FAM111B may promote the progression of lung squamous cell carcinoma through PI3K signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article FAM111B may promote the progression of lung squamous cell carcinoma through PI3K signaling pathway Yajuan Chen, Shiwei Chai, Huimin Wang, Yunyi Chen, Yanting Bi, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8974853/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 14 You are reading this latest preprint version Abstract Lung squamous cell carcinoma (LUSC) is a subtype of non-small cell lung cancer (NSCLC). Compared to lung adenocarcinoma (LUAD), LUSC is characterized by a greater propensity for recurrence and metastasis, poorer prognosis, shorter survival. Therefore, further research into the pathogenesis of LUSC and the identification of new therapeutic targets are essential to advance clinical treatment options for this aggressive cancer. FAM111B, a serine protease and cancer-associated nuclear protein, has been implicated in various cancers. Previous studies have shown that FAM111B is closely associated with the progression of LUAD. However, our pan-cancer analysis suggests that FAM111B may play an even more significant role in LUSC, which revealed that FAM111B is highly expressed in LUSC tissues and exhibits significant clinical correlations with patient gender, histological type, tumor size, and stage. To investigate the functional role of FAM111B in LUSC, we developed both in vitro and in vivo knockdown models. Our results demonstrate that knocking down FAM111B significantly inhibits the proliferation, migration, and invasion of LUSC cells. Additionally, FAM111B knockdown induces cell cycle arrest in the S phase, further underscoring its role in LUSC progression. Mechanistically, FAM111B promotes LUSC migration and invasion by facilitating epithelial-mesenchymal transition (EMT). Moreover, the proliferation and cell cycle processes in LUSC are regulated through the PI3K signaling pathway. In conclusion, our study elucidates the clinical relevance and molecular mechanisms of FAM111B in LUSC, highlighting its potential as a novel therapeutic target for this challenging cancer subtype. Biological sciences/Cancer Biological sciences/Cell biology Health sciences/Oncology Lung squamous cell carcinoma FAM111B PI3K Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction According to Globocan 2024, lung cancer remains the deadliest cancer in the world 1 . Lung cancer can be roughly divided into small cell lung cancer (SCLC) and non-SCLC (NSCLC) according to histology, accounting for about 85% and 15% of the total number of lung cancer, respectively 2 . NSCLC can be divided into lung squamous cell carcinoma (LUSC), lung adenocarcinoma (LUAD), and large cell carcinoma (LCC), and LUSC accounts for about 30% of NSCLC patients 3 , 4 . Compared with LUAD, LUSC has a high incidence, strong drug resistance, easy recurrence and metastasis, poor prognosis, short survival, and a lack of early diagnosis and treatment strategies 5 , 6 . Chemotherapy still plays an irreplaceable role in the treatment of LUSC, but its specificity is poor. In addition to chemotherapy, immunotherapy and targeted therapies for lung cancer can benefit cancer patients. EGFR-TKI is still the main target therapy for advanced LUSC in the world, such as erlotinib and afatinib 7 . However, the common gene mutations in LUAD, such as EGFR and KRAS, are rarely mutated in LUSC, so LUSC patients find it difficult to benefit from EGFR inhibitors 8 . The frequency of total gene mutations in patients with LUSC is high and complex, and targeted therapies for LUSC are still being explored. Many new drugs in patients with LUSC are still in the clinical trial stage, including FGFR inhibitors 9 , 10 , PI3 inhibitors 11 , 12 , CDK4/6 inhibitors 13 , 14 , etc. Several kinds of PI3K inhibitors have passed the examination and approval of the United States Food and Drug Administration, and have stronger antitumor activity, but as a result, large adverse reactions greatly limit their clinical application. Because of the refractory nature of LUSC, it is very important to further study the pathogenesis of LUSC and discover new diagnostic molecular markers and therapeutic targets, which can promote the progress of early diagnosis and treatment of LUSC. The family with the sequence similarity 111 (FAM111) is composed of two members, A-B. FAM111B and FAM111A are adjacent on chromosome 11, and the serine protease FAM111B is a cancer-associated nuclear protein. In the past decade, studies have found that FAM111B mutations often lead to an inherited disease, which is usually characterized by abnormal skin pigmentation, tendon contracture, and pulmonary fibrosis 15 . Recent studies have found that FAM111B is also closely related to the occurrence and development of various cancers 16 – 18 . The decreased expression of FAM111B can reduce the proliferation ability of cervical cancer cells and cause cycle arrest in the G1/S phase 19 , 20 . The down-regulated expression of FAM111B can significantly slow down the proliferation of breast cancer cells and enhance the ability of breast cancer cells to undergo apoptosis 21 . Studies have found that downregulation of FAM111B expression can inhibit the proliferation and invasion of LUAD, and promote the G2/M cell cycle arrest of LUAD 22 , but the specific mechanism is still unclear. In summary, the existing findings of FAM111B did not elaborate on the relationship between FAM111B and LUSC, nor were more in-depth studies conducted. In this study, reverse transcriptome sequencing of various tumor tissues revealed that the expression of the FAM111B gene was significantly higher in lung cancer compared to other tumor types. To further investigate this finding, we collected tumor tissue and serum samples from patients with NSCLC for preliminary experiments. Our analysis demonstrated that levels of FAM111B-cfDNA in the serum of these patients were markedly elevated compared to those in normal serum samples. Immunohistochemical analysis further confirmed that FAM111B protein expression was significantly higher in LUSC than in LUAD. To address whether FAM111B plays a more significant role in the progression of LUSC compared to LUAD, we conducted a series of in vitro and in vivo experiments to explore the relationship between FAM111B and LUSC. Our goal was to elucidate the molecular mechanisms by which FAM111B contributes to the carcinogenesis of LUSC, with the aim of providing a theoretical foundation for the development of targeted therapies for this aggressive cancer subtype. 2. Materials and methods 2.1 Bioinformatics analysis of FAM111B in LUSC To investigate FAM111B expression in lung squamous cell carcinoma (LUSC), we utilized the UALCAN platform ( https://ualcan.path.uab.edu/ ), which integrates data from The Cancer Genome Atlas (TCGA), and the GEPIA2 online database to perform a comprehensive data analysis. In addition, the Kaplan-Meier Plotter ( https://kmplot.com/analysis/index.php? p=background) to analyze the prognostic relationship between FAM111B and LUSC. The study were approved by the Ethical Committee of Kunming Medical University. All animal experiments in the present study were conducted in accordance with the ARRIVE guidelines (PLoS Bio 8(6), e1000412,2010). The studies involving humans were conducted in ethical norms and standards in the Declaration of Helsinki. All patients gave their informed consent. 2.2 Immunohistochemical and quantitative analysis All tissues were from Yunnan Cancer Hospital (Kunming, China) from October 2020 to October 2021. Postoperative tissues from patients with confirmed non-small cell lung cancer and complete clinicopathological data were included in the study. A total of 146 NSCLC (74 LUSC, 72 LUAD; 44 female patients and 102 male patient; median age, 56.5 years; age range, 24–83 years) were screened. Surgically removed specimens were fixed in 10% formalin and paraffin-embedded. Then, the wax blocks were sectioned at 5 µm with a tissue slicer and placed in a constant temperature oven at 70 ° C for 2-3h, then placed in a constant temperature oven at 58 ° C overnight, hydrated using an ethanol gradient, and incubated in 3% H 2 O 2 at room temperature for 10 min to remove endogenous peroxidase activity. After a wash with PBS, the antigen was fixed with acid buffer (pH 6.0) and sealed for 20 min at room temperature with 5% normal goat serum to block nonspecific binding. A FAM111B goat anti-human polyclonal antibody (Novus,1:300 dilution) was added and incubated at 4℃ overnight. Following a wash with PBS, the biotinylated secondary antibody (polyclonal biotin-conjugated donkey anti-goat IgG; Abcam, UK; 1:200 dilution) was added and incubated at room temperature for 30 min. After washing with PBS, DAB was used for coloring, and the samples were stained with hematoxylin, dehydrated, cleared, and mounted with neutral gum. Specimens known to be positive for FAM111B expression were used as positive controls, and PBS was used as the negative control. Samples were processed by two experienced pathologists using the double-blind method. The immunohistochemical staining results from each group and each view were analyzed. Immune response score (IRS) = SI (stain intensity, stain intensity) * PP(percentage of positive cells, percentage of positive cells) 23 . The staining intensity was scored according to the following scale: 0: negative; 1: Weak positive; 2: Moderate positive; 3: Strong positive. Positive cells were counted under the same lens using the following scale: no positive cells were 0 points, and 1 was the negative control. Samples were processed by two experienced pathol. Counts were performed 3 times by 2 pathologists, and the mean value was taken. 2.3 Cell lines and cell culture All cells were obtained from the Yunnan Cancer Hospital and grown at 37℃ under a humidified 95%-5% (v/v) mixture of air and CO 2 . The human LUAD cell lines(NCI-H1299), LUSC cell lines (NCI-H520, NCI-H226, SK-MES-1), and the human bronchial epithelial cell line Beas-2B were maintained in RPMI medium 1640 supplemented with 10% fetal bovine serum (FBS) plus 50 units/ml penicillin and streptomycin. 2.4 Real-Time Quantitative PCR (qPCR) Cells were plated in triplicate into a 6-well plate incubated at 37℃ under a humidified 95%-5% (v/v) mixture of air and CO2. The cells in the logarithmic growth phase were collected and washed with PBS. Lung cancer tissue samples with clinical medical record information were collected from Yunnan Cancer Hospital for RNA extraction. TRIzol reagent (Invitrogen, Lot.252610) was used to extract total RNA from cell lines. The miRcute miRNA Isolation Kit (TIANGEN, Cat. #DP501) was used to extract the total RNA of tissue samples. The cDNA of cells and tissues was synthesized by RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Lot.00791016), and performed according to the protocol. PowerUp SYBR Green Master Mix was used for qRT-PCR in ABI7500 Real-Time PCR System as following reactions: 50°C for 2 min and 95°C for 10 min, and then 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec. The relative gene expression was calculated using the 2 −ΔΔCt quantification method, and the housekeeping gene β-actin was used as a control. The primers used are shown in Table 1 . Table 1 Primer sequences (5′→3′) of PCR Gene Forward Reverse FAM111B GCATATGGTAAACCCAGCGAG GAATCACTAGGCAGGCACTTG β-actin CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT 2.5 Western blot analysis The total protein of the cell was extracted using Radio Immunoprecipitation Assay (Beyotime Biotechnology) and BCA Protein Assay Kit (Beyotime Biotechnology) to quantify. The 10% SDS-PAGE was performed with a separate equal amount of protein (20 µg) and then transferred to a 0.45 µm polyvinylidene fluoride (PVDF) membrane (EMD Millipore) via a trans-blotting system (Bio-Rad Laboratories, Inc.). The PVDF membrane was blocked in 5% TBST-configured skimmed milk (Bio-Rad Laboratories, Inc.) powder at room temperature for 2 hours, incubated overnight at 4°C with rabbit polyclonal antibodies against FAM111B (Novus Biologicals; cat. NBP1-86645), PI3K p85 (Affinity; cat. AF6241), P27 Kip1 (Cell Signaling Technology; cat. No. 3686), p21 Waf1/Cip1 (Cell Signaling Technology; cat. No. 37543), Phospho-PI3 Kinese p85 (Cell Signaling Technology; cat. No. 4228), Cyclin D1 (Cell Signaling Technology; cat. No. 2978), Cyclin D2 (Cell Signaling Technology; cat. No. 3741), CDK2 (Cell Signaling Technology; cat. No. 2546), CDK4 (Cell Signaling Technology; cat. No. 12790), Cyclin A2 (Cell Signaling Technology; cat. No. 67955), MDM2 (Cell Signaling Technology; cat. No. 86934), p53(Cell Signaling Technology; cat. 9282T), β-actin (Proteintech; cat. 20536-1-AP), E -cadherin (Proteintech; cat. 20874-1-AP), N-cadherin (Proteintech; cat. 22018-1-AP), GSK-3β (Proteintech; cat. 22104-1-AP), Phospho-GSK-3β (Proteintech; cat. 67558-1-Ig), C-myc (Proteintech; cat. 10828-1-AP), Phospho-AKT (Ser473) (Proteintech; cat. 80455-1-RR), Phospho-Akt (Thr308) (Proteintech; cat. 13038), AKT (Proteintech; cat. 60203-2-Ig) and then with the goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:20000; cat. No. ZB2301; AZGB-Bio) at room temperature for 1 h, and analyzed using enhanced chemiluminescence (ECL) detection kit (Applygen Technologies, Inc.). The β-actin (1:10000; cat. No. 42859; GeneTex) was used as the internal control. The density of the bands was analyzed using ImageJ software. 2.6 Construction of lentiviral shRNA vectors and transfection assay The human LUSC cell line NCI-H226, SK-MES-1, was maintained in RPMI medium 1640 supplemented with 10% fetal bovine serum (FBS) plus 50 units/ml penicillin and streptomycin. The overexpression plasmid of FAM111B was purchased from Shanghai KeyGEN Co., Ltd. The cells were seeded into a 12-well plate at a rate of 1.5x10 5 cells per well for culture, and used for transfection 24 hours after seeding. According to the results of preliminary experiments, the optimal MOI (multiplicity of infection) for NCI-H226 lentivirus infection is 10, and the optimal MOI for SK-MES-1 lentivirus infection is 5. The control group and the experimental group were infected with CON077 and LV-FAM111B-RNAi lentivirus, respectively. Add an appropriate amount of virus and corresponding infection enhancement solution to each well of the 12-well plate, shake the medium slightly, put the 12-well plate in a cell culture incubator for 12 hours, and then replace it with 1640 medium containing 10% FBS. After 72 hours, the 12-well plate was placed under a fluorescence microscope to observe the infection efficiency. Lentivirus-transfected cell lines were screened with puromycin (minimum puro concentration 2.5ug/ml) for 14 days. The transfection efficiency was evaluated by real-time quantitative RT-PCR (qRT-PCR) and western blot. The shRNA target sequences were listed as follows: hU6-MCS-Ubiquitin-EGFP-IRES-puromycin, shRNA sequences are shown in Table 2 . The sequence of the control empty vector was: TTCTCCGAACGTGTCACGT. Table 2 The shRNA target sequences. NO. Accession Target Seq CDS GC% GV248-NC (CON077) None TTCTCCGAACGTGTCACGT N/A 42.11% FAM111B-RNAi(96900-1) NM_198947 GCGAACAGCTTACATATTATA 192..2396 26.32% FAM111B-RNAi(96901-1) NM_198947 GCCTGCCTAGTGATTCTCATT 192..2396 42.11% FAM111B-RNAi(96902-1) NM_198947 CCATAAAGACATGCACATATA 192..2396 26.32% 2.7 Cell Counting Assay Logarithmic NCI-H226 and SK-MES-1 transfected cells were collected by trypsin digestion and counted after suspension and dilution. Inoculated with 5000/ml cell concentration in a 24-well culture plate and placed in a cell incubator. After 24 hours of culture, 3 cells with multiple pores were digested and collected, and the number of cells in each well was detected for a total of 7 days. Growth curves were drawn according to the number of cells. 