinatal undernutrition was ensured by providing 70% of the actual food consumption during prenatal and postnatal period. Six male pups (n = 6) were selected from each group for the behavioural study. The dosage of intervention and undernourishment was according to our previously reported study 4 , 66 . Body and Brain weight of offspring’s: The body weight of the pups from all the experimental groups was measured on PND-0 from all and throughout the lactation and adolescent period i.e., from PD-1 to PD-56. At the end of the behavioural study, rats were sacrificed, and whole brain weight was measured. Behavioural Testing: All the behavioural tests were performed during the light cycle of the animals. Training and testing were carried out in a sound-attenuated experimental room where the light intensity, temperature visuospatial cues remained the same throughout the experimental period. Novel Object Recognition: The Novel Object Recognition test assessed the recognition memory. NOR task exploits natural preference of rodents to spend more time exploring novel object rather than familiar one. This experiment included three sessions; Habituation, Training and Test. During habituation (Day 1), animals were introduced into an empty Plexiglas arena (40 x 23 x 1 cm) and allowed to explore the arena for 5 minutes. After 24 hours of habituation training session was done. During training (Day 2), Animals were exposed to the two identical objects (Object A1 and A2) placed inside the box for 5 minutes. Training was followed by test on day 3. In this session one object (Object A1) from the training session was replaced by a novel object (Object B). And animals were allowed to explore the objects for 5 minutes. A camera was mounted above the arena to record all the sessions. The objects and arena were cleaned with 1% acetic acid between each trial to remove olfactory cues. Exploration was defined when an animal touched the object or pointed its head towards the object, with a distance of ≤ 2cm with its neck extended and vibrissae moving. Climbing on the object and turning around was not considered as exploration. Total time taken to explore each object during training and testing was noted manually. A Discrimination Index (DI) was calculated to measure relative time spent exploring novel object. Radial Arm Maze Evaluation of spatial learning and memory was done by radial arm maze test 4 , 67 . The Radial Arm Maze consisted of eight equally spaced arms (40×9×9) radiating from an octagonal centre. The maze was kept elevated 40 cm off the ground. A food cup was placed at the end of each arm, with Kellogg's chocos as baits. The partial baiting technique was used to test both the working and reference memory, which involved baiting only four arms. The animals were kept on a restricted diet, and their body weight was maintained at 85% of their free-feeding weight, with water available ad libitum, before the training. Habituation: Habituation was carried out for two consecutive days before acquisition to acclimatize the animals to the RAM. All eight arms were baited during habituation, and rats were allowed to explore the maze for 10 minutes. The maze was cleaned with 1% acetic acid between trials to remove olfactory cues. Acquisition: During acquisition, the partial baiting technique was applied. Four arms (1,2,5 & 7) were baited with Kellogg's chocos (Kellogg's Planets and Stars™, Kellogg India, Mumbai, India) as food reinforcement. The rat was placed in the centre facing the same arm during each trial and allowed for a free choice. Two trials were given each day with an inter-time interval of one hour, and each trial was of five minutes or until the rat entered all four baited arms. When a rat ate a bait or reached the end of an arm, the arm choice was recorded. Only the first entry into the baited arm was considered the correct choice. The training was continued until the rats attained the criteria of 80% correct choice (at least four correct entries out of five). All the trials were recorded with the video camera mounted above the maze. Scoring was done manually by the experimenter. Retention: Retention was evaluated after a ten-day interval following acquisition. Two trials were given with an inter-trial interval of five minutes, and the average of the two trials was taken for the analysis. Evaluation criteria: Data from four trials were averaged and expressed as blocks. Data from the two daily trials were averaged and entered into further analysis. The data were analyzed for percentage correct choice, reference, and working memory errors. Percentage correct choice (%CC) was calculated as the number of correct entries in relation to total entries. An entry into an unbaited arm was considered a reference memory error (RME), and any re-entry was considered a working memory error (WME). A re-entry into a baited arm or an unbaited arm was regarded as working memory error correct (WME correct) or incorrect (WME incorrect), respectively. Total RNA extraction and Real-Time Quantitative RT-PCR : Animals were sacrificed by decapitation at the end of the behavioral study. Brain tissues were collected and immediately stored at -80°C. Real-time PCR technique was used to investigate the effects of maternal undernutrition and Neutraceuticals (AsX and DHA) supplementation on the expression of synaptic plasticity markers. Total RNA was extracted from the hippocampus by the Trizol method. RNA concentration and purity were determined using a nano spectrophotometer. 200ng of total RNA was used as a template in a 20µl reaction. Real-time PCR reactions were performed on Applied Biosystems 7300/7500 fast real-time PCR system using One Step TB Green Prime Script RT-PCR Kit (TaKaRa) according to the manufacturer's protocol. The conditions used for PCR reactions were 42°C for 5min; 95°C for 2min. and 95°C for 15 sec; 60°C for 60 sec. for 40 cycles. All the reactions were performed in triplicates. Each set of triplicates was checked to ensure that all Ct values were within 1 Ct value of each other. The forward and reverse primer sequences used for the study were as follows: BDNF forward: 5’ CGTGGGGAGCTGAGCGTGTGT 3’; BDNF reverse: 5’ GCCCCTGCAGCCTTCCTTCGT 3’; UCP-2 forward: 5’ GAGAGTCAAG GGCTAGCGC 3’; UCP-2 reverse: 5’ GCTTCGACAGTGCTCTGGTA 3’; NT-3 forward: 5’ CACCCAGAGAACCAGAGCAG 3’; NT-3 reverse: 5’ CTCTCCTCGGTGACTCTTAT 3’ CREB forward: 5’ CCAAACTAGCAGTGGGCAGT 3’; CREB reverse: 5’ GAATGGTAGTA CCCGGCTGA 3’; β-actin forward: 5'CGACGAGGCCCAGAGCAAGA 3'; reverse: 5'AGAGGGGCCTCGGTGAGCAG3'. B-actin was used as internal control and the mRNA expression levels of the target gene were normalized to B-actin. To determine the relative quantification ΔΔCt method was used and to determine the normalized relative gene expression 2 -ΔΔCt (fold change) values were calculated. Immunohistochemistry After the retention test, animals were anesthetized (n = 3) and were perfused with 0.9% saline and 10% formalin. Whole brains were taken out and kept in 10% formalin, followed by perfusion. The whole brains were embedded in paraffin wax and cut into 5µm coronal sections using a microtome. The sections were deparaffinized and transferred to an xylene bath for clearing. The sections were incubated with graded alcohol (100%, 90%, 70%, 50% and 30%) for 5 min in each solution. Antigen retrieval was done using 10 mM citrate buffer (pH 6.0). Sections were incubated with 3% H2O2 at room temperature for 20 min. to inactivate endogenous peroxidase activity. The sections were washed in PBS (3×5 min.) and incubated with horse serum, followed by avidin and biotin (Vector laboratories, Cat#SP-2001) solutions to block nonspecific binding. Sections were incubated with primary antibody (Synapsin 1&PSD-95 -1:500) overnight at 4° C. After washing; sections were incubated with biotinylated secondary antibody (60 min.), ABC solution (45 min.) and DAB substrate (20 min.) at room temperature. Sections were washed in PBS and counterstained with hematoxylin. Slides were dehydrated, mounted, and observed using Nikon (Japan trinocular microscope, Ni-U,100-240V, MBA92010 upright microscope). The percentage of positive area was measured using Image J (version 1.53). Statistical Analysis: All the data were expressed as mean ± SEM. All statistical tests were performed using Prism version 8 for Windows, GraphPad Software ( https://www.graphpad.com/ ). Data was analysed by one-way or two-way analysis of variance (ANOVA) followed by Tukey’s post hoc test to compare the means between experimental groups. Acquisition on RAM was analysed by repeated measures, a two-way analysis of variance with Tukey’s post hoc test between experimental groups. Correlation studies were performed by calculating Pearson’s correlation coefficient. We correlated Synapsin-1 and PSD95 expression to behavioural study parameters (% CC, RME, WME, and DI). Significance was accepted at P < 0.05. Declarations Acknowledgements Authors acknowledge the support of institutional animal care facility, Nitte (Deemed to be University) and laboratory facilities at Nitte University Centre for Science Education and Research, and Mangalore University. This study was supported by grants from the Indian Council of Medical Research (No. 5/9/1220/2019-Nut.). Author contributions M.A.B. and P.S.H. carried out animal handling and treatment experiments, performed statistical analysis, preparation of figures, tables, and contributed to the drafting and editing of the manuscript. D.G.K.M., P.R., and M.S. provided scientific advice and contributed to designing the research work, conceptualizing the ideas, preparation of tables and figures, reviewing the analyzed data, drafting and editing of the manuscript. M.S. supervised behavioral experiments. D.G.K.M. supervised the research. All the authors read and approved the final manuscript. Competing interests The authors declare no competing interests. Additional information Supplementary information The supplementary material is provided as supplementary Figures S1 and S2 Correspondence and requests for materials Dr. Damodara Gowda K M Associate Professor, Dept. of Physiology, K S Hegde Medical Academy, Nitte (Deemed to be University), Deralakatte, Mangalore-575018-India. Email: [email protected] References Barbeito-Andrés, J., Gleiser, P. M., Bernal, V., Hallgrímsson, B. & Gonzalez, P. N. Brain Structural Networks in Mouse Exposed to Chronic Maternal Undernutrition. Neuroscience 380 , 14–26 (2018). Lesage, J. et al. Perinatal maternal undernutrition programs the offspring hypothalamo-pituitary-adrenal (HPA) axis. Stress vol. 9 183–198 (2006). Lapiz, M. D. S. et al. Influence of postweaning social isolation in the rat on brain development, conditioned behavior, and neurotransmission. Neurosci. Behav. Physiol. 33 , 13–29 (2003). Damodara Gowda, K. M., Suchetha Kumari, N. & Ullal, H. Role of astaxanthin in the modulation of brain-derived neurotrophic factor and spatial learning behavior in perinatally undernourished Wistar rats. Nutr. Neurosci. 23 , 422–431 (2020). Morgane, P. J., Mokler, D. J. & Galler, J. R. Effects of prenatal protein malnutrition on the hippocampal formation. Neurosci. Biobehav. Rev. 26 , 471–483 (2002). No Title. https://www.who.int/news-room/fact-sheets/detail/malnutrition. Ambati, R. R., Moi, P. S., Ravi, S. & Aswathanarayana, R. G. Astaxanthin: Sources, extraction, stability, biological activities and its commercial applications - A review. Mar. Drugs 12 , 128–152 (2014). Naguib, Y. M. A. Antioxidant activities of astaxanthin and related carotenoids. J. Agric. Food Chem. 48 , 1150–1154 (2000). Liu, X. & Osawa, T. Cis astaxanthin and especially 9-cis astaxanthin exhibits a higher antioxidant activity in vitro compared to the all-trans isomer. Biochem. Biophys. Res. Commun. 357 , 187–193 (2007). Ying, C. jiang et al. Anti-inflammatory Effect of Astaxanthin on the Sickness Behavior Induced by Diabetes Mellitus. Cell. Mol. Neurobiol. 35 , 1027–1037 (2015). Hussein, G. et al. Antihypertensive and neuroprotective effects of astaxanthin in experimental animals. Biol. Pharm. Bull. 28 , 47–52 (2005). Lu, Y. et al. Astaxanthin rescues neuron loss and attenuates oxidative stress induced by amygdala kindling in adult rat hippocampus. Neurosci. Lett. 597 , 49–53 (2015). Green, P., Glozman, S., Kamensky, B. & Yavin, E. Developmental changes in rat brain membrane lipids and fatty acids: The preferential prenatal accumulation of docosahexaenoic acid. J. Lipid Res. 40 , 960–966 (1999). Ikemoto, A. et al. Effects of docosahexaenoic and arachidonic acids on the synthesis and distribution of aminophospholipids during neuronal differentiation of PC12 cells. Arch. Biochem. Biophys. 364 , 67–74 (1999). Calderon, F. & Kim, H. Y. Docosahexaenoic acid promotes neurite growth in hippocampal neurons. J. Neurochem. 90 , 979–988 (2004). Kim, H. Y., Akbar, M., Lau, A. & Edsall, L. Inhibition of neuronal apoptosis by docosahexaenoic acid (22:6n-3): Role of phosphatidylserine in antiapoptotic effect. J. Biol. Chem. 275 , 35215–35223 (2000). Carver, J. D., Benford, V. J., Han, B. & Cantor, A. B. The relationship between age and the fatty acid composition of cerebral cortex and erythrocytes in human subjects. Brain Res. Bull. 56 , 79–85 (2001). Desai, A., Kevala, K. & Kim, H. Y. Depletion of brain docosahexaenoic acid impairs recovery from traumatic brain injury. PLoS One 9 , (2014). Mills, J. D., Hadley, K. & Bailes, J. E. Dietary supplementation with the Omega-3 fatty acid docosahexaenoic acid in traumatic brain injury. Neurosurgery 68 , 474–481 (2011). Jarrard, L. E. On the role of the hippocampus in learning and memory in the rat. Behav. Neural Biol. 60 , 9–26 (1993). Iii, S. Neurotrophins and CNS. Lu, B., Pang, P. T. & Woo, N. H. The yin and yang of neurotrophin action. Nat. Rev. Neurosci. 6 , 603–614 (2005). Lohof 1993. Kang, H. & Schuman, E. M. Long-Lasting Neurotrophin-Induced Enhancement of Synaptic Transmission in the Adult Hippocampus Author ( s ): Hyejin Kang and Erin M . Schuman Published by : American Association for the Advancement of Science Stable URL : http://www.jstor.org/stable/2886. Science (80-. ). 267 , 1658–1662 (2016). Ramos-Languren, L. E. & Escobar, M. L. Plasticity and metaplasticity of adult rat hippocampal mossy fibers induced by neurotrophin-3. Eur. J. Neurosci. 37 , 1248–1259 (2013). Bartsch, D. et al. Aplysia CREB2 represses long-term facilitation: Relief of repression converts transient facilitation into long-term functional and structural change. Cell 83 , 979–992 (1995). West, A. E., Griffith, E. C. & Greenberg, M. E. Regulation of transcription factors by neuronal activity. Nat. Rev. Neurosci. 3 , 921–931 (2002). Deisseroth, K., Mermelstein, P. G., Xia, H. & Tsien, R. W. Signaling from synapse to nucleus: The logic behind the mechanisms. Curr. Opin. Neurobiol. 13 , 354–365 (2003). Bechmann, I. et al. Brain mitochondrial uncoupling protein 2 (UCP2): A protective stress signal in neuronal injury. Biochem. Pharmacol. 