Recombinant Erythropoietin Expression Elevates by UCOE in CHO DG44 Cells

Recombinant Erythropoietin Expression Elevates by UCOE in CHO DG44 Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Recombinant Erythropoietin Expression Elevates by UCOE in CHO DG44 Cells Fateme Hasheminejad, Haniyeh Norouzi, Seyede Hoda Jazayeri, Zahra Halfinezhad, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7213580/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Feb, 2026 Read the published version in Biotechnology Letters → Version 1 posted 5 You are reading this latest preprint version Abstract Purpose The demand for biopharmaceuticals has significantly increased in recent years. Achieving high-yield and cost-effective production of therapeutics remains a critical challenge. However, transcriptional gene silencing is a common issue in recombinant cell lines, often resulting in diminished protein expression levels. A promising strategy to overcome this challenge is the engineering of the expression cassette, particularly through the ubiquitous chromatin opening elements (UCOEs), unmethylated CpG island fragments derived from housekeeping genes. In this study, we utilized an expression platform incorporating a UCOE to enhance the expression of erythropoietin (EPO) in CHO DG44 cells. Methods The codon-optimized EPO sequence was cloned into the pOptiVEC vector, and subsequently, the EPO -IRES-DHFR fragment was inserted into the UCOE vector. Each linearized gene cassette was transfected into CHO DG44 cells. Subsequently, protein expression levels were assessed using quantitative Real-Time PCR, Western blotting, and enzyme-linked immunosorbent assay (ELISA). Results Our findings demonstrated a significant increase in EPO expression at both the mRNA and protein levels in the UCOE- EPO -IRES-DHFR pool, which were 3.8 and 7 times higher compared to pOptiVEC- EPO , respectively. Conclusion This study suggests that UCOE elements can mitigate insertion-site position effects and enhance recombinant mRNA and protein expression in CHO DG44 cell lines. Additionally, these elements can substantially reduce the time and cost associated with large-scale recombinant protein production. Ubiquitous chromatin opening element CHO DG44 Erythropoietin Recombinant protein Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Developing efficient strategies for recombinant protein production is becoming increasingly important, as higher production efficiency is essential for reducing final product costs and ensuring commercial viability (Palomareset al. 2004 ). Despite recent advancements, developing innovative technologies to generate stable and high-yielding mammalian cell lines remains one of the major challenges in cell line engineering (Wurm 2004 ; Orvieto and Seifer 2016 ). Optimizing the expression vector is the primary and one of the most effective strategies for enhancing recombinant protein production. Following this, optimizing the culture medium and conditions is crucial in further increasing protein expression (Hunter et al. 2019 ; Kawabe et al. 2017 ; Wang and Guo 2020 ). Mammalian vector systems often face inefficiencies in stably expressing proteins due to the silencing of exogenous genes, which results from modifications to the integrated vector or its surrounding regions, such as CpG DNA sequence methylation (Fuks 2005 ; Razin 1998 ; Bird and Wolffe 1999 ). Typically, expression vectors integrate randomly into the host cell genome, and many genomic loci exhibit transcriptional repression. Consequently, chromatin position effects complicate the generation of stable mammalian cell lines for therapeutic protein expression, making the process time-consuming, costly, and challenging (Jazayeri et al. 2018 ; Barnes et al. 2000 ). To mitigate these positional effects, chromatin-modifying elements, such as ubiquitous chromatin opening elements (UCOEs), have been incorporated into expression vectors to protect transgenes from epigenetic silencing (Romanova and Noll 2018 ; Guo et al. 2020 ; Hasheminejad and Amiri-Yekta 2024 ). Reports indicate that UCOEs enhance the number of recombinant clones following the random integration of the vector (Boscolo et al. 2012 ; Williams et al. 2005 ). Furthermore, UCOEs create a transcriptionally active, open chromatin environment around the integrated transgene, maximizing its potential for transcription into protein. This effect is independent of the transgene's position in the chromosome. Structurally, UCOEs consist of methylation-free CpG islands paired with bidirectional promoters of ubiquitously expressed housekeeping genes, resulting in consistent, stable, and high-level gene expression (Romanova and Noll 2018 ; Guo et al. 2020 ; Antoniou et al. 2003 ; Hasheminejad et al. 2024 ). Among mammalian cells, Chinese hamster ovary (CHO) cells are the primary host for the commercial production of therapeutic proteins (Walsh 2018 ). CHO cells were established by Puck et al., and have become the preferred choice for several reasons. CHO cells are the preferred host for the commercial production of therapeutic proteins due to their well-established properties, such as adaptation to suspension growth in serum-free media, high cell-specific productivity (qP), and ease of gene manipulation (PUCK et al. 1958; Kim et al. 2012 ; Derouazi et al. 2006 ; Wurm and Hacker 2011 ; Durocher and Butler 2009 ). Additionally, they are less prone to viral infections, making them a safer choice for synthesizing and processing proteins with large molecular structures and complex, human-like post-translational modifications. Furthermore, CHO cells are highly effective in producing human recombinant glycoproteins, which can generate processes yielding over 10 g/l of product (Berting et al. 2010 ; Butler and Spearman 2014 ; Zhu and Hatton 2018 ). Erythropoietin (EPO) is a glycoprotein hormone produced in the adult kidney and fetal liver that regulates erythrocyte levels based on blood oxygen levels (Krystal 1983 ). Recombinant human EPO (rhEPO) is clinically used to treat anemia in patients with cancer, HIV infection, those undergoing autologous blood donation, and individuals with chronic kidney disease (CKD) (Henry and Spivak 1995 ). CHO cells are the preferred system for rhEPO production, as those from other cell lines or organisms exhibit different glycosylation patterns, leading to reduce in vivo activity (Varas et al. 2018 ). The high demand for recombinant EPO necessitates the development of cell lines capable of producing it in large quantities (Nag et al. 2023 ). Here, we use an expression vector containing UCOE elements to establish a CHO DG44 cell line that produces high levels of EPO. For this purpose, gene expression cassettes carrying the EPO gene were cloned into pOptiVEC and UCOE vectors, which were randomly integrated into the host cell genome. The results were then compared across two different cell lines. This review explores the potential of UCOEs to mitigate epigenetic silencing in biomanufacturing. This study provides significant advancements in mammalian cell lines for enhanced EPO expression. Materials and methods Construction and characterization of expression cassettes The EPO sequence was codon-optimized and amplified from the pUC57 vector by PCR using Phusion U Hot Start DNA polymerase (Thermo Fisher Scientific, USA, F555S). Erythropoietin was cloned into the pOptiVEC vector using Xba I (Thermo Fisher Scientific, 3177788) and Not I (Thermo Fisher Scientific, 00850392) restriction enzymes. The EPO -IRES-DHFR sequence was amplified from the pOptiVEC vector by PCR with AQ90 High Fidelity DNA Polymerase (Amplicon, Denmark, A470701). The resulting EPO -IRES-DHFR cassette was cloned into the CET 1019 HD-hygro-SceI (UCOE) (Millipore Sigma, USA, CS221307) vector by Nhe I (Thermo Fisher Scientific, 00676340) digestion. To simplify the notation, the UCOE- EPO -IRES-DHFR vector will hereafter be referred to as UCOE- EPO . The recombinant vectors were transformed into E. coli DH5α competent cells using the heat shock method. The two vector constructs were first analyzed by colony PCR and restriction digestion, then verified by Sanger sequencing, and subsequently linearized using Pvu II (Thermo Fisher Scientific, ER0631) and I-Sce I (NEB, 10030588). The schematic maps of the plasmid vectors used in this study are shown in Fig. 1 . Transfection and cell pool development The suspension CHO DG44 (cGMP banked, Thermo Fisher Scientific, RRID:CVCL_KA66) cell line was used as a host for protein production. CHO DG44 cells were cultured in a 50ml Erlenmeyer Conical Flask with a Screw Cap (Glassco) containing 6 ml of serum-free CD DG44 medium (Gibco, USA, 2337149) supplemented with 8 mM GlutaMAX™ (Gibco, 2037045) and 18 ml/L Pluronic™ F-68 (Gibco, 2044567). The cultures were maintained at 37°C, 85% relative humidity, and 8% CO₂ with 130 rpm agitation. 24 hours before transfection, cells were seeded at a density of 5×10⁵ cells/ml. Linearized expression vectors were transfected into two 6.6 ml cell pools, each containing 3×10⁵ cells/ml, using 4 µg of DNA per transfection along with OptiPRO™ SFM (Gibco, 1465606) and FreeStyle™ MAX reagent (Gibco, 2185360), following the manufacturer’s instructions. 48 hours after transfection, the selection was carried out by culturing the cells in CD OptiCHO™ (Gibco, 2193384) medium without hypoxanthine and thymidine. Cell concentration and viability were assessed using the trypan blue (Sigma-Aldrich, USA, RNBL8011) exclusion method with analyses performed by a hemocytometer (Neubauer, Germany). After 22 days, cell viability exceeded 90%, and cell pools were obtained. Genomic DNA was extracted from both cell pools using the High pure PCR template preparation kit (Roche, 45611700). PCR subsequently confirmed the integration of the gene cassettes into the genome of both pools. On day 7, cell culture supernatants and pellets were collected for further analysis of EPO expression using reverse transcription quantitative polymerase chain reaction (RT-qPCR) for the pellets, Western blotting, and an enzyme-linked immunosorbent assay (ELISA) for the supernatants. mRNA expression analysis Total cellular RNA was extracted using the NucleoSpin™ RNA kit (MACHEREYNAGEL, 1912/006) and treated with the GeneJET RNA Purification Kit (Thermo Fisher Scientific, 00071050). cDNA synthesis was performed using 1 µg of DNase-treated RNA with the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, 00903062), followed by RT-PCR. Real-Time PCR was conducted on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA) using a RealQ Plus 2x Master Mix Green (Amplicon, 19F1805) according to the manufacturer’s instructions. All samples were analyzed in duplicate. The primers used for Real-Time PCR are listed in Table 1 . Relative expression levels were calculated using the ΔCt method and normalized using GAPDH as an internal reference control. The ΔCt values were then used to determine