2.8 Cell counting kit-8 (CCK-8) NCI-H226 and SK-MES-1 transfected cells at the logarithmic growth stage were collected by trypsin digestion and counted after suspension dilution. The cell suspension was adjusted to the desired concentration (5400 /well) and inoculated on the 96-well culture plate at a volume of 90µl/ well. After incubation with CCK-8 for 2h at 24h, 48h, 72h, 96h, and 120h, the absorbance of each hole at 450nm was measured by enzyme-labeler. The cell proliferation curve was drawn according to the mean and standard deviation of OD values corresponding to different time points. 2.9 FAM111B overexpression and EDU cell proliferation assay We constructed the full-length FAM111B gene and subcloned it into the pCDH-3xFlag lentiviral vector. Lentiviruses were produced by co-transfecting HEK293T cells with the packaging plasmids (PSPAX2 and PMD2.G) and the pCDH-FAM111B-3xFlag plasmid using PEI (poly sciences, 24765) in Opti-MEM (Gibco, 31985070). Supernatants were harvested 48 hours post-transfection and used to infect SK-MES-1 cells, which were subsequently selected with puromycin (1 µg/mL). For EDU proliferation assays, shNC, shFAM111B (3’UTR: CTCATAAGTGGAAGCTAAATA), shFAM111B-PCDH3xFlag, and shFAM111B-OE SK-MES-1 cells were seeded in 24-well plates (2×10⁴ cells/well). After adherence, cells were stained using the BeyoClick™ EdU Kit (Beyotime, C0071S) according to the manufacturer's instructions. EdU and Hoechst signals were visualized by fluorescence microscopy, and positive cells were quantified using Image J. 2.10 Wound-Healing Assay Mark two straight lines on the rear of the six-hole plate using a marker. The cells at the logarithmic growth stage of NCI-H226 and SK-MES-1 were transfected and prepared into a cell suspension with a concentration of 6×10 5 /mL and then inoculated in the six-well plate. Use a 10µl gun with the six-hole plate held upright at a 90-degree angle for scoring. The medium in the wells was discarded to remove the suspended cells, and then the six-well plates were placed in an incubator at 37℃ with appropriate normal saline. After 24h, 48h, and 72h, the necrotic cells were washed again with PBS buffer three times, and then observed under a microscope and photographed. Image J software was used to calculate the scratch area, histogram, and scratch area change. 2.11 Transwell Assay Corning transwell chambers (Cat. 3422) were used to perform the transwell migration assay. Add 200µl preheated base medium to the upper chamber and preheat it in the incubator for 2 hours. The cells were transfected with NCI-H226 and SK-MS-1 at the logarithmic growth stage and were inoculated with 1×105/ml at 200µl per well in the upper chamber. After 24h, approximately 600µl of complete medium was added to the lower chamber of the 24-well plate, and then the chamber was placed in the well containing the complete medium. After 48 hours of removal of the chamber, the remaining cells on the surface layer of the upper chamber were wiped with a cotton swab, and then the chamber was washed 3 times with normal saline. Then add paraformaldehyde 600ul to the lower chamber and fix for at least 30 minutes. After washing the chamber with normal saline 3 times, add 0.1% crystal violet to the lower chamber and stain it for at least 30 minutes. Then take it out and wash it with normal saline 3 times. After cleaning, select 5 visual fields for each chamber. The Image J software is used to calculate the number of cells passing through the diaphragm. 2.12 Flow cytometry analysis The cells were inoculated in a 6-well plate and cultured in 1640 complete medium containing 10%FBS for 72 hours. The cells were centrifuged with pancreatic digestive enzymes without EDTA, and the level of apoptosis was detected by AnnexinV-kFluor647/PI double staining apoptosis detection kit (KeyGEN BioTECH, 277444). The experimental results were analyzed by flowjoV10 software. 2.13 Clone formation assay The cells were spread into 6-well plates at 2500 / well, and each group had three Wells. The cells were placed in an incubator containing 5%CO 2 at 37℃ for about 12 days, and the medium was changed regularly to observe the cell viability. Add an appropriate amount of 4% paraformaldehyde to cover the bottom of each hole, fix the cells for about 30 minutes, rinse with normal saline, then add 0.1% crystal violet for two hours, and finally rinse the staining solution with water. Imaging was performed under an inverted microscope, and the number of clones was counted by Image J software. 2.14 Construction of xenograft model Logarithmic growth stage cells were taken, and 0.2ml was inoculated into the left or right armpit of each nude mouse at a concentration of 2×10 7 /mL. Forty-five vaccinated nude mice were randomly divided into three groups: sh-NC, sh-FAM111B-2, and sh-FAM111B-3, with 15 mice in each group. Seven days after inoculation, tumor growth was observed, and tumor volume was measured twice a week. Tumors were removed on day 49, weighed, and fixed in a centrifuge tube with 4% paraformaldehyde. Following euthanasia via cervical dislocation, tissue samples were collected from all nude mice. The experimental procedures were reviewed and approved by the Institutional Animal Ethics Committee. 2.15 Bulk RNA Sequencing (RNA-seq) TRIzol extraction of cell RNA from the control group and sh-FAM111B-2 and sh-FAM111B-3 experimental groups, reverse transcription, amplification, andsequencing library preparation and sequencing were conducted by Lynk & Co Biotechnology (Kunming, China) Co., Ltd. (website: www.biolinker.com ). The library quality assessment comprises three primary methods: (1) Initial quantification of library concentration was performed using Qubit 2.0; (2) Fragment integrity and insert size were analyzed using the Agilent 2100 Bioanalyzer; (3) Precise quantification of effective library concentration was carried out via qPCR. Following successful quality assessment, libraries were pooled into flow cells based on their effective concentrations and the instrument’s required data output. Cluster generation was subsequently performed on the cBOT platform, followed by sequencing on the Illumina NovaSeq high-throughput sequencing system. Bulk RNA Sequencing raw data were logged into PUTTY (version 0.79) and analyzed by RStudio Server. 2.16 PI3K Agonist Rescue Assay The shNC and shFAM111B (3’UTR: CTCATAAGTGGAAGCTAAATA) SK-MES-1 cells in the logarithmic growth phase were digested, counted, and seeded into 96-well plates at 1,000 cells per well. The cells were divided into a solvent control group and a PI3K agonist-treated group. Following overnight culture at 37°C with 5% CO₂, the PI3K agonist group was supplemented with 740Y-P at a final concentration of 2 µM, while the control group received an equal volume of DMSO. Cell viability was measured at indicated time points using the CCK-8 assay. 2.17 Statistical analysis The data were expressed as the mean ± standard deviation (mean ± SD) and were analyzed by SPSS 24.0. The comparison of the results between the groups was analyzed by one-way ANOVA. The rank-sum test was used when the variances were uneven. Significant differences were considered when P-values < 0.05 (α = 0.05). 3. Results 3.1 Bioinformatics analysis of FAM111B in LUSC Analysis using the UALCAN online platform revealed that the expression of FAM111B was significantly higher in both LUSC and LUAD tissues compared with normal controls (Fig. 1 A). In LUSC, FAM111B expression was significantly elevated across different age groups and disease stages compared to normal tissues, and showed an increasing trend with advancing patient age (Fig. 1 C– 1 D). Results from the GEPIA2 database further confirmed that FAM111B expression levels were significantly upregulated in LUSC and LUAD relative to normal tissues, with a more pronounced difference observed in LUSC (Fig. 1 B). Additionally, analysis based on the Kaplan-Meier Plotter database indicated that high expression of the FAM111B gene was significantly associated with poor survival outcomes (Fig. 1 E). 3.2 The expression of the FAM111B gene was positively correlated with LUSC Real-time PCR analysis revealed that FAM111B exhibited high levels of reverse transcription expression in both LUAD and LUSC tissues, which were clinical lung cancer tissues collected in the pre-experiment ( P < 0.001), with significantly higher expression in LUSC tissues compared to LUAD tissues ( P < 0.05) (Fig. 2 G). To investigate the protein expression of FAM111B in LUSC, we collected postoperative paired tissue samples from 74 LUSC patients and 72 LUAD patients. Immunohistochemistry (IHC) results demonstrated that FAM111B was localized in both the nucleus and cytoplasm, with brown staining indicating protein binding. The positive expression rate of FAM111B in LUSC tissues (85.14%, n = 74) (Figs. 2 A- 2 C) was significantly higher than in LUAD tissues (58.33%, n = 72) (Figs. 2 D- 2 F). Furthermore, FAM111B expression was notably elevated in advanced-stage (III, IV) patients ( P < 0.05), and higher in patients with tumor sizes classified as T2–T4 compared to those with T1 tumors ( P < 0.05) (Table 3 ). Patients with lymph node metastasis also exhibited significantly higher FAM111B protein expression than those without metastasis ( P < 0.05) (Table 3 ). These findings suggest that FAM111B is closely associated with the progression of LUSC. Table 3 The relationship between the expression of FAM111B protein in 146 cases of NSCLC tissues and clinicopathological indicators of patients. Factors No. of cases FAM111B X 2 P Positive(%) Negative(%) Gender Male(n = 102) 84(82.35) 18(17.65) 18.249 55(n = 88) 63(71.59) 25(28.41) Histology LUSC(n = 74) 63(85.14) 11(14.86) 12.98 < 0.001*** LUAD(n = 72) 42(58.33) 30(41.67) Stage Ⅰ-Ⅱ(n = 92) 61(66.30) 31(33.70) 3.881 0.049* Ⅲ-Ⅳ(n = 54) 44(81.48) 10(18.52) Grading of tumors T1(n = 42) 24(57.14) 18(42.86) 6.373 0.012* T2-T4(n = 104) 81(77.89) 23(22.11) Lymphatic metastasis Yes(n = 60) 49(81.67) 11(18.33) 6.666 0.036* No(n = 83) 53(63.86) 30(36.14) Unable to evaluate (n = 3) 3(100.00) 0(0.00) To further investigate the role of FAM111B, we designed three shRNA constructs and transfected NCI-H226 and SK-MES-1 cells using lentiviral vectors to establish a FAM111B-knockdown cell model (Figure S1 ). 3.3 Knockdown of FAM111B inhibits the proliferation, migration, clonability, and invasion of LUSC cells. We assessed cell proliferation using the CCK-8 assay and observed that the proliferation of LUSC cells in the sh-FAM111B-2 and sh-FAM111B-3 groups was significantly lower compared to the negative control (sh-NC) group (Fig. 3 A, 3 B). EDU cell proliferation assay showed that the proliferation of FAM111B-OE group was significantly higher than that of shNC group (Fig. 8 A, 8 B). These findings further confirm that knocking down FAM111B significantly inhibits the proliferation of lung squamous cell carcinoma (LUSC) cells in vitro. The clone formation assay revealed that the number of colonies formed by LUSC cells in the sh-FAM111B-2 and sh-FAM111B-3 groups was significantly reduced (Fig. 3 C- 3 F). These results indicate that knocking down FAM111B effectively inhibits the clonogenic ability of LUSC cells in vitro. The wound-healing assay results demonstrated that, compared to the negative control (sh-NC) group, the scratch area in the sh-FAM111B-2 and sh-FAM111B-3 groups showed minimal healing at 24, 48, and 72 hours ( P < 0.001) (Fig. 4 A- 4 D). In contrast, the scratch area in the negative control group was significantly reduced over the same period. Additionally, the Transwell assay revealed that the number of migrating and invading cells in the sh-FAM111B-2 and sh-FAM111B-3 groups was markedly lower than in the negative control group ( P < 0.001) (Fig. 4 E- 4 L). These findings indicate that knocking down FAM111B effectively inhibits the migration and invasion of LUSC cells in vitro. 3.4 Knocking down FAM111B significantly inhibited the cell cycle of LUSC in vitro Flow cytometry analysis revealed that the total apoptosis rate of sh-FAM111B-2 and sh-FAM111B-3 cells did not significantly differ from that of the negative control (sh-NC) group, suggesting that knocking down FAM111B does not affect the apoptotic capacity of NCI-H226 and SK-MES-1 cells ( P > 0.05) (Fig. 5 A- 5 D). However, the cell cycle assay demonstrated that, compared to the sh-NC group, the number of cells in the S phase was significantly increased in the FAM111B knockdown groups, while the number of cells in the G2/M phase was reduced (Fig. 5 E- 5 H). This indicates that the cell cycle was arrested in the S phase. These findings suggest that knocking down FAM111B in vitro significantly inhibits the cell cycle progression of LUSC cells, leading to S phase arrest. 3.5 Transcriptome sequencing and differential gene cluster analysis of NCI-H226 (sh-FAM111B-2/3) The Q30 base rate for sh-NC, sh-FAM111B-2, and sh-FAM111B-3 samples exceeded 90%, confirming the reliability of the sequencing data. The raw sequencing data were logged into PUTTY (version 0.79) and analyzed by RStudio Server.. A total of 22,551 genes were differentially expressed between sh-FAM111B-2/sh-FAM111B-3 and sh-NC, with 1,545 genes showing statistically significant differences ( P < 0.05). Among these, 947 genes were downregulated, and 598 genes were upregulated (Fig. 6 A, 6 B). KEGG enrichment analysis identified the PI3K-AKT signaling pathway as the most relevant pathway associated with FAM111B-mediated gene downregulation. Key upstream target genes, including PGF, VEGFA, NGFR, FGFR4, COL4A2, and LAMB3, were found to be downregulated. Additionally, the protein-coding gene PIK3CD, a core component of the PI3K signaling pathway, was downregulated, along with the downstream cell cycle-related gene CCND2 (Fig. 6 C). Western blot analysis revealed that, compared to the sh-NC group, the total protein levels of PI3K, AKT in FAM111B-knockdown NCI-H226 cells did not show significant changes. The phosphorylated forms of PI3K and AKT were significantly downregulated. Furthermore, downstream components of the PI3K signaling pathway exhibited notable changes: the expression of P21, P27, and P53 proteins was upregulated, whereas the expression of CCND1, CCND2, CCNA2, MDM2, CDK2, CDK4, and c-Myc proteins was downregulated (Fig. 6 D- 6 E). Furthermore, the PI3K Agonist Rescue Assay revealed that cell proliferation in the 740Y-P group was significantly higher than that in the negative control group (Fig. 8 C). 3.6 Differences in PI3K signaling pathway-related proteins in transplanted nude mice with FAM111B knockdown Using a xenograft tumor model in nude mice with NCI-H226 cells, we observed that after 28 days, tumor growth in the sh-FAM111B-2 and sh-FAM111B-3 groups was significantly reduced compared to the negative control (sh-NC) group. These results demonstrate that knocking down FAM111B significantly inhibits the growth of LUSC xenografts in nude mice (Fig. 7 A, 7 B). Western blot analysis of xenograft tumors in nude mice revealed that, compared to the sh-NC group, the total protein levels of PI3K and AKT showed no significant changes. However, the phosphorylation levels of PI3K and AKT were markedly reduced. Additionally, downstream components of the PI3K signaling pathway exhibited notable changes: the expression of P21, P27, and P53 proteins was upregulated, while the expression of CCND1, CCND2, CDK2, CDK4, CDK6, and MMP2 proteins was downregulated. Furthermore, among epithelial-mesenchymal transition (EMT)-related proteins, the expression of N-cadherin was downregulated, whereas E-cadherin expression was upregulated (Fig. 7 C, 7 D). 