Nitrogen Fixing Bacteria Reduces Drought Stress and Improve Molecular and Biochemical Response in the Garden Thyme

Nitrogen Fixing Bacteria Reduces Drought Stress and Improve Molecular and Biochemical Response in the Garden Thyme | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Nitrogen Fixing Bacteria Reduces Drought Stress and Improve Molecular and Biochemical Response in the Garden Thyme Farideh Goshasbi, Seyed Kazem Sabbagh, Mostfa Heydari This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4726162/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Abiotic stresses such as water-deficient are the most important factor that could impress the agricultural process causing a reduction of crop yield. Use of Bio-fertilizers could improve growth condition of drought stressed plant to reduce the damage of water deficit. The objective of this work is to assay comparative effect of some organic and non-organic fertilizers on the flowering branches essential and some antioxidant activity (APX, PO, CAT), then expression analysis of two thymus and carvacrol bio-synthesis related genes(CYP171 d178 and CYP171D180 ) in Thymus vulgaris under water deficit stress in a field trial was investigated using qRT-PCR method. The treatments were arranged in a completely randomized design with a total of 42 experimental separate blocks. The highest and lowest yield of flowering branches was observed in NPK and mycorrhizae treatments Approximately, Azospirillum bio-fertilizer showed high effect on enzyme activity in treated plants. Unlike, chemical fertilizer showed minimum efficiency on enzyme activity. A high expression level (approximately, 6-fold change) of both genes was observed in treated plants with Azospirillum bio-fertilizer while the lowest expression level (1.3-fold change) was observed in chemical fertilizer application when compared to other fertilizers. According to the obtained results of this work, we conclude that yearly fertilizer application could have a significant effect on molecular and biochemical traits and resulted in increase of yield component via decrease of drought stress. Plant medicinal Essentials oil Gene expression Thymol Carvacrol Figures Figure 1 Figure 2 Figure 3 1. Introduction Thymus vulgaris belonging to the Lamiaceae family is originally cultivated in Southern Europe and has a worldwide distribution. In the field of plant medicine, this species is known as thyme. The use of thyme has been recommended in traditional medicine as an infusion to treat cough, decrease blood insulin levels, control infectious diseases, and for digestive conditions in a syrup form (Ekoh et al, 2014 ). The antiseptic, antibiotic, and antifungal properties of thyme have been demonstrated by several studies (Dauqan and Abdullah 2017 ; Hosseinzadeh et al, 2015 ; Javed et al, 2013 ). Under water stress conditions, reactive species oxygen (ROS) is necessary to retain energy balance in influenced cells. The key role of Ascorbate peroxidase, peroxidase, and catalase as an antioxidant enzyme in free radical scavenging to water stress responses has been well demonstrated (Caverzan et al, 2012 ; Faize et al, 2011 ; Zhang and Kirkham 1994 ). Drought stress in soybean leads to a clear increase in the activity of antioxidant enzymes (Caverzan et al, 2012 ; Faize et al, 2011 ; Zhang and Kirkham 1994 ). Abiotic stresses such as water-deficient are the most important factor that could impress the agricultural process causing a reduction of crop yield. The physiology and growth of plants under drought stress can be influenced in many ways (Waraich et al, 2011 ). Soil moisture plays an important role in the mineral nutrient transport from the soil solution to the roots. Thus, any decrease of soil moisture due to water deficiency stress can affect nutrient transport from the roots to the shoots (da Silva et al, 2011 ). The use of bio-fertilizers in higher plants under drought stress can ameliorate the drought effect and enhance the soil’s water retention capacity and increase the root growth plus yield (Li and Ni 1996 ). Thymol and its isomer carvacrol are the main constituents of essential oil in thyme species. The biological and pharmacological properties of thymol and carvacrol as biocidal and antiseptic effects have been well documented (Ahmad et al, 2011 ; Gursul et al, 2019 ; Lambert et al, 2001 ). The objective of this study was to investigate the effect of bio-fertilizers on the change of antioxidant enzymes and expression level of two CYP171 d178 and CYP171D180 genes involved in the biosynthesis of thymol and carvacrol and also two SOD and APX genes involve in plant drought resistance in thymus vulgaris under water deficit stress. 