fold change in gene expression via the 2^(-ΔΔCt) method. Experiments were performed in duplicate, and results are presented as mean ± standard deviation (SD). Table 1 Primers used in RT-qPCR Gene Sequence (5'>3') Forward EPO TGAGCACTGTAGCCTGAACG Reverse EPO GGGCTGGCTGCTATTCAC Forward GAPDH CAAGGTCATCCATGACAACTTTG Reverse GAPDH GTCCACCACCCTGTTGCTGTAG Western blotting analysis Western blotting analysis was performed to detect the expression of EPO proteins in each cell pool. A total of 30 µg of concentrated supernatants collected from transfected and non-transfected cells on day 7 were separated by SDS-PAGE using a 12% resolving polyacrylamide gel. Proteins were then transferred onto a polyvinylidene difluoride (PVDF) (Amersham, UK, G5509140) membrane using the Mini Trans-Blot® Cell system (Bio-Rad, USA, 153BR77442). After blocking with 5% skim milk (Sigma-Aldrich, BCBK0207V (, a rabbit anti-human erythropoietin antibody (Bio-Rad, 180621, RIDD:AB_2098522) was used as the primary antibody at a 1:1000 dilution, followed by an anti-rabbit IgG antibody (Sigma, 0000403410, RIDD:AB_257896) as the secondary antibody at a 1:350000 dilution, according to the manufacturer’s instructions. The protein detection was performed using Amersham™ ECL™ Prime (Cytiva, UK, 9643337) with the Alliance Q9 Advanced System (UVITEC, UK). Enzyme-linked immunosorbent assay The supernatants from recombinant cell pools were harvested on day 7 and used for EPO quantification. The EPO concentration was measured using the Human Erythropoietin DuoSet ELISA Kit (R&D Systems a Bio-Techne brand, USA, DY286-05) according to the manufacturer’s instructions. Sample concentrations were calculated based on standard curves generated by linear regression. All standard dilutions, along with negative and positive controls and samples, were assayed in duplicate. The optical density (OD) was measured at 450 nm using a Multiskan Spectrum Microplate Reader (Thermo Fisher Scientific). Statistical analysis Expression analysis data was statistically analyzed using a Student’s t-test and one-way analysis of variance (ANOVA) and Sidak’s multiple comparisons test in GraphPad Prism 9 (GraphPad Software, USA, RIID:SCR_002798) to assess significant differences in EPO production between the generated cell pools. Data are presented as mean ± SD from two independent experiments. For all statistical analyses, the difference between the means was considered significant at p < 0.05. Results Stable recombinant CHO cell pools were created through the pOptiVEC and UCOE vectors The pOptiVEC and UCOE vectors were used to clone the EPO and EPO -IRES-DHFR coding sequences, respectively. PCR analysis of the extracted genomic DNA confirmed the successful integration of the expression cassettes into the CHO DG44 genome. This integration was further validated by Sanger sequencing, which confirmed that the obtained fragment lengths matched the expected sizes (Fig. 2 a and b). Consequently, the UCOE- EPO cell pool was successfully established, while the pOptiVEC- EPO cell pool was developed as a comparative control. UCOE cell pool indicated a higher level of mRNA expression To assess EPO mRNA expression, pOptiVEC- EPO and UCOE- EPO cell pools were seeded at a density of 3×10⁵ cells/ml in 6-well plates and cultured for seven days. Previous studies identified day 7 as the optimal time point for collecting EPO from the UCOE-containing cell pool in batch culture (Hasheminejad et al. 2024 ). The viable cell density and viability of cell pools were monitored on test days (Fig. 3 ). Cell samples were collected on day 7, and mRNA expression levels were analyzed using Real-Time PCR. The mean threshold cycle (Ct) value for the pOptiVEC cell pool was significantly higher than that of the UCOE cell pool, which was used as the reference for comparison. The UCOE cell pool exhibited a 3.8-fold higher EPO mRNA expression compared to the pOptiVEC cell pool (Fig. 4 ). Expression of EPO protein in each cell pool was confirmed through western blotting analysis The culture supernatants from each cell pool, collected on day 7, were analyzed by western blotting. Recombinant erythropoietin (Cinnapoietin®, G019FT) was used as a positive control, while the culture medium from CHO DG44 cells transfected with the empty pOptiVEC™ vector served as a negative control. Western blotting analysis detected a 30.4 kDa band corresponding to EPO. Moreover, the UCOE- EPO cell pool exhibited higher EPO protein expression levels than the pOptiVEC- EPO cell pool (Fig. 5 a). The western blotting images were analyzed using ImageJ software (RIID:SCR_003070), with Cinnapoietin as a loading control (Fig. 5 b). EPO was increased in the UCOE-containing cell pool The EPO expression levels in the culture supernatants of each cell pool were quantified using ELISA. In agreement with the western blotting results, the UCOE- EPO cell pool exhibited significantly higher EPO production compared to the non-UCOE cell pool. As illustrated in Fig. 6 , after seven days of culture, the UCOE- EPO cell pool produced seven-folds more EPO protein than the pOptiVEC- EPO cell pool. These results indicate that incorporating the UCOE element significantly enhances protein expression, leading to improved productivity compared to cell pools lacking this regulatory element. Discussion The increasing demand for biopharmaceuticals and recombinant proteins has underscored the need for advanced bioprocessing technologies that can enhance protein yields for industrial production (Walsh 2018 ). One key strategy to achieve higher productivity is the development of highly efficient cell lines, often by random insertion of expression vectors into the host cell genome. However, this random integration can lead to epigenetic changes, such as promoter methylation, which may cause transcriptional silencing of the transgene during cultivation. To mitigate this issue, the inclusion of chromatin-opening elements, such as UCOE (ubiquitous chromatin opening elements), in expression cassettes has shown promise in preventing gene silencing and improving expression levels (Guo et al. 2020 ; Song et al. 2013 ; Hoseinpoor et al. 2020 ; Xiong et al. 2005 ; Ye et al. 2010 ; Dharshanan et al. 2014 ). In this study, we utilized UCOE elements to modulate chromatin structure and mitigate silencing in CHO DG44 cells. Our results indicate that the inclusion of UCOE upstream of the CMV promoter effectively reduced silencing associated with the recombinant gene, leading to a notable increase in recombinant protein production. This enhancement is likely due to the role of UCOEs, which contain elements derived from housekeeping gene promoters that are transcriptionally active and heavily acetylated (Benton et al. 2002 ). These elements function to maintain an open chromatin structure, thereby preventing transgene silencing and ensuring stable, high-level gene expression, regardless of the chromosomal integration site. This finding aligns with previous reports demonstrating that the incorporation of UCOEs into expression vectors enhances recombinant protein production in various mammalian cell lines. Comparing the effect of different DNA elements, including UCOEs, S/MARs, and cHS4 insulators, on protein expression levels, the UCOE cell lines displayed improved antibody production 6-fold higher than the non-UCOE cell lines. For instance, a study by Neville et al. ( 2017 ) found that UCOE-containing vectors increased the stable expression of monoclonal antibodies in CHO cell-based systems by more than 10-fold (Neville et al. 2017 ). In addition to enhancing recombinant protein yields, UCOEs have been shown to improve the homogeneity of expressing cell populations and increase the number of high-producing clones, even under stressful conditions (Betts et al 2015 ). For instance, Hou et al. demonstrated that UCOE-based vectors allowed high-expressing clones to be cultured within four weeks of transfection, expediting the production process (Hou et al. 2014 ). However, challenges such as genome instability and reduced growth rates still present risks that can affect productivity, particularly during prolonged cultivation (Doan et al. 2022a ). The use of mammalian cell lines, particularly CHO cells, remains the gold standard for recombinant protein production due to their ability to properly fold, assemble, and post-translationally modify proteins. In this study, the CHO DG44 cell line, which is deficient in both versions of the DHFR gene, was chosen for its advantages in cell density, viability, and productivity in suspension cultures. The DHFR system also allows the selection of stable clones, which is critical for large-scale production (Lucas et al. 1996 ). The use of UCOE-containing vectors with CHO cells can be considered a promising strategy for the production of recombinant proteins before industrial-scale production. In a study conducted by Doan et al. in 2022, the expression of TNF-α antibody was evaluated in CHO cell lines transfected with vectors containing and lacking UCOE elements. The results of this study demonstrated that the expression of this antibody was enhanced up to 3 times in the UCOE-containing cell pool compared to the control cell pool (Doan et al. 2022 ). Our findings corroborate the well-established correlation between cell growth and protein production, reinforcing the importance of optimizing cell line growth when selecting suitable cell pools for therapeutic protein production, such as erythropoietin (EPO) (Fann et al. 2000 ; Chusainow et al. 2009 ). In this study, we observed that the UCOE- EPO cell pool produced 7-fold higher EPO levels compared to the pOptiVEC- EPO pool, as determined by ELISA. Moreover, the UCOE-EPO pool exhibited 3.8-fold higher EPO mRNA expression than the non-UCOE control pool, suggesting that UCOE elements significantly enhance both transcriptional and translational levels of recombinant protein expression. These results are consistent with other published studies, which demonstrate that UCOE-containing pools exhibit higher recombinant protein production and enhanced transgene expression compared to the control pool that lacks this element (Hasheminejad et al. 2024 ; Dharshanan et al. 2014 ). Our study clearly demonstrates that mRNA expression levels do not always directly correlate with protein production. Factors such as translational efficiency, post-translational modifications, and protein stability play significant roles in determining the final yield of proteins. This complexity in recombinant protein expression reveals that multiple stages of gene expression and protein processing interact intricately, ultimately influencing the overall output. Understanding these interactions is crucial for optimizing protein production (Doan et al. 2022a ; Nematpour et al. 2017 ). Additionally, the combined use of codon optimization and UCOE elements to enhance EPO expression in CHO DG44 cells further emphasizes the