4. Discussion LUSC is a type of NSCLC, which originates in the center of the lung and easily metastasizes to other parts of the body, such as lymph, liver, bone, and brain, bringing a huge burden to the social medical system and LUSC patients 24 , 25 . Various driver gene mutations are common in LUSC, including FGFR1, CCND2, PIK3CA, CDKN2A, and TP53 26 . Due to the high frequency of genetic mutations in LUSC, few genetic targets can be used for patent drugs in LUSC. So far, targeted therapies for LUSC are still lacking. We identified that FAM111B is abnormally highly expressed in lung cancer tissues in preliminary experiments. IHC further revealed that FAM111B expression was found to correlate with key clinicopathological features, such as gender and histological type, based on clinical medical records. These findings suggest that FAM111B may play a crucial role in the malignant progression of LUSC, and we aim to explore how FAM111B drives oncogenic processes in LUSC and whether these mechanisms differ from its role in LUAD. In this study, we observed that the expression of FAM111B was significantly higher in LUSC compared to LUAD. The FAM111B-knockdown models demonstrated that FAM111B knockdown inhibited key biological behaviors, including cell proliferation, migration, invasion, wound healing, and colony formation. Furthermore, FAM111B knockdown did not affect apoptosis in LUSC cells. It significantly inhibited the cell cycle, leading to S phase arrest. The xenograft tumor model confirmed that FAM111B knockdown significantly suppressed the growth of LUSC tumors. RNA-seq revealed that the differentially expressed genes were closely associated with the PI3K signaling pathway, which was known to regulate critical malignant behaviors in cancer. Based on these findings, we speculate that FAM111B may promote LUSC progression by regulating upstream genes of the PI3K signaling pathway, thereby influencing the activity of PI3K-related proteins. AKT typically inhibits GSK3β activity through phosphorylation, a mechanism that is inconsistent with our research results. In our study, we constructed H226 with low expression of FAM111B using shRNA and found inconsistent expression of p-GSK3β. However, the alterations in the PI3K/AKT/cMyc pathway align with those reported in previous studies. This suggests that GSK3β may not serve as an intermediary node in FAM111B-mediated cell regulation. The underlying mechanisms warrant further investigation. The proliferation function of FAM111B knockdown cells was also restored when PI3K was inhibited, which also proved that FAM111B was involved in cell regulation through PI3K.We speculate that FAM111B knockdown, mediated through the PI3K/AKT/c-Myc pathway, led to the downregulation of CCND1. Additionally, the expression of CCND1, CCND2, CCNA2, CDK2, and CDK4 was reduced via the PI3K/AKT/P21 and P27 pathways, resulting in cell cycle arrest in the S phase. P21 and P27 are critical cyclin-dependent kinase inhibitors, and their overexpression can prevent cells from progressing into the S phase 27 . Additionally, the interaction between CDK2 and Cyclin A is essential for regulating the progression from the S phase to the G2 phase 28 . Previous studies have found that knocking down FAM111B can increase p53 protein expression in LUAD cells 22 . Knockdown of FAM111B decreased the expression of N-cadherin and MMP2 protein, and increased the expression of E-cadherin protein, suggesting that FAM111B may promote the EMT process, thereby affecting the migration and invasion of LUSC (Fig. 9 ). This study elucidated the general mechanism of FAM111B in LUSC. However, whether FAM111B interacts with other proteins to regulate the phosphorylation of PI3K remains to be further explored. Due to the limited number of experimental samples, this study focused solely on verifying the expression and mechanistic role of FAM111B in LUSC. Additionally, the study lacks a comparative analysis of FAM111B's role in LUAD, which would provide valuable context. Further validation using animal models with other lung cancer cell lines is necessary to strengthen the findings and enhance their credibility. PI3K inhibitors diminish the catalytic activity of PI3K or its specific subtypes (α, β, δ, γ), leading to a reduction in PIP3 production, which subsequently inhibits the activation of AKT and downstream signal transduction pathways, resulting in tumor cell cycle arrest, suppression of proliferation, promotion of apoptosis, and potentially inhibition of angiogenesis and metastasis. Recent research on cancer therapy has demonstrated that the combination of PI3Kα-selective inhibitors (Inavolisib 29 ) with fulvestrant and palbociclib significantly enhances efficacy in overcoming drug resistance associated with PI3KA-mutated breast cancer 30 , and the combination of inavolisib and osimertinib as a first-line treatment for advanced NSCLC harboring EGFR mutations and detectable PIK3CA aberrations is currently ongoing. This effect is particularly pronounced when the mechanism underlying drug resistance involves PIK3CA mutations or amplifications. The sample size and methods of this study have limitations, which leads to the unclear specificity of the potential mechanism between FAM111B and the PI3K signaling pathway in LUSC, as well as the specific molecular mechanism by which FAM111B blocks LUSC in the S phase. Therefore, we plan to expand the sample size and include additional lung cancer models to further delineate the LUSC-specific regulatory mechanism of FAM111B, particularly its interplay with the PI3K/AKT/c-Myc, p-AKT/E-cadherin, and MMP2/MMP9 pathways. In addition, protein-protein interaction technology will be used to explore the specific mechanism of FAM111B knockdown to arrest cells in S phase. These efforts will provide a deeper understanding of FAM111B's role in LUSC progression. Furthermore, we aim to design targeted signaling pathway inhibitors based on the regulatory mechanisms of FAM111B, paving the way for future clinical research and therapeutic development. In summary, we have demonstrated that FAM111B likely regulates downstream targets such as c-MycP21, and P27 by modulating the phosphorylation of PI3K and AKT proteins, thereby promoting the proliferation and cell cycle progression of LUSC, which are different with LUAD. Additionally, FAM111B may facilitate epithelial-mesenchymal transition (EMT) processes, including LUSC migration and invasion, by regulating the expression of E-cadherin and N-cadherin. These findings highlight FAM111B as a promising therapeutic target for LUSC. Declarations Ethics approval and consent to participate All animal experiments in the present study were conducted in accordance with the regulations for the administration of affairs concerning experimental animals and relevant institutional guidelines. The experiments were approved by the Ethical Committee of Kunming Medical University (Approval no. KMMU2020016 for animal experiments and KMMU2020MEC053 for human study). Conflicts of Interest The authors declare that they have no competing interests Funding This work was supported by grants from: 1. National Natural Science Foundation of China (Regional Science Foundation Project: 82360459): Study on the mechanism of YBX1 dependent on m6A modification of stable FAM111B to promote LUSC. 2. Applied Basic Research Project of Yunnan Province (Key joint project: 202401AY070001-025): Research on the pathogenesis of lung squamous cell carcinoma based on FAM111B. Author Contribution Yajuan Chen provided the funding and manuscript writing. Shiwei Chai, Yunyi Chen and Huimin Wang were responsible for conducting the experiment and obtaining the data. Yanting Bi, Yifei Ma, Ruotian Li and Ruiyi Liu were responsible for collecting and organizing the data. Zaoxiu Hu and Shaoxiang Wan guided the experiment and were responsible for the proofreading of the manuscript. Acknowledgement Not applicable. Data Availability The data generated in the present study may be requested from the corresponding author. The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive (Genomics, Proteomics & Bioinformatics 2025) in National Genomics Data Center (Nucleic Acids Res 2025), China National Center for Bioinformation / Beijing Institute of Genomics, Chinese Academy of Sciences (GSA-Human: HRA014876) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa-human. References GLOBOCAN 2023.International Agency for Research on Cancer.WHO. Available online: (2023). http://gco.iarc.fr/ , accessed 13 March 2025). Rodriguez-Canales, J., Parra-Cuentas, E. & Wistuba, I. I. Diagnosis and Molecular Classification of Lung Cancer. Cancer Treat. Res. 170 , 25–46. 10.1007/978-3-319-40389-2_2 (2016). Zhong, H. et al. First-line penpulimab combined with paclitaxel and carboplatin for metastatic squamous non-small-cell lung cancer in China (AK105-302): a multicentre, randomised, double-blind, placebo-controlled phase 3 clinical trial. Lancet Respir Med. 12 , 355–365. 10.1016/s2213-2600(23)00431-9 (2024). Dong, M. et al. The analysis of surgical prognostic factors and molecular typing of locally advanced lung squamous cell carcinomas. Asia Pac. J. Clin. Oncol. 17 , e226–e237. 10.1111/ajco.13438 (2021). DuCote, T. J. et al. EZH2 Inhibition Promotes Tumor Immunogenicity in Lung Squamous Cell Carcinomas. Cancer Res. Commun. 4 , 388–403. 10.1158/2767-9764.Crc-23-0399 (2024). Brainson, C. F. et al. Description of a Lung Cancer Hotspot: Disparities in Lung Cancer Histology, Incidence, and Survival in Kentucky and Appalachian Kentucky. Clin. Lung Cancer . 22 , e911–e920. 10.1016/j.cllc.2021.03.007 (2021). Santos, E. S. & Rodriguez, E. Treatment Considerations for Patients With Advanced Squamous Cell Carcinoma of the Lung. Clin. Lung Cancer . 23 , 457–466. 10.1016/j.cllc.2022.06.002 (2022). Niu, Z., Jin, R., Zhang, Y. & Li, H. Signaling pathways and targeted therapies in lung squamous cell carcinoma: mechanisms and clinical trials. Signal. Transduct. Target. Ther. 7 , 353. 10.1038/s41392-022-01200-x (2022). Addeo, A. et al. Fibroblast growth factor receptor (FGFR) inhibitor rogaratinib in patients with advanced pretreated squamous-cell non-small cell lung cancer over-expressing FGFR mRNA: The SAKK 19/18 phase II study. Lung Cancer . 172 , 154–159. 10.1016/j.lungcan.2022.08.016 (2022). Hashemi-Sadraei, N. & Hanna, N. Targeting FGFR in Squamous Cell Carcinoma of the Lung. Target. Oncol. 12 , 741–755. 10.1007/s11523-017-0513-6 (2017). Ji, L. et al. The NRF2 antagonist ML385 inhibits PI3K-mTOR signaling and growth of lung squamous cell carcinoma cells. Cancer Med. 12 , 5688–5702. 10.1002/cam4.5311 (2023). Xue, X. et al. PI3Kα inhibitor GNE-493 triggers antitumor immunity in murine lung cancer by inducing immunogenic cell death and activating T cells. Int. Immunopharmacol. 130 , 111747. 10.1016/j.intimp.2024.111747 (2024). Besse, B. et al. A phase 1b study of necitumumab in combination with abemaciclib in patients with stage IV non-small cell lung cancer. Lung Cancer . 137 , 136–143. 10.1016/j.lungcan.2019.09.002 (2019). Shi, R. et al. Targeting the CDK4/6-Rb Pathway Enhances Response to PI3K Inhibition in PIK3CA-Mutant Lung Squamous Cell Carcinoma. Clin. Cancer Res. 24 , 5990–6000. 10.1158/1078-0432.Ccr-18-0717 (2018). Welter, A. L. & Machida, Y. J. Functions and evolution of FAM111 serine proteases. Front. Mol. Biosci. 9 , 1081166. 10.3389/fmolb.2022.1081166 (2022). Arowolo, A., Malebana, M., Sunda, F. & Rhoda, C. Proposed Cellular Function of the Human FAM111B Protein and Dysregulation in Fibrosis and Cancer. Front. Oncol. 12 , 932167. 10.3389/fonc.2022.932167 (2022). Huang, N. et al. FAM111B Acts as an Oncogene in Bladder Cancer. Cancers (Basel) . 15 10.3390/cancers15215122 (2023). Wu, H. & Liang, C. Pan-Cancer Analysis of the Tumorigenic Effect and Prognostic Diagnostic Value of FAM111B in Human Carcinomas. Int. J. Gen. Med. 16 , 1845–1865. 10.2147/ijgm.S409690 (2023). Wang, W., Gu, Y., Ni, H., Quan, Q. & Guo, L. Silencing of FAM111B inhibits tumor growth and promotes apoptosis by decreasing AKT activity in ovarian cancer. Exp. Biol. Med. (Maywood) . 248 , 1043–1055. 10.1177/15353702231160326 (2023). Gupta, S., Silveira, D. A. & Mombach, J. C. M. Towards DNA-damage induced autophagy: A Boolean model of p53-induced cell fate mechanisms. DNA Repair. (Amst) . 96 , 102971. 10.1016/j.dnarep.2020.102971 (2020). Li, W., Hu, S., Han, Z. & Jiang, X. YY1-Induced Transcriptional Activation of FAM111B Contributes to the Malignancy of Breast Cancer. Clin. Breast Cancer . 22 , e417–e425. 10.1016/j.clbc.2021.10.008 (2022). Gupta, S., Silveira, D. A. & Hashimoto, R. F. A Boolean model of the oncogene role of FAM111B in lung adenocarcinoma. Comput. Biol. Chem. 106 , 107926. 10.1016/j.compbiolchem.2023.107926 (2023). Remmele, W. & Stegner, H. E. [Recommendation for uniform definition of an immunoreactive score (IRS) for immunohistochemical estrogen receptor detection (ER-ICA) in breast cancer tissue]. Pathologe 8 , 138–140 (1987). Song, G. Q. et al. The necroptosis signature and molecular mechanism of lung squamous cell carcinoma. Aging (Albany NY) . 15 , 12907–12926. 10.18632/aging.205210 (2023). Guttapadu, R. et al. Identification of novel biomarkers for lung squamous cell carcinoma. 3 Biotech. 13 , 72. 10.1007/s13205-023-03489-z (2023). Joon, H. K., Thalor, A. & Gupta, D. Machine learning analysis of lung squamous cell carcinoma gene expression datasets reveals novel prognostic signatures. Comput. Biol. Med. 165 , 107430. 10.1016/j.compbiomed.2023.107430 (2023). Massey, A. J., Benwell, K., Burbridge, M., Kotschy, A. & Walmsley, D. L. Targeting DYRK1A/B kinases to modulate p21-cyclin D1-p27 signalling and induce anti-tumour activity in a model of human glioblastoma. J. Cell. Mol. Med. 25 , 10650–10662. 10.1111/jcmm.17002 (2021). Liu, Y. et al. Duck hepatitis A virus type 1 mediates cell cycle arrest in the S phase. Virol. J. 19 , 111. 10.1186/s12985-022-01839-6 (2022). Hanan, E. J. et al. Discovery of GDC-0077 (Inavolisib), a Highly Selective Inhibitor and Degrader of Mutant PI3Kα. J. Med. Chem. 65 , 16589–16621. 10.1021/acs.jmedchem.2c01422 (2022). Gambardella, V. et al. Safety overview and management of inavolisib alone and in combination therapies in PIK3CA-mutated, HR-positive, HER2-negative advanced breast cancer (GO39374). ESMO Open. 10 , 105303. 10.1016/j.esmoop.2025.105303 (2025). Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial.pdf FigureS1.tif Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 13 Apr, 2026 Reviews received at journal 11 Apr, 2026 Reviews received at journal 10 Apr, 2026 Reviewers agreed at journal 02 Apr, 2026 Reviews received at journal 01 Apr, 2026 Reviewers agreed at journal 31 Mar, 2026 Reviewers agreed at journal 30 Mar, 2026 Reviewers agreed at journal 29 Mar, 2026 Reviewers agreed at journal 28 Mar, 2026 Reviewers invited by journal 28 Mar, 2026 Editor assigned by journal 28 Mar, 2026 Editor invited by journal 26 Mar, 2026 Submission checks completed at journal 24 Mar, 2026 First submitted to journal 24 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8974853","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":616777925,"identity":"e668e5a7-9644-409b-bdfa-a73d1ca8237b","order_by":0,"name":"Yajuan Chen","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yajuan","middleName":"","lastName":"Chen","suffix":""},{"id":616777926,"identity":"270a80bd-a3e0-4266-b43d-d1ec6bfbb13b","order_by":1,"name":"Shiwei Chai","email":"","orcid":"","institution":"Zhanjiang Health School of Guangdong","correspondingAuthor":false,"prefix":"","firstName":"Shiwei","middleName":"","lastName":"Chai","suffix":""},{"id":616777927,"identity":"fc281b8b-0d72-477e-876f-8c39f66483f3","order_by":2,"name":"Huimin Wang","email":"","orcid":"","institution":"Yunnan Provincial Infectious Disease Hospital","correspondingAuthor":false,"prefix":"","firstName":"Huimin","middleName":"","lastName":"Wang","suffix":""},{"id":616777928,"identity":"3c5c1bb4-ee97-4652-ac70-86117bde1167","order_by":3,"name":"Yunyi Chen","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yunyi","middleName":"","lastName":"Chen","suffix":""},{"id":616777929,"identity":"e8515569-f231-4deb-a72c-408383bee2fa","order_by":4,"name":"Yanting Bi","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanting","middleName":"","lastName":"Bi","suffix":""},{"id":616777931,"identity":"3e9e9e34-2f20-42f5-9a9b-adf51765870c","order_by":5,"name":"Yifei Ma","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yifei","middleName":"","lastName":"Ma","suffix":""},{"id":616777932,"identity":"fe795cb0-313a-450a-b6cd-48bde36b3bb4","order_by":6,"name":"Ruotian Li","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ruotian","middleName":"","lastName":"Li","suffix":""},{"id":616777933,"identity":"5f488169-bed4-42fe-bb42-456ce76de695","order_by":7,"name":"Ruiyi Liu","email":"","orcid":"","institution":"Kunming Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ruiyi","middleName":"","lastName":"Liu","suffix":""},{"id":616777936,"identity":"0aedccbf-8b3e-4dfb-b9aa-e6128ed014cb","order_by":8,"name":"Zaoxiu Hu","email":"","orcid":"","institution":"Yunnan Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zaoxiu","middleName":"","lastName":"Hu","suffix":""},{"id":616777937,"identity":"d14451ce-f430-4689-b800-d82d1e65c814","order_by":9,"name":"Shaoxiang Wan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtklEQVRIiWNgGAWjYJACZhDBz8x8+AFpWiTb2dIMSNNicJ5HQYIo5QbHzx7+XFBjk7j5MA+DAUONTTRhLWfy0qRnHEszNjvMe+ABw7G03AZCWswO5Jgx87AdljM7zJdgwNhwmAgt598Yf+b5d5jHuJnHQII4LTdyDKR52w7LGTATq8X+xhszad6+NGOJw8BATiDGL5L9OUCHfbNJ7O8/fPjBhxobwlpQQQJpykfBKBgFo2AU4AIAlO865kB+Z0oAAAAASUVORK5CYII=","orcid":"","institution":"Yunnan Provincial Infectious Disease Hospital","correspondingAuthor":true,"prefix":"","firstName":"Shaoxiang","middleName":"","lastName":"Wan","suffix":""}],"badges":[],"createdAt":"2026-02-26 07:53:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8974853/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8974853/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106381409,"identity":"f7b039c4-4202-49f4-98a8-29c8b89e6282","added_by":"auto","created_at":"2026-04-08 05:21:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3015065,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBioinformatics analysis of FAM111B and LUSC. A: \u003c/strong\u003eUALCAN online analysis of the expression level of FAM111B in LUSC. \u003cstrong\u003eB:\u003c/strong\u003e GEPIA2 online database analysis of the expression differences of FAM111B in LUSC and LUAD. \u003cstrong\u003eC, D:\u003c/strong\u003e UALCAN analysis of the correlation between the expression of FAM111B in LUSC and the age and stage of patients. \u003cstrong\u003eE:\u003c/strong\u003e Kaplan-Meier Plotter analyzed that high expression of FAM111B was associated with poor survival prognosis in patients.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/b285a688ba045d214df60195.png"},{"id":106404486,"identity":"9f525692-dcad-4f5e-aafb-ced7569b1691","added_by":"auto","created_at":"2026-04-08 09:16:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":14798363,"visible":true,"origin":"","legend":"\u003cp\u003eThe protein expression of FAM111B among LUAD and LUSC. \u003cstrong\u003eA\u003c/strong\u003e: FAM111B protein was negatively, weakly, positively, strongly positive expressed in LUSC adjacent tissues, respectively. \u003cstrong\u003eB\u003c/strong\u003e: Histogram of positive rate of FAM111B protein expression. \u003cstrong\u003eC\u003c/strong\u003e: Histogram of IRS expression score of FAM111B protein in LUSC. \u003cstrong\u003eD\u003c/strong\u003e: FAM111B protein was negatively, weakly, positively, strongly positive expressed in LUAD adjacent tissues, respectively. \u003cstrong\u003eE\u003c/strong\u003e: Histogram of positive rate of FAM111B protein expression in LUAD. \u003cstrong\u003eF\u003c/strong\u003e: Histogram of IRS expression score of FAM111B protein. \u003cstrong\u003eG\u003c/strong\u003e: The protein expression of FAM111B among LUAD and LUSC. (para-Ca/LUSC/LUAD: Tissue area more than 5cm from the tumor margin. Ca: Central area of tumor tissue without necrosis. A, D: 200×, representative result shown in the figure, *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/2f9e8cc64dcb2258de16bb04.png"},{"id":106381412,"identity":"3b39a140-d199-43c3-be98-e22a8575c03d","added_by":"auto","created_at":"2026-04-08 05:21:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6790022,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of FAM111B knockdown on proliferation of NCI-H226 and SK-MES-1. \u003cstrong\u003eA\u003c/strong\u003e: The effect of FAM111B knockdown on the proliferation of NCI-H226 cell lines. \u003cstrong\u003eB\u003c/strong\u003e: The effect of FAM111B knockdown on the proliferation of SK-MES-1 cell lines. \u003cstrong\u003eC, D\u003c/strong\u003e: Comparison of the number of cell clones formed in sh-FAM111B-2, sh-FAM111B-3, and sh-NC groups in NCI-H226. \u003cstrong\u003eE, F\u003c/strong\u003e: Comparison of the number of cell clones formed in sh-FAM111B-2, sh-FAM111B-3, and sh-NC groups in SK-MES-1. (The number of cell clones was calculated using ImageJ, and the histogram result was the mean ± standard deviation of 3 independent repeats, sh-FAM111B-2, sh-FAM111B-3 compared with sh-NC: **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/3edf715dc22d3aae9d566333.png"},{"id":106404491,"identity":"20702d87-582a-4f29-ba24-feb5b2da785b","added_by":"auto","created_at":"2026-04-08 09:16:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":15323043,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of FAM111B knockdown on migration and invasion of NCI-H226 and SK-MES-1. \u003cstrong\u003eA-B, E-F:\u003c/strong\u003e The effect of knocking down FAM111B on the migration of NCI-H226.\u003cstrong\u003eC-D, G-H:\u003c/strong\u003e The effect of knocking down FAM111B on the migration of SK-MES-1.\u003cstrong\u003eI, J:\u003c/strong\u003e The effect of knocking down FAM111B on the invasion of NCI-H226. \u003cstrong\u003eK, L:\u003c/strong\u003e The effect of knocking down FAM111B on the invasion of SK-MES-1. (ImageJ was used to calculate the area, and the histogram results are the mean ± standard deviation of three independent replicates. sh-FAM111B-2, sh-FAM111B-3 and sh-NC were compared: *\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, **\u003cem\u003ep\u0026lt;\u003c/em\u003e0.01, ***\u003cem\u003ep\u0026lt;\u003c/em\u003e0.001).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/a260bb46aac0b4be4adbdb62.png"},{"id":106404040,"identity":"31360d78-4dc9-4228-9bf3-c6feaed3623b","added_by":"auto","created_at":"2026-04-08 09:15:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3519589,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of FAM111B knockdown on apoptosis and cell cycle in NCI-H226 and SK-MES-1. \u003cstrong\u003eA-B:\u003c/strong\u003eEffect of FAM111B knockdown on apoptosis of NCI-H226.\u003cstrong\u003e C-D:\u003c/strong\u003e Effect of FAM111B knockdown on apoptosis of SK-MES-1. \u003cstrong\u003eE-F: \u003c/strong\u003eFlow cytometry results of sh-FAM111B-2, sh-FAM111B-3, and sh-NC groups in NCI-H226.\u003cstrong\u003e G-H: \u003c/strong\u003eFlow cytometry results of sh-FAM111B-2, sh-FAM111B-3, and sh-NC groups in SK-MES-1. (The histogram result was the mean ± standard deviation of 3 independent repeats, sh-FAM111B-2, sh-FAM111B-3 compared with sh-NC: #\u003cem\u003ep\u0026gt;\u003c/em\u003e0.05, *\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, **\u003cem\u003ep\u0026lt;\u003c/em\u003e0.01, ***\u003cem\u003ep\u0026lt;\u003c/em\u003e0.001).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/5fcaa75e896c0dc70e7a80d7.png"},{"id":106404513,"identity":"e29b83df-cfb4-4879-91b0-f3ad422bdd06","added_by":"auto","created_at":"2026-04-08 09:16:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3672112,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential gene analysis of NCI-H226 cells in sh-NC, sh-FAM111B-2, and sh-FAM111B-2 groups. \u003cstrong\u003eA:\u003c/strong\u003e Differential gene heat map (Showing the top ten genes with large differences). \u003cstrong\u003eB:\u003c/strong\u003e Differential gene volcano map (Green dots are 947 down-regulated genes, red dots are 598 up-regulated genes). \u003cstrong\u003eC:\u003c/strong\u003eDown-regulated gene KEGG analysis. \u003cstrong\u003eD, E:\u003c/strong\u003e Expression of related proteins in PI3K signaling pathway in sh-FAM111B-2, sh-FAM111B-3 and sh-NC groups in NCI-H226 (The blots were cut prior to hybridization with antibodies during blotting, n=3, *\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, **\u003cem\u003ep\u0026lt;\u003c/em\u003e0.01, ***\u003cem\u003ep\u0026lt;\u003c/em\u003e0.001).\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/abf463fb1768546a339bb5c4.png"},{"id":106381417,"identity":"8d2de791-7bfc-4910-bb7d-630519e9c7c2","added_by":"auto","created_at":"2026-04-08 05:21:41","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":9449184,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of FAM111B inhibited the growth of NCI-H226 LUSC xenografts in nude mice. \u003cstrong\u003eA, B: \u003c/strong\u003eForty-five female nude mice without thymus were selected. The concentration of NC-H226 cells after FAMM111B knockdown was adjusted to 2x10\u003csup\u003e7\u003c/sup\u003e cells/ml. Nude mice were inoculated subcutaneously in the right armpit, and the growth and formation of subcutaneous tumors were observed every day. \u003cstrong\u003eC, D:\u003c/strong\u003e Expression of related proteins in PI3K signaling pathway in tumor tissue of nude mice in sh-FAM111B-2, sh-FAM111B-3, and sh-NC groups (The blots were cut prior to hybridization with antibodies during blotting, n=3, *\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, **\u003cem\u003ep\u0026lt;\u003c/em\u003e0.01, ***\u003cem\u003ep\u0026lt;\u003c/em\u003e0.001).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/8c6fe0116ec5c8c633229f64.png"},{"id":106404480,"identity":"26f9261f-ac02-43f8-8f0a-4be00a40e4d9","added_by":"auto","created_at":"2026-04-08 09:16:05","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2859007,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of FAM111B overexpression and PI3K activation on SK-MES-1 cell proliferation.\u003cstrong\u003e A, B:\u003c/strong\u003e Overexpression of FAM111B enhanced the proliferation of SK-MES-1. \u003cstrong\u003eC:\u003c/strong\u003e The PI3K agonist rescued the impaired cell proliferation induced by FAM111B knockdown. (The number of cells was calculated using ImageJ, and the histogram result was the mean ± standard deviation of 3 independent repeats, compared among groups: *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/78a8b4108258b6bf2b21c81e.png"},{"id":106381419,"identity":"be881e63-44ff-403b-8367-1eb535a52012","added_by":"auto","created_at":"2026-04-08 05:21:41","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":3102022,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of the mechanism of FAM111B promoting LUSC.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/a985e03bf6a3bc2fd9529d0b.png"},{"id":106414949,"identity":"683086ec-b6f5-4e94-8cd0-09d93ba25d34","added_by":"auto","created_at":"2026-04-08 10:31:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":59644347,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/a5ad66c3-08ef-4892-af2e-a12c3044c9b0.pdf"},{"id":106381416,"identity":"74544a78-fb23-4a56-b754-3b9dcdfa2ebc","added_by":"auto","created_at":"2026-04-08 05:21:41","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5342353,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/704d25ecd72d6621ceb9511c.pdf"},{"id":106404709,"identity":"0614e95d-4758-482c-a386-94733493ad99","added_by":"auto","created_at":"2026-04-08 09:16:37","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1244605,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8974853/v1/18efda72c98321c9babfa0a4.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"FAM111B may promote the progression of lung squamous cell carcinoma through PI3K signaling pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAccording to Globocan 2024, lung cancer remains the deadliest cancer in the world\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Lung cancer can be roughly divided into small cell lung cancer (SCLC) and non-SCLC (NSCLC) according to histology, accounting for about 85% and 15% of the total number of lung cancer, respectively\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. NSCLC can be divided into lung squamous cell carcinoma (LUSC), lung adenocarcinoma (LUAD), and large cell carcinoma (LCC), and LUSC accounts for about 30% of NSCLC patients\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Compared with LUAD, LUSC has a high incidence, strong drug resistance, easy recurrence and metastasis, poor prognosis, short survival, and a lack of early diagnosis and treatment strategies\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eChemotherapy still plays an irreplaceable role in the treatment of LUSC, but its specificity is poor. In addition to chemotherapy, immunotherapy and targeted therapies for lung cancer can benefit cancer patients. EGFR-TKI is still the main target therapy for advanced LUSC in the world, such as erlotinib and afatinib\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. However, the common gene mutations in LUAD, such as EGFR and KRAS, are rarely mutated in LUSC, so LUSC patients find it difficult to benefit from EGFR inhibitors \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. The frequency of total gene mutations in patients with LUSC is high and complex, and targeted therapies for LUSC are still being explored. Many new drugs in patients with LUSC are still in the clinical trial stage, including FGFR inhibitors \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, PI3 inhibitors\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, CDK4/6 inhibitors\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, etc. Several kinds of PI3K inhibitors have passed the examination and approval of the United States Food and Drug Administration, and have stronger antitumor activity, but as a result, large adverse reactions greatly limit their clinical application. Because of the refractory nature of LUSC, it is very important to further study the pathogenesis of LUSC and discover new diagnostic molecular markers and therapeutic targets, which can promote the progress of early diagnosis and treatment of LUSC.