64 , 363–367 (2002). Simon-Areces, J. et al. Ucp2 induced by natural birth regulates neuronal differentiation of the hippocampus and related adult behavior. PLoS One 7 , 2–9 (2012). Antunes, M. & Biala, G. The novel object recognition memory: Neurobiology, test procedure, and its modifications. Cogn. Process. 13 , 93–110 (2012). Valadares, C. T., Fukuda, M. T. H., Françolin-Silva, A. L., Hernandes, A. S. & Almeida, S. S. Effects of postnatal protein malnutrition on learning and memory procedures. Nutr. Neurosci. 13 , 274–282 (2010). Pérez-Garciá, G., Guzmán-Quevedo, O., Da Silva Aragaõ, R. & Bolanõs-Jiménez, F. Early malnutrition results in long-lasting impairments in pattern-separation for overlapping novel object and novel location memories and reduced hippocampal neurogenesis. Sci. Rep. 6 , 1–12 (2016). Berardino, B. G., Ballarini, F., Chertoff, M., Igaz, L. M. & Cánepa, E. T. Nutritional stress timing differentially programs cognitive abilities in young adult male mice. Nutr. Neurosci. 25 , 286–298 (2022). Tau, G. Z. & Peterson, B. S. Normal development of brain circuits. Neuropsychopharmacology 35 , 147–168 (2010). Monk, C., Georgieff, M. K. & Osterholm, E. A. Research Review: Maternal prenatal distress and poor nutrition - Mutually influencing risk factors affecting infant neurocognitive development. J. Child Psychol. Psychiatry Allied Discip. 54 , 115–130 (2013). Lupien, S. J., McEwen, B. S., Gunnar, M. R. & Heim, C. Effects of stress throughout the lifespan on the brain, behaviour and cognition. Nat. Rev. Neurosci. 10 , 434–445 (2009). Ranade, A. V. et al. Astaxanthin and DHA supplementation ameliorates the proteomic profile of perinatal undernutrition-induced adipose tissue dysfunction in adult life. Sci. Rep. 13 , 12312 (2023). Chadio, S. & Kotsampasi, B. Handbook of Famine, Starvation, and Nutrient Deprivation. Handb. Famine, Starvation, Nutr. Deprivation (2017) doi:10.1007/978-3-319-40007-5. Rajamoorthi, A., LeDuc, C. A. & Thaker, V. V. The metabolic conditioning of obesity: A review of the pathogenesis of obesity and the epigenetic pathways that “program” obesity from conception. Front. Endocrinol. (Lausanne). 13 , 1–23 (2022). Cho, W. K. & Suh, B. K. Catch-up growth and catch-up fat in children born small for gestational age. Korean J. Pediatr. 59 , 1–7 (2016). Barker, G. R. I. & Warburton, E. C. When is the hippocampus involved in recognition memory? J. Neurosci. 31 , 10721–10731 (2011). Georgieff, M. K., Ramel, S. E. & Cusick, S. E. Nutritional influences on brain development. Acta Paediatr. Int. J. Paediatr. 107 , 1310–1321 (2018). Pandey, A. K. Disruption of Neurosynaptic Physiology and Neuron Network Dysfunction in Brain Disorders: an Environmental and Occupational Health Perspective. Act. Nerv. Super. (Praha). 59 , 61–77 (2017). Melgar-Locatelli, S. et al. Nutrition and adult neurogenesis in the hippocampus: Does what you eat help you remember? Front. Neurosci. 17 , 1–9 (2023). Wattez, J. S. et al. Short-and long-term effects of maternal perinatal undernutrition are lowered by cross-fostering during lactation in the male rat. J. Dev. Orig. Health Dis. 5 , 109–120 (2014). Bathina, S. & Das, U. N. Brain-derived neurotrophic factor and its clinical Implications. Arch. Med. Sci. 11 , 1164–1178 (2015). Georgieff, M. K., Brunette, K. E. & Tran, P. V. Early life nutrition and neural plasticity. Dev. Psychopathol. 27 , 411–423 (2015). Prado, E. L. & Dewey, K. G. Nutrition and brain development in early life. Nutr. Rev. 72 , 267–284 (2014). Yan, Z. et al. Neurotrophin-3 Promotes the Neuronal Differentiation of BMSCs and Improves Cognitive Function in a Rat Model of Alzheimer’s Disease. Front. Cell. Neurosci. 15 , 1–10 (2021). Likhar, A. & Patil, M. S. Importance of Maternal Nutrition in the First 1,000 Days of Life and Its Effects on Child Development: A Narrative Review. Cureus 14 , 8–13 (2022). Polverino, A., Sorrentino, P., Pesoli, M. & Mandolesi, L. Nutrition and cognition across the lifetime: an overview on epigenetic mechanisms. AIMS Neurosci. 8 , 448–476 (2021). Wang, H., Xu, J., Lazarovici, P., Quirion, R. & Zheng, W. cAMP Response Element-Binding Protein (CREB): A Possible Signaling Molecule Link in the Pathophysiology of Schizophrenia. Front. Mol. Neurosci. 11 , 1–14 (2018). Kadosh, K. C. et al. Nutritional support of neurodevelopment and cognitive function in infants and young children—an update and novel insights. Nutrients 13 , 1–26 (2021). Kandel, E. R. molbio of Memory-PKA CREB. Mol. Brain 1–12 (2012). Sakamoto, K., Karelina, K. & Obrietan, K. CREB: A multifaceted regulator of neuronal plasticity and protection. J. Neurochem. 116 , 1–9 (2011). Sreedhar, A. & Zhao, Y. Uncoupling protein 2 and metabolic diseases. Mitochondrion 34 , 135–140 (2017). Pierelli, G. et al. Uncoupling protein 2: A key player and a potential therapeutic target in vascular diseases. Oxid. Med. Cell. Longev. 2017 , (2017). Liu, Z. et al. Role of ROS and nutritional antioxidants in human diseases. Front. Physiol. 9 , 1–14 (2018). Mehta, S. L. & Li, P. A. Neuroprotective role of mitochondrial uncoupling protein 2 in cerebral stroke. J. Cereb. Blood Flow Metab. 29 , 1069–1078 (2009). Mattson, M. P., Gleichmann, M. & Cheng, A. Mitochondria in Neuroplasticity and Neurological Disorders. Neuron 60 , 748–766 (2008). Hilfiker, S. et al. Synapsins as regulators of neurotransmitter release. Philos. Trans. R. Soc. B Biol. Sci. 354 , 269–279 (1999). Evstratova, A. & Tóth, K. Information processing and synaptic plasticity at hippocampal mossy fiber terminals. Front. Cell. Neurosci. 8 , 7–12 (2014). Mirza, F. J. & Zahid, S. The Role of Synapsins in Neurological Disorders. Neurosci. Bull. 34 , 349–358 (2018). Mardones, M. D. et al. PSD95 regulates morphological development of adult-born granule neurons in the mouse hippocampus. J. Chem. Neuroanat. 98 , 117–123 (2019). Agni, M. B., Hegde, P. S. & Ullal, H. Nutritional efficacy of Astaxanthin in modulating orexin peptides and fatty acid level during adult life of rats exposed to perinatal undernutrition stress. Nutr. Neurosci. 1–13 (2022) doi:10.1080/1028415X.2022.2123184. Bhagya, V., Srikumar, B. N., Raju, T. R. & Shankaranarayana Rao, B. S. Chronic escitalopram treatment restores spatial learning, monoamine levels, and hippocampal long-term potentiation in an animal model of depression. Psychopharmacology (Berl). 214 , 477–494 (2011). Table Table 1 is available in the Supplementary Files section Additional Declarations There is NO Competing Interest. Supplementary Files Supplementaryfile.docx Supplementary Information: Figure S1 and Figure S2 Tables.docx Table 1 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3322166","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":232200958,"identity":"4d3f7880-8afd-424b-86aa-9220d3528b99","order_by":0,"name":"Damodara Gowda K M","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYDCCA0DMA0RszMwgpoQM0Vrk+NnZEkBaeIjWYizZz2PAAGETAHzHTyc+eFNzL3HDYZ7Pr27UWPAwsB8+ugGfFskzuZsN5xwrBmrh3WadcwzoMJ60tBv4tBgcyN0mzcOWANZinMMG1CLBY4Zfy/m3QC3/QFp4nhnn/CNGyw2gLbxtCcaSzTzMj3PbiNAieePtZsO5fQly/MxsZsy5fRI8bIT8wnc+d+ODN98SeNj4Dz/+nPOtDhhBh4/h1YIM2CTAJLHKQYD5AymqR8EoGAWjYOQAAFDcSTlds3m0AAAAAElFTkSuQmCC","orcid":"","institution":"KS Hegde Medical Academy, Nitte (Deemed to be University)","correspondingAuthor":true,"prefix":"","firstName":"Damodara","middleName":"Gowda K","lastName":"M","suffix":""},{"id":232200959,"identity":"ab1994a4-6d4e-4030-87ae-341ce3877d60","order_by":1,"name":"Megha Bhat","email":"","orcid":"","institution":"Dept. of Physiology, KS Hegde Medical Academy, Nitte (Deemed to be University)","correspondingAuthor":false,"prefix":"","firstName":"Megha","middleName":"","lastName":"Bhat","suffix":""},{"id":232200960,"identity":"f386620a-e904-4ede-8b21-ecaa6ffe096b","order_by":2,"name":"Pramukh Hegde","email":"","orcid":"","institution":"Dept. of Physiology, KS Hegde Medical Academy, Nitte (Deemed to be University)","correspondingAuthor":false,"prefix":"","firstName":"Pramukh","middleName":"","lastName":"Hegde","suffix":""},{"id":232200961,"identity":"16a0f7d2-7884-4b81-92b0-603b2b0bd490","order_by":3,"name":"Praveen Rai","email":"","orcid":"","institution":"Department of Infectious Diseases \u0026 Microbial Genomics, Nitte University Centre for Science Education and Research, Nitte (Deemed to be University)","correspondingAuthor":false,"prefix":"","firstName":"Praveen","middleName":"","lastName":"Rai","suffix":""},{"id":232200962,"identity":"aef4dccf-ca62-41f2-92a0-65aeab230ac5","order_by":4,"name":"Monika Sadananda","email":"","orcid":"","institution":"Department of Biosciences, Mangalore University, Mangalagangothri","correspondingAuthor":false,"prefix":"","firstName":"Monika","middleName":"","lastName":"Sadananda","suffix":""}],"badges":[],"createdAt":"2023-09-03 17:40:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3322166/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3322166/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65262621,"identity":"cda422e5-134c-4758-99c8-38858b00ed6e","added_by":"auto","created_at":"2024-09-25 11:19:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":213238,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of AsX and DHA supplementation to pre, post and perinatal undernutrition on physical development. A-C) Body weight of the offspring at birth was significantly reduced in pre and perinatally undernourished groups. Maternal AsX and DHA supplementation promoted the body weight at birth. D-F) The significant decrease in the body weight in undernourished groups continued till adulthood. In case of postnatal undernourishment, offspring did not show decreased body weight at birth (B), but body weight significantly decreased during lactation and post-weaning period. PostUN-AD groups showed increased body weight compared post-UN groups (E). Results were represented as mean ± SEM. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 in comparison with control group. #p \u0026lt; 0.05, ##p\u0026lt; 0.01, ###p \u0026lt; 0.001 with respect to AsX and DHA supplemented group.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/929f7f75a8d6a66f4013929a.png"},{"id":65262619,"identity":"b1168699-a886-4a4b-8b06-dec288ed01bf","added_by":"auto","created_at":"2024-09-25 11:19:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":129565,"visible":true,"origin":"","legend":"\u003cp\u003eMaternal AsX and DHA supplementation enhance recognition memory in pre, post, and perinatally undernourished rats. A) Schematic representation of Novel Object Recognition (NOR) test. B) Discrimination Index of PreUN, PreUN-AD, and control groups. C) Discrimination Index of PostUN, PostUN-AD, and control groups. D) Discrimination Index of PeriUN, PeriUN-AD, and control groups. In all the cases One-Way ANOVA with post hoc Tukey’s test was used. Values were expressed as mean ± SEM (n=6). Asterisks were used to represent significant differences, *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/9b541ed414d7fd31f87526a7.png"},{"id":65262622,"identity":"1af051eb-794c-4288-bc85-e654ecd84339","added_by":"auto","created_at":"2024-09-25 11:19:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":219443,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of maternal AsX-DHA supplementation on the performance in partially baited radial arm maze test during acquisition. A) Schematic representation of Radial Arm Maze (RAM) test. B-D) The acquisition of RAM task of different experimental groups across the trials (data from four trials were averaged and expressed as blocks). A two-way repeated measure ANOVA was used. E-G) Percentage correct choice on day-12 of different experimental groups. One-way ANOVA followed by Tukey’s post hoc test was used. Data were represented as mean ± SEM (n=6). Asterisks were used to represent significant differences, *p\u0026lt; 0.05, **p\u0026lt; 0.01, ***p\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/0ccb2579547482232ad58575.png"},{"id":65262623,"identity":"1753e740-aac3-4888-b59f-a5a1d7e5e12f","added_by":"auto","created_at":"2024-09-25 11:19:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":597942,"visible":true,"origin":"","legend":"\u003cp\u003eA) Representative track reports of experimental groups. The effect of undernourishment and AsX-DHA supplementation on %CC (B-D), number of reference memory errors (E-G), and number of working memory errors (H-J) in the retention test of partially baited radial arm maze task. In all the cases One-Way ANOVA with post hoc Tukey’s test was used. Values were represented as mean ± SEM (n=6). Asterisks were used to represent significant differences, *p \u0026lt; 0.05, **p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/a546f864b9bff176d14e7713.png"},{"id":65264201,"identity":"92b25e49-63c4-4efd-a039-7a5d0b31c2c6","added_by":"auto","created_at":"2024-09-25 11:35:32","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":654377,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of maternal undernourishment and AsX-DHA supplementation on expression of hippocampal BDNF (A-C), NT-3 (D-F), CREB (G-I), and UCP-2 (J-L). Data were expressed as fold change (2^-ΔΔCT) as compared to controls. One -way ANOVA followed by Tukey’s post hoc test was used. Data were expressed as Mean ± SEM. Asterisks were used to represent significant difference between the other groups *p\u0026lt; 0.05, **p\u0026lt; 0.01, ***p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/0b819f42e8a48014f369d668.png"},{"id":65262626,"identity":"f0974038-4379-4239-a857-d53026df3edb","added_by":"auto","created_at":"2024-09-25 11:19:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2486964,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of maternal undernutrition and AsX-DHA supplementation on Synapsin-1 protein expression in the hippocampus. A) Representative image of the coronal section of the Hippocampus (bregma -3.12mm) showing CA1, CA2, CA3, and DG regions. Scale bar, 100µm. B) Representative images showing the localization of synapsin-1 protein expression in CA1, CA2, CA3, and DG regions of the hippocampus. Scale bar, 50um. Bar graphs indicate the percentage of Synapsin-1 positive area at CA1, CA2, CA3, and DG regions. One-Way ANOVA followed by post-hoc Tukey’s test was used to compare the cases. Values were expressed as mean ± SEM (n=3). Asterisks were used to represent significant differences, *p\u0026lt; 0.05, **p\u0026lt; 0.01, ***p\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/1b755d704aa17736f436b859.png"},{"id":65263971,"identity":"95c3515d-c5ac-4b3c-b6cc-4af54af73ebb","added_by":"auto","created_at":"2024-09-25 11:27:32","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2394457,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of maternal undernutrition and AsX-DHA supplementation on PSD-95 protein expression in the hippocampus. A) Representative image of the coronal section of the hippocampus (bregma -3.12mm) showing CA1, CA2, CA3, and DG regions. Scale bar, 100µm. B) Representative images showing the localization of PSD-95 protein expression in the hippocampus's CA1, CA2, CA3, and DG regions. Scale bar, 50um. Bar graphs indicate the percentage of Synapsin-1 positive area at CA1, CA2, CA3, and DG regions. One-Way ANOVA followed by post-hoc Tukey's test was used to compare the cases. Values were expressed as mean ± SEM (n=3). Asterisks were used to represent significant differences, *p\u0026lt; 0.05, **p\u0026lt; 0.01, ***p\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/615286cdd286e3a156242994.png"},{"id":65263970,"identity":"e5ae0991-9960-4c8e-a113-8ba90af3bce9","added_by":"auto","created_at":"2024-09-25 11:27:32","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":206538,"visible":true,"origin":"","legend":"\u003cp\u003eProposed of mechanism of action of AsX and DHA supplementation\u003cstrong\u003e \u003c/strong\u003eon the upregulation of BDNF, NT-3, CREB and UCP2 gene expressions. The BDNF, NT-3 signalling pathway regulates intracellular signalling cascades like MAPK, PI3K, and PLC, triggering effects like neuronal differentiation, survival, and plasticity.