importance of optimizing multiple aspects of gene expression. Previous studies have demonstrated that codon optimization alone can lead to significant increases in mRNA and protein levels, as seen in the case of EPO production, where codon optimization improved transcript and protein levels by 13.8-fold and 2.9-fold, respectively (Kim et al. 1997 ). Conclusion In summary, our findings indicated a boosted EPO expression rate at both mRNA and protein levels in the UCOE- EPO pool compared to pOptiVEC- EPO . Here, we have provided evidence that the UCOE-based gene expression platform can provide promise as a means to enhance the time and cost efficiency for the biomanufacturing stages. Additionally, it may serve as a general template for recombinant protein production improvement. Abbreviations UCOEs Ubiquitous chromatin opening elements CHO Chinese hamster ovary EPO Erythropoietin rhEPO Recombinant human EPO CKD Chronic kidney disease SD Standard deviation PVDF Polyvinylidene difluoride OD Optical density ELISA Enzyme-linked immunosorbent assay RT-qPCR Reverse transcription quantitative polymerase chain reaction Declarations Acknowledgments Many thanks to our colleagues at the Royan institute-ACECR for their cooperation. Author contributions Conceptualization: Amir Amiri-Yekta; Methodology: Fateme Hasheminejad, Haniyeh Norouzi; Formal analysis and investigation: Fateme Hasheminejad, Haniyeh Norouzi, Seyede Hoda Jazayeri, Zahra Halfinezhad, Abbas Daneshipour, Zeynab Khoshnood, Mahsa Nejati, Fatemeh Norouzi, Somayeh Abolghasemi, Mohsen Gharanfoli; Writing - original draft preparation: Fateme Hasheminejad, Haniyeh Norouzi; Writing - review and editing: Fateme Hasheminejad, Haniyeh Norouzi, Amir Amiri-Yekta; Funding acquisition: Amir Amiri-Yekta; Resources: Amir Amiri-Yekta; Supervisions: Amir Amiri-Yekta, Sara Taleahmad. Funding This study was funded by grant number 99000004 from the Royan Institute, ACECR. Data Availability The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Ethics approval This study was approved by the Ethics Committee of Royan Institute (IR.ACECR.ROYAN.REC.1403.004). Consent to publish All authors confirm their approval of the final manuscript and their consent for publication. References Antoniou M, Harland L, Mustoe T et al (2003) Transgenes encompassing dual-promoter CpG islands from the human TBP and HNRPA2B1 loci are resistant to heterochromatin-mediated silencing. Genomics 82(3):269-79. https://doi.org/10.1016/s0888-7543(03)00107-1 Barnes LM, Bentley CM, Dickson AJ (2000) Advances in animal cell recombinant protein production: GS-NS0 expression system. Cytotechnology 32:109-23. https://doi.org/10.1023/A:1008170710003 Benton T, Chen T, McEntee M et al (2002) The use of UCOE vectors in combination with a preadapted serum free, suspension cell line allows for rapid production of large quantities of protein. Cytotechnology 38:43-46. https://doi.org/10.1023/A:1021141712344 Berting A, Farcet MR, Kreil TR (2010) Virus susceptibility of Chinese hamster ovary (CHO) cells and detection of viral contaminations by adventitious agent testing. Biotechnol Bioeng 106(4):598-607. https://doi.org/10.1002/bit.22723 Betts Z, Croxford AS, Dickson AJ (2015) Evaluating the interaction between UCOE and DHFR-linked amplification and stability of recombinant protein expression. Biotechnol Prog 31(4):1014-25. https://doi.org/10.1002/btpr.2083 Bird AP, Wolffe AP (1999) Methylation-induced repression—belts, braces, and chromatin. Cell 99 (5):451-454. https://doi.org/10.1016/s0092-8674(00)81532-9 Boscolo S, Mion F, Licciulli M et al (2012) Simple scale-up of recombinant antibody production using an UCOE containing vector. N Biotechnol 29 (4):477-484. https://doi.org/10.1016/j.nbt.2011.12.005 Butler M, Spearman M (2014) The choice of mammalian cell host and possibilities for glycosylation engineering. Curr Opin Biotechnol 30:107-12. https://doi.org/10.1016/j.copbio.2014.06.010 Chusainow J, Yang YS, Yeo JH, Toh PC, Asvadi P, Wong NS, Yap MG (2009) A study of monoclonal antibody-producing CHO cell lines: what makes a stable high producer? Biotechnol Bioeng 102(4):1182-96. https://doi.org/10.1002/bit.22158 Derouazi M, Martinet D, Besuchet Schmutz N et al (2006) Genetic characterization of CHO production host DG44 and derivative recombinant cell lines. Biochem Biophys Res Commun 340(4):1069-77. https://doi.org/10.1016/j.bbrc.2005.12.111 Dharshanan S, Chong H, Cheah SH, Zamrod Z (2014) Stable expression of H1C2 monoclonal antibody in NS0 and CHO cells using pFUSE and UCOE expression system. Cytotechnology 66(4):625-33. https://doi.org/10.1007/s10616-013-9615-x Dharshanan S, Chong H, Cheah SH, Zamrod Z (2014) Stable expression of H1C2 monoclonal antibody in NS0 and CHO cells using pFUSE and UCOE expression system. Cytotechnology 66(4):625-33. https://doi.org/10.1007/s10616-013-9615-x Doan CC, Ho NQC, Nguyen TT, Nguyen TPT, Do DG, Hoang NS, Le TL (2022a) Enhancement of anti-TNFα monoclonal antibody production in CHO cells through the use of UCOE and DHFR elements in vector construction and the optimization of cell culture media. Prep Biochem Biotechnol 52(4):452-470. https://doi.org/10.1080/10826068.2021.1963981 Doan CC, Le TL, Ho NQC, Hoang NS (2022) Effects of ubiquitous chromatin opening element (UCOE) on recombinant anti-TNFα antibody production and expression stability in CHO-DG44 cells. Cytotechnology 74(1):31-49. https://doi.org/10.1007/s10616-021-00503-1 Durocher Y, Butler M (2009) Expression systems for therapeutic glycoprotein production. Curr Opin Biotechnol 20(6):700-7. https://doi.org/10.1016/j.copbio.2009.10.008 Fann CH, Guirgis F, Chen G, Lao MS, Piret JM (2000) Limitations to the amplification and stability of human tissue-type plasminogen activator expression by Chinese hamster ovary cells. Biotechnol Bioeng 69(2):204-12. https://doi.org/10.1002/(sici)1097-0290(20000720)69:2%3C204::aid-bit9%3E3.0.co;2-z Fuks F (2005) DNA methylation and histone modifications: teaming up to silence genes. Curr Opin Genet Dev 15(5):490-495. https://doi.org/10.1016/j.gde.2005.08.002 Guo X, Wang C, Wang TY (2020) Chromatin-modifying elements for recombinant protein production in mammalian cell systems. Crit Rev Biotechnol 40(7):1035-43. https://doi.org/10.1080/07388551.2020.1805401 Hasheminejad F, Amiri-Yekta A (2024) Recombinant Protein Expression Optimizing: A Review of S/MAR, STAR, and UCOE, as a Chromatin-Modifying Element. West Kaz Med J 28:137-45. https://doi.org/10.18502/wkmj.v66i2.16456 Hasheminejad F, Jazayeri SH, Halfinezhad Z et al (2024) Ubiquitous chromatin opening element enhance Darbepoetin alfa expression in CHO DG44 cell line. Biochem Eng J 211 :109468. https://doi.org/10.2139/ssrn.4829999 Henry DH, Spivak JL (1995) Clinical use of erythropoietin. Curr Opin Hematol 2(2):118-24. https://doi.org/10.1097/00062752-199502020-00003 Hoseinpoor R, Kazemi B, Rajabibazl M, Rahimpour A (2020) Improving the expression of anti-IL-2Rα monoclonal antibody in the CHO cells through optimization of the expression vector and translation efficiency. J Biotechnol 324:112-120. https://doi.org/10.1016/j.jbiotec.2020.09.006 Hou JJ, Hughes BS, Smede M et al (2014) High-throughput ClonePix FL analysis of mAb-expressing clones using the UCOE expression system. N Biotechnol 31(3):214-20. https://doi.org/10.1016/j.nbt.2014.02.002 Hunter M, Yuan P, Vavilala D, Fox M (2019) Optimization of protein expression in mammalian cells. Curr Protoc Protein Sci 95 (1):77. https://doi.org/10.1002/cpps.77 Jazayeri SH, Amiri-Yekta A, Bahrami S, Gourabi H, Sanati MH, Khorramizadeh MR (2018) Vector and cell line engineering technologies toward recombinant protein expression in mammalian cell lines. Appl Biochem Biotechnol 185:986-1003. https://doi.org/10.1007/s12010-017-2689-8 Kawabe Y, Inao T, Komatsu S, Huang G, Ito A, Omasa T, Kamihira M (2017) Improved recombinant antibody production by CHO cells using a production enhancer DNA element with repeated transgene integration at a predetermined chromosomal site. J Biosci Bioeng 123(3):390-397. https://doi.org/10.1016/j.jbiosc.2016.10.011 Kim CH, Oh Y, Lee TH (1997) Codon optimization for high-level expression of human erythropoietin (EPO) in mammalian cells. Gene 199(1-2):293-301. https://doi.org/10.1016/s0378-1119(97)00384-3 Kim JY, Kim YG, Lee GM (2012) CHO cells in biotechnology for production of recombinant proteins: current state and further potential. Appl Microbiol Biotechnol 93(3):917-30. https://doi.org/10.1007/s00253-011-3758-5 Krystal G (1983) A simple microassay for erythropoietin based on 3H-thymidine incorporation into spleen cells from phenylhydrazine treated mice. Exp Hematol 11(7):649-60 Lucas BK, Giere LM, DeMarco RA, Shen A, Chisholm V, Crowley CW (1996) High-level production of recombinant proteins in CHO cells using a dicistronic DHFR intron expression vector. Nucleic Acids Res 24(9):1774-9. https://doi.org/10.1093/nar/24.9.1774 Nag K, Mohiuddin M, Khan MR et al (2023) Development and qualification of a high-yield recombinant human Erythropoietin biosimilar. BioRxiv 2024-06. https://doi.org/10.1101/2023.01.22.525046 Nematpour F, Mahboudi F, Vaziri B et al (2017) Evaluating the expression profile and stability of different UCOE containing vector combinations in mAb-producing CHO cells. BMC Biotechnol 17(1):18. https://doi.org/10.1186/s12896-017-0330-0 Neville JJ, Orlando J, Mann K, McCloskey B, Antoniou MN (2017) Ubiquitous Chromatin-opening Elements (UCOEs): Applications in biomanufacturing and gene therapy. Biotechnol Adv 35(5):557-564. https://doi.org/10.1016/j.biotechadv.2017.05.004 Orvieto R, Seifer DB (2016) Biosimilar FSH preparations-are they identical twins or just siblings? Reprod Biol Endocrinol 14:1-6. https://doi.org/10.1186/s12958-016-0167-8 Palomares LA, Estrada-Moncada S, Ramírez OT (2004) Production of Recombinant Proteins. In: Balbás P, Lorence A (eds) Recombinant Gene Expression. Methods in Molecular Biology, 3rd edn. Springer, Berlin, pp 15–51 PUCK TT, CIECIURA SJ, ROBINSON A (1958) Genetics of somatic mammalian cells. III. Long-term cultivation of euploid cells from human and animal subjects. J Exp Med 108(6):945-56. https://doi.org/10.1084/jem.108.6.945 Razin A (1998) CpG methylation, chromatin structure and gene silencing—a three-way connection. EMBO J 17 (17):4905-4908. https://doi.org/10.1093/emboj/17.17.4905 Romanova N, Noll T (2018) Engineered and natural promoters and chromatin‐modifying elements for recombinant protein expression in CHO cells. Biotechnol J 13(3):1700232. https://doi.org/10.1002/biot.201700232 Song SW, Lee SJ, Kim CY, Han B, Oh JW (2013) Rapid establishment of CHO cell lines producing the anti-hepatocyte growth factor antibody SFN68. J Microbiol Biotechnol 23(8):1176-84. https://doi.org/10.4014/jmb.1305.05056 Varas N, Camacho F, Sánchez O (2018) Recombinant human erythropoietin. The problem of glycosylation. Lat Am J Biotechnol Life Sci 3 :683-688. https://doi.org/10.21931/RB/2018.03.03.10 Walsh G (2018) Biopharmaceutical benchmarks 20. Nat Biotechnol 36(12):1136-1145. https://doi.org/10.1038/nbt.4305 Wang TY, Guo X (2020) Expression vector cassette engineering for recombinant therapeutic production in mammalian cell systems. Appl Microbiol Biotechnol 104(13):5673-88. https://doi.org/10.1007/s00253-020-10640-w Williams S, Mustoe T, Mulcahy T et al (2005) CpG-island fragments from the HNRPA2B1/CBX3 genomic locus reduce silencing and enhance transgene expression from the hCMV promoter/enhancer in mammalian cells. BMC Biotechnol 5:17. https://doi.org/10.1186/1472-6750-5-17 Wurm FM (2004) Production of recombinant protein therapeutics in cultivated mammalian cells. Nat Biotechnol 22(11):1393-1398. https://doi.org/10.1038/nbt1026 Wurm FM, Hacker D (2011) First CHO genome. Nat Biotechnol 29(8):718-20. https://doi.org/10.1038/nbt.1943 Xiong KH, Liang QC, Xiong H, Zou CX, Gao GD, Zhao ZW, Zhang H (2005) Expression of chimeric antibody in mammalian cells using dicistronic expression vector. Biotechnol Lett 27(21):1713-7. https://doi.org/10.1007/s10529-005-2736-3 Ye J, Alvin K, Latif H et al (2010) Rapid protein production using CHO stable transfection pools. Biotechnol Prog. 26(5):1431-7. https://doi.org/10.1002/btpr.469 Zhu J, Hatton D (2018) New Mammalian Expression Systems. Adv Biochem Eng Biotechnol 165:9-50. https://doi.org/10.1007/10_2016_55 Cite Share Download PDF Status: Published Journal Publication published 16 Feb, 2026 Read the published version in Biotechnology Letters → Version 1 posted Editorial decision: Major revisions 21 Nov, 2025 Reviewers agreed at journal 10 Sep, 2025 Reviewers invited by journal 19 Aug, 2025 Editor assigned by journal 26 Jul, 2025 First submitted to journal 25 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7213580","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":502653392,"identity":"28b62f62-e3f5-4982-9632-d779f45268d4","order_by":0,"name":"Fateme Hasheminejad","email":"","orcid":"","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Fateme","middleName":"","lastName":"Hasheminejad","suffix":""},{"id":502653393,"identity":"7aa4b96d-cefc-46e2-abde-6abc0b335533","order_by":1,"name":"Haniyeh Norouzi","email":"","orcid":"","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Haniyeh","middleName":"","lastName":"Norouzi","suffix":""},{"id":502653394,"identity":"11500bd9-5fe8-46a7-a021-bc45e1d433c9","order_by":2,"name":"Seyede Hoda Jazayeri","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"prefix":"","firstName":"Seyede","middleName":"Hoda","lastName":"Jazayeri","suffix":""},{"id":502653395,"identity":"dc51ee46-4092-42f8-b449-dc9e221ee508","order_by":3,"name":"Zahra Halfinezhad","email":"","orcid":"","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"","lastName":"Halfinezhad","suffix":""},{"id":502653396,"identity":"300fe819-79f7-47c9-befb-9485e9ca6a57","order_by":4,"name":"Abbas Daneshipour","email":"","orcid":"","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Abbas","middleName":"","lastName":"Daneshipour","suffix":""},{"id":502653397,"identity":"8576c3f7-4003-40d5-8d90-c4f770843255","order_by":5,"name":"Zeynab Khoshnood","email":"","orcid":"","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Zeynab","middleName":"","lastName":"Khoshnood","suffix":""},{"id":502653398,"identity":"01d9864e-9bd5-414b-86b1-a45801170831","order_by":6,"name":"Mahsa Nejati","email":"","orcid":"","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Mahsa","middleName":"","lastName":"Nejati","suffix":""},{"id":502653399,"identity":"bc670fcc-cb6e-4efa-a83a-b3abdf8f8d03","order_by":7,"name":"Fatemeh Norouzi","email":"","orcid":"","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Norouzi","suffix":""},{"id":502653400,"identity":"055226f1-8aef-4e8b-b12d-1495355f41d9","order_by":8,"name":"Somayeh Abolghasemi","email":"","orcid":"","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":false,"prefix":"","firstName":"Somayeh","middleName":"","lastName":"Abolghasemi","suffix":""},{"id":502653401,"identity":"61706779-f746-4500-a86e-01450075541a","order_by":9,"name":"Mohsen Gharanfoli","email":"","orcid":"","institution":"University of Science and Culture","correspondingAuthor":false,"prefix":"","firstName":"Mohsen","middleName":"","lastName":"Gharanfoli","suffix":""},{"id":502653402,"identity":"d5f02511-81da-4c35-bc5f-2a06aa9b0e48","order_by":10,"name":"Sara Taleahmad","email":"","orcid":"","institution":"Royan Institute for Stem Cell Biology and Technology","correspondingAuthor":false,"prefix":"","firstName":"Sara","middleName":"","lastName":"Taleahmad","suffix":""},{"id":502653403,"identity":"4ee4702a-8995-46c4-b21f-c185aefa2d03","order_by":11,"name":"Amir Amir-Yekta","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABV0lEQVRIie2RT0vDMBiH3xJYPQR6fcdG9xVaApvgsF8lRXCXDQaCDBxYGGyX4m5SwYMfYSLodSNQL/0Ag+7QIXieCKIow7R1Y3MDPQr2IQlvAk9++QOQkfEnUZx4pEDSUk9XDdnJrxQObKlQIpeGPwZysJ3FLNlli6Kdi+4M2rfFSo+a04vX/dpdzzWfm82JZamaX5i1QK/0r1YVDO2OB35Ii4Iyc8APGpdBwAqe8Wi7hORwGAArjqO1GKkA5EKKhJbzEScND+tGgRqC01gZdcH2cO14pUSZJ0rlLeKnNcQ6e5eKlSrzDcWIFaWbpigDLrhUynGKkhxs5EhFc1YVM1bss1jJHeW9w3vTo/7xnlRsVxC2G/jIENeuooe1B5i9hBZq4vrJrZ6UUO3chPRDWGp/NB232lUdtc2n5sm4Y3xNl0X6prLxzd9JUKPvxYItKRkZGRn/iU8oDHCZpMzU0wAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-8099-7984","institution":"Royan Institute for Reproductive Biomedicine","correspondingAuthor":true,"prefix":"","firstName":"Amir","middleName":"","lastName":"Amir-Yekta","suffix":""}],"badges":[],"createdAt":"2025-07-25 11:00:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7213580/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7213580/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10529-026-03707-7","type":"published","date":"2026-02-16T15:57:10+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90026788,"identity":"c457874a-3cd7-4962-8844-91c392cf5551","added_by":"auto","created_at":"2025-08-27 14:17:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":317455,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic structure of EPO expression cassettes.\u003cstrong\u003e a\u003c/strong\u003e EPO was cloned into the pOptiVEC vector as a control and subsequently linearized with PvuII. \u003cstrong\u003eb\u003c/strong\u003e EPO-IRES-DHFR was cloned into the first multiple cloning site (MCS) of the CET 1019 HD-hygro-SceI (UCOE) vector and then linearized with I-SceI\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7213580/v1/26b8c447d1f4600d48dd1b1f.png"},{"id":90027489,"identity":"dc20cac5-7f70-43a3-8d26-fb6aa236de97","added_by":"auto","created_at":"2025-08-27 14:25:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":28510,"visible":true,"origin":"","legend":"\u003cp\u003ePCR evaluation of EPO cassettes integration.\u003cstrong\u003e a \u003c/strong\u003eLane 1: 1Kb plus DNA Ladder, Lane 2: Transfected CHO DG44 cells by pOptiVEC\u003cstrong\u003e-\u003c/strong\u003eEPO Pool, Lane 3: Positive Control (pOptiVEC\u003cstrong\u003e-\u003c/strong\u003eEPO Plasmid), Lane 4: Negative Control (Non-transfected CHO DG44 DNA), Lane 5: Non-template control PCR product.\u003cstrong\u003e b\u003c/strong\u003e Lane 1: 1Kb plus DNA Ladder, Lane 2: Transfected CHO DG44 cells by UCOE\u003cstrong\u003e-\u003c/strong\u003eEPO Pool, Lane 3: Positive Control (UCOE\u003cstrong\u003e-\u003c/strong\u003eEPO Plasmid), Lane 4: Positive Control (UCOE\u003cstrong\u003e-\u003c/strong\u003eEPO Plasmid), Lane 5: Negative Control (Non-transfected CHO DG44 DNA)\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7213580/v1/7a8625ae7796d1e27aadb0ab.png"},{"id":90027490,"identity":"40a92db6-d8a3-4906-9c10-a55b0cdea3ae","added_by":"auto","created_at":"2025-08-27 14:25:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":90874,"visible":true,"origin":"","legend":"\u003cp\u003eCell growth profile and viability percentage of transfected pools. Cell pools were checked over test days and cell samples were collected on the 7th day for subsequent analysis\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7213580/v1/23435220a8f89c8e9ae56056.png"},{"id":90026792,"identity":"5be2bbc9-4861-4e41-bf77-56e0190595b8","added_by":"auto","created_at":"2025-08-27 14:17:21","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":39586,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eEPO\u003c/em\u003e mRNA expression level. Incorporating the UCOE element significantly enhanced the \u003cem\u003eEPO\u003c/em\u003emRNA levels by more than threefold in UCOE cell lines compared to the pOptiVEC cell pool. Data are presented as mean ± SD from a minimum of two replicates using Student’s \u003cem\u003et\u003c/em\u003e-test with statistical significance indicated at **** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7213580/v1/6b961d232ca7f97314c76680.png"},{"id":90027491,"identity":"c16e0d2c-63e1-4ba5-b9c9-e9cf3c84d97b","added_by":"auto","created_at":"2025-08-27 14:25:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":147850,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blotting analysis of EPO protein expression in CHO DG44 cell pools.\u003cstrong\u003e a \u003c/strong\u003eWestern blotting analysis of culture supernatants. Lane 1: Magic Mark™ Western Ladder; Lane 2: Positive control (Cinnapoietin); Lane 3: Negative control; Lane 4: pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e supernatant; Lane 5: UCOE-\u003cem\u003eEPO\u003c/em\u003e supernatant. \u003cstrong\u003eb \u003c/strong\u003eDensitometric analysis of western blotting bands using ImageJ software and GraphPad Prism (version 9). Data are presented as mean ± SD from at least two replicates, analyzed using ANOVA, with statistical significance indicated at **** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7213580/v1/440581fc69504f4d80c0729a.png"},{"id":90026794,"identity":"3821698e-a6a2-4708-b14b-1a8561f52dfb","added_by":"auto","created_at":"2025-08-27 14:17:21","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":44933,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative Assessment of EPO Protein Levels in the Supernatant of UCOE-\u003cem\u003eEPO\u003c/em\u003e and pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e.