2. Materials and Methods 2.1 Plant materials and culture condition This experimental field was performed during 2018–2019 at the Yazd province, Iran (Longitude 51° 17', Latitude 31° 53', Height 1230.2 m). At the first step, prior to thyme seedling transportation, chemical analysis of cultivation soil was performed on the soil sample (upper 25-cm layer) to determine soil texture and characteristics (Table 1 ). Table 1 Analysis of soil texture and physical and chemicals characteristics of sample cultivation soil N (%) P (mg/Kg) K (mg/kg) CO (%) Loam (%) Clay (%) Sand (%) pH EC (ds/m) Soil Texture 0.029 14.8 190.8 0.339 15 10 75 7.66 2.05 Sandy loam Meteorological and climate data were obtained from nearest weather station at Yazd province, Iran. Meteorological and climate data were obtained from nearest weather station at Yazd province, Iran. Average annual of atmospheric characteristics of weather are summarized in Table 2 . Table 2 The annual average of climate data in Yazd province Number of sunny hours annual evaporation (mm) Total annual rainfall (mm) Average maximum annual relative humidity (%) Average minimum annual relative humidity (%) Average annual relative humidity (%) Average maximum annual temperature (°C) Average minimum annual temperature (°C) Average annual temperature (°C) Station 3409.9 3063.8 71.6 40.7 15.2 27.9 27.7 14.4 21 Yazd Seeds of Thymus vulgaris were surface sterilized by 1% chloramine T (Sigma) and then were rinsed three times with tap water. Disinfected seeds were planted in Gifi pot containing peat moss and were maintained in the nursery. Seedlings were transported (50 plantlet/ plot) from the nursery to the main field designed ( October) to blocking plots with determined size (4 × 3.5 m). The first irrigation after transplanting was performed by the flooding method. After installing plants in the soil, plants were irrigated by the drip irrigation system. The volume of consumed water was the same for all treatments. The periods of irrigation were continued until sampling time at the flowering stage. 2.3 The treatments The treatments consisted of: drought stress: three irrigation intervals (W 1 = 7day, W 2 = 12 day, and W 3 = 17d), Bio-fertilizer treatments (B 1 = control, B 2 = Mycorrhiza (Rhizophagus irregular fungi; 5%,150gr/plant), B 3 = Azospirillum brasilense; 200gr/10lit water, B 4 = Pseudomonas fluorescens bacterial; 200gr/10lit water and B5 = NKP (20:20:20) fertilizer;200kg/ha). Controls were drought-stressed plants without bio-fertilizer application. Three independent replicates were done for all treatments.The treatments were arranged in a completely randomized design with a total of 45 experimental units. 2.2 Flowering branches yield and essential oil measurement During the experiment from Two months after the date of transplanting to the field and at the flowering stage for a week, Thymus flowers were counted and removed three times, and the individual counts were combined. At the end of the experiment (at the flowering stage ), shoots were separated from stems, and shoot fresh weight (FW) was recorded. Flowers were then dried at 80°C for 2 days, and dry weight (DW) was recorded. Clevenger apparatus was used to extract the essential oil in treated plants with bio-fertilizer under drought stress. Essential oils were stored in dark glass containers and in the refrigerator for further analysis. 2.4 Plant extraction and enzyme activity assay Plant materials were frozen in liquid nitrogen and then were grinded into a fine powder with a mortar and pestle. Sodium phosphate buffer (50mM, pH 7.0) containing 0.1 mM EDTA and polyvinyl pyrrolidone (1% w/v) was used as extraction buffer. The homogenate was filtered through cheesecloth and the filtrate was centrifuged at 14 000 g for 25 min at 4º C. Enzyme activity was determined using aliquots of the supernatant as a crude extract. Catalase activity (µmol(H2O2) g- /min) was done by the method of Goth (Goth 1991 ). One unit of CAT activity was defined as the absorbance change of 0.01 per min. Guaiacol is a hydrogen donor was used to determine peroxidase activity (Fielding and Hall 1978 ) Nitroblue tetrazolium (NBT) reagent was used to measure Superoxide dismutase (SOD) activity. SOS can inhibit photochemical reduction of NBT (Kjari et al, 2000). Ascorbate peroxidase activity was determined by the Nakano and Asada Method (Nakano and Asada 1981 ) based on the oxidation of ascorbate. 