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/61e935f2e140c60987830b4a.png"},{"id":65262629,"identity":"7bb33d7c-ad33-4670-8659-837601d7d724","added_by":"auto","created_at":"2024-09-25 11:19:32","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":3145953,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of study design and timeline.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/b09630752e3dbe933c033031.png"},{"id":65264938,"identity":"61184222-85fd-4609-9a8e-5d4a1231d791","added_by":"auto","created_at":"2024-09-25 11:43:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13350745,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/66272a29-eacd-4e45-9ce6-1fb93b63478f.pdf"},{"id":65263968,"identity":"9b40c63a-ce35-41c9-950d-e56a52f5ade3","added_by":"auto","created_at":"2024-09-25 11:27:32","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":98476,"visible":true,"origin":"","legend":"Supplementary Information: Figure S1 and Figure S2","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/e4c149d9199e7867cea04ee2.docx"},{"id":65264202,"identity":"96f167d5-d19e-4ece-8e74-1eb5902739b7","added_by":"auto","created_at":"2024-09-25 11:35:32","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":14005,"visible":true,"origin":"","legend":"Table 1","description":"","filename":"Tables.docx","url":"https://assets-eu.researchsquare.com/files/rs-3322166/v1/595b0b93ba6064810a1044a3.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"A Mechanistic Approach to Elucidate the Molecular Basis of Amelioration of Perinatal Undernutrition Induced Cognitive Impairment Using Astaxanthin and DHA in the Adult Life of Albino Wistar Rats","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe formation of the central nervous system is a complicated process that needs an enormous amount of energy as well as particular nutritional components. Maternal nutrition has been recognized as a significant component of brain growth and maturation in most mammalian species\u003csup\u003e1\u003c/sup\u003e. Previous studies reported that prenatal, and postnatal manipulations can program functional brain development in most mammalian species\u003csup\u003e2\u003c/sup\u003e. Heredity, nutrition, and living environment are the key elements involved in the functional development of the brain, with nutrition being a highly significant non-genetic aspect with a long-term influence on brain development\u003csup\u003e3\u003c/sup\u003e. Early life nutritional insufficiency results in long-term learning and memory deficits in adults. Therefore, the perinatal period is crucial for brain development.\u0026nbsp;As we know, foetuses and new-borns depend upon placental blood and breast milk for their nutrient requirements, as a result, any condition that reduces placental blood flow and/or the quantity and/or quality of breast milk might result in foetal and neonatal malnutrition. The maternal diet would be one of the most important variables impacting brain development if the mother is free of hereditary abnormalities\u003csup\u003e4\u003c/sup\u003e. Hence availability of nutrients is important for brain growth and the development of optimal cognitive function\u003csup\u003e5\u003c/sup\u003e. According to a WHO report (2021), undernutrition is responsible for approximately 45% of deaths in children under five, primarily in low- and middle-income countries resulting from chronic undernutrition, poor socioeconomic conditions, maternal health, and inappropriate early childhood care\u0026nbsp;\u003csup\u003e6\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eSeveral approaches have been made to overcome the detrimental effects of undernutrition stress by giving nutritional supplements to mothers as well as to the progeny. Findings of these studies \u0026nbsp; have revealed, availability of nutritional components plays important role in development of brain during foetal and neonatal stage. In particular, plant based and marine derived nutrients such as carotenoids, omega-3 fatty acids, flavonoids, vitamins etc have shown promising effects on improvement of brain function by various repair mechanisms. However, there is paucity in the available literature regarding the dietary approach using antioxidant in positively influencing the foetal programming of brain health in adult offspring’s suffered undernutrition in their prenatal and/or postnatal life. In this point of view, in the present study we have evaluated the effect of Astaxanthin (AsX) and DHA as dietary supplements to ameliorate the effect of pre, post and perinatal undernourishment induced stress in the adult life.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCarotenoids have been studied for its influence on human health; xanthophyll AsX is one such carotenoid that has received a lot of interest recently.AsX (3,3’-dihydroxy-β,β’-carotene-4,4’-dione) is widely distributed in microorganisms and marine animals including, algae, yeast, salmon, trout, krill, shrimp, and crayfish\u003csup\u003e7\u003c/sup\u003e. AsX contains conjugated double bonds, hydroxyl and keto groups, which are responsible for its antioxidant properties\u003csup\u003e8\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e. Various biological activities of AsX have been reported such as anti-inflammatory, antiapoptosis, antioxidative, and neuroprotective\u003csup\u003e10\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e11\u003c/sup\u003e. In an amygdala kindling model of epilepsy, AsX treated rats were protected from hippocampal injury\u003csup\u003e12\u003c/sup\u003e. Also, it has been reported that AsX may modulate the brain-derived neurotrophic factor, a key growth factor of neuronal development in perinatally undernourished rats\u003csup\u003e4\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eDocosahexaenoic acid\u0026nbsp;(DHA) is an omega-3 polyunsaturated fatty acid\u0026nbsp;(PUFA),\u0026nbsp;most predominantly found in brain grey matter and in the retina of mammals. Several studies have reported the important role of DHA in the brain development, which includes, neuronal differentiation, formation of synapses, neurite growth, anti-apoptosis and antioxidant properties\u003csup\u003e13\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e14\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e15\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e16\u003c/sup\u003e. During the last trimester of pregnancy and neonatal period, DHA is preferentially transferred from maternal resources to foetus circulation via the placenta and breastfeeding; it rapidly accumulates in the foetal brain and plays a critical role in the initial stage of brain development. And the rate of accumulation of DHA in the foetus brain depends upon the maternal diet (breastfeeding)\u0026nbsp;\u003csup\u003e17\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e13\u003c/sup\u003e. Recent study has shown that DHA depleted (70%) mice of the third generation of traumatic brain injury, exhibited accelerated neuronal death and slower cognitive and motor recovery when compared to normal control mice\u003csup\u003e18\u003c/sup\u003e. In a rodent model of traumatic brain injury, pre-injury DHA supplementation was found to reduce the injury response and enhance memory when compared to the non-DHA supplemented group\u003csup\u003e19\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eHippocampus is a crucial brain structure involved in spatial learning and memory formation in rodents and episodic memory in humans\u003csup\u003e20\u003c/sup\u003e. It is known that learning and memory rely on the strength of the synaptic connections between the neurons. In the hippocampus,\u0026nbsp;neurotrophins play an important role in formation and maintenance of synaptic plasticity. Among them, neurotrophin-3 (NT-3) and brain-derived neurotrophic factor (BDNF) have been discovered to have essential roles in the neurobiological mechanisms of learning and memory.\u0026nbsp;According to previous\u0026nbsp;findings, BDNF plays a vital role in regulating synapse development, synaptic transmission, and plasticity mechanisms\u003csup\u003e21\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e22\u003c/sup\u003e.\u0026nbsp;It has been reported that long-term exposure to NT-3 results in rapid long-lasting enhancement of synaptic transmission at cultured neuromuscular synapses and Schaffer collateral pathway\u003csup\u003e23\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e24\u003c/sup\u003e. Furthermore, it is found that NT-3 administration potentiates MF-CA3 synaptic transmission at the DG-CA3 hippocampal projection, a region crucial for memory consolidation and acquisition of many learning tasks\u003csup\u003e25\u003c/sup\u003e.\u0026nbsp;As we know, long-term potentiation of synaptic plasticity mediates the neurobiological mechanisms of learning and memory. And long-term synaptic plasticity requires the production of new proteins, which is considered to be facilitated by the transcription factor cAMP response element-binding protein (CREB). CREB's binding to the CRE (cAMP response element) regulates the expression of several genes involved in plasticity. Several \u0026nbsp;studies have reported the critical role of CREB in long-term facilitation of synaptic efficacy and memory\u003csup\u003e26\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e27\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e28\u003c/sup\u003e. Uncoupling protein-2 \u0026nbsp;(UCP2) promotes scavenging of free radicles in neurons which is necessary for β- oxidation of fatty acids in neurons, which is essential for the development of neurons as well as hippocampal and adult synaptogenesis\u003csup\u003e29\u003c/sup\u003e. And it is also observed that \u0026nbsp;long-lasting impairment in UCP2 expression during development may affect hippocampus-related adult behaviour\u003csup\u003e30\u003c/sup\u003e. Since the expression of these genes modulate the synapse development and plasticity in the central nervous system these genes can be considered as important biomarkers of learning and memory processes. Along with these genes, learning and memory formation, and synaptic plasticity are regulated by pre- and postsynaptic proteins. This study used the immunohistochemistry method to evaluate the changes in the expressions of Synapsin1 and Postsynaptic density protein 95 (PSD-95) as indicators of synaptic density. PSD-95 is a core synaptic scaffold component, highly enriched in postsynaptic density, and plays a crucial role in storing neuronal information \u003csup\u003e32,33\u003c/sup\u003e. Synapsin 1, a phosphoprotein, is localized to the cytoplasmic synaptic vesicle membrane in presynaptic terminals. It regulates the of no. of vesicles available, and neurotransmitters released in presynaptic terminals \u003csup\u003e34,35\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe current study is intended to evaluate the effect of dietary supplementation of FDA approved nutraceuticals, AsX and DHA in adult offspring undernourished during their prenatal and/or postnatal life using Albino Wistar rat model on a molecular basis. The hippocampus was the subject of our investigation because, as a component of the limbic system, it plays a significant role in cognition and behaviour. We hypothesized that altered gene and synaptic protein expressions in the hippocampus are responsible for the learning and memory deficit. AsX and DHA administration may modulate these deficiencies caused by pre, post, and perinatal undernutrition.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eMaternal AsX and DHA supplementation modulate the body weight of pups at birth and average litter size\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThere was no significant effect of pre, post, and perinatal undernourishment on average number of pups born per dam. However, pups\u0026rsquo; weight at birth was significantly reduced by maternal undernutrition, and this significant body weight depletion remained throughout the study. The body weight of the pups from all the experimental groups were measured at birth and throughout the lactation and adolescent period i.e., from PD-1 to PD-56. The same trend was observed in brain weight, measured at the end of the experiment (supplementary table 1). The birth weight of the pups born to pre and perinatally undernourished dams showed significant decrease compared to pups born to the dams fed with control diet. AsX and DHA supplementation to pre and perinatally undernourished dams significantly increased the body weight of the pups at birth (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, C; C vs PreUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; C vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; PreUN vs PreUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; PeriUN vs PeriUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, one-way ANOVA with Tukey\u0026rsquo;s multiple comparison). Even though, pups born to the undernourished dams supplemented with AsX and DHA showed lowered body weight at birth compared to controls (C vs PreUN-AD: p\u0026thinsp;=\u0026thinsp;0.0018; C vs PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.0177), when compared to undernourished groups, AsX and DHA supplemented groups showed significantly increased birth weight (PreUN vs PreUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; PeriUN vs PeriUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Compared to control group pre, post, and perinatally undernourished offsprings showed significantly reduced body weight during lactation (PD-1 to PD-21) and postweaning period (PD-21 TO PD-57) indicating the effect of undernourishment on the body weight. AsX and DHA supplementation in all the three groups promoted the body weight. The two-way ANOVA with repeated measures revealed the significant effects for the treatment, time and time \u0026times; treatment interaction. Tukey\u0026rsquo;s multiple comparison showed significant difference between the groups from PD-1 to PD-57(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD; Time effect: F [ 2.814, 84.41]\u0026thinsp;=\u0026thinsp;2288; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Treatment effect: F [ 