\u003c/p\u003e \u003cp\u003eThe family with the sequence similarity 111 (FAM111) is composed of two members, A-B. FAM111B and FAM111A are adjacent on chromosome 11, and the serine protease FAM111B is a cancer-associated nuclear protein. In the past decade, studies have found that FAM111B mutations often lead to an inherited disease, which is usually characterized by abnormal skin pigmentation, tendon contracture, and pulmonary fibrosis\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Recent studies have found that FAM111B is also closely related to the occurrence and development of various cancers\u003csup\u003e\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The decreased expression of FAM111B can reduce the proliferation ability of cervical cancer cells and cause cycle arrest in the G1/S phase\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. The down-regulated expression of FAM111B can significantly slow down the proliferation of breast cancer cells and enhance the ability of breast cancer cells to undergo apoptosis\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Studies have found that downregulation of FAM111B expression can inhibit the proliferation and invasion of LUAD, and promote the G2/M cell cycle arrest of LUAD\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, but the specific mechanism is still unclear. In summary, the existing findings of FAM111B did not elaborate on the relationship between FAM111B and LUSC, nor were more in-depth studies conducted.\u003c/p\u003e \u003cp\u003eIn this study, reverse transcriptome sequencing of various tumor tissues revealed that the expression of the FAM111B gene was significantly higher in lung cancer compared to other tumor types. To further investigate this finding, we collected tumor tissue and serum samples from patients with NSCLC for preliminary experiments. Our analysis demonstrated that levels of FAM111B-cfDNA in the serum of these patients were markedly elevated compared to those in normal serum samples. Immunohistochemical analysis further confirmed that FAM111B protein expression was significantly higher in LUSC than in LUAD. To address whether FAM111B plays a more significant role in the progression of LUSC compared to LUAD, we conducted a series of in vitro and in vivo experiments to explore the relationship between FAM111B and LUSC. Our goal was to elucidate the molecular mechanisms by which FAM111B contributes to the carcinogenesis of LUSC, with the aim of providing a theoretical foundation for the development of targeted therapies for this aggressive cancer subtype.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Bioinformatics analysis of FAM111B in LUSC\u003c/h2\u003e \u003cp\u003eTo investigate FAM111B expression in lung squamous cell carcinoma (LUSC), we utilized the UALCAN platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ualcan.path.uab.edu/\u003c/span\u003e\u003cspan address=\"https://ualcan.path.uab.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), which integrates data from The Cancer Genome Atlas (TCGA), and the GEPIA2 online database to perform a comprehensive data analysis. In addition, the Kaplan-Meier Plotter (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://kmplot.com/analysis/index.php?\u003c/span\u003e\u003cspan address=\"https://kmplot.com/analysis/index.php?\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e p=background) to analyze the prognostic relationship between FAM111B and LUSC.\u003c/p\u003e \u003cp\u003eThe study were approved by the Ethical Committee of Kunming Medical University. All animal experiments in the present study were conducted in accordance with the ARRIVE guidelines (PLoS Bio 8(6), e1000412,2010). The studies involving humans were conducted in ethical norms and standards in the Declaration of Helsinki. All patients gave their informed consent.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Immunohistochemical and quantitative analysis\u003c/h2\u003e \u003cp\u003eAll tissues were from Yunnan Cancer Hospital (Kunming, China) from October 2020 to October 2021. Postoperative tissues from patients with confirmed non-small cell lung cancer and complete clinicopathological data were included in the study. A total of 146 NSCLC (74 LUSC, 72 LUAD; 44 female patients and 102 male patient; median age, 56.5 years; age range, 24\u0026ndash;83 years) were screened. Surgically removed specimens were fixed in 10% formalin and paraffin-embedded. Then, the wax blocks were sectioned at 5 \u0026micro;m with a tissue slicer and placed in a constant temperature oven at 70 \u0026deg; C for 2-3h, then placed in a constant temperature oven at 58 \u0026deg; C overnight, hydrated using an ethanol gradient, and incubated in 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e at room temperature for 10 min to remove endogenous peroxidase activity. After a wash with PBS, the antigen was fixed with acid buffer (pH 6.0) and sealed for 20 min at room temperature with 5% normal goat serum to block nonspecific binding. A FAM111B goat anti-human polyclonal antibody (Novus,1:300 dilution) was added and incubated at 4℃ overnight. Following a wash with PBS, the biotinylated secondary antibody (polyclonal biotin-conjugated donkey anti-goat IgG; Abcam, UK; 1:200 dilution) was added and incubated at room temperature for 30 min. After washing with PBS, DAB was used for coloring, and the samples were stained with hematoxylin, dehydrated, cleared, and mounted with neutral gum. Specimens known to be positive for FAM111B expression were used as positive controls, and PBS was used as the negative control. Samples were processed by two experienced pathologists using the double-blind method. The immunohistochemical staining results from each group and each view were analyzed.\u003c/p\u003e \u003cp\u003eImmune response score (IRS)\u0026thinsp;=\u0026thinsp;SI (stain intensity, stain intensity) * PP(percentage of positive cells, percentage of positive cells)\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The staining intensity was scored according to the following scale: 0: negative; 1: Weak positive; 2: Moderate positive; 3: Strong positive. Positive cells were counted under the same lens using the following scale: no positive cells were 0 points, and 1 was the negative control. Samples were processed by two experienced pathol. Counts were performed 3 times by 2 pathologists, and the mean value was taken.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Cell lines and cell culture\u003c/h2\u003e \u003cp\u003eAll cells were obtained from the Yunnan Cancer Hospital and grown at 37℃ under a humidified 95%-5% (v/v) mixture of air and CO\u003csub\u003e2\u003c/sub\u003e. The human LUAD cell lines(NCI-H1299), LUSC cell lines (NCI-H520, NCI-H226, SK-MES-1), and the human bronchial epithelial cell line Beas-2B were maintained in RPMI medium 1640 supplemented with 10% fetal bovine serum (FBS) plus 50 units/ml penicillin and streptomycin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Real-Time Quantitative PCR (qPCR)\u003c/h2\u003e \u003cp\u003eCells were plated in triplicate into a 6-well plate incubated at 37℃ under a humidified 95%-5% (v/v) mixture of air and CO2. The cells in the logarithmic growth phase were collected and washed with PBS. Lung cancer tissue samples with clinical medical record information were collected from Yunnan Cancer Hospital for RNA extraction. TRIzol reagent (Invitrogen, Lot.252610) was used to extract total RNA from cell lines. The miRcute miRNA Isolation Kit (TIANGEN, Cat. #DP501) was used to extract the total RNA of tissue samples. The cDNA of cells and tissues was synthesized by RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Lot.00791016), and performed according to the protocol. PowerUp SYBR Green Master Mix was used for qRT-PCR in ABI7500 Real-Time PCR System as following reactions: 50\u0026deg;C for 2 min and 95\u0026deg;C for 10 min, and then 40 cycles of 95\u0026deg;C for 15 sec, 60\u0026deg;C for 30 sec, and 72\u0026deg;C for 30 sec. The relative gene expression was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e quantification method, and the housekeeping gene β-actin was used as a control. The primers used are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences (5\u0026prime;\u0026rarr;3\u0026prime;) of PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFAM111B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATATGGTAAACCCAGCGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAATCACTAGGCAGGCACTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCATTGGCAATGAGCGGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGTCTTTGCGGATGTCCACGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Western blot analysis\u003c/h2\u003e \u003cp\u003eThe total protein of the cell was extracted using Radio Immunoprecipitation Assay (Beyotime Biotechnology) and BCA Protein Assay Kit (Beyotime Biotechnology) to quantify. The 10% SDS-PAGE was performed with a separate equal amount of protein (20 \u0026micro;g) and then transferred to a 0.45 \u0026micro;m polyvinylidene fluoride (PVDF) membrane (EMD Millipore) via a trans-blotting system (Bio-Rad Laboratories, Inc.). The PVDF membrane was blocked in 5% TBST-configured skimmed milk (Bio-Rad Laboratories, Inc.) powder at room temperature for 2 hours, incubated overnight at 4\u0026deg;C with rabbit polyclonal antibodies against FAM111B (Novus Biologicals; cat. NBP1-86645), PI3K p85 (Affinity; cat. AF6241), P27 Kip1 (Cell Signaling Technology; cat. No. 3686), p21 Waf1/Cip1 (Cell Signaling Technology; cat. No. 37543), Phospho-PI3 Kinese p85 (Cell Signaling Technology; cat. No. 4228), Cyclin D1 (Cell Signaling Technology; cat. No. 2978), Cyclin D2 (Cell Signaling Technology; cat. No. 3741), CDK2 (Cell Signaling Technology; cat. No. 2546), CDK4 (Cell Signaling Technology; cat. No. 12790), Cyclin A2 (Cell Signaling Technology; cat. No. 67955), MDM2 (Cell Signaling Technology; cat. No. 86934), p53(Cell Signaling Technology; cat. 9282T), β-actin (Proteintech; cat. 20536-1-AP), E -cadherin (Proteintech; cat. 20874-1-AP), N-cadherin (Proteintech; cat. 22018-1-AP), GSK-3β (Proteintech; cat. 22104-1-AP), Phospho-GSK-3β (Proteintech; cat. 67558-1-Ig), C-myc (Proteintech; cat. 10828-1-AP), Phospho-AKT (Ser473) (Proteintech; cat. 80455-1-RR), Phospho-Akt (Thr308) (Proteintech; cat. 13038), AKT (Proteintech; cat. 60203-2-Ig) and then with the goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:20000; cat. No. ZB2301; AZGB-Bio) at room temperature for 1 h, and analyzed using enhanced chemiluminescence (ECL) detection kit (Applygen Technologies, Inc.). The β-actin (1:10000; cat. No. 42859; GeneTex) was used as the internal control. The density of the bands was analyzed using ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Construction of lentiviral shRNA vectors and transfection assay\u003c/h2\u003e \u003cp\u003eThe human LUSC cell line NCI-H226, SK-MES-1, was maintained in RPMI medium 1640 supplemented with 10% fetal bovine serum (FBS) plus 50 units/ml penicillin and streptomycin. The overexpression plasmid of FAM111B was purchased from Shanghai KeyGEN Co., Ltd.\u003c/p\u003e \u003cp\u003eThe cells were seeded into a 12-well plate at a rate of 1.5x10\u003csup\u003e5\u003c/sup\u003e cells per well for culture, and used for transfection 24 hours after seeding. According to the results of preliminary experiments, the optimal MOI (multiplicity of infection) for NCI-H226 lentivirus infection is 10, and the optimal MOI for SK-MES-1 lentivirus infection is 5. The control group and the experimental group were infected with CON077 and LV-FAM111B-RNAi lentivirus, respectively. Add an appropriate amount of virus and corresponding infection enhancement solution to each well of the 12-well plate, shake the medium slightly, put the 12-well plate in a cell culture incubator for 12 hours, and then replace it with 1640 medium containing 10% FBS. After 72 hours, the 12-well plate was placed under a fluorescence microscope to observe the infection efficiency. Lentivirus-transfected cell lines were screened with puromycin (minimum puro concentration 2.5ug/ml) for 14 days. The transfection efficiency was evaluated by real-time quantitative RT-PCR (qRT-PCR) and western blot.\u003c/p\u003e \u003cp\u003eThe shRNA target sequences were listed as follows: hU6-MCS-Ubiquitin-EGFP-IRES-puromycin, shRNA sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The sequence of the control empty vector was: TTCTCCGAACGTGTCACGT.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe shRNA target sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNO.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget Seq\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCDS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGC%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGV248-NC\u003c/p\u003e \u003cp\u003e(CON077)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTCCGAACGTGTCACGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e42.11%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFAM111B-RNAi(96900-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_198947\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCGAACAGCTTACATATTATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e192..2396\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e26.32%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFAM111B-RNAi(96901-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_198947\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTGCCTAGTGATTCTCATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e192..2396\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e42.11%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFAM111B-RNAi(96902-1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_198947\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCATAAAGACATGCACATATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e192..2396\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e26.32%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Cell Counting Assay\u003c/h2\u003e \u003cp\u003eLogarithmic NCI-H226 and SK-MES-1 transfected cells were collected by trypsin digestion and counted after suspension and dilution. Inoculated with 5000/ml cell concentration in a 24-well culture plate and placed in a cell incubator. After 24 hours of culture, 3 cells with multiple pores were digested and collected, and the number of cells in each well was detected for a total of 7 days. Growth curves were drawn according to the number of cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Cell counting kit-8 (CCK-8)\u003c/h2\u003e \u003cp\u003eNCI-H226 and SK-MES-1 transfected cells at the logarithmic growth stage were collected by trypsin digestion and counted after suspension dilution. The cell suspension was adjusted to the desired concentration (5400 /well) and inoculated on the 96-well culture plate at a volume of 90\u0026micro;l/ well. After incubation with CCK-8 for 2h at 24h, 48h, 72h, 96h, and 120h, the absorbance of each hole at 450nm was measured by enzyme-labeler. The cell proliferation curve was drawn according to the mean and standard deviation of OD values corresponding to different time points.