\u003cstrong\u003e \u003c/strong\u003eEPO quantification was performed using ELISA to assess the impact of the UCOE on EPO protein production. The UCOE cell lines demonstrated an average EPO expression of 62,200 mIU/ml, significantly higher than the pOptiVEC cell lines, which expressed an average of 8,800 mIU/ml. Data are presented as mean ± SD from a minimum of two replicates, with statistical significance indicated at **** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7213580/v1/2a8ff220dfe3d6a1fcaacd8e.png"},{"id":103252094,"identity":"f607a3b1-d7f1-4dbb-a522-bc8c5258d977","added_by":"auto","created_at":"2026-02-23 16:12:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1211274,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7213580/v1/03dae1bc-ee9b-42b7-961a-3805602f9d2a.pdf"}],"financialInterests":"","formattedTitle":"Recombinant Erythropoietin Expression Elevates by UCOE in CHO DG44 Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDeveloping efficient strategies for recombinant protein production is becoming increasingly important, as higher production efficiency is essential for reducing final product costs and ensuring commercial viability (Palomareset al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Despite recent advancements, developing innovative technologies to generate stable and high-yielding mammalian cell lines remains one of the major challenges in cell line engineering (Wurm \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Orvieto and Seifer \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Optimizing the expression vector is the primary and one of the most effective strategies for enhancing recombinant protein production. Following this, optimizing the culture medium and conditions is crucial in further increasing protein expression (Hunter et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Kawabe et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Wang and Guo \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Mammalian vector systems often face inefficiencies in stably expressing proteins due to the silencing of exogenous genes, which results from modifications to the integrated vector or its surrounding regions, such as CpG DNA sequence methylation (Fuks \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Razin \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Bird and Wolffe \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Typically, expression vectors integrate randomly into the host cell genome, and many genomic loci exhibit transcriptional repression. Consequently, chromatin position effects complicate the generation of stable mammalian cell lines for therapeutic protein expression, making the process time-consuming, costly, and challenging (Jazayeri et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Barnes et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2000\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTo mitigate these positional effects, chromatin-modifying elements, such as ubiquitous chromatin opening elements (UCOEs), have been incorporated into expression vectors to protect transgenes from epigenetic silencing (Romanova and Noll \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Guo et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Hasheminejad and Amiri-Yekta \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Reports indicate that UCOEs enhance the number of recombinant clones following the random integration of the vector (Boscolo et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Williams et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Furthermore, UCOEs create a transcriptionally active, open chromatin environment around the integrated transgene, maximizing its potential for transcription into protein. This effect is independent of the transgene's position in the chromosome. Structurally, UCOEs consist of methylation-free CpG islands paired with bidirectional promoters of ubiquitously expressed housekeeping genes, resulting in consistent, stable, and high-level gene expression (Romanova and Noll \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Guo et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Antoniou et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Hasheminejad et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Among mammalian cells, Chinese hamster ovary (CHO) cells are the primary host for the commercial production of therapeutic proteins (Walsh \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). CHO cells were established by Puck et al., and have become the preferred choice for several reasons. CHO cells are the preferred host for the commercial production of therapeutic proteins due to their well-established properties, such as adaptation to suspension growth in serum-free media, high cell-specific productivity (qP), and ease of gene manipulation (PUCK et al. 1958; Kim et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Derouazi et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Wurm and Hacker \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Durocher and Butler \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Additionally, they are less prone to viral infections, making them a safer choice for synthesizing and processing proteins with large molecular structures and complex, human-like post-translational modifications. Furthermore, CHO cells are highly effective in producing human recombinant glycoproteins, which can generate processes yielding over 10 g/l of product (Berting et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Butler and Spearman \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zhu and Hatton \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eErythropoietin (EPO) is a glycoprotein hormone produced in the adult kidney and fetal liver that regulates erythrocyte levels based on blood oxygen levels (Krystal \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1983\u003c/span\u003e). Recombinant human EPO (rhEPO) is clinically used to treat anemia in patients with cancer, HIV infection, those undergoing autologous blood donation, and individuals with chronic kidney disease (CKD) (Henry and Spivak \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). CHO cells are the preferred system for rhEPO production, as those from other cell lines or organisms exhibit different glycosylation patterns, leading to reduce in vivo activity (Varas et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The high demand for recombinant EPO necessitates the development of cell lines capable of producing it in large quantities (Nag et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eHere, we use an expression vector containing UCOE elements to establish a CHO DG44 cell line that produces high levels of EPO. For this purpose, gene expression cassettes carrying the \u003cem\u003eEPO\u003c/em\u003e gene were cloned into pOptiVEC and UCOE vectors, which were randomly integrated into the host cell genome. The results were then compared across two different cell lines. This review explores the potential of UCOEs to mitigate epigenetic silencing in biomanufacturing. This study provides significant advancements in mammalian cell lines for enhanced EPO expression.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eConstruction and characterization of expression cassettes\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eEPO\u003c/em\u003e sequence was codon-optimized and amplified from the pUC57 vector by PCR using Phusion U Hot Start DNA polymerase (Thermo Fisher Scientific, USA, F555S). Erythropoietin was cloned into the pOptiVEC vector using \u003cem\u003eXba\u003c/em\u003eI (Thermo Fisher Scientific, 3177788) and \u003cem\u003eNot\u003c/em\u003eI (Thermo Fisher Scientific, 00850392) restriction enzymes. The \u003cem\u003eEPO\u003c/em\u003e-IRES-DHFR sequence was amplified from the pOptiVEC vector by PCR with \u003cem\u003eAQ90\u003c/em\u003e High Fidelity DNA Polymerase (Amplicon, Denmark, A470701). The resulting \u003cem\u003eEPO\u003c/em\u003e-IRES-DHFR cassette was cloned into the CET 1019 HD-hygro-SceI (UCOE) (Millipore Sigma, USA, CS221307) vector by \u003cem\u003eNhe\u003c/em\u003eI (Thermo Fisher Scientific, 00676340) digestion. To simplify the notation, the UCOE-\u003cem\u003eEPO\u003c/em\u003e-IRES-DHFR vector will hereafter be referred to as UCOE-\u003cem\u003eEPO\u003c/em\u003e. The recombinant vectors were transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5α competent cells using the heat shock method. The two vector constructs were first analyzed by colony PCR and restriction digestion, then verified by Sanger sequencing, and subsequently linearized using \u003cem\u003ePvu\u003c/em\u003eII (Thermo Fisher Scientific, ER0631) and \u003cem\u003eI-Sce\u003c/em\u003eI (NEB, 10030588). The schematic maps of the plasmid vectors used in this study are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTransfection and cell pool development\u003c/p\u003e\u003cp\u003eThe suspension CHO DG44 (cGMP banked, Thermo Fisher Scientific, RRID:CVCL_KA66) cell line was used as a host for protein production. CHO DG44 cells were cultured in a 50ml Erlenmeyer Conical Flask with a Screw Cap (Glassco) containing 6 ml of serum-free CD DG44 medium (Gibco, USA, 2337149) supplemented with 8 mM GlutaMAX\u0026trade; (Gibco, 2037045) and 18 ml/L Pluronic\u0026trade; F-68 (Gibco, 2044567). The cultures were maintained at 37\u0026deg;C, 85% relative humidity, and 8% CO₂ with 130 rpm agitation. 24 hours before transfection, cells were seeded at a density of 5\u0026times;10⁵ cells/ml. Linearized expression vectors were transfected into two 6.6 ml cell pools, each containing 3\u0026times;10⁵ cells/ml, using 4 \u0026micro;g of DNA per transfection along with OptiPRO\u0026trade; SFM (Gibco, 1465606) and FreeStyle\u0026trade; MAX reagent (Gibco, 2185360), following the manufacturer\u0026rsquo;s instructions. 48 hours after transfection, the selection was carried out by culturing the cells in CD OptiCHO\u0026trade; (Gibco, 2193384) medium without hypoxanthine and thymidine. Cell concentration and viability were assessed using the trypan blue (Sigma-Aldrich, USA, RNBL8011) exclusion method with analyses performed by a hemocytometer (Neubauer, Germany). After 22 days, cell viability exceeded 90%, and cell pools were obtained. Genomic DNA was extracted from both cell pools using the High pure PCR template preparation kit (Roche, 45611700). PCR subsequently confirmed the integration of the gene cassettes into the genome of both pools. On day 7, cell culture supernatants and pellets were collected for further analysis of EPO expression using reverse transcription quantitative polymerase chain reaction (RT-qPCR) for the pellets, Western blotting, and an enzyme-linked immunosorbent assay (ELISA) for the supernatants.