5, 30]\u0026thinsp;=\u0026thinsp;54.52; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Interaction effect: F [ 35, 210]\u0026thinsp;=\u0026thinsp;10.84; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, E; Time effect: F [ 3.322, 99.67]\u0026thinsp;=\u0026thinsp;2238; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Treatment effect: F [ 5, 30]\u0026thinsp;=\u0026thinsp;90.39; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Interaction effect: F [ 35, 210]\u0026thinsp;=\u0026thinsp;13.28; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, F; Time effect: F [ 2.871, 86.13]\u0026thinsp;=\u0026thinsp;2420; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Treatment effect: F [ 5, 30]\u0026thinsp;=\u0026thinsp;92.50; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Interaction effect: F [ 35, 210]\u0026thinsp;=\u0026thinsp;18.87; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Further, we also observed that the brain weight of the offspring\u0026rsquo;s were significantly reduced in pre and perinatally undernourished groups. Maternal AsX and DHA supplementation enhanced brain weight (Supplementary Figure S1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eMaternal AsX and DHA supplementation modulates cognitive decline following acute stress caused by maternal undernutrition\u003c/h3\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAsX and DHA supplementation enhances recognition memory\u003c/h2\u003e \u003cp\u003eTo evaluate the effect of pre, post and perinatal undernutrition on recognition memory, and to asses weather maternal AsX and DHA supplementation ameliorates the recognition memory, we performed NOR test. It included 3 sessions\u0026rsquo; habituation, training and test (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Discrimination Index was calculated as a measure of discrimination between familiar and novel objects \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. NOR test utilizes the innate preference of rodents to explore novel objects over the familiar ones in the environment. Repeated exposure to an object decreases exploration time as the object becomes familiar, and rodents will spend more time exploring the novel. Several previous studies have reported that protein malnutrition during the gestation and lactation period impairs recognition memory \u003csup\u003e32 33 34\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTotal exploration time in the training session did not significantly differ between the objects and experimental groups (Supplementary Figure S2). Pre, post, and perinatal dietary supplementation of AsX and DHA enhanced recognition memory which was impaired by maternal undernutrition. In this study, we observed significantly decreased DI in undernourished groups compared to drug control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB; DC vs. PreUN: p\u0026thinsp;=\u0026thinsp;0.0006 0.0038, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC; DC vs. PostUN: p\u0026thinsp;=\u0026thinsp;0.0006, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD; DC vs. PeriUN: p\u0026thinsp;=\u0026thinsp;0.0020). With maternal undernourishment, dietary supplementation of AsX and DHA showed enhanced DI compared to the undernourished group. Perinatal undernourishment and AsX and DHA supplemented group showed significantly increased DI (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD; PeriUN vs. PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.0243) when compared to the perinatally undernourished group indicating, AsX and DHA supplementation improved recognition memory in adult rats which were undernourished during their pre, post and perinatal period.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eMaternal AsX and DHA supplementation enhance learning in undernutrition-induced learning impairment in partially baited radial arm maze tasks\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAll the experimental rats were given 12 days of training before retention. Food rewards were placed at the end of the 1st and 2nd arms as an adjacent choice and at the end of the 5th and 7th arms as a choice. Two-way ANOVA with repeated measures revealed the significant effect of treatment and interaction on experimental groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB; Interaction effect: F (25, 150)\u0026thinsp;=\u0026thinsp;1.827, p\u0026thinsp;=\u0026thinsp;0.0147; Treatment effect: F (5, 30)\u0026thinsp;=\u0026thinsp;6.201, p\u0026thinsp;=\u0026thinsp;0.0005; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC Interaction effect: F (25, 150)\u0026thinsp;=\u0026thinsp;2.747, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Treatment effect: F (5, 30)\u0026thinsp;=\u0026thinsp;5.455, p\u0026thinsp;=\u0026thinsp;0.0011; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD Interaction effect: F (25, 150)\u0026thinsp;=\u0026thinsp;2.212, p\u0026thinsp;=\u0026thinsp;0.0018; Treatment effect: F (5, 30)\u0026thinsp;=\u0026thinsp;5.931, p\u0026thinsp;=\u0026thinsp;0.0006). The percentage of correct choice (%CC) increased, and all the experimental groups showed a standard learning curve during acquisition. Maternal undernourishment resulted in a significant decrease of %CC in B-5 and B-6 (B-5; C vs. PreUN: p\u0026thinsp;=\u0026thinsp;0.015, C vs. PostUN: ns, C vs. PeriUN: p\u0026thinsp;=\u0026thinsp;0.028; B-6; C vs. PreUN: P\u0026thinsp;=\u0026thinsp;0.008, C vs PostUN: p\u0026thinsp;=\u0026thinsp;0.009, C vs PeriUN: p\u0026thinsp;=\u0026thinsp;ns). AsX-DHA supplementation significantly declined learning deficit only in B-6 in PostUN-AD rats (B-6; PostUN vs PostUN-AD: p\u0026thinsp;=\u0026thinsp;0.011). These results suggested differential learning only in Blocks 5 and 6. Throughout the acquisition, AsX-DHA-supplemented groups showed better learning than undernourished groups (Fig. B-D).\u003c/p\u003e \u003cp\u003eControl rats attained 80% correct choice criteria after 11 days of training. At 12 days of training, Control rats reached 83.92\u0026thinsp;\u0026plusmn;\u0026thinsp;9.18, Drug control rats achieved 82.67\u0026thinsp;\u0026plusmn;\u0026thinsp;6.56, and Vehicle control rats reached 80.08\u0026thinsp;\u0026plusmn;\u0026thinsp;5.69% correct choice, whereas undernourished rats failed to reach the criteria of learning (80% correct choice) at 12 days of training (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-G). Undernourished groups showed a significantly decreased %CC on day 12th compared to control groups (C vs. PreUN: p\u0026thinsp;=\u0026thinsp;0.030; C vs. PostUN: p\u0026thinsp;=\u0026thinsp;0.001 and C vs. PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Pre and Post AsX-DHA supplemented groups did not show significantly increased %CC compared to the undernourished group on day 12th, indicating, AsX-DHA supplementation did not boost the learning in pre and postnatally undernourished rats. But perinatal supplementation of AsX-DHA improved learning by showing significantly enhanced %CC compared to PeriUN rats (PeriUN vs PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.002).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEffect of maternal undernourishment and ASX-DHA supplementation on retention\u003c/h3\u003e\n\u003cp\u003eTo assess the effect of maternal undernutrition and AsX-DHA on the retention of learned information, we tested retention after ten days\u0026rsquo; post-acquisition. During retention, subjects demonstrated a significantly decreased %CC, a significantly increased number of reference memory errors (RMEs), and the number of working memory errors (WMEs) in PreUN and PeriUN groups.\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e: A) Representative track reports of experimental groups. The effect of undernourishment and AsX-DHA supplementation on %CC (B-D), number of reference memory errors (E-G), and number of working memory errors (H-J) in the retention test of partially baited radial arm maze task. In all the cases One-Way ANOVA with post hoc Tukey\u0026rsquo;s test was used. Values were represented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;6). Asterisks were used to represent significant differences, *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01.\u003c/p\u003e \u003cp\u003eSimilar to the acquisition, the retention test also observed a significant decline in %CC in VC-UN, Pre-UN, and PeriUN groups [Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB; F (5, 30)\u0026thinsp;=\u0026thinsp;8.883, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD; F (5, 30)\u0026thinsp;=\u0026thinsp;8.635, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001]. Compared to controls, PreUN and PeriUN groups showed decreased %CC (C vs. Pre-UN: p\u0026thinsp;=\u0026thinsp;0.0008, C vs Peri-UN: p\u0026thinsp;=\u0026thinsp;0.001). AsX-DHA-supplemented groups did not show any impairment in the retention test. The positive effect of AsX-DHA supplementation on %CC in the retention test was statistically significant in the PeriUN-AD group (PeriUN vs. PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.006). Though we observed lower %CC in PostUN subjects on the 12th day of training, this trend has not continued the retention.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSignificant increase in the number of RMEs have been observed in undernourished groups [Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE; F (5, 30)\u0026thinsp;=\u0026thinsp;7.097: p\u0026thinsp;=\u0026thinsp;0.0002, C vs. PreUN: p\u0026thinsp;=\u0026thinsp;0.004; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, F (5, 30)\u0026thinsp;=\u0026thinsp;5.977: p\u0026thinsp;=\u0026thinsp;0.0006, C vs. Peri-UN: p\u0026thinsp;=\u0026thinsp;0.02]. Supplementation ameliorated impairment in PreUN and PeriUN groups as we have observed no significant increase in the number of RMEs in the ASX-DHA-supplemented group compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-G). Working memory impairment in undernourished rats was reinforced by AsX-DHA supplementation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-J). Postnatal undernourishment and AsX-DHA supplementation did not affect the number of WMEs. But Pre and Perinatal undernourishment negatively affected WMEs which was restored by AsX-DHA supplementation (C vs. PreUN: p\u0026thinsp;=\u0026thinsp;0.006; C vs. Peri-UN: p\u0026thinsp;=\u0026thinsp;0.006; Peri-UN vs. PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.006).\u003c/p\u003e\n\u003ch3\u003eEffect of maternal undernourishment and AsX-DHA supplementation on BDNF, CREB, NT-3 and UCP-2 gene expression\u003c/h3\u003e\n\u003cp\u003eIt has been shown that expression of BDNF, NT-3, CREB and UCP-2 genes modulate the synapse development, transmission and plasticity. We wanted to investigate whether pre, post and perinatal undernourishment alters the long-term expression of these genes in the hippocampus. Transcriptomic changes of these factors were studied by quantifying mRNA levels using real time RT-PCR.\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e displays the hippocampus's relative expression of BDNF, NT-3, CREB, and UCP-2. In pre, post, and perinatally undernourished rats, BDNF mRNA levels decreased significantly when compared to their controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-C; C vs. PreUN: p\u0026thinsp;=\u0026thinsp;0.0003; C vs. PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; C vs. PostUN: p\u0026thinsp;=\u0026thinsp;0.009). AsX-DHA supplemented groups showed significantly higher levels of BDNF compared to their undernourished counterparts except for PostUN-AD group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-C; PreUN vs. PreUN-AD: p\u0026thinsp;=\u0026thinsp;0.001; PeriUN vs. PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.005). Only PeriUN rats showed significantly lower levels of NT-3 compared to controls and PeriUN-AD rats, but in the case of pre and postnatal conditions, AsX-DHA supplementation increased the NT-3 expression, which was not significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD-F; C vs PeriUN: P\u0026thinsp;=\u0026thinsp;0.028; PeriUN vs. PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.001). Undernourishment resulted in significantly lower levels of CREB and UCP-2 mRNA, and in PreUN-AD and PeriUN-AD conditions significant increase in CREB and UCP-2 mRNA levels was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG-I; C vs PreUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; C vs. PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; C vs. PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; PreUN vs. PreUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; PeriUN vs. PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.004, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ-L; C vs PreUN: p\u0026thinsp;=\u0026thinsp;0.0004; C vs PostUN: p\u0026thinsp;=\u0026thinsp;0.0003; C vs PeriUN: p\u0026thinsp;=\u0026thinsp;0.0001; PreUN vs. PreUN-AD: p\u0026thinsp;=\u0026thinsp;0.003).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUsing the immunohistochemistry technique, we studied the expression of synapsin-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) and PSD-95 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA) in the hippocampus's CA1, CA2, CA3, and DG regions. The results showed that the percentage of positive areas significantly differed between the experimental groups. The expressions of synapsin-1 and PSD-95 decreased in undernourished groups compared to control and AsX-DHA treated groups at CA1, CA2, CA3, and DG regions, respectively. CA1-Synapsin 1 [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB. Control vs PreUN: p\u0026thinsp;=\u0026thinsp;0.0003, PreUN vs PreUN-AD: p\u0026thinsp;=\u0026thinsp;0.022; Control vs PostUN: p\u0026thinsp;=\u0026thinsp;0.0002, PostUN vs PostUN-AD: p\u0026thinsp;=\u0026thinsp;0.039; Control vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PeriUN vs PeriUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001], CA2-Synapsin-1 [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB. Control vs PreUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PreUN vs PreUN-AD: p\u0026thinsp;=\u0026thinsp;0.0001; Control vs PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PostUN vs PostUN-AD: p\u0026thinsp;=\u0026thinsp;0.0014; Control vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PeriUN vs PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.0006], CA3-Synapsin-1 [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB. Control vs PreUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PreUN vs PreUN-AD: p\u0026thinsp;=\u0026thinsp;0.0007; Control vs PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001: Control vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PeriUN vs PeriUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001], DG-Synapsin-1 [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB. Control vs PreUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PreUN vs PreUN-AD: p\u0026thinsp;=\u0026thinsp;0.0002; Control vs PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Control vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PeriUN vs PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.032].