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 FAM111B overexpression and EDU cell proliferation assay\u003c/h2\u003e \u003cp\u003eWe constructed the full-length FAM111B gene and subcloned it into the pCDH-3xFlag lentiviral vector. Lentiviruses were produced by co-transfecting HEK293T cells with the packaging plasmids (PSPAX2 and PMD2.G) and the pCDH-FAM111B-3xFlag plasmid using PEI (poly sciences, 24765) in Opti-MEM (Gibco, 31985070). Supernatants were harvested 48 hours post-transfection and used to infect SK-MES-1 cells, which were subsequently selected with puromycin (1 \u0026micro;g/mL).\u003c/p\u003e \u003cp\u003eFor EDU proliferation assays, shNC, shFAM111B (3\u0026rsquo;UTR: CTCATAAGTGGAAGCTAAATA), shFAM111B-PCDH3xFlag, and shFAM111B-OE SK-MES-1 cells were seeded in 24-well plates (2\u0026times;10⁴ cells/well). After adherence, cells were stained using the BeyoClick\u0026trade; EdU Kit (Beyotime, C0071S) according to the manufacturer's instructions. EdU and Hoechst signals were visualized by fluorescence microscopy, and positive cells were quantified using Image J.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Wound-Healing Assay\u003c/h2\u003e \u003cp\u003eMark two straight lines on the rear of the six-hole plate using a marker. The cells at the logarithmic growth stage of NCI-H226 and SK-MES-1 were transfected and prepared into a cell suspension with a concentration of 6\u0026times;10\u003csup\u003e5\u003c/sup\u003e /mL and then inoculated in the six-well plate. Use a 10\u0026micro;l gun with the six-hole plate held upright at a 90-degree angle for scoring. The medium in the wells was discarded to remove the suspended cells, and then the six-well plates were placed in an incubator at 37℃ with appropriate normal saline. After 24h, 48h, and 72h, the necrotic cells were washed again with PBS buffer three times, and then observed under a microscope and photographed. Image J software was used to calculate the scratch area, histogram, and scratch area change.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Transwell Assay\u003c/h2\u003e \u003cp\u003eCorning transwell chambers (Cat. 3422) were used to perform the transwell migration assay. Add 200\u0026micro;l preheated base medium to the upper chamber and preheat it in the incubator for 2 hours. The cells were transfected with NCI-H226 and SK-MS-1 at the logarithmic growth stage and were inoculated with 1\u0026times;105/ml at 200\u0026micro;l per well in the upper chamber. After 24h, approximately 600\u0026micro;l of complete medium was added to the lower chamber of the 24-well plate, and then the chamber was placed in the well containing the complete medium. After 48 hours of removal of the chamber, the remaining cells on the surface layer of the upper chamber were wiped with a cotton swab, and then the chamber was washed 3 times with normal saline. Then add paraformaldehyde 600ul to the lower chamber and fix for at least 30 minutes. After washing the chamber with normal saline 3 times, add 0.1% crystal violet to the lower chamber and stain it for at least 30 minutes. Then take it out and wash it with normal saline 3 times. After cleaning, select 5 visual fields for each chamber. The Image J software is used to calculate the number of cells passing through the diaphragm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Flow cytometry analysis\u003c/h2\u003e \u003cp\u003eThe cells were inoculated in a 6-well plate and cultured in 1640 complete medium containing 10%FBS for 72 hours. The cells were centrifuged with pancreatic digestive enzymes without EDTA, and the level of apoptosis was detected by AnnexinV-kFluor647/PI double staining apoptosis detection kit (KeyGEN BioTECH, 277444). The experimental results were analyzed by flowjoV10 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Clone formation assay\u003c/h2\u003e \u003cp\u003eThe cells were spread into 6-well plates at 2500 / well, and each group had three Wells. The cells were placed in an incubator containing 5%CO\u003csub\u003e2\u003c/sub\u003e at 37℃ for about 12 days, and the medium was changed regularly to observe the cell viability. Add an appropriate amount of 4% paraformaldehyde to cover the bottom of each hole, fix the cells for about 30 minutes, rinse with normal saline, then add 0.1% crystal violet for two hours, and finally rinse the staining solution with water. Imaging was performed under an inverted microscope, and the number of clones was counted by Image J software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14 Construction of xenograft model\u003c/h2\u003e \u003cp\u003eLogarithmic growth stage cells were taken, and 0.2ml was inoculated into the left or right armpit of each nude mouse at a concentration of 2\u0026times;10\u003csup\u003e7\u003c/sup\u003e /mL. Forty-five vaccinated nude mice were randomly divided into three groups: sh-NC, sh-FAM111B-2, and sh-FAM111B-3, with 15 mice in each group. Seven days after inoculation, tumor growth was observed, and tumor volume was measured twice a week. Tumors were removed on day 49, weighed, and fixed in a centrifuge tube with 4% paraformaldehyde. Following euthanasia via cervical dislocation, tissue samples were collected from all nude mice. The experimental procedures were reviewed and approved by the Institutional Animal Ethics Committee.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.15 Bulk RNA Sequencing (RNA-seq)\u003c/h2\u003e \u003cp\u003eTRIzol extraction of cell RNA from the control group and sh-FAM111B-2 and sh-FAM111B-3 experimental groups, reverse transcription, amplification, andsequencing library preparation and sequencing were conducted by Lynk \u0026amp; Co Biotechnology (Kunming, China) Co., Ltd. (website: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.biolinker.com\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.biolinker.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The library quality assessment comprises three primary methods: (1) Initial quantification of library concentration was performed using Qubit 2.0; (2) Fragment integrity and insert size were analyzed using the Agilent 2100 Bioanalyzer; (3) Precise quantification of effective library concentration was carried out via qPCR.\u003c/p\u003e \u003cp\u003eFollowing successful quality assessment, libraries were pooled into flow cells based on their effective concentrations and the instrument\u0026rsquo;s required data output. Cluster generation was subsequently performed on the cBOT platform, followed by sequencing on the Illumina NovaSeq high-throughput sequencing system. Bulk RNA Sequencing raw data were logged into PUTTY (version 0.79) and analyzed by RStudio Server.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.16 PI3K Agonist Rescue Assay\u003c/h2\u003e \u003cp\u003eThe shNC and shFAM111B (3\u0026rsquo;UTR: CTCATAAGTGGAAGCTAAATA) SK-MES-1 cells in the logarithmic growth phase were digested, counted, and seeded into 96-well plates at 1,000 cells per well. The cells were divided into a solvent control group and a PI3K agonist-treated group. Following overnight culture at 37\u0026deg;C with 5% CO₂, the PI3K agonist group was supplemented with 740Y-P at a final concentration of 2 \u0026micro;M, while the control group received an equal volume of DMSO. Cell viability was measured at indicated time points using the CCK-8 assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e2.17 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe data were expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) and were analyzed by SPSS 24.0. The comparison of the results between the groups was analyzed by one-way ANOVA. The rank-sum test was used when the variances were uneven. Significant differences were considered when P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (α\u0026thinsp;=\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Bioinformatics analysis of FAM111B in LUSC\u003c/h2\u003e \u003cp\u003eAnalysis using the UALCAN online platform revealed that the expression of FAM111B was significantly higher in both LUSC and LUAD tissues compared with normal controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In LUSC, FAM111B expression was significantly elevated across different age groups and disease stages compared to normal tissues, and showed an increasing trend with advancing patient age (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u0026ndash;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Results from the GEPIA2 database further confirmed that FAM111B expression levels were significantly upregulated in LUSC and LUAD relative to normal tissues, with a more pronounced difference observed in LUSC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Additionally, analysis based on the Kaplan-Meier Plotter database indicated that high expression of the FAM111B gene was significantly associated with poor survival outcomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.2 The expression of the FAM111B gene was positively correlated with LUSC\u003c/h2\u003e \u003cp\u003eReal-time PCR analysis revealed that FAM111B exhibited high levels of reverse transcription expression in both LUAD and LUSC tissues, which were clinical lung cancer tissues collected in the pre-experiment (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001), with significantly higher expression in LUSC tissues compared to LUAD tissues (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). To investigate the protein expression of FAM111B in LUSC, we collected postoperative paired tissue samples from 74 LUSC patients and 72 LUAD patients. Immunohistochemistry (IHC) results demonstrated that FAM111B was localized in both the nucleus and cytoplasm, with brown staining indicating protein binding. The positive expression rate of FAM111B in LUSC tissues (85.14%, n\u0026thinsp;=\u0026thinsp;74) (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) was significantly higher than in LUAD tissues (58.33%, n\u0026thinsp;=\u0026thinsp;72) (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Furthermore, FAM111B expression was notably elevated in advanced-stage (III, IV) patients (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and higher in patients with tumor sizes classified as T2\u0026ndash;T4 compared to those with T1 tumors (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Patients with lymph node metastasis also exhibited significantly higher FAM111B protein expression than those without metastasis (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These findings suggest that FAM111B is closely associated with the progression of LUSC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe relationship between the expression of FAM111B protein in 146 cases of NSCLC tissues and clinicopathological indicators of patients.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFactors\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNo. of cases\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFAM111B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eX\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePositive(%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNegative(%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale(n\u0026thinsp;=\u0026thinsp;102)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e84(82.35)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18(17.65)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e18.249\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale(n\u0026thinsp;=\u0026thinsp;44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21(47.73)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23(52.27)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;55(n\u0026thinsp;=\u0026thinsp;58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42(72.36)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16(27.64)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.012\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.914\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026gt;55(n\u0026thinsp;=\u0026thinsp;88)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e63(71.59)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25(28.41)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHistology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLUSC(n\u0026thinsp;=\u0026thinsp;74)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e63(85.14)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11(14.86)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e12.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLUAD(n\u0026thinsp;=\u0026thinsp;72)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42(58.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30(41.67)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eStage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eⅠ-Ⅱ(n\u0026thinsp;=\u0026thinsp;92)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e61(66.30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e31(33.70)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e3.881\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.049*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eⅢ-Ⅳ(n\u0026thinsp;=\u0026thinsp;54)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e44(81.48)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10(18.52)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGrading of tumors\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT1(n\u0026thinsp;=\u0026thinsp;42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24(57.14)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18(42.86)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e6.373\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.012*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eT2-T4(n\u0026thinsp;=\u0026thinsp;104)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e81(77.89)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23(22.11)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eLymphatic metastasis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYes(n\u0026thinsp;=\u0026thinsp;60)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e49(81.67)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11(18.33)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e6.666\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e0.036*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo(n\u0026thinsp;=\u0026thinsp;83)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e53(63.86)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30(36.14)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUnable to evaluate (n\u0026thinsp;=\u0026thinsp;3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3(100.00)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0(0.00)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTo further investigate the role of FAM111B, we designed three shRNA constructs and transfected NCI-H226 and SK-MES-1 cells using lentiviral vectors to establish a FAM111B-knockdown cell model (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Knockdown of FAM111B inhibits the proliferation, migration, clonability, and invasion of LUSC cells.