\u003c/p\u003e\u003cp\u003emRNA expression analysis\u003c/p\u003e\u003cp\u003eTotal cellular RNA was extracted using the NucleoSpin\u0026trade; RNA kit (MACHEREYNAGEL, 1912/006) and treated with the GeneJET RNA Purification Kit (Thermo Fisher Scientific, 00071050). cDNA synthesis was performed using 1 \u0026micro;g of DNase-treated RNA with the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, 00903062), followed by RT-PCR. Real-Time PCR was conducted on a StepOnePlus\u0026trade; Real-Time PCR System (Applied Biosystems, USA) using a RealQ Plus 2x Master Mix Green (Amplicon, 19F1805) according to the manufacturer\u0026rsquo;s instructions. All samples were analyzed in duplicate. The primers used for Real-Time PCR are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Relative expression levels were calculated using the ΔCt method and normalized using GAPDH as an internal reference control. The ΔCt values were then used to determine fold change in gene expression via the 2^(-ΔΔCt) method. Experiments were performed in duplicate, and results are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers used in RT-qPCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence (5'\u0026gt;3')\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eForward \u003cem\u003eEPO\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGAGCACTGTAGCCTGAACG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReverse \u003cem\u003eEPO\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGCTGGCTGCTATTCAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eForward \u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAAGGTCATCCATGACAACTTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReverse \u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTCCACCACCCTGTTGCTGTAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eWestern blotting analysis\u003c/p\u003e\u003cp\u003eWestern blotting analysis was performed to detect the expression of EPO proteins in each cell pool. A total of 30 \u0026micro;g of concentrated supernatants collected from transfected and non-transfected cells on day 7 were separated by SDS-PAGE using a 12% resolving polyacrylamide gel. Proteins were then transferred onto a polyvinylidene difluoride (PVDF) (Amersham, UK, G5509140) membrane using the Mini Trans-Blot\u0026reg; Cell system (Bio-Rad, USA, 153BR77442). After blocking with 5% skim milk (Sigma-Aldrich, BCBK0207V (, a rabbit anti-human erythropoietin antibody (Bio-Rad, 180621, RIDD:AB_2098522) was used as the primary antibody at a 1:1000 dilution, followed by an anti-rabbit IgG antibody (Sigma, 0000403410, RIDD:AB_257896) as the secondary antibody at a 1:350000 dilution, according to the manufacturer\u0026rsquo;s instructions. The protein detection was performed using Amersham\u0026trade; ECL\u0026trade; Prime (Cytiva, UK, 9643337) with the Alliance Q9 Advanced System (UVITEC, UK).\u003c/p\u003e\u003cp\u003eEnzyme-linked immunosorbent assay\u003c/p\u003e\u003cp\u003eThe supernatants from recombinant cell pools were harvested on day 7 and used for EPO quantification. The EPO concentration was measured using the Human Erythropoietin DuoSet ELISA Kit (R\u0026amp;D Systems a Bio-Techne brand, USA, DY286-05) according to the manufacturer\u0026rsquo;s instructions. Sample concentrations were calculated based on standard curves generated by linear regression. All standard dilutions, along with negative and positive controls and samples, were assayed in duplicate. The optical density (OD) was measured at 450 nm using a Multiskan Spectrum Microplate Reader (Thermo Fisher Scientific).\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eExpression analysis data was statistically analyzed using a Student\u0026rsquo;s t-test and one-way analysis of variance (ANOVA) and Sidak\u0026rsquo;s multiple comparisons test in GraphPad Prism 9 (GraphPad Software, USA, RIID:SCR_002798) to assess significant differences in EPO production between the generated cell pools. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD from two independent experiments. For all statistical analyses, the difference between the means was considered significant at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eStable recombinant CHO cell pools were created through the pOptiVEC and UCOE vectors\u003c/p\u003e\u003cp\u003eThe pOptiVEC and UCOE vectors were used to clone the \u003cem\u003eEPO\u003c/em\u003e and \u003cem\u003eEPO\u003c/em\u003e-IRES-DHFR coding sequences, respectively. PCR analysis of the extracted genomic DNA confirmed the successful integration of the expression cassettes into the CHO DG44 genome. This integration was further validated by Sanger sequencing, which confirmed that the obtained fragment lengths matched the expected sizes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and b). Consequently, the UCOE-\u003cem\u003eEPO\u003c/em\u003e cell pool was successfully established, while the pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e cell pool was developed as a comparative control.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eUCOE cell pool indicated a higher level of mRNA expression\u003c/p\u003e\u003cp\u003eTo assess \u003cem\u003eEPO\u003c/em\u003e mRNA expression, pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e and UCOE-\u003cem\u003eEPO\u003c/em\u003e cell pools were seeded at a density of 3\u0026times;10⁵ cells/ml in 6-well plates and cultured for seven days. Previous studies identified day 7 as the optimal time point for collecting EPO from the UCOE-containing cell pool in batch culture (Hasheminejad et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The viable cell density and viability of cell pools were monitored on test days (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Cell samples were collected on day 7, and mRNA expression levels were analyzed using Real-Time PCR. The mean threshold cycle (Ct) value for the pOptiVEC cell pool was significantly higher than that of the UCOE cell pool, which was used as the reference for comparison. The UCOE cell pool exhibited a 3.8-fold higher \u003cem\u003eEPO\u003c/em\u003e mRNA expression compared to the pOptiVEC cell pool (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eExpression of EPO protein in each cell pool was confirmed through western blotting analysis\u003c/p\u003e\u003cp\u003eThe culture supernatants from each cell pool, collected on day 7, were analyzed by western blotting. Recombinant erythropoietin (Cinnapoietin\u0026reg;, G019FT) was used as a positive control, while the culture medium from CHO DG44 cells transfected with the empty pOptiVEC\u0026trade; vector served as a negative control. Western blotting analysis detected a 30.4 kDa band corresponding to EPO. Moreover, the UCOE-\u003cem\u003eEPO\u003c/em\u003e cell pool exhibited higher EPO protein expression levels than the pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e cell pool (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). The western blotting images were analyzed using ImageJ software (RIID:SCR_003070), with Cinnapoietin as a loading control (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eEPO was increased in the UCOE-containing cell pool\u003c/p\u003e\u003cp\u003eThe EPO expression levels in the culture supernatants of each cell pool were quantified using ELISA. In agreement with the western blotting results, the UCOE-\u003cem\u003eEPO\u003c/em\u003e cell pool exhibited significantly higher EPO production compared to the non-UCOE cell pool. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, after seven days of culture, the UCOE-\u003cem\u003eEPO\u003c/em\u003e cell pool produced seven-folds more EPO protein than the pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e cell pool. These results indicate that incorporating the UCOE element significantly enhances protein expression, leading to improved productivity compared to cell pools lacking this regulatory element.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe increasing demand for biopharmaceuticals and recombinant proteins has underscored the need for advanced bioprocessing technologies that can enhance protein yields for industrial production (Walsh \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). One key strategy to achieve higher productivity is the development of highly efficient cell lines, often by random insertion of expression vectors into the host cell genome. However, this random integration can lead to epigenetic changes, such as promoter methylation, which may cause transcriptional silencing of the transgene during cultivation. To mitigate this issue, the inclusion of chromatin-opening elements, such as UCOE (ubiquitous chromatin opening elements), in expression cassettes has shown promise in preventing gene silencing and improving expression levels (Guo et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Song et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Hoseinpoor et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xiong et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Ye et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Dharshanan et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn this study, we utilized UCOE elements to modulate chromatin structure and mitigate silencing in CHO DG44 cells. Our results indicate that the inclusion of UCOE upstream of the CMV promoter effectively reduced silencing associated with the recombinant gene, leading to a notable increase in recombinant protein production. This enhancement is likely due to the role of UCOEs, which contain elements derived from housekeeping gene promoters that are transcriptionally active and heavily acetylated (Benton et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). These elements function to maintain an open chromatin structure, thereby preventing transgene silencing and ensuring stable, high-level gene expression, regardless of the chromosomal integration site. This finding aligns with previous reports demonstrating that the incorporation of UCOEs into expression vectors enhances recombinant protein production in various mammalian cell lines. Comparing the effect of different DNA elements, including UCOEs, S/MARs, and cHS4 insulators, on protein expression levels, the UCOE cell lines displayed improved antibody production 6-fold higher than the non-UCOE cell lines. For instance, a study by Neville et al. (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) found that UCOE-containing vectors increased the stable expression of monoclonal antibodies in CHO cell-based systems by more than 10-fold (Neville et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In addition to enhancing recombinant protein yields, UCOEs have been shown to improve the homogeneity of expressing cell populations and increase the number of high-producing clones, even under stressful conditions (Betts et al \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). For instance, Hou et al. demonstrated that UCOE-based vectors allowed high-expressing clones to be cultured within four weeks of transfection, expediting the production process (Hou et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). However, challenges such as genome instability and reduced growth rates still present risks that can affect productivity, particularly during prolonged cultivation (Doan et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022a\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe use of mammalian cell lines, particularly CHO cells, remains the gold standard for recombinant protein production due to their ability to properly fold, assemble, and post-translationally modify proteins. In this study, the CHO DG44 cell line, which is deficient in both versions of the DHFR gene, was chosen for its advantages in cell density, viability, and productivity in suspension