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCA1-PSD-95 [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB. Control vs PreUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PreUN vs PreUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Control vs PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PostUN vs PostUN-AD: p\u0026thinsp;=\u0026thinsp;0.015; Control vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PeriUN vs PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.0001], CA2-PSD-95[Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB. Control vs PreUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PreUN vs PreUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Control vs PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Control vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PeriUN vs PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.0003] CA3-PSD-95 [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB. Control vs PreUN: P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PreUN vs PreUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Control vs PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PostUN vs PostUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Control vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PeriUN vs PeriUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001], DG-PSD-95 [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB. Control vs PreUN: p\u0026thinsp;=\u0026thinsp;0.024; Control vs PostUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PostUN vs PostUN-AD: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Control vs PeriUN: p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, PeriUN vs PeriUN-AD: p\u0026thinsp;=\u0026thinsp;0.007].\u003c/p\u003e \u003cp\u003eHowever, our study showed that AsX-DHA-treated animals did not show a significantly increased percentage of positive area at CA3 and DG compared to the PostUN group. Similarly, PSD95 in AsX-DHA treated animals also did not show a significantly increased portion of positive area at CA2 in the PostUN group and DG in the PreUN group.\u003c/p\u003e\n\u003ch3\u003eCorrelation OF behaviour with hippocampal protein levels\u003c/h3\u003e\n\u003cp\u003eThe Pearson correlation between behavioural parameters (% CC, RME, WME, and DI) with the expression of synapsin-1 and PSD-95 in hippocampal subfields, CA1, CA2, CA3, and DG revealed a significant positive correlation between %CC retention and DI with synapsin-1 and PSD-95 expression and a significant negative correlation between RME and WME with synapsin-1 and PSD-95 (Table no. 1). On the other hand, the expression of PSD-95 in DG did not show a significant correlation with behavioural parameters (PSD-95: %CC retention: r\u0026thinsp;=\u0026thinsp;0.504, P\u0026thinsp;=\u0026thinsp;0.137; RME: r=-0.564, P\u0026thinsp;=\u0026thinsp;0.318; WME: r=-0.367, P\u0026thinsp;=\u0026thinsp;0.296; DI: r\u0026thinsp;=\u0026thinsp;0.627, P\u0026thinsp;=\u0026thinsp;0.052).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFrom this study we illustrate that AsX-DHA supplementation ameliorates maternal undernutrition induced cognitive impairment associated with altered synaptic plasticity in the adult life of offsprings. Restricted dietary intake during pregnancy has a significant impact on foetal brain development. Many cellular processes occur from the first trimester to mid-gestation, including neuronal cell proliferation, differentiation, migration, and synapse formation. Especially dendritic arborisation and synaptogenesis take place in the 3rd trimester \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Insufficient nutrient intake during this period impairs neurocognitive development, especially concerning learning and memory, particularly regarding variation in the structural and functional aspects of the hippocampus \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. With the addition of new neurons throughout life, hippocampus development in rodents occurs mostly in late gestation and the first two weeks after birth. As a result, it has been established that the hippocampus is especially vulnerable to changes in the environment during infancy \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. A possible strategy to combat the harmful effects of maternal undernourishment is to manipulate the maternal diet during pregnancy. Our previous study revealed that a 30% reduction in maternal diet during pregnancy induces stress, which leads to adipose tissue dysfunction in adult life. Treatment with AsX and DHA significantly improved the stress of perinatal undernutrition-induced differential protein expression in adipose tissue \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. The aim of this study was to assess the neuroprotective ability of AsX and DHA supplementation in pre, post and perinatally undernourished rats.\u003c/p\u003e \u003cp\u003ePerinatal undernutrition can have profound and long-lasting effects on body weight regulation in the later stages of life. Perinatal undernutrition can lead to alterations in foetal growth and development, potentially resulting in low birth weight \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Low birth weight infants are at an increased risk of developing obesity and related metabolic disorders later in life. This phenomenon is referred to as the \"foetal programming\" hypothesis, which suggests that undernutrition during early life can lead to adaptations in metabolism and physiology that predispose individuals to obesity in an obesogenic environment \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Individuals who experienced undernutrition during the perinatal period may exhibit a phenomenon known as \"catch-up growth,\" where they initially show rapid weight gain and increased adiposity during early childhood and adolescence \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. This catch-up growth can increase the risk of obesity and metabolic syndrome in adulthood. However, the effects may differ depending on the interplay between genetic predisposition and environmental factors \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Efforts to mitigate the impact of perinatal undernutrition on body weight by improving maternal nutrition during pregnancy are essential to support optimal foetal development. The present study used FDA-approved nutraceuticals, Astaxanthin, and DHA to mitigate undernourishment-induced disorders.\u003c/p\u003e \u003cp\u003eThe potential impact of perinatal undernutrition on cognitive function, particularly recognition memory, is significant. Recognition memory is the ability to identify previously encountered stimuli, and it plays a crucial role in daily functioning, learning, and decision-making. Maternal undernutrition induced recognition memory impairment in NOR task was restored by maternal AsX-DHA supplementation in the adulthood. NOR test assesses the natural ability of rodents to recognize the novel object in the environment \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Research suggests that perinatal undernutrition cause significant effects on recognition memory later in life \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Animal studies have demonstrated that animals subjected to perinatal undernutrition exhibit impairments in various memory tasks, including recognition memory \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. These impairments arise from disruptions in neural circuitry, altered synaptic plasticity, and changes in neurotransmitter systems \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Nutritional deficiencies during critical brain development periods can alter the formation and maintenance of neural connections. This can result in suboptimal communication between brain regions involved in memory processing, leading to deficits in recognition memory performance. Additionally, perinatal undernutrition can impact the levels of neurotrophic factors and neurotransmitters that are crucial for synaptic plasticity and memory consolidation \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Adequate maternal nutrition can contribute to optimal brain development and cognitive function, particularly during critical developmental periods. The present study confirmed the potential ameliorative effect of AsX and DHA on perinatal undernutrition-induced recognition memory.\u003c/p\u003e \u003cp\u003ePerinatal undernutrition has the potential to impact spatial learning and memory in later life due to its influence on brain development and neural circuitry. Maternal undernourishment had a discernible impact on the retention of RMEs and WMEs in the RAM task \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Offspring born to pre, post and perinatally undernourished mothers exhibited higher rates of memory errors, suggesting a potential impairment in spatial memory and working memory functions. However, the study also introduced a possible avenue for intervention. AsX-DHA supplementation showed promise in mitigating the harmful effects of maternal undernourishment on memory performance. Offspring who received the supplementation demonstrated reduced rates of RMEs and WMEs, approaching levels comparable to those in the control group. This study underscores maternal nutrition's importance in shaping offspring's cognitive outcomes. Furthermore, the potential benefits of AsX-DHA supplementation in ameliorating memory deficits are noteworthy.\u003c/p\u003e \u003cp\u003eBrain-Derived Neurotrophic Factor (BDNF) is a protein that plays a crucial role in promoting the growth, survival, and maintenance of neurons in the brain. It is also involved in synaptic plasticity, learning, and memory \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. In perinatal undernutrition, inadequate nutritional intake during the period surrounding childbirth can profoundly affect the levels and functions of BDNF in the brain throughout an individual's life, influencing their cognitive and neurological development. Sufficient nutrition during these periods is essential for the average growth and maturation of the brain. Perinatal undernutrition can affect BDNF levels during early developmental stages, including foetal development and infancy \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. These early disruptions can set the stage for long-term cognitive and neurological consequences. Reduced BDNF levels resulting from undernutrition can impair the brain's ability to adapt and form new connections in response to experiences and learning opportunities \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. This can lead to deficits in cognitive functions such as attention, memory, and learning. The effects of perinatal undernutrition on BDNF can persist into adulthood and even influence aging processes. Efforts to mitigate the impact of perinatal undernutrition on BDNF levels and associated cognitive outcomes include providing optimal nutrition during pregnancy, infancy, and childhood. In our previous study, we found significantly reduced hippocampal BDNF protein level in perinatally undernourished rats which was modulated by AsX supplementation \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. The current study demonstrated a significant upregulation of hippocampal BDNF by AsX-DHA in the pre and perinatally undernourished offspring.\u003c/p\u003e \u003cp\u003eNT-3 is a growth factor that plays a vital role in developing and maintaining neurons in the nervous system. During early developmental stages, including foetal growth and infancy, NT-3 is essential for promoting neurons' development, differentiation, and survival \u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. Adequate nutrition during this period is crucial for supporting the production and availability of NT-3 \u003csup\u003e51\u003c/sup\u003e. Perinatal undernutrition leads to altered NT-3 expression and signalling, which may disrupt the normal development of neural circuits and connections, leading to long-lasting effects on sensory, motor, and cognitive functions. Reduced NT-3 levels due to undernutrition contribute to an increased vulnerability to neurodegenerative diseases and cognitive decline in later years \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. The disruptions in neural connectivity and plasticity caused by perinatal undernutrition can contribute to age-related cognitive impairments. Adequate maternal nutrition provides the necessary nutrients for producing and releasing NT-3, supporting healthy neuronal development. This study evaluated the neuroprotective ability of AsX and DHA supplementation in pre, post, and perinatally undernourished rats on NT-3 levels, providing promising positive results. Therefore, early cognitive stimulation by a nutrient-rich diet, AsX and DHA, contribute to maintaining healthy NT-3 levels and promoting optimal brain function.\u003c/p\u003e \u003cp\u003eThe cAMP response element-binding protein (CREB). is a transcription factor that plays a pivotal role in regulating gene expression in response to various cellular signals \u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. It is imperative in the brain to mediate synaptic plasticity, learning, memory, and other cognitive processes. CREB is essential for adequately developing neural circuits and establishing synaptic connections in the brain. During early developmental stages, CREB activation helps to guide the formation and maturation of neuronal networks \u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. It involves in long-term potentiation (LTP) and long-term depression (LTD), fundamental mechanisms underlying memory formation \u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. Perinatal undernutrition hindered CREB-mediated synaptic plasticity, potentially impairing the brain's ability to adapt and encode new information. This would lead to deficits in learning, memory, and cognitive flexibility and lasting effects on mental and neurological functions. The impact of perinatal undernutrition on CREB involves intricate interactions between nutritional status, hormonal regulation, and cellular signalling pathways. CREB activity is regulated by factors such as cAMP (cyclic AMP) and Ca\u003csup\u003e2+\u003c/sup\u003e (calcium) signalling\u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. Undernutrition can disrupt these signalling pathways, reducing CREB activation and altering gene expression. The current study demonstrated the benefits of AsX and DHA in supporting CREB-mediated synaptic plasticity and cognitive function.