\u003c/h2\u003e \u003cp\u003eWe assessed cell proliferation using the CCK-8 assay and observed that the proliferation of LUSC cells in the sh-FAM111B-2 and sh-FAM111B-3 groups was significantly lower compared to the negative control (sh-NC) group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). EDU cell proliferation assay showed that the proliferation of FAM111B-OE group was significantly higher than that of shNC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eA, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). These findings further confirm that knocking down FAM111B significantly inhibits the proliferation of lung squamous cell carcinoma (LUSC) cells in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe clone formation assay revealed that the number of colonies formed by LUSC cells in the sh-FAM111B-2 and sh-FAM111B-3 groups was significantly reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). These results indicate that knocking down FAM111B effectively inhibits the clonogenic ability of LUSC cells in vitro.\u003c/p\u003e \u003cp\u003eThe wound-healing assay results demonstrated that, compared to the negative control (sh-NC) group, the scratch area in the sh-FAM111B-2 and sh-FAM111B-3 groups showed minimal healing at 24, 48, and 72 hours (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). In contrast, the scratch area in the negative control group was significantly reduced over the same period. Additionally, the Transwell assay revealed that the number of migrating and invading cells in the sh-FAM111B-2 and sh-FAM111B-3 groups was markedly lower than in the negative control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eL). These findings indicate that knocking down FAM111B effectively inhibits the migration and invasion of LUSC cells in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Knocking down FAM111B significantly inhibited the cell cycle of LUSC in vitro\u003c/h2\u003e \u003cp\u003eFlow cytometry analysis revealed that the total apoptosis rate of sh-FAM111B-2 and sh-FAM111B-3 cells did not significantly differ from that of the negative control (sh-NC) group, suggesting that knocking down FAM111B does not affect the apoptotic capacity of NCI-H226 and SK-MES-1 cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). However, the cell cycle assay demonstrated that, compared to the sh-NC group, the number of cells in the S phase was significantly increased in the FAM111B knockdown groups, while the number of cells in the G2/M phase was reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). This indicates that the cell cycle was arrested in the S phase. These findings suggest that knocking down FAM111B in vitro significantly inhibits the cell cycle progression of LUSC cells, leading to S phase arrest.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Transcriptome sequencing and differential gene cluster analysis of NCI-H226 (sh-FAM111B-2/3)\u003c/h2\u003e \u003cp\u003eThe Q30 base rate for sh-NC, sh-FAM111B-2, and sh-FAM111B-3 samples exceeded 90%, confirming the reliability of the sequencing data. The raw sequencing data were logged into PUTTY (version 0.79) and analyzed by RStudio Server.. A total of 22,551 genes were differentially expressed between sh-FAM111B-2/sh-FAM111B-3 and sh-NC, with 1,545 genes showing statistically significant differences (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). Among these, 947 genes were downregulated, and 598 genes were upregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). KEGG enrichment analysis identified the PI3K-AKT signaling pathway as the most relevant pathway associated with FAM111B-mediated gene downregulation. Key upstream target genes, including PGF, VEGFA, NGFR, FGFR4, COL4A2, and LAMB3, were found to be downregulated. Additionally, the protein-coding gene PIK3CD, a core component of the PI3K signaling pathway, was downregulated, along with the downstream cell cycle-related gene CCND2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWestern blot analysis revealed that, compared to the sh-NC group, the total protein levels of PI3K, AKT in FAM111B-knockdown NCI-H226 cells did not show significant changes. The phosphorylated forms of PI3K and AKT were significantly downregulated. Furthermore, downstream components of the PI3K signaling pathway exhibited notable changes: the expression of P21, P27, and P53 proteins was upregulated, whereas the expression of CCND1, CCND2, CCNA2, MDM2, CDK2, CDK4, and c-Myc proteins was downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Furthermore, the PI3K Agonist Rescue Assay revealed that cell proliferation in the 740Y-P group was significantly higher than that in the negative control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Differences in PI3K signaling pathway-related proteins in transplanted nude mice with FAM111B knockdown\u003c/h2\u003e \u003cp\u003eUsing a xenograft tumor model in nude mice with NCI-H226 cells, we observed that after 28 days, tumor growth in the sh-FAM111B-2 and sh-FAM111B-3 groups was significantly reduced compared to the negative control (sh-NC) group. These results demonstrate that knocking down FAM111B significantly inhibits the growth of LUSC xenografts in nude mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWestern blot analysis of xenograft tumors in nude mice revealed that, compared to the sh-NC group, the total protein levels of PI3K and AKT showed no significant changes. However, the phosphorylation levels of PI3K and AKT were markedly reduced. Additionally, downstream components of the PI3K signaling pathway exhibited notable changes: the expression of P21, P27, and P53 proteins was upregulated, while the expression of CCND1, CCND2, CDK2, CDK4, CDK6, and MMP2 proteins was downregulated. Furthermore, among epithelial-mesenchymal transition (EMT)-related proteins, the expression of N-cadherin was downregulated, whereas E-cadherin expression was upregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eC, \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eLUSC is a type of NSCLC, which originates in the center of the lung and easily metastasizes to other parts of the body, such as lymph, liver, bone, and brain, bringing a huge burden to the social medical system and LUSC patients\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Various driver gene mutations are common in LUSC, including FGFR1, CCND2, PIK3CA, CDKN2A, and TP53\u003csup\u003e26\u003c/sup\u003e. Due to the high frequency of genetic mutations in LUSC, few genetic targets can be used for patent drugs in LUSC. So far, targeted therapies for LUSC are still lacking.\u003c/p\u003e \u003cp\u003eWe identified that FAM111B is abnormally highly expressed in lung cancer tissues in preliminary experiments. IHC further revealed that FAM111B expression was found to correlate with key clinicopathological features, such as gender and histological type, based on clinical medical records. These findings suggest that FAM111B may play a crucial role in the malignant progression of LUSC, and we aim to explore how FAM111B drives oncogenic processes in LUSC and whether these mechanisms differ from its role in LUAD.\u003c/p\u003e \u003cp\u003eIn this study, we observed that the expression of FAM111B was significantly higher in LUSC compared to LUAD. The FAM111B-knockdown models demonstrated that FAM111B knockdown inhibited key biological behaviors, including cell proliferation, migration, invasion, wound healing, and colony formation. Furthermore, FAM111B knockdown did not affect apoptosis in LUSC cells. It significantly inhibited the cell cycle, leading to S phase arrest. The xenograft tumor model confirmed that FAM111B knockdown significantly suppressed the growth of LUSC tumors. RNA-seq revealed that the differentially expressed genes were closely associated with the PI3K signaling pathway, which was known to regulate critical malignant behaviors in cancer. Based on these findings, we speculate that FAM111B may promote LUSC progression by regulating upstream genes of the PI3K signaling pathway, thereby influencing the activity of PI3K-related proteins.\u003c/p\u003e \u003cp\u003eAKT typically inhibits GSK3β activity through phosphorylation, a mechanism that is inconsistent with our research results. In our study, we constructed H226 with low expression of FAM111B using shRNA and found inconsistent expression of p-GSK3β. However, the alterations in the PI3K/AKT/cMyc pathway align with those reported in previous studies. This suggests that GSK3β may not serve as an intermediary node in FAM111B-mediated cell regulation. The underlying mechanisms warrant further investigation. The proliferation function of FAM111B knockdown cells was also restored when PI3K was inhibited, which also proved that FAM111B was involved in cell regulation through PI3K.We speculate that FAM111B knockdown, mediated through the PI3K/AKT/c-Myc pathway, led to the downregulation of CCND1. Additionally, the expression of CCND1, CCND2, CCNA2, CDK2, and CDK4 was reduced via the PI3K/AKT/P21 and P27 pathways, resulting in cell cycle arrest in the S phase. P21 and P27 are critical cyclin-dependent kinase inhibitors, and their overexpression can prevent cells from progressing into the S phase\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Additionally, the interaction between CDK2 and Cyclin A is essential for regulating the progression from the S phase to the G2 phase\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Previous studies have found that knocking down FAM111B can increase p53 protein expression in LUAD cells\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Knockdown of FAM111B decreased the expression of N-cadherin and MMP2 protein, and increased the expression of E-cadherin protein, suggesting that FAM111B may promote the EMT process, thereby affecting the migration and invasion of LUSC (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThis study elucidated the general mechanism of FAM111B in LUSC. However, whether FAM111B interacts with other proteins to regulate the phosphorylation of PI3K remains to be further explored. Due to the limited number of experimental samples, this study focused solely on verifying the expression and mechanistic role of FAM111B in LUSC. Additionally, the study lacks a comparative analysis of FAM111B's role in LUAD, which would provide valuable context. Further validation using animal models with other lung cancer cell lines is necessary to strengthen the findings and enhance their credibility.\u003c/p\u003e \u003cp\u003ePI3K inhibitors diminish the catalytic activity of PI3K or its specific subtypes (α, β, δ, γ), leading to a reduction in PIP3 production, which subsequently inhibits the activation of AKT and downstream signal transduction pathways, resulting in tumor cell cycle arrest, suppression of proliferation, promotion of apoptosis, and potentially inhibition of angiogenesis and metastasis. Recent research on cancer therapy has demonstrated that the combination of PI3Kα-selective inhibitors (Inavolisib\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e) with fulvestrant and palbociclib significantly enhances efficacy in overcoming drug resistance associated with PI3KA-mutated breast cancer\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, and the combination of inavolisib and osimertinib as a first-line treatment for advanced NSCLC harboring EGFR mutations and detectable PIK3CA aberrations is currently ongoing. This effect is particularly pronounced when the mechanism underlying drug resistance involves PIK3CA mutations or amplifications.\u003c/p\u003e \u003cp\u003eThe sample size and methods of this study have limitations, which leads to the unclear specificity of the potential mechanism between FAM111B and the PI3K signaling pathway in LUSC, as well as the specific molecular mechanism by which FAM111B blocks LUSC in the S phase. Therefore, we plan to expand the sample size and include additional lung cancer models to further delineate the LUSC-specific regulatory mechanism of FAM111B, particularly its interplay with the PI3K/AKT/c-Myc, p-AKT/E-cadherin, and MMP2/MMP9 pathways. In addition, protein-protein interaction technology will be used to explore the specific mechanism of FAM111B knockdown to arrest cells in S phase. These efforts will provide a deeper understanding of FAM111B's role in LUSC progression. Furthermore, we aim to design targeted signaling pathway inhibitors based on the regulatory mechanisms of FAM111B, paving the way for future clinical research and therapeutic development.\u003c/p\u003e \u003cp\u003eIn summary, we have demonstrated that FAM111B likely regulates downstream targets such as c-MycP21, and P27 by modulating the phosphorylation of PI3K and AKT proteins, thereby promoting the proliferation and cell cycle progression of LUSC, which are different with LUAD. Additionally, FAM111B may facilitate epithelial-mesenchymal transition (EMT) processes, including LUSC migration and invasion, by regulating the expression of E-cadherin and N-cadherin. These findings highlight FAM111B as a promising therapeutic target for LUSC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003eAll animal experiments in the present study were conducted in accordance with the regulations for the administration of affairs concerning experimental animals and relevant institutional guidelines. The experiments were approved by the Ethical Committee of Kunming Medical University (Approval no. KMMU2020016 for animal experiments and KMMU2020MEC053 for human study).\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eConflicts of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by grants from: 1. National Natural Science Foundation of China (Regional Science Foundation Project: 82360459): Study on the mechanism of YBX1 dependent on m6A modification of stable FAM111B to promote LUSC. 2. Applied Basic Research Project of Yunnan Province (Key joint project: 202401AY070001-025): Research on the pathogenesis of lung squamous cell carcinoma based on FAM111B.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eYajuan Chen provided the funding and manuscript writing. Shiwei Chai, Yunyi Chen and Huimin Wang were responsible for conducting the experiment and obtaining the data. Yanting Bi, Yifei Ma, Ruotian Li and Ruiyi Liu were responsible for collecting and organizing the data. Zaoxiu Hu and Shaoxiang Wan guided the experiment and were responsible for the proofreading of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data generated in the present study may be requested from the corresponding author. The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive (Genomics, Proteomics \u0026amp; Bioinformatics 2025) in National Genomics Data Center (Nucleic Acids Res 2025), China National Center for Bioinformation / Beijing Institute of Genomics, Chinese Academy of Sciences (GSA-Human: HRA014876) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa-human.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGLOBOCAN 2023.International Agency for Research on Cancer.WHO. Available online: (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gco.iarc.fr/\u003c/span\u003e\u003cspan address=\"http://gco.iarc.fr/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, accessed 13 March 2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodriguez-Canales, J., Parra-Cuentas, E. \u0026amp; Wistuba, I. I. Diagnosis and Molecular Classification of Lung Cancer. \u003cem\u003eCancer Treat. Res.