cultures. The DHFR system also allows the selection of stable clones, which is critical for large-scale production (Lucas et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). The use of UCOE-containing vectors with CHO cells can be considered a promising strategy for the production of recombinant proteins before industrial-scale production. In a study conducted by Doan et al. in 2022, the expression of TNF-α antibody was evaluated in CHO cell lines transfected with vectors containing and lacking UCOE elements. The results of this study demonstrated that the expression of this antibody was enhanced up to 3 times in the UCOE-containing cell pool compared to the control cell pool (Doan et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our findings corroborate the well-established correlation between cell growth and protein production, reinforcing the importance of optimizing cell line growth when selecting suitable cell pools for therapeutic protein production, such as erythropoietin (EPO) (Fann et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Chusainow et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn this study, we observed that the UCOE-\u003cem\u003eEPO\u003c/em\u003e cell pool produced 7-fold higher EPO levels compared to the pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e pool, as determined by ELISA. Moreover, the UCOE-EPO pool exhibited 3.8-fold higher \u003cem\u003eEPO\u003c/em\u003e mRNA expression than the non-UCOE control pool, suggesting that UCOE elements significantly enhance both transcriptional and translational levels of recombinant protein expression. These results are consistent with other published studies, which demonstrate that UCOE-containing pools exhibit higher recombinant protein production and enhanced transgene expression compared to the control pool that lacks this element (Hasheminejad et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Dharshanan et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Our study clearly demonstrates that mRNA expression levels do not always directly correlate with protein production. Factors such as translational efficiency, post-translational modifications, and protein stability play significant roles in determining the final yield of proteins. This complexity in recombinant protein expression reveals that multiple stages of gene expression and protein processing interact intricately, ultimately influencing the overall output. Understanding these interactions is crucial for optimizing protein production (Doan et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022a\u003c/span\u003e; Nematpour et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Additionally, the combined use of codon optimization and UCOE elements to enhance EPO expression in CHO DG44 cells further emphasizes the importance of optimizing multiple aspects of gene expression. Previous studies have demonstrated that codon optimization alone can lead to significant increases in mRNA and protein levels, as seen in the case of EPO production, where codon optimization improved transcript and protein levels by 13.8-fold and 2.9-fold, respectively (Kim et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1997\u003c/span\u003e).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, our findings indicated a boosted EPO expression rate at both mRNA and protein levels in the UCOE-\u003cem\u003eEPO\u003c/em\u003e pool compared to pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e. Here, we have provided evidence that the UCOE-based gene expression platform can provide promise as a means to enhance the time and cost efficiency for the biomanufacturing stages. Additionally, it may serve as a general template for recombinant protein production improvement.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eUCOEs Ubiquitous chromatin opening elements \u003c/p\u003e\n\u003cp\u003eCHO Chinese hamster ovary\u003c/p\u003e\n\u003cp\u003eEPO Erythropoietin\u003c/p\u003e\n\u003cp\u003erhEPO Recombinant human EPO\u003c/p\u003e\n\u003cp\u003eCKD Chronic kidney disease\u003c/p\u003e\n\u003cp\u003eSD Standard deviation\u003c/p\u003e\n\u003cp\u003ePVDF Polyvinylidene difluoride\u003c/p\u003e\n\u003cp\u003eOD Optical density\u003c/p\u003e\n\u003cp\u003eELISA Enzyme-linked immunosorbent assay\u003c/p\u003e\n\u003cp\u003eRT-qPCR Reverse transcription quantitative polymerase chain reaction\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003e\u0026nbsp; Many thanks to our colleagues at the Royan institute-ACECR for their cooperation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e Conceptualization: Amir Amiri-Yekta; Methodology: Fateme Hasheminejad, Haniyeh Norouzi; Formal analysis and investigation: Fateme Hasheminejad, Haniyeh Norouzi, Seyede Hoda Jazayeri, Zahra Halfinezhad, Abbas Daneshipour, Zeynab Khoshnood, Mahsa Nejati, Fatemeh Norouzi, Somayeh Abolghasemi, Mohsen Gharanfoli; Writing - original draft preparation: Fateme Hasheminejad, Haniyeh Norouzi; Writing - review and editing: Fateme Hasheminejad, Haniyeh Norouzi, Amir Amiri-Yekta; Funding acquisition: Amir Amiri-Yekta; Resources: Amir Amiri-Yekta; Supervisions: Amir Amiri-Yekta, Sara Taleahmad.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u0026nbsp; \u0026nbsp;This study was funded by grant number 99000004 from the Royan Institute, ACECR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u0026nbsp;\u003c/strong\u003e\u0026nbsp; \u0026nbsp;The authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003eThis study was approved by the Ethics Committee of Royan Institute (IR.ACECR.ROYAN.REC.1403.004).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u0026nbsp;\u003c/strong\u003e All authors confirm their approval of the final manuscript and their consent for publication.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAntoniou M, Harland L, Mustoe T et al (2003) Transgenes encompassing dual-promoter CpG islands from the human TBP and HNRPA2B1 loci are resistant to heterochromatin-mediated silencing. Genomics 82(3):269-79. https://doi.org/10.1016/s0888-7543(03)00107-1 \u003c/li\u003e\n\u003cli\u003eBarnes LM, Bentley CM, Dickson AJ (2000) Advances in animal cell recombinant protein production: GS-NS0 expression system. Cytotechnology 32:109-23. https://doi.org/10.1023/A:1008170710003\u003c/li\u003e\n\u003cli\u003eBenton T, Chen T, McEntee M et al (2002) The use of UCOE vectors in combination with a preadapted serum free, suspension cell line allows for rapid production of large quantities of protein. Cytotechnology 38:43-46. https://doi.org/10.1023/A:1021141712344\u003c/li\u003e\n\u003cli\u003eBerting A, Farcet MR, Kreil TR (2010) Virus susceptibility of Chinese hamster ovary (CHO) cells and detection of viral contaminations by adventitious agent testing. Biotechnol Bioeng 106(4):598-607. https://doi.org/10.1002/bit.22723\u003c/li\u003e\n\u003cli\u003eBetts Z, Croxford AS, Dickson AJ (2015) Evaluating the interaction between UCOE and DHFR-linked amplification and stability of recombinant protein expression. Biotechnol Prog 31(4):1014-25. https://doi.org/10.1002/btpr.2083\u003c/li\u003e\n\u003cli\u003eBird AP, Wolffe AP (1999) Methylation-induced repression\u0026mdash;belts, braces, and chromatin. Cell \u003cem\u003e99\u003c/em\u003e(5):451-454. https://doi.org/10.1016/s0092-8674(00)81532-9\u003c/li\u003e\n\u003cli\u003eBoscolo S, Mion F, Licciulli M et al (2012) Simple scale-up of recombinant antibody production using an UCOE containing vector. N Biotechnol\u003cstrong\u003e 29\u003c/strong\u003e(4):477-484. https://doi.org/10.1016/j.nbt.2011.12.005\u003c/li\u003e\n\u003cli\u003eButler M, Spearman M (2014) The choice of mammalian cell host and possibilities for glycosylation engineering. Curr Opin Biotechnol 30:107-12. https://doi.org/10.1016/j.copbio.2014.06.010\u003c/li\u003e\n\u003cli\u003eChusainow J, Yang YS, Yeo JH, Toh PC, Asvadi P, Wong NS, Yap MG (2009) A study of monoclonal antibody-producing CHO cell lines: what makes a stable high producer? Biotechnol Bioeng 102(4):1182-96. https://doi.org/10.1002/bit.22158\u003c/li\u003e\n\u003cli\u003eDerouazi M, Martinet D, Besuchet Schmutz N et al (2006) Genetic characterization of CHO production host DG44 and derivative recombinant cell lines. Biochem Biophys Res Commun 340(4):1069-77. https://doi.org/10.1016/j.bbrc.2005.12.111\u003c/li\u003e\n\u003cli\u003eDharshanan S, Chong H, Cheah SH, Zamrod Z (2014) Stable expression of H1C2 monoclonal antibody in NS0 and CHO cells using pFUSE and UCOE expression system. Cytotechnology 66(4):625-33. https://doi.org/10.1007/s10616-013-9615-x\u003c/li\u003e\n\u003cli\u003eDharshanan S, Chong H, Cheah SH, Zamrod Z (2014) Stable expression of H1C2 monoclonal antibody in NS0 and CHO cells using pFUSE and UCOE expression system. Cytotechnology 66(4):625-33. https://doi.org/10.1007/s10616-013-9615-x\u003c/li\u003e\n\u003cli\u003eDoan CC, Ho NQC, Nguyen TT, Nguyen TPT, Do DG, Hoang NS, Le TL (2022a) Enhancement of anti-TNF\u0026alpha; monoclonal antibody production in CHO cells through the use of UCOE and DHFR elements in vector construction and the optimization of cell culture media. Prep Biochem Biotechnol 52(4):452-470. https://doi.org/10.1080/10826068.2021.1963981\u003c/li\u003e\n\u003cli\u003eDoan CC, Le TL, Ho NQC, Hoang NS (2022) Effects of ubiquitous chromatin opening element (UCOE) on recombinant anti-TNF\u0026alpha; antibody production and expression stability in CHO-DG44 cells. Cytotechnology 74(1):31-49. https://doi.org/10.1007/s10616-021-00503-1\u003c/li\u003e\n\u003cli\u003eDurocher Y, Butler M (2009) Expression systems for therapeutic glycoprotein production. Curr Opin Biotechnol 20(6):700-7. https://doi.org/10.1016/j.copbio.2009.10.008\u003c/li\u003e\n\u003cli\u003eFann CH, Guirgis F, Chen G, Lao MS, Piret JM (2000) Limitations to the amplification and stability of human tissue-type plasminogen activator expression by Chinese hamster ovary cells. Biotechnol Bioeng 69(2):204-12. https://doi.org/10.1002/(sici)1097-0290(20000720)69:2%3C204::aid-bit9%3E3.0.co;2-z\u003c/li\u003e\n\u003cli\u003eFuks F (2005) DNA methylation and histone modifications: teaming up to silence genes. Curr Opin Genet Dev 15(5):490-495. https://doi.org/10.1016/j.gde.2005.08.002\u003c/li\u003e\n\u003cli\u003eGuo X, Wang C, Wang TY (2020) Chromatin-modifying elements for recombinant protein production in mammalian cell systems. Crit Rev Biotechnol 40(7):1035-43. https://doi.org/10.1080/07388551.2020.1805401\u003c/li\u003e\n\u003cli\u003eHasheminejad F, Amiri-Yekta A (2024) Recombinant Protein Expression Optimizing: A Review of S/MAR, STAR, and UCOE, as a Chromatin-Modifying Element. West Kaz Med J 28:137-45. https://doi.org/10.18502/wkmj.v66i2.16456\u003c/li\u003e\n\u003cli\u003eHasheminejad F, Jazayeri SH, Halfinezhad Z et al (2024) Ubiquitous chromatin opening element enhance Darbepoetin alfa expression in CHO DG44 cell line. Biochem Eng J \u003cstrong\u003e211\u003c/strong\u003e:109468. https://doi.org/10.2139/ssrn.4829999\u003c/li\u003e\n\u003cli\u003eHenry DH, Spivak JL (1995) Clinical use of erythropoietin. Curr Opin Hematol 2(2):118-24. https://doi.org/10.1097/00062752-199502020-00003\u003c/li\u003e\n\u003cli\u003eHoseinpoor R, Kazemi B, Rajabibazl M, Rahimpour A (2020) Improving the expression of anti-IL-2R\u0026alpha; monoclonal antibody in the CHO cells through optimization of the expression vector and translation efficiency. J Biotechnol 324:112-120. https://doi.org/10.1016/j.jbiotec.2020.09.006\u003c/li\u003e\n\u003cli\u003eHou JJ, Hughes BS, Smede M et al (2014) High-throughput ClonePix FL analysis of mAb-expressing clones using the UCOE expression system. N Biotechnol 31(3):214-20. https://doi.org/10.1016/j.nbt.2014.02.002\u003c/li\u003e\n\u003cli\u003eHunter M, Yuan P, Vavilala D, Fox M (2019) Optimization of protein expression in mammalian cells. Curr Protoc Protein Sci\u003cem\u003e 95\u003c/em\u003e(1):77. https://doi.org/10.1002/cpps.77\u003c/li\u003e\n\u003cli\u003eJazayeri SH, Amiri-Yekta A, Bahrami S, Gourabi H, Sanati MH, Khorramizadeh MR (2018) Vector and cell line engineering technologies toward recombinant protein expression in mammalian cell lines. Appl Biochem Biotechnol 185:986-1003. https://doi.org/10.1007/s12010-017-2689-8\u003c/li\u003e\n\u003cli\u003eKawabe Y, Inao T, Komatsu S, Huang G, Ito A, Omasa T, Kamihira M (2017) Improved recombinant antibody production by CHO cells using a production enhancer DNA element with repeated transgene integration at a predetermined chromosomal site. J Biosci Bioeng 123(3):390-397. https://doi.org/10.1016/j.jbiosc.2016.10.011\u003c/li\u003e\n\u003cli\u003eKim CH, Oh Y, Lee TH (1997) Codon optimization for high-level expression of human erythropoietin (EPO) in mammalian cells. Gene 199(1-2):293-301. https://doi.org/10.1016/s0378-1119(97)00384-3\u003c/li\u003e\n\u003cli\u003eKim JY, Kim YG, Lee GM (2012) CHO cells in biotechnology for production of recombinant proteins: current state and further potential. Appl Microbiol Biotechnol 93(3):917-30. https://doi.org/10.1007/s00253-011-3758-5\u003c/li\u003e\n\u003cli\u003eKrystal G (1983) A simple microassay for erythropoietin based on 3H-thymidine incorporation into spleen cells from phenylhydrazine treated mice. Exp Hematol 11(7):649-60\u003c/li\u003e\n\u003cli\u003eLucas BK, Giere LM, DeMarco RA, Shen A, Chisholm V, Crowley CW (1996) High-level production of recombinant proteins in CHO cells using a dicistronic DHFR intron expression vector. Nucleic Acids Res 24(9):1774-9. https://doi.org/10.1093/nar/24.9.1774\u003c/li\u003e\n\u003cli\u003eNag K, Mohiuddin M, Khan MR et al (2023) Development and qualification of a high-yield recombinant human Erythropoietin biosimilar. BioRxiv 2024-06. https://doi.org/10.1101/2023.01.22.525046\u003c/li\u003e\n\u003cli\u003eNematpour F, Mahboudi F, Vaziri B et al (2017) Evaluating the expression profile and stability of different UCOE containing vector combinations in mAb-producing CHO cells. BMC Biotechnol 17(1):18. https://doi.org/10.1186/s12896-017-0330-0\u003c/li\u003e\n\u003cli\u003eNeville JJ, Orlando J, Mann K, McCloskey B, Antoniou MN (2017) Ubiquitous Chromatin-opening Elements (UCOEs): Applications in biomanufacturing and gene therapy. Biotechnol Adv 35(5):557-564. https://doi.org/10.1016/j.biotechadv.2017.05.004\u003c/li\u003e\n\u003cli\u003eOrvieto R, Seifer DB (2016) Biosimilar FSH preparations-are they identical twins or just siblings? Reprod Biol Endocrinol 14:1-6. https://doi.org/10.1186/s12958-016-0167-8\u003c/li\u003e\n\u003cli\u003ePalomares LA, Estrada-Moncada S, Ram\u0026iacute;rez OT (2004) Production of Recombinant Proteins. In: Balb\u0026aacute;s P, Lorence A (eds) Recombinant Gene Expression. Methods in Molecular Biology, 3rd edn. Springer, Berlin, pp 15\u0026ndash;51\u003c/li\u003e\n\u003cli\u003ePUCK TT, CIECIURA SJ, ROBINSON A (1958) Genetics of somatic mammalian cells. III. Long-term cultivation of euploid cells from human and animal subjects. J Exp Med 108(6):945-56. https://doi.org/10.1084/jem.108.6.945\u003c/li\u003e\n\u003cli\u003eRazin A (1998) CpG methylation, chromatin structure and gene silencing\u0026mdash;a three-way connection. EMBO J \u003cstrong\u003e17\u003c/strong\u003e(17):4905-4908. https://doi.org/10.1093/emboj/17.17.4905\u003c/li\u003e\n\u003cli\u003eRomanova N, Noll T (2018) Engineered and natural promoters and chromatin‐modifying elements for recombinant protein expression in CHO cells. Biotechnol J 13(3):1700232. https://doi.org/10.1002/biot.201700232\u003c/li\u003e\n\u003cli\u003eSong SW, Lee SJ, Kim CY, Han B, Oh JW (2013) Rapid establishment of CHO cell lines producing the anti-hepatocyte growth factor antibody SFN68. J Microbiol Biotechnol 23(8):1176-84. https://doi.org/10.4014/jmb.1305.05056\u003c/li\u003e\n\u003cli\u003eVaras N, Camacho F, S\u0026aacute;nchez O (2018) Recombinant human erythropoietin. The problem of glycosylation. Lat Am J Biotechnol Life Sci \u003cstrong\u003e3\u003c/strong\u003e:683-688. https://doi.org/10.21931/RB/2018.03.03.10\u003c/li\u003e\n\u003cli\u003eWalsh G (2018) Biopharmaceutical benchmarks 20. Nat Biotechnol 36(12):1136-1145. https://doi.org/10.1038/nbt.4305\u003c/li\u003e\n\u003cli\u003eWang TY, Guo X (2020) Expression vector cassette engineering for recombinant therapeutic production in mammalian cell systems. Appl Microbiol Biotechnol 104(13):5673-88. https://doi.org/10.1007/s00253-020-10640-w\u003c/li\u003e\n\u003cli\u003eWilliams S, Mustoe T, Mulcahy T et al (2005) CpG-island fragments from the HNRPA2B1/CBX3 genomic locus reduce silencing and enhance transgene expression from the hCMV promoter/enhancer in mammalian cells. BMC Biotechnol 5:17. https://doi.org/10.1186/1472-6750-5-17\u003c/li\u003e\n\u003cli\u003eWurm FM (2004) Production of recombinant protein therapeutics in cultivated mammalian cells. Nat Biotechnol 22(11):1393-1398. https://doi.org/10.1038/nbt1026\u003c/li\u003e\n\u003cli\u003eWurm FM, Hacker D (2011) First CHO genome. Nat Biotechnol 29(8):718-20. https://doi.org/10.1038/nbt.1943\u003c/li\u003e\n\u003cli\u003eXiong KH, Liang QC, Xiong H, Zou CX, Gao GD, Zhao ZW, Zhang H (2005) Expression of chimeric antibody in mammalian cells using dicistronic expression vector. Biotechnol Lett 27(21):1713-7. https://doi.org/10.1007/s10529-005-2736-3\u003c/li\u003e\n\u003cli\u003eYe J, Alvin K, Latif H et al (2010) Rapid protein production using CHO stable transfection pools. Biotechnol Prog. 26(5):1431-7. https://doi.org/10.1002/btpr.469\u003c/li\u003e\n\u003cli\u003eZhu J, Hatton D (2018) New Mammalian Expression Systems. Adv Biochem Eng Biotechnol 165:9-50. https://doi.org/10.1007/10_2016_55\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"biotechnology-letters","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bile","sideBox":"Learn more about [Biotechnology Letters](https://www.springer.com/journal/10529)","snPcode":"10529","submissionUrl":"https://submission.nature.com/new-submission/10529/3","title":"Biotechnology Letters","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Ubiquitous chromatin opening element, CHO DG44, Erythropoietin, Recombinant protein","lastPublishedDoi":"10.21203/rs.3.rs-7213580/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7213580/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003ePurpose\u003c/em\u003e The demand for biopharmaceuticals has significantly increased in recent years. Achieving high-yield and cost-effective production of therapeutics remains a critical challenge. However, transcriptional gene silencing is a common issue in recombinant cell lines, often resulting in diminished protein expression levels. A promising strategy to overcome this challenge is the engineering of the expression cassette, particularly through the ubiquitous chromatin opening elements (UCOEs), unmethylated CpG island fragments derived from housekeeping genes. In this study, we utilized an expression platform incorporating a UCOE to enhance the expression of erythropoietin (EPO) in CHO DG44 cells.\u003c/p\u003e\u003cp\u003e\u003cem\u003eMethods\u003c/em\u003e The codon-optimized \u003cem\u003eEPO\u003c/em\u003e sequence was cloned into the pOptiVEC vector, and subsequently, the \u003cem\u003eEPO\u003c/em\u003e-IRES-DHFR fragment was inserted into the UCOE vector. Each linearized gene cassette was transfected into CHO DG44 cells. Subsequently, protein expression levels were assessed using quantitative Real-Time PCR, Western blotting, and enzyme-linked immunosorbent assay (ELISA).\u003c/p\u003e\u003cp\u003e\u003cem\u003eResults\u003c/em\u003e Our findings demonstrated a significant increase in EPO expression at both the mRNA and protein levels in the UCOE-\u003cem\u003eEPO\u003c/em\u003e-IRES-DHFR pool, which were 3.8 and 7 times higher compared to pOptiVEC-\u003cem\u003eEPO\u003c/em\u003e, respectively.\u003c/p\u003e\u003cp\u003e\u003cem\u003eConclusion\u003c/em\u003e This study suggests that UCOE elements can mitigate insertion-site position effects and enhance recombinant mRNA and protein expression in CHO DG44 cell lines. Additionally, these elements can substantially reduce the time and cost associated with large-scale recombinant protein production.\u003c/p\u003e","manuscriptTitle":"Recombinant Erythropoietin Expression Elevates by UCOE in CHO DG44 Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-27 14:17:16","doi":"10.21203/rs.3.rs-7213580/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2025-11-21T07:01:43+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-09-10T22:50:11+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-19T15:18:28+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-26T11:24:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"Biotechnology Letters","date":"2025-07-25T06:59:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"biotechnology-letters","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bile","sideBox":"Learn more about [Biotechnology Letters](https://www.springer.com/journal/10529)","snPcode":"10529","submissionUrl":"https://submission.nature.com/new-submission/10529/3","title":"Biotechnology Letters","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9db6d283-da3d-4489-94c3-c1db5cadcc80","owner":[],"postedDate":"August 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-02-23T16:10:23+00:00","versionOfRecord":{"articleIdentity":"rs-7213580","link":"https://doi.org/10.1007/s10529-026-03707-7","journal":{"identity":"biotechnology-letters","isVorOnly":false,"title":"Biotechnology Letters"},"publishedOn":"2026-02-16 15:57:10","publishedOnDateReadable":"February 16th, 2026"},"versionCreatedAt":"2025-08-27 14:17:16","video":"","vorDoi":"10.1007/s10529-026-03707-7","vorDoiUrl":"https://doi.org/10.1007/s10529-026-03707-7","workflowStages":[]},"version":"v1","identity":"rs-7213580","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7213580","identity":"rs-7213580","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}