\u003c/p\u003e \u003cp\u003eUncoupling Protein-2 (UCP-2) is a mitochondrial protein crucial for regulating energy balance, metabolism, and oxidative stress. It is primarily found in various tissues, including adipose tissue, skeletal muscle, and the brain \u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. The relationship between perinatal undernutrition, UCP-2, and cognitive function is complex and multifaceted. Perinatal undernutrition can lead to mitochondrial dysfunction in various tissues, including the brain. UCP-2 is involved in maintaining mitochondrial function by regulating the proton gradient. Impairments in UCP-2 activity due to undernutrition could contribute to mitochondrial dysfunction and affect cognitive function \u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. It was reported that undernutrition can lead to oxidative stress, negatively impacting various cellular processes, including cognitive function \u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e. UCP-2 is linked to the regulation of ROS production in mitochondria. Therefore, alterations in its activity due to undernutrition might influence oxidative stress levels in brain cells. UCP-2 also influences neurotransmitter function in the brain. Disruptions in UCP-2 activity could affect neurotransmitter release and signalling, thus impacting cognitive function \u003csup\u003e\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. Mitochondrial function, which UCP-2 is linked to, has been shown to influence synaptic plasticity \u003csup\u003e\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. Therefore, alterations in UCP-2 activity due to undernutrition could impact synaptic plasticity and, subsequently, cognitive function. The specific effects of perinatal undernutrition on UCP-2 and cognitive function would likely depend on various factors, including the severity and duration of undernutrition, the timing of nutrient deprivation, and genetic factors. The present study illustrated the impact of prenatal, postnatal, and perinatal undernutrition on UCP-2 activity and its amelioration by AsX and DHA.\u003c/p\u003e \u003cp\u003eSynapsins are a family of proteins that play a crucial role in regulating neurotransmitter release and synapse formation. They are primarily associated with presynaptic terminals and are involved in the assembly and stabilization of synaptic vesicles \u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e. In the hippocampus, synapsin expression is not uniform across its different regions. The hippocampus has several sub regions, including the dentate gyrus and CA1, CA2, and CA3 regions. Among these, the highest expression of synapsins is generally observed in the mossy fibres of the CA3 region, which are the axons of dentate gyrus granule cells that project to the CA3 pyramidal cells \u003csup\u003e\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u003c/sup\u003e. Synapsin proteins are abundant in these mossy fibre terminals; contribute to the regulation of neurotransmitter release and synaptic plasticity. The Synapsin expression varies depending on the developmental stage, synaptic activity, and other factors \u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e. Therefore, while the CA3 mossy fibers typically show higher Synapsin expression in the hippocampus, the precise distribution and levels of synapsin proteins can be influenced by specific experimental conditions or pathological states. However, our study found that AsX-DHA-treated animals did not show a significantly increased percentage of positive area at CA3 and DG compared to the PostUN group. This indicates that perinatal undernutrition stress preferentially causes the inhibition of synapsin-1 at CA3 and DG, even in the presence of nutraceuticals, Astaxanthin, and DHA \u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePost-Synsptic Density-95 (PSD95) is a protein primarily located in the postsynaptic density of neurons, a specialized region involved in synaptic signalling and plasticity. While PSD95 is widely distributed throughout the brain, including various regions of the hippocampus, its expression levels can vary across different subregions of the hippocampus \u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e. Studies have shown that PSD95 expression is particularly prominent in the CA1 region of the hippocampus, which is known for its role in learning and memory processes. However, it is worth noting that PSD95 is also expressed in other hippocampus regions, albeit at varying levels. Overall, while PSD95 can be found in different parts of the hippocampus \u003csup\u003e\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e. The current study demonstrated that the PSD95 in AsX-DHA treated animals did not show a significantly increased percentage of positive area at CA2 in the PostUN group and DG in the PreUN group. This revealed that PSD95 was suppressed by postnatal undernutrition stress at CA2, and prenatal undernutrition suppresses the expression of PSD95 at DG in the presence of Astaxanthin and DHA.\u003c/p\u003e \u003cp\u003eThe proposed of mechanism of action of AsX and DHA supplementation on the upregulation of BDNF, NT-3, CREB and UCP2 gene expressions is shown in figure-8. The BDNF, NT-3 signalling pathway regulates intracellular signalling cascades like MAPK, PI3K, and PLC, triggering effects like neuronal differentiation, survival, and plasticity. CREB is a crucial molecule that initiates transcriptional activation of other genes encoding proteins, potentially playing a significant role in structural and functional changes in information storage. Adaptive bio-energetic stress response (ABSR) encompassing several signalling channels and organelles is triggered by mild uncoupling caused by activation of endogenous uncoupling proteins (UCPs). The ABSR includes the activation of kinases and transcription factors, including the cyclic AMP response element-binding protein (CREB), and induces the production of genes that code for proteins that improve stress resistance and neuroplasticity, including the immediate early gene products such as Fos and Arc; BDNF. Signalling pathway was drawn using Biorender.com\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eMaternal undernourishment appeared to have a discernible impact on offspring\u0026rsquo;s health. Offspring\u0026rsquo;s born to undernourished mothers exhibited cognitive dysfunction. Understanding the complex mechanisms underlying these effects is crucial for developing effective strategies to prevent and manage the consequences of perinatal undernutrition on future health. The study concludes that perinatal undernutrition has a far-reaching impact on learning and memory and the levels of genes responsible for cognitive function, such as BDNF, NT-3, CREB, and UCP-2 levels and their functions. While research in this area is ongoing, it is evident that perinatal undernutrition causes profound and lasting effects on cognitive development, as evidenced by the decline in the expression of Synapsin and PSD-95. However, the precise role of these markers and their impact on cognitive function within this context requires further investigation at the level of epigenetic modification. The potential benefits of Astaxanthin-DHA supplementation in ameliorating memory deficits and cognitive dysfunction in the adult life of offspring are noteworthy and warrant deeper investigation.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eAll the experiments were performed following the National Institute of Health Guide for the Care and Use of Laboratory Animals, revised in 2011, and associated guidelines and study protocol were approved by the Institutional Animal Ethics Committee, KS Hegde Medical Academy, Nitte (Deemed to be University), Mangalore.\u003c/p\u003e\n\u003ch3\u003eAnimals:\u003c/h3\u003e\n\u003cp\u003e30 Female and 10 Male Albino Wistar Rats of 2 months old weighing 150–200 gm were procured from our institutional animal house. Rats were housed in polypropylene cages, and paddy husk was used as bedding material. Animals were maintained under controlled temperature (23 ± 2°C) and humidity (50 ± 5%), 12:12 hour light and dark cycle with food and water available \u003cem\u003ead libitum\u003c/em\u003e. The schematic representation of the study design and timeline is shown in Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eExperimental Setup and Drug Treatment:\u003c/h2\u003e\n \u003cp\u003eFemale rats were kept for breeding with male rats in 3 (Females):1(Male) ratio. Once pregnancy was confirmed by vaginal smear test, males were separated from female rats and pregnant dams were divided into the following 10 groups.\u003c/p\u003e\n \u003cp\u003eGroup-I: (Control) Dams received standard feed and water ad libitum and Group-II (Drug Control) was comprised of dams treated perinatally with Astaxanthin (24mg/kg/day) + DHA (500 mg/kg/day). Group- III (Vehicle Control) Dams treated perinatally with olive oil at a dose of 1 ml/kg body weight. Group- IV (Vehicle Control-UN) perinatally undernourished dams treated with olive oil at a dose of 1 mL/kg body weight. Group-V (PreUN) and VI (PreUN-AD) comprised of prenatally undernourished dams and dams treated prenatally with Astaxanthin (24mg/kg/day) + DHA (500 mg/kg/day) respectively. Group-VII (PostUN) and VIII (PostUN-AD) postnatally undernourished dams and treated postnatally with Astaxanthin (24mg/kg/day) + DHA (500 mg/kg/day) respectively. Group-IX (PeriUN) and X (PeriUN-AD) was comprised of perinatally undernourished dams, and dams treated perinatally with Astaxanthin (24mg/kg/day) + DHA (500 mg/kg/day), respectively. Perinatal undernutrition was ensured by providing 70% of the actual food consumption during prenatal and postnatal period. Six male pups (n = 6) were selected from each group for the behavioural study. The dosage of intervention and undernourishment was according to our previously reported study \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eBody and Brain weight of offspring’s:\u003c/h2\u003e\n \u003cp\u003eThe body weight of the pups from all the experimental groups was measured on PND-0 from all and throughout the lactation and adolescent period i.e., from PD-1 to PD-56. At the end of the behavioural study, rats were sacrificed, and whole brain weight was measured.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eBehavioural Testing:\u003c/h2\u003e\n \u003cp\u003eAll the behavioural tests were performed during the light cycle of the animals. Training and testing were carried out in a sound-attenuated experimental room where the light intensity, temperature visuospatial cues remained the same throughout the experimental period.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eNovel Object Recognition:\u003c/h2\u003e\n \u003cp\u003eThe Novel Object Recognition test assessed the recognition memory. NOR task exploits natural preference of rodents to spend more time exploring novel object rather than familiar one. This experiment included three sessions; Habituation, Training and Test. During habituation (Day 1), animals were introduced into an empty Plexiglas arena (40 x 23 x 1 cm) and allowed to explore the arena for 5 minutes. After 24 hours of habituation training session was done. During training (Day 2), Animals were exposed to the two identical objects (Object A1 and A2) placed inside the box for 5 minutes. Training was followed by test on day 3. In this session one object (Object A1) from the training session was replaced by a novel object (Object B). And animals were allowed to explore the objects for 5 minutes. A camera was mounted above the arena to record all the sessions. The objects and arena were cleaned with 1% acetic acid between each trial to remove olfactory cues. Exploration was defined when an animal touched the object or pointed its head towards the object, with a distance of ≤ 2cm with its neck extended and vibrissae moving. Climbing on the object and turning around was not considered as exploration. Total time taken to explore each object during training and testing was noted manually. A Discrimination Index (DI) was calculated to measure relative time spent exploring novel object.\u003c/p\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAUIAAABECAYAAAD0gzw1AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAAjeSURBVHhe7Z1LbtRMF4bNvwyEooiwBkaEIWEJsIFIzThKJgwYMGkWQCRGjBKQsoCEIUEZZA00QiHKNvL7cfz2d1JxX+NOX+p9pJLr7lNl+7hO2S4/ui4pjDEmY/5Xb40xJlusCI0x2WNFaIzJHitCY0z2WBEaY7LHitAYkz1WhMaY7LEiNMZkjxWhMSZ7rAiNMdljRbhkfPv2rXj06NFQ9+vXrzr38vDs2bPGtsi9fv26zmlM+1gRLhkXFxdFt9st+EQct7GxUXQ6nX4Y/+XlZZ17eej1ev02HB4e3opj+/v37yrOmFlgRbiE7O7u1r677Ozs1L7lAuU+iKdPnxbb29t1yJj28eozSw4m5atXr4rPnz/XMcsP5v/bt2+rkSBK0JhZ4xGhmRrm7t69e1eH5gcy3GcekZvJnz9/qvL4BXWaPLAiNFOjubx5ogdDGDYnJyeVQpsU5h8ZeaajahtL+WBFaFpHI7RBrs0nwPHBEIrLprSZBivCDGCUhAJCQaGE8GskFZUWc3OfPn2q/DIRo7mofKPMYUZWKKVB7vj4uM55PzSXuL+/X8kY24JfrxppKxNYflCZlNjuQfWqL6cZhZoFozwxzRKzsbFx3el06tBgSjMWO+/69PT0utvtVg6/yvZ6vSqdLXlxigfykR/Yp/KNs+9Jkaza9zCaZKAcMgJpOs23trb68fhVv9JjuegXab2zaLuZDx4RZkR54RYvXryoQ0VxdnZWrK+vV35MylI5FFdXV8Xz58+Lr1+/VvFHR0fVllHP5uZmNQIqFUJxfn5exS8ajGhLZVWHbiiVZe0r+u0C2jouTfW+fPmy9pllx4pwSZF5hlLCNJzGRFtbWyv29vbq0M1DAxSl5tkwn8kDxJUjwr55++bNmyq+bTBHMXcBxYMpOi6ae6RP2mRW9ZoFohoXmpUGk45DjZOpiJNpHMNC5mlE+XDfv3/v+8k7DyQjDlMXhx/zVfFysZ3RrzJsVY706B9WL31rlh+/UG2MyR6bxsaY7LEiNMZkjxWhMSZ7rAiNMdljRWiMyR4rQmNM9lgRGmOyx4rQGJM9M1eEfDLF51+DXEqazqdkxhgzS2auCPl+VR+9860mH7Lg9N0myo4P2gVp/L+C70zxz+qbVmOMEXMzjfmIH0WHwuPD/2X8BaUxZjWY+xyhlkU6ODiotsYY89DMXRFqfbwfP35U23EYNe84ydJNxhgzd0UImMeTwLyj5hqb3Cr92tIYM3sWQhF6wUtjzDyZuyLUQxJ+Uj4uD2Ea6ydGsU79+Cc60E985HjlZ5LyaXvok0UsT3yMo9yilid/jKO+RS0f43Acp0Usr1XR5bRy9yrwIAuz0oEsv87IL/3dIgeD+JhGp3/58qUygY0xZtbMbUSo0QkKkPcMUwVpjDEPxcxHhBrxNcFDknTUh3KMoCT9UrUxZpb4nyXGmOxZiKfGxhgzT6wIjTHZY0VojMkeK0JjTPZYERpjsseK0BiTPVaExpjssSI0xmSPFaExJnusCEeQrrjR5FjVYxZQNwtQTMI0ZVYNrbIyq+NyX/jslNVdHhKdx3zjb+5iRTiCi4uL6mdSfImI4/voTqfTD+O/vLysc7cHJ+00INPu7m4dyhNWPacftPr5IjHs2/tZwvf69IkXN2nGinAMhimWnZ2d2jca7sq4ceCkHcUk9a0SjKaWdWTDIiOTrsg+Dau0VuBDYEU4glGjK+6w466Ow5qMbdJ2fcsA5u7+/n4dMk1wczw5OalDZhysCFsGk1ZO80BaexFQXvKnKwaPexcfVJ/iNUpUmP1oFW2tShxXIE7n0uKK28PmsqL8+LVftsRp/7i0bcxjKk0ygeqkLPExnXo3NzcrP6OqQf0V9x/DwBY3qq+b5FM9iovtU54of5o2jNjnaX7SOA7Ek44cse9xag9y6wZJvI6f2hOJbcSpv4C0tI3DzoWlpzTBzASUF+B1p9OpQ7ehO09PTyt/r9erwjEv4cPDwzp0U1e32638lIvlgbDSm4j1aX+Ki2Ec9aZ5YGtrq3IC/7gyIL9QnTjtQ+lqm+phG+uUDMonh7ySWfIqD/FNxP2TJ4ZxoDpiOyOD5APJo+OKP5VNDtL8kJ5D1B33R7r6jjTVF9tMusqk7VGbBflUhyBObQLk0T5ifsmhOqMMq4QV4YSkJ7FITyxITx78umgiyoeLFydhnexNpPXpolOcwrHOeAEBbUkv8tSl7RKD+kLtiZBPFxXbdB/Kr4s6XnCE1aam9BTtX3lSeZr6JTJMPpAMuLSOJvmkWETsN+WPSD61mf5v6mdQ23CSJW0vpDLE/CLKRX4dL2hq1yph07gl/v79W/v+48mTJ9X26uqq2qbI1Pr58+dcniSmIGd58nO13HLHx8d1jtt8/Pixmq+T6TSM9fX12nfz10Jcup9FYZR8PI0uFUblPzs7q7bDWFtbq313aXrjQE92eWNhEPc5d6IJHJEpnCNWhC0yaIL68ePHte8/OOGYyynvtAvzH2bk5KIa92LQKxm0AYbNhXGjUDrK9vz8vPIvIqPkQwkB7d7b2+uHB4FCo85hMOeXMkiBtnXuNCnxXF+vsSJsCb1GEyfhDw4OqpFDenJx4fz796/ya0RwH8VAfW3cyZGzNMPu/Fp10CS5FBsjJCnDiBQEsjFyfP/+fRXe3t6uLuQo8zQT8Uzoz4Jh8qGwGIWhgGh3aYZWeVNleHR0VPuKSlkyem6CmwlKUg+BgLqIG/U2wjjnTlMfcZw5L5FLCpi2ciOf5HWwlaK8o5sxiHMxcuXoqU69gXBMT+d1mOuJ8WxjXvnTfQ2aJ4z1pfv+8OHDrXBaJ2VUHldeeHWtd+fI0nYKzTul+bSvtE2RmKb0VMY0rH6I6SlpmfJivxVu2kcTTfKVyr4fxg8xD/IpTywfj1/sW/KIGD/oWHC8RKw/+pEzngvIkx4nkbZRxy+NT/tMbV8l/PMm0zqMaBgl5XhqMcJidFcqlWzNzGXEprExJnusCE2rMCfFaBB4qtnG3OWywEg4vvDd9ADELCY2jY0xmVMU/wfXntNbwivI4wAAAABJRU5ErkJggg==\"\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003cbr\u003e\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eRadial Arm Maze\u003c/h2\u003e\n \u003cp\u003eEvaluation of spatial learning and memory was done by radial arm maze test \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e,\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e. The Radial Arm Maze consisted of eight equally spaced arms (40×9×9) radiating from an octagonal centre. The maze was kept elevated 40 cm off the ground. A food cup was placed at the end of each arm, with Kellogg's chocos as baits. The partial baiting technique was used to test both the working and reference memory, which involved baiting only four arms. The animals were kept on a restricted diet, and their body weight was maintained at 85% of their free-feeding weight, with water available ad libitum, before the training.