\u003c/em\u003e \u003cb\u003e170\u003c/b\u003e, 25\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-3-319-40389-2_2\u003c/span\u003e\u003cspan address=\"10.1007/978-3-319-40389-2_2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhong, H. et al. First-line penpulimab combined with paclitaxel and carboplatin for metastatic squamous non-small-cell lung cancer in China (AK105-302): a multicentre, randomised, double-blind, placebo-controlled phase 3 clinical trial. \u003cem\u003eLancet Respir Med.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 355\u0026ndash;365. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s2213-2600(23)00431-9\u003c/span\u003e\u003cspan address=\"10.1016/s2213-2600(23)00431-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong, M. et al. The analysis of surgical prognostic factors and molecular typing of locally advanced lung squamous cell carcinomas. \u003cem\u003eAsia Pac. J. Clin. Oncol.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, e226\u0026ndash;e237. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ajco.13438\u003c/span\u003e\u003cspan address=\"10.1111/ajco.13438\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuCote, T. J. et al. EZH2 Inhibition Promotes Tumor Immunogenicity in Lung Squamous Cell Carcinomas. \u003cem\u003eCancer Res. Commun.\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e, 388\u0026ndash;403. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/2767-9764.Crc-23-0399\u003c/span\u003e\u003cspan address=\"10.1158/2767-9764.Crc-23-0399\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrainson, C. F. et al. Description of a Lung Cancer Hotspot: Disparities in Lung Cancer Histology, Incidence, and Survival in Kentucky and Appalachian Kentucky. \u003cem\u003eClin. Lung Cancer\u003c/em\u003e. \u003cb\u003e22\u003c/b\u003e, e911\u0026ndash;e920. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cllc.2021.03.007\u003c/span\u003e\u003cspan address=\"10.1016/j.cllc.2021.03.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos, E. S. \u0026amp; Rodriguez, E. Treatment Considerations for Patients With Advanced Squamous Cell Carcinoma of the Lung. \u003cem\u003eClin. Lung Cancer\u003c/em\u003e. \u003cb\u003e23\u003c/b\u003e, 457\u0026ndash;466. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cllc.2022.06.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cllc.2022.06.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiu, Z., Jin, R., Zhang, Y. \u0026amp; Li, H. Signaling pathways and targeted therapies in lung squamous cell carcinoma: mechanisms and clinical trials. \u003cem\u003eSignal. Transduct. Target. Ther.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 353. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-022-01200-x\u003c/span\u003e\u003cspan address=\"10.1038/s41392-022-01200-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAddeo, A. et al. Fibroblast growth factor receptor (FGFR) inhibitor rogaratinib in patients with advanced pretreated squamous-cell non-small cell lung cancer over-expressing FGFR mRNA: The SAKK 19/18 phase II study. \u003cem\u003eLung Cancer\u003c/em\u003e. \u003cb\u003e172\u003c/b\u003e, 154\u0026ndash;159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lungcan.2022.08.016\u003c/span\u003e\u003cspan address=\"10.1016/j.lungcan.2022.08.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHashemi-Sadraei, N. \u0026amp; Hanna, N. Targeting FGFR in Squamous Cell Carcinoma of the Lung. \u003cem\u003eTarget. Oncol.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 741\u0026ndash;755. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11523-017-0513-6\u003c/span\u003e\u003cspan address=\"10.1007/s11523-017-0513-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJi, L. et al. The NRF2 antagonist ML385 inhibits PI3K-mTOR signaling and growth of lung squamous cell carcinoma cells. \u003cem\u003eCancer Med.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 5688\u0026ndash;5702. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/cam4.5311\u003c/span\u003e\u003cspan address=\"10.1002/cam4.5311\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue, X. et al. PI3Kα inhibitor GNE-493 triggers antitumor immunity in murine lung cancer by inducing immunogenic cell death and activating T cells. \u003cem\u003eInt. Immunopharmacol.\u003c/em\u003e \u003cb\u003e130\u003c/b\u003e, 111747. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2024.111747\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2024.111747\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBesse, B. et al. A phase 1b study of necitumumab in combination with abemaciclib in patients with stage IV non-small cell lung cancer. \u003cem\u003eLung Cancer\u003c/em\u003e. \u003cb\u003e137\u003c/b\u003e, 136\u0026ndash;143. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lungcan.2019.09.002\u003c/span\u003e\u003cspan address=\"10.1016/j.lungcan.2019.09.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi, R. et al. Targeting the CDK4/6-Rb Pathway Enhances Response to PI3K Inhibition in PIK3CA-Mutant Lung Squamous Cell Carcinoma. \u003cem\u003eClin. Cancer Res.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e, 5990\u0026ndash;6000. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/1078-0432.Ccr-18-0717\u003c/span\u003e\u003cspan address=\"10.1158/1078-0432.Ccr-18-0717\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWelter, A. L. \u0026amp; Machida, Y. J. Functions and evolution of FAM111 serine proteases. \u003cem\u003eFront. Mol. Biosci.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 1081166. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmolb.2022.1081166\u003c/span\u003e\u003cspan address=\"10.3389/fmolb.2022.1081166\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArowolo, A., Malebana, M., Sunda, F. \u0026amp; Rhoda, C. Proposed Cellular Function of the Human FAM111B Protein and Dysregulation in Fibrosis and Cancer. \u003cem\u003eFront. Oncol.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 932167. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2022.932167\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2022.932167\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, N. et al. FAM111B Acts as an Oncogene in Bladder Cancer. \u003cem\u003eCancers (Basel)\u003c/em\u003e. \u003cb\u003e15\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cancers15215122\u003c/span\u003e\u003cspan address=\"10.3390/cancers15215122\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, H. \u0026amp; Liang, C. Pan-Cancer Analysis of the Tumorigenic Effect and Prognostic Diagnostic Value of FAM111B in Human Carcinomas. \u003cem\u003eInt. J. Gen. Med.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 1845\u0026ndash;1865. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/ijgm.S409690\u003c/span\u003e\u003cspan address=\"10.2147/ijgm.S409690\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, W., Gu, Y., Ni, H., Quan, Q. \u0026amp; Guo, L. Silencing of FAM111B inhibits tumor growth and promotes apoptosis by decreasing AKT activity in ovarian cancer. \u003cem\u003eExp. Biol. Med. (Maywood)\u003c/em\u003e. \u003cb\u003e248\u003c/b\u003e, 1043\u0026ndash;1055. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/15353702231160326\u003c/span\u003e\u003cspan address=\"10.1177/15353702231160326\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta, S., Silveira, D. A. \u0026amp; Mombach, J. C. M. Towards DNA-damage induced autophagy: A Boolean model of p53-induced cell fate mechanisms. \u003cem\u003eDNA Repair. (Amst)\u003c/em\u003e. \u003cb\u003e96\u003c/b\u003e, 102971. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.dnarep.2020.102971\u003c/span\u003e\u003cspan address=\"10.1016/j.dnarep.2020.102971\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, W., Hu, S., Han, Z. \u0026amp; Jiang, X. YY1-Induced Transcriptional Activation of FAM111B Contributes to the Malignancy of Breast Cancer. \u003cem\u003eClin. Breast Cancer\u003c/em\u003e. \u003cb\u003e22\u003c/b\u003e, e417\u0026ndash;e425. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.clbc.2021.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.clbc.2021.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta, S., Silveira, D. A. \u0026amp; Hashimoto, R. F. A Boolean model of the oncogene role of FAM111B in lung adenocarcinoma. \u003cem\u003eComput. Biol. Chem.\u003c/em\u003e \u003cb\u003e106\u003c/b\u003e, 107926. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.compbiolchem.2023.107926\u003c/span\u003e\u003cspan address=\"10.1016/j.compbiolchem.2023.107926\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRemmele, W. \u0026amp; Stegner, H. E. [Recommendation for uniform definition of an immunoreactive score (IRS) for immunohistochemical estrogen receptor detection (ER-ICA) in breast cancer tissue]. \u003cem\u003ePathologe\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 138\u0026ndash;140 (1987).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong, G. Q. et al. The necroptosis signature and molecular mechanism of lung squamous cell carcinoma. \u003cem\u003eAging (Albany NY)\u003c/em\u003e. \u003cb\u003e15\u003c/b\u003e, 12907\u0026ndash;12926. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/aging.205210\u003c/span\u003e\u003cspan address=\"10.18632/aging.205210\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuttapadu, R. et al. Identification of novel biomarkers for lung squamous cell carcinoma. \u003cem\u003e3 Biotech.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s13205-023-03489-z\u003c/span\u003e\u003cspan address=\"10.1007/s13205-023-03489-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoon, H. K., Thalor, A. \u0026amp; Gupta, D. Machine learning analysis of lung squamous cell carcinoma gene expression datasets reveals novel prognostic signatures. \u003cem\u003eComput. Biol. Med.\u003c/em\u003e \u003cb\u003e165\u003c/b\u003e, 107430. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.compbiomed.2023.107430\u003c/span\u003e\u003cspan address=\"10.1016/j.compbiomed.2023.107430\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMassey, A. J., Benwell, K., Burbridge, M., Kotschy, A. \u0026amp; Walmsley, D. L. Targeting DYRK1A/B kinases to modulate p21-cyclin D1-p27 signalling and induce anti-tumour activity in a model of human glioblastoma. \u003cem\u003eJ. Cell. Mol. Med.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 10650\u0026ndash;10662. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jcmm.17002\u003c/span\u003e\u003cspan address=\"10.1111/jcmm.17002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, Y. et al. Duck hepatitis A virus type 1 mediates cell cycle arrest in the S phase. \u003cem\u003eVirol. J.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12985-022-01839-6\u003c/span\u003e\u003cspan address=\"10.1186/s12985-022-01839-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanan, E. J. et al. Discovery of GDC-0077 (Inavolisib), a Highly Selective Inhibitor and Degrader of Mutant PI3Kα. \u003cem\u003eJ. Med. Chem.\u003c/em\u003e \u003cb\u003e65\u003c/b\u003e, 16589\u0026ndash;16621. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.jmedchem.2c01422\u003c/span\u003e\u003cspan address=\"10.1021/acs.jmedchem.2c01422\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGambardella, V. et al. Safety overview and management of inavolisib alone and in combination therapies in PIK3CA-mutated, HR-positive, HER2-negative advanced breast cancer (GO39374). \u003cem\u003eESMO Open.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 105303. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.esmoop.2025.105303\u003c/span\u003e\u003cspan address=\"10.1016/j.esmoop.2025.105303\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Lung squamous cell carcinoma, FAM111B, PI3K","lastPublishedDoi":"10.21203/rs.3.rs-8974853/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8974853/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLung squamous cell carcinoma (LUSC) is a subtype of non-small cell lung cancer (NSCLC). Compared to lung adenocarcinoma (LUAD), LUSC is characterized by a greater propensity for recurrence and metastasis, poorer prognosis, shorter survival. Therefore, further research into the pathogenesis of LUSC and the identification of new therapeutic targets are essential to advance clinical treatment options for this aggressive cancer. FAM111B, a serine protease and cancer-associated nuclear protein, has been implicated in various cancers. Previous studies have shown that FAM111B is closely associated with the progression of LUAD. However, our pan-cancer analysis suggests that FAM111B may play an even more significant role in LUSC, which revealed that FAM111B is highly expressed in LUSC tissues and exhibits significant clinical correlations with patient gender, histological type, tumor size, and stage. To investigate the functional role of FAM111B in LUSC, we developed both in vitro and in vivo knockdown models. Our results demonstrate that knocking down FAM111B significantly inhibits the proliferation, migration, and invasion of LUSC cells. Additionally, FAM111B knockdown induces cell cycle arrest in the S phase, further underscoring its role in LUSC progression. Mechanistically, FAM111B promotes LUSC migration and invasion by facilitating epithelial-mesenchymal transition (EMT). Moreover, the proliferation and cell cycle processes in LUSC are regulated through the PI3K signaling pathway. In conclusion, our study elucidates the clinical relevance and molecular mechanisms of FAM111B in LUSC, highlighting its potential as a novel therapeutic target for this challenging cancer subtype.\u003c/p\u003e","manuscriptTitle":"FAM111B may promote the progression of lung squamous cell carcinoma through PI3K signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-08 05:21:35","doi":"10.21203/rs.3.rs-8974853/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-13T09:38:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-11T22:32:46+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-10T18:41:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"250489450872538687649386127654116402184","date":"2026-04-02T17:42:31+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-01T07:03:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"105419574782778962104108517326731482615","date":"2026-03-31T18:18:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"339831980203865883694711404008535435735","date":"2026-03-30T17:43:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"96997466802103528116461070857270258547","date":"2026-03-30T00:24:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"330242524903961059255522533974210498937","date":"2026-03-28T17:41:08+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-28T17:36:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-28T17:21:02+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-26T14:47:55+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-24T08:45:11+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-03-24T08:39:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e5c21cd9-b288-4f36-b099-b20ea5fbc73e","owner":[],"postedDate":"April 8th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":65636142,"name":"Biological sciences/Cancer"},{"id":65636143,"name":"Biological sciences/Cell biology"},{"id":65636144,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2026-05-12T08:08:22+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-08 05:21:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8974853","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8974853","identity":"rs-8974853","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.