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eHabituation:\u003c/h2\u003e\n \u003cp\u003eHabituation was carried out for two consecutive days before acquisition to acclimatize the animals to the RAM. All eight arms were baited during habituation, and rats were allowed to explore the maze for 10 minutes. The maze was cleaned with 1% acetic acid between trials to remove olfactory cues.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003eAcquisition:\u003c/h2\u003e\n \u003cp\u003eDuring acquisition, the partial baiting technique was applied. Four arms (1,2,5 \u0026amp; 7) were baited with Kellogg's chocos (Kellogg's Planets and Stars™, Kellogg India, Mumbai, India) as food reinforcement. The rat was placed in the centre facing the same arm during each trial and allowed for a free choice. Two trials were given each day with an inter-time interval of one hour, and each trial was of five minutes or until the rat entered all four baited arms. When a rat ate a bait or reached the end of an arm, the arm choice was recorded. Only the first entry into the baited arm was considered the correct choice. The training was continued until the rats attained the criteria of 80% correct choice (at least four correct entries out of five). All the trials were recorded with the video camera mounted above the maze. Scoring was done manually by the experimenter.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eRetention:\u003c/h2\u003e\n \u003cp\u003eRetention was evaluated after a ten-day interval following acquisition. Two trials were given with an inter-trial interval of five minutes, and the average of the two trials was taken for the analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eEvaluation criteria:\u003c/h2\u003e\n \u003cp\u003eData from four trials were averaged and expressed as blocks. Data from the two daily trials were averaged and entered into further analysis. The data were analyzed for percentage correct choice, reference, and working memory errors. Percentage correct choice (%CC) was calculated as the number of correct entries in relation to total entries.\u003c/p\u003e\n \u003cp\u003eAn entry into an unbaited arm was considered a reference memory error (RME), and any re-entry was considered a working memory error (WME). A re-entry into a baited arm or an unbaited arm was regarded as working memory error correct (WME correct) or incorrect (WME incorrect), respectively.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003eTotal RNA extraction and Real-Time Quantitative RT-PCR :\u003c/h2\u003e\n \u003cp\u003eAnimals were sacrificed by decapitation at the end of the behavioral study. Brain tissues were collected and immediately stored at -80°C. Real-time PCR technique was used to investigate the effects of maternal undernutrition and Neutraceuticals (AsX and DHA) supplementation on the expression of synaptic plasticity markers. Total RNA was extracted from the hippocampus by the Trizol method. RNA concentration and purity were determined using a nano spectrophotometer. 200ng of total RNA was used as a template in a 20µl reaction. Real-time PCR reactions were performed on Applied Biosystems 7300/7500 fast real-time PCR system using One Step TB Green Prime Script RT-PCR Kit (TaKaRa) according to the manufacturer's protocol. The conditions used for PCR reactions were 42°C for 5min; 95°C for 2min. and 95°C for 15 sec; 60°C for 60 sec. for 40 cycles. All the reactions were performed in triplicates. Each set of triplicates was checked to ensure that all Ct values were within 1 Ct value of each other. The forward and reverse primer sequences used for the study were as follows: BDNF forward: 5’ CGTGGGGAGCTGAGCGTGTGT 3’; BDNF reverse: 5’ GCCCCTGCAGCCTTCCTTCGT 3’; UCP-2 forward: 5’ GAGAGTCAAG GGCTAGCGC 3’; UCP-2 reverse: 5’ GCTTCGACAGTGCTCTGGTA 3’; NT-3 forward: 5’\u003c/p\u003e\n \u003cp\u003eCACCCAGAGAACCAGAGCAG 3’; NT-3 reverse: 5’ CTCTCCTCGGTGACTCTTAT 3’ CREB forward: 5’ CCAAACTAGCAGTGGGCAGT 3’; CREB reverse: 5’ GAATGGTAGTA\u003c/p\u003e\n \u003cp\u003eCCCGGCTGA 3’; β-actin forward: 5'CGACGAGGCCCAGAGCAAGA 3'; reverse: 5'AGAGGGGCCTCGGTGAGCAG3'. B-actin was used as internal control and the mRNA expression levels of the target gene were normalized to B-actin. To determine the relative quantification ΔΔCt method was used and to determine the normalized relative gene expression 2\u003csup\u003e-ΔΔCt\u003c/sup\u003e (fold change) values were calculated.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e\n \u003cp\u003eAfter the retention test, animals were anesthetized (n = 3) and were perfused with 0.9% saline and 10% formalin. Whole brains were taken out and kept in 10% formalin, followed by perfusion. The whole brains were embedded in paraffin wax and cut into 5µm coronal sections using a microtome. The sections were deparaffinized and transferred to an xylene bath for clearing. The sections were incubated with graded alcohol (100%, 90%, 70%, 50% and 30%) for 5 min in each solution. Antigen retrieval was done using 10 mM citrate buffer (pH 6.0). Sections were incubated with 3% H2O2 at room temperature for 20 min. to inactivate endogenous peroxidase activity. The sections were washed in PBS (3×5 min.) and incubated with horse serum, followed by avidin and biotin (Vector laboratories, Cat#SP-2001) solutions to block nonspecific binding. Sections were incubated with primary antibody (Synapsin 1\u0026amp;PSD-95 -1:500) overnight at 4° C. After washing; sections were incubated with biotinylated secondary antibody (60 min.), ABC solution (45 min.) and DAB substrate (20 min.) at room temperature. Sections were washed in PBS and counterstained with hematoxylin. Slides were dehydrated, mounted, and observed using Nikon (Japan trinocular microscope, Ni-U,100-240V, MBA92010 upright microscope). The percentage of positive area was measured using Image J (version 1.53).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical Analysis:\u003c/h2\u003e\n \u003cp\u003eAll the data were expressed as mean ± SEM. All statistical tests were performed using Prism version 8 for Windows, GraphPad Software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.graphpad.com/\u003c/span\u003e\u003c/span\u003e). Data was analysed by one-way or two-way analysis of variance (ANOVA) followed by Tukey’s post hoc test to compare the means between experimental groups. Acquisition on RAM was analysed by repeated measures, a two-way analysis of variance with Tukey’s post hoc test between experimental groups. Correlation studies were performed by calculating Pearson’s correlation coefficient. We correlated Synapsin-1 and PSD95 expression to behavioural study parameters (% CC, RME, WME, and DI). Significance was accepted at P \u0026lt; 0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors acknowledge the support of institutional animal care facility, Nitte (Deemed to be University) and laboratory facilities at Nitte University Centre for Science Education and Research, and Mangalore University. This study was supported by grants from the Indian Council of Medical Research (No. 5/9/1220/2019-Nut.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.A.B. and P.S.H. carried out animal handling and treatment experiments, performed statistical analysis, preparation of figures, tables, and contributed to the drafting and editing of the manuscript. D.G.K.M., P.R., and M.S. provided scientific advice and contributed to designing the research work, conceptualizing the ideas, preparation of tables and figures, reviewing the analyzed data, drafting and editing of the manuscript. M.S. supervised behavioral experiments. D.G.K.M. supervised the research. All the authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe supplementary material is provided as supplementary Figures S1 and S2\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrespondence and requests for materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDr. Damodara Gowda K M\u003c/p\u003e\n\u003cp\u003eAssociate Professor, Dept. of Physiology,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eK S Hegde Medical Academy, Nitte (Deemed to be University),\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDeralakatte, Mangalore-575018-India.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEmail:
[email protected]\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBarbeito-Andr\u0026eacute;s, J., Gleiser, P. M., Bernal, V., Hallgr\u0026iacute;msson, B. \u0026amp; Gonzalez, P. N. Brain Structural Networks in Mouse Exposed to Chronic Maternal Undernutrition. \u003cem\u003eNeuroscience\u003c/em\u003e \u003cstrong\u003e380\u003c/strong\u003e, 14\u0026ndash;26 (2018).\u003c/li\u003e\n \u003cli\u003eLesage, J. \u003cem\u003eet al.\u003c/em\u003e Perinatal maternal undernutrition programs the offspring hypothalamo-pituitary-adrenal (HPA) axis. \u003cem\u003eStress\u003c/em\u003e vol. 9 183\u0026ndash;198 (2006).\u003c/li\u003e\n \u003cli\u003eLapiz, M. D. S. \u003cem\u003eet al.\u003c/em\u003e Influence of postweaning social isolation in the rat on brain development, conditioned behavior, and neurotransmission. \u003cem\u003eNeurosci. Behav. Physiol.\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 13\u0026ndash;29 (2003).\u003c/li\u003e\n \u003cli\u003eDamodara Gowda, K. M., Suchetha Kumari, N. \u0026amp; Ullal, H. Role of astaxanthin in the modulation of brain-derived neurotrophic factor and spatial learning behavior in perinatally undernourished Wistar rats. \u003cem\u003eNutr. Neurosci.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 422\u0026ndash;431 (2020).\u003c/li\u003e\n \u003cli\u003eMorgane, P. J., Mokler, D. J. \u0026amp; Galler, J. R. Effects of prenatal protein malnutrition on the hippocampal formation. \u003cem\u003eNeurosci. Biobehav. Rev.\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 471\u0026ndash;483 (2002).\u003c/li\u003e\n \u003cli\u003eNo Title. https://www.who.int/news-room/fact-sheets/detail/malnutrition.\u003c/li\u003e\n \u003cli\u003eAmbati, R. R., Moi, P. S., Ravi, S. \u0026amp; Aswathanarayana, R. G. Astaxanthin: Sources, extraction, stability, biological activities and its commercial applications - A review. \u003cem\u003eMar. Drugs\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 128\u0026ndash;152 (2014).\u003c/li\u003e\n \u003cli\u003eNaguib, Y. M. A. Antioxidant activities of astaxanthin and related carotenoids. \u003cem\u003eJ. Agric. Food Chem.\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 1150\u0026ndash;1154 (2000).\u003c/li\u003e\n \u003cli\u003eLiu, X. \u0026amp; Osawa, T. Cis astaxanthin and especially 9-cis astaxanthin exhibits a higher antioxidant activity in vitro compared to the all-trans isomer. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cstrong\u003e357\u003c/strong\u003e, 187\u0026ndash;193 (2007).\u003c/li\u003e\n \u003cli\u003eYing, C. jiang \u003cem\u003eet al.\u003c/em\u003e Anti-inflammatory Effect of Astaxanthin on the Sickness Behavior Induced by Diabetes Mellitus. \u003cem\u003eCell. Mol. Neurobiol.\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 1027\u0026ndash;1037 (2015).\u003c/li\u003e\n \u003cli\u003eHussein, G. \u003cem\u003eet al.\u003c/em\u003e Antihypertensive and neuroprotective effects of astaxanthin in experimental animals. \u003cem\u003eBiol. Pharm. Bull.\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 47\u0026ndash;52 (2005).\u003c/li\u003e\n \u003cli\u003eLu, Y. \u003cem\u003eet al.\u003c/em\u003e Astaxanthin rescues neuron loss and attenuates oxidative stress induced by amygdala kindling in adult rat hippocampus. \u003cem\u003eNeurosci. Lett.\u003c/em\u003e \u003cstrong\u003e597\u003c/strong\u003e, 49\u0026ndash;53 (2015).\u003c/li\u003e\n \u003cli\u003eGreen, P., Glozman, S., Kamensky, B. \u0026amp; Yavin, E. Developmental changes in rat brain membrane lipids and fatty acids: The preferential prenatal accumulation of docosahexaenoic acid. \u003cem\u003eJ. Lipid Res.\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 960\u0026ndash;966 (1999).\u003c/li\u003e\n \u003cli\u003eIkemoto, A. \u003cem\u003eet al.\u003c/em\u003e Effects of docosahexaenoic and arachidonic acids on the synthesis and distribution of aminophospholipids during neuronal differentiation of PC12 cells. \u003cem\u003eArch. Biochem. Biophys.\u003c/em\u003e \u003cstrong\u003e364\u003c/strong\u003e, 67\u0026ndash;74 (1999).\u003c/li\u003e\n \u003cli\u003eCalderon, F. \u0026amp; Kim, H. Y. Docosahexaenoic acid promotes neurite growth in hippocampal neurons. \u003cem\u003eJ. Neurochem.\u003c/em\u003e \u003cstrong\u003e90\u003c/strong\u003e, 979\u0026ndash;988 (2004).\u003c/li\u003e\n \u003cli\u003eKim, H. Y., Akbar, M., Lau, A. \u0026amp; Edsall, L. Inhibition of neuronal apoptosis by docosahexaenoic acid (22:6n-3): Role of phosphatidylserine in antiapoptotic effect. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e275\u003c/strong\u003e, 35215\u0026ndash;35223 (2000).\u003c/li\u003e\n \u003cli\u003eCarver, J. D., Benford, V. J., Han, B. \u0026amp; Cantor, A. B. The relationship between age and the fatty acid composition of cerebral cortex and erythrocytes in human subjects. \u003cem\u003eBrain Res. Bull.\u003c/em\u003e \u003cstrong\u003e56\u003c/strong\u003e, 79\u0026ndash;85 (2001).\u003c/li\u003e\n \u003cli\u003eDesai, A., Kevala, K. \u0026amp; Kim, H. Y. Depletion of brain docosahexaenoic acid impairs recovery from traumatic brain injury. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, (2014).\u003c/li\u003e\n \u003cli\u003eMills, J. D., Hadley, K. \u0026amp; Bailes, J. E. Dietary supplementation with the Omega-3 fatty acid docosahexaenoic acid in traumatic brain injury. \u003cem\u003eNeurosurgery\u003c/em\u003e \u003cstrong\u003e68\u003c/strong\u003e, 474\u0026ndash;481 (2011).\u003c/li\u003e\n \u003cli\u003eJarrard, L. E. On the role of the hippocampus in learning and memory in the rat. \u003cem\u003eBehav. Neural Biol.\u003c/em\u003e \u003cstrong\u003e60\u003c/strong\u003e, 9\u0026ndash;26 (1993).\u003c/li\u003e\n \u003cli\u003eIii, S. Neurotrophins and CNS.\u003c/li\u003e\n \u003cli\u003eLu, B., Pang, P. T. \u0026amp; Woo, N. H. The yin and yang of neurotrophin action. \u003cem\u003eNat. Rev. Neurosci.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 603\u0026ndash;614 (2005).\u003c/li\u003e\n \u003cli\u003eLohof 1993.\u003c/li\u003e\n \u003cli\u003eKang, H. \u0026amp; Schuman, E. M. Long-Lasting Neurotrophin-Induced Enhancement of Synaptic Transmission in the Adult Hippocampus Author ( s ): Hyejin Kang and Erin M . Schuman Published by : American Association for the Advancement of Science Stable URL : http://www.jstor.org/stable/2886. \u003cem\u003eScience (80-. ).\u003c/em\u003e \u003cstrong\u003e267\u003c/strong\u003e, 1658\u0026ndash;1662 (2016).\u003c/li\u003e\n \u003cli\u003eRamos-Languren, L. E. \u0026amp; Escobar, M. L. Plasticity and metaplasticity of adult rat hippocampal mossy fibers induced by neurotrophin-3. \u003cem\u003eEur. J. Neurosci.\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 1248\u0026ndash;1259 (2013).\u003c/li\u003e\n \u003cli\u003eBartsch, D. \u003cem\u003eet al.\u003c/em\u003e Aplysia CREB2 represses long-term facilitation: Relief of repression converts transient facilitation into long-term functional and structural change. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e83\u003c/strong\u003e, 979\u0026ndash;992 (1995).\u003c/li\u003e\n \u003cli\u003eWest, A. E., Griffith, E. C. \u0026amp; Greenberg, M. E. Regulation of transcription factors by neuronal activity. \u003cem\u003eNat. Rev. Neurosci.\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 921\u0026ndash;931 (2002).\u003c/li\u003e\n \u003cli\u003eDeisseroth, K., Mermelstein, P. G., Xia, H. \u0026amp; Tsien, R. W. Signaling from synapse to nucleus: The logic behind the mechanisms. \u003cem\u003eCurr. Opin. Neurobiol.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 354\u0026ndash;365 (2003).\u003c/li\u003e\n \u003cli\u003eBechmann, I. \u003cem\u003eet al.\u003c/em\u003e Brain mitochondrial uncoupling protein 2 (UCP2): A protective stress signal in neuronal injury. \u003cem\u003eBiochem. Pharmacol.\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 363\u0026ndash;367 (2002).\u003c/li\u003e\n \u003cli\u003eSimon-Areces, J. \u003cem\u003eet al.\u003c/em\u003e Ucp2 induced by natural birth regulates neuronal differentiation of the hippocampus and related adult behavior. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 2\u0026ndash;9 (2012).\u003c/li\u003e\n \u003cli\u003eAntunes, M. \u0026amp; Biala, G. The novel object recognition memory: Neurobiology, test procedure, and its modifications. \u003cem\u003eCogn. Process.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 93\u0026ndash;110 (2012).\u003c/li\u003e\n \u003cli\u003eValadares, C. T., Fukuda, M. T. H., Fran\u0026ccedil;olin-Silva, A. L., Hernandes, A. S. \u0026amp; Almeida, S. S. Effects of postnatal protein malnutrition on learning and memory procedures. \u003cem\u003eNutr. Neurosci.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 274\u0026ndash;282 (2010).\u003c/li\u003e\n \u003cli\u003eP\u0026eacute;rez-Garci\u0026aacute;, G., Guzm\u0026aacute;n-Quevedo, O., Da Silva Araga\u0026otilde;, R. \u0026amp; Bolan\u0026otilde;s-Jim\u0026eacute;nez, F. Early malnutrition results in long-lasting impairments in pattern-separation for overlapping novel object and novel location memories and reduced hippocampal neurogenesis. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 1\u0026ndash;12 (2016).\u003c/li\u003e\n \u003cli\u003eBerardino, B. G., Ballarini, F., Chertoff, M., Igaz, L. M. \u0026amp; C\u0026aacute;nepa, E. T. Nutritional stress timing differentially programs cognitive abilities in young adult male mice. \u003cem\u003eNutr. Neurosci.\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 286\u0026ndash;298 (2022).\u003c/li\u003e\n \u003cli\u003eTau, G. Z. \u0026amp; Peterson, B. S. Normal development of brain circuits. \u003cem\u003eNeuropsychopharmacology\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 147\u0026ndash;168 (2010).\u003c/li\u003e\n \u003cli\u003eMonk, C., Georgieff, M. K. \u0026amp; Osterholm, E. A. Research Review: Maternal prenatal distress and poor nutrition - Mutually influencing risk factors affecting infant neurocognitive development. \u003cem\u003eJ. Child Psychol. Psychiatry Allied Discip.\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 115\u0026ndash;130 (2013).\u003c/li\u003e\n \u003cli\u003eLupien, S. J., McEwen, B. S., Gunnar, M. R. \u0026amp; Heim, C. Effects of stress throughout the lifespan on the brain, behaviour and cognition. \u003cem\u003eNat. Rev. Neurosci.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 434\u0026ndash;445 (2009).\u003c/li\u003e\n \u003cli\u003eRanade, A. V. \u003cem\u003eet al.\u003c/em\u003e Astaxanthin and DHA supplementation ameliorates the proteomic profile of perinatal undernutrition-induced adipose tissue dysfunction in adult life. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 12312 (2023).\u003c/li\u003e\n \u003cli\u003eChadio, S. \u0026amp; Kotsampasi, B. Handbook of Famine, Starvation, and Nutrient Deprivation. \u003cem\u003eHandb. Famine, Starvation, Nutr. Deprivation\u003c/em\u003e (2017) doi:10.1007/978-3-319-40007-5.\u003c/li\u003e\n \u003cli\u003eRajamoorthi, A., LeDuc, C. A. \u0026amp; Thaker, V. V. The metabolic conditioning of obesity: A review of the pathogenesis of obesity and the epigenetic pathways that \u0026ldquo;program\u0026rdquo; obesity from conception. \u003cem\u003eFront. Endocrinol. (Lausanne).\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1\u0026ndash;23 (2022).\u003c/li\u003e\n \u003cli\u003eCho, W. K. \u0026amp; Suh, B. K. Catch-up growth and catch-up fat in children born small for gestational age. \u003cem\u003eKorean J. Pediatr.\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 1\u0026ndash;7 (2016).\u003c/li\u003e\n \u003cli\u003eBarker, G. R. I. \u0026amp; Warburton, E. C. When is the hippocampus involved in recognition memory? \u003cem\u003eJ. Neurosci.\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 10721\u0026ndash;10731 (2011).\u003c/li\u003e\n \u003cli\u003eGeorgieff, M. K., Ramel, S. E. \u0026amp; Cusick, S. E. Nutritional influences on brain development. \u003cem\u003eActa Paediatr. Int. J. Paediatr.\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e, 1310\u0026ndash;1321 (2018).\u003c/li\u003e\n \u003cli\u003ePandey, A. K. Disruption of Neurosynaptic Physiology and Neuron Network Dysfunction in Brain Disorders: an Environmental and Occupational Health Perspective. \u003cem\u003eAct. Nerv. Super. (Praha).\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 61\u0026ndash;77 (2017).\u003c/li\u003e\n \u003cli\u003eMelgar-Locatelli, S. \u003cem\u003eet al.\u003c/em\u003e Nutrition and adult neurogenesis in the hippocampus: Does what you eat help you remember? \u003cem\u003eFront. Neurosci.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 1\u0026ndash;9 (2023).\u003c/li\u003e\n \u003cli\u003eWattez, J. S. \u003cem\u003eet al.\u003c/em\u003e Short-and long-term effects of maternal perinatal undernutrition are lowered by cross-fostering during lactation in the male rat. \u003cem\u003eJ. Dev. Orig. Health Dis.\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 109\u0026ndash;120 (2014).\u003c/li\u003e\n \u003cli\u003eBathina, S. \u0026amp; Das, U. N. Brain-derived neurotrophic factor and its clinical Implications. \u003cem\u003eArch. Med. Sci.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1164\u0026ndash;1178 (2015).\u003c/li\u003e\n \u003cli\u003eGeorgieff, M. K., Brunette, K. E. \u0026amp; Tran, P. V. Early life nutrition and neural plasticity. \u003cem\u003eDev. Psychopathol.\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 411\u0026ndash;423 (2015).\u003c/li\u003e\n \u003cli\u003ePrado, E. L. \u0026amp; Dewey, K. G. Nutrition and brain development in early life. \u003cem\u003eNutr. Rev.\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e, 267\u0026ndash;284 (2014).\u003c/li\u003e\n \u003cli\u003eYan, Z. \u003cem\u003eet al.\u003c/em\u003e Neurotrophin-3 Promotes the Neuronal Differentiation of BMSCs and Improves Cognitive Function in a Rat Model of Alzheimer\u0026rsquo;s Disease. \u003cem\u003eFront. Cell. Neurosci.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1\u0026ndash;10 (2021).\u003c/li\u003e\n \u003cli\u003eLikhar, A. \u0026amp; Patil, M. S. Importance of Maternal Nutrition in the First 1,000 Days of Life and Its Effects on Child Development: A Narrative Review. \u003cem\u003eCureus\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 8\u0026ndash;13 (2022).\u003c/li\u003e\n \u003cli\u003ePolverino, A., Sorrentino, P., Pesoli, M. \u0026amp; Mandolesi, L. Nutrition and cognition across the lifetime: an overview on epigenetic mechanisms. \u003cem\u003eAIMS Neurosci.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 448\u0026ndash;476 (2021).\u003c/li\u003e\n \u003cli\u003eWang, H., Xu, J., Lazarovici, P., Quirion, R. \u0026amp; Zheng, W. cAMP Response Element-Binding Protein (CREB): A Possible Signaling Molecule Link in the Pathophysiology of Schizophrenia. \u003cem\u003eFront. Mol. Neurosci.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1\u0026ndash;14 (2018).\u003c/li\u003e\n \u003cli\u003eKadosh, K. C. \u003cem\u003eet al.\u003c/em\u003e Nutritional support of neurodevelopment and cognitive function in infants and young children\u0026mdash;an update and novel insights. \u003cem\u003eNutrients\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1\u0026ndash;26 (2021).\u003c/li\u003e\n \u003cli\u003eKandel, E. R. molbio of Memory-PKA CREB. \u003cem\u003eMol. Brain\u003c/em\u003e 1\u0026ndash;12 (2012).\u003c/li\u003e\n \u003cli\u003eSakamoto, K., Karelina, K. \u0026amp; Obrietan, K. CREB: A multifaceted regulator of neuronal plasticity and protection. \u003cem\u003eJ. Neurochem.\u003c/em\u003e \u003cstrong\u003e116\u003c/strong\u003e, 1\u0026ndash;9 (2011).\u003c/li\u003e\n \u003cli\u003eSreedhar, A. \u0026amp; Zhao, Y. Uncoupling protein 2 and metabolic diseases. \u003cem\u003eMitochondrion\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 135\u0026ndash;140 (2017).\u003c/li\u003e\n \u003cli\u003ePierelli, G. \u003cem\u003eet al.\u003c/em\u003e Uncoupling protein 2: A key player and a potential therapeutic target in vascular diseases. \u003cem\u003eOxid. Med. Cell. Longev.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, (2017).\u003c/li\u003e\n \u003cli\u003eLiu, Z. \u003cem\u003eet al.\u003c/em\u003e Role of ROS and nutritional antioxidants in human diseases. \u003cem\u003eFront. Physiol.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 1\u0026ndash;14 (2018).\u003c/li\u003e\n \u003cli\u003eMehta, S. L. \u0026amp; Li, P. A. Neuroprotective role of mitochondrial uncoupling protein 2 in cerebral stroke. \u003cem\u003eJ. Cereb. Blood Flow Metab.\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 1069\u0026ndash;1078 (2009).\u003c/li\u003e\n \u003cli\u003eMattson, M. P., Gleichmann, M. \u0026amp; Cheng, A. Mitochondria in Neuroplasticity and Neurological Disorders. \u003cem\u003eNeuron\u003c/em\u003e \u003cstrong\u003e60\u003c/strong\u003e, 748\u0026ndash;766 (2008).\u003c/li\u003e\n \u003cli\u003eHilfiker, S. \u003cem\u003eet al.\u003c/em\u003e Synapsins as regulators of neurotransmitter release. \u003cem\u003ePhilos. Trans. R. Soc. B Biol. Sci.\u003c/em\u003e \u003cstrong\u003e354\u003c/strong\u003e, 269\u0026ndash;279 (1999).\u003c/li\u003e\n \u003cli\u003eEvstratova, A. \u0026amp; T\u0026oacute;th, K. Information processing and synaptic plasticity at hippocampal mossy fiber terminals. \u003cem\u003eFront. Cell. Neurosci.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 7\u0026ndash;12 (2014).\u003c/li\u003e\n \u003cli\u003eMirza, F. J. \u0026amp; Zahid, S. The Role of Synapsins in Neurological Disorders. \u003cem\u003eNeurosci. Bull.\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 349\u0026ndash;358 (2018).\u003c/li\u003e\n \u003cli\u003eMardones, M. D. \u003cem\u003eet al.\u003c/em\u003e PSD95 regulates morphological development of adult-born granule neurons in the mouse hippocampus. \u003cem\u003eJ. Chem. Neuroanat.\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 117\u0026ndash;123 (2019).\u003c/li\u003e\n \u003cli\u003eAgni, M. B., Hegde, P. S. \u0026amp; Ullal, H. Nutritional efficacy of Astaxanthin in modulating orexin peptides and fatty acid level during adult life of rats exposed to perinatal undernutrition stress. \u003cem\u003eNutr. Neurosci.\u003c/em\u003e 1\u0026ndash;13 (2022) doi:10.1080/1028415X.2022.2123184.\u003c/li\u003e\n \u003cli\u003eBhagya, V., Srikumar, B. N., Raju, T. R. \u0026amp; Shankaranarayana Rao, B. S. Chronic escitalopram treatment restores spatial learning, monoamine levels, and hippocampal long-term potentiation in an animal model of depression. \u003cem\u003ePsychopharmacology (Berl).\u003c/em\u003e \u003cstrong\u003e214\u003c/strong\u003e, 477\u0026ndash;494 (2011).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003eTable 1 is available in the Supplementary Files section\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3322166/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3322166/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMaternal nutrition has been recognized as a significant component of brain growth and maturation in most mammalian species. Here, we showed that the downregulation of BDNF, NT-3, CREB, and UCP2 gene expressions in perinatally undernourished animals in their adult life was mitigated by Astaxanthin and DHA. We also found that maternal undernutrition reduced the pups’ weight at birth considerably and remained decreased throughout the study. Maternal AsX and DHA supplementation ameliorated the undernutrition-induced learning impairment in NOR test and partially baited radial arm maze tasks. Furthermore, the expressions of Synapsin-1 and PSD-95 decreased in perinatally undernourished groups compared to control, and AsX-DHA treated groups at CA1, CA2, CA3, and DG, respectively. Our results identified a signalling pathway that mediates perinatal undernutrition stress-induced cognitive decline via intracellular signalling cascades like MAPK, PI3K, and PLC, triggering neuronal differentiation, survival, and plasticity, indicating the critical time for the reversal of undernutrition-induced cognitive impairment.\u003c/p\u003e","manuscriptTitle":"A Mechanistic Approach to Elucidate the Molecular Basis of Amelioration of Perinatal Undernutrition Induced Cognitive Impairment Using Astaxanthin and DHA in the Adult Life of Albino Wistar Rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-25 11:19:27","doi":"10.21203/rs.3.rs-3322166/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6a3c1575-a3d4-4152-9997-7e36d54a8113","owner":[],"postedDate":"September 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":24533776,"name":"Biological sciences/Neuroscience/Synaptic plasticity"},{"id":24533777,"name":"Biological sciences/Physiology"}],"tags":[],"updatedAt":"2024-09-25T11:19:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-25 11:19:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3322166","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3322166","identity":"rs-3322166","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.