2.5 mRNA extraction and cDNA synthesis Total RNA of 50mg of leaf tissue from treated and non-treated thyme plants was extracted by the Pure Plant RNA Purification Kit (TopazGene, Iran) according to the manufacturer’s instructions. RNase-free DNase I (Sinaclon, Iran) was used to eliminate genomic DNA contamination. Total RNA was quantified using a Nanodrop ND-100 spectrophotometer and RNA quality was assessed by 1% agarose gel electrophoresis stained by Ethidium bromide (Sabbagh, et al, 2012 ). Purified RNA was subjected to first-strand cDNA synthesis using a superscript reverse transcriptase kit (Sinaclon, Iran). The Actin gene was used as a reference gene. Sequences of CYP71D178 and CYP71D180 genes were provided from Crocoll (Crocoll 2011 ). The primers for SOD, APX genes were selected from Baek and Mehrabadi pour-began (Baek and Skinner 2003 ; Mehrabad Pour-Benab et al, 2019 ). The character of primer sequences for the selected genes is summarized in Table 3 . Table 3 Nucleotide sequences of primers used in PCR. gene Forward primer 5′ -3′ Reverse primer 5′ -3 Reference CYP178 TGGCCTTTGGAAGCGTCG TCAGGCTCATTCCAATAGAGG Majidi CYP180 GGTAAACTGGCGGACTTGGT CGAACGGGATTAACTCGAAA Majidi actin ATTCTTACCCTCAAGTAT CATGATCTGAGTCATCTT 2.6 Relative gene expression analysis Real-time PCR (qRT-PCR) was done in a Rotor gene Real-Time PCR System (Corbett 3000, Australia) a volume of 25 µL containing 8 µL of Eva Green qPCR Mix (5x Hot FIREPOL, ROX, Ampliqon), 3 µL of diluted cDNA, 2 µL of forward and reverse primers ( 0.5 µmol/L) of, and 10 µL of RNase-free water. The PCR temperature cycling conditions were as follows: a first initial denaturation in 95°C for 4 min followed by: 95°C for 20 seconds, 20-second primer annealing at optimum degree for each primer, and elongation at 72°C for 30 seconds in 40 cycles, with a five-minute extension at 72°C after the final cycle. The reactions were repeated two times (as two technical replications) for each of two biological samples The Ct values of the calibrator and the samples were normalized to the endogenous housekeeping gene. Relative gene expressions were determined according to the ∆∆Ct method, using the formula: 2-∆∆Ct where, ∆∆Ct= [∆] Ct sample -[∆]Ct reference where, [∆] Ct sample was the Ct value for any sample normalized to the endogenous actin gene as reference gene, and -[∆]Ct reference value for the reference sample normalized to the endogenous housekeeping gene (Livak and Schmittgen 2001 ). 2.6. Data analysis Enzymes activity was measured on three independent experiments. One-way analysis of variance (ANOVA) with three replications was carried out. If significant differences were found, pairs of samples were compared by Tukey's test. Statistical analysis was performed with SAS software SAS 9.1 software package. The relative expression level of targets genes was analyzed with ∆∆Ct method and was normalized to the expression level of the actin gene. SPSS (v. 22) software was used to the analysis of gene expression data obtained using the qRT-PCR method. All data were statistically analyzed using LSD 0.05. 3. Results 3.1. Flowering branches and Essential oil The results of analysis of variance of flowering branch trait showed that the interaction effect of irrigation periods and fertilizers on the yield of flowering branches was significant at the 1% probability level (Table 4 ). The highest yield of flowering branches was observed during the irrigation period of 7d (W1) and in NPK fertilizer treatment (30.2 g/plantlet), while the lowest amount of this trait was related to the irrigation period of 17 days with mycorrhizae application (11.7 g/plantlet). The reduction of this trait (61%) showed a close relation between drought stress and flowering branch production (Fig. 1 a). Table 4 Analysis of variance of flowering branches yield, essential oil yield and activity of antioxidant enzymes in treated Thymus plant with fertilizer under drought stress. Mean square Source of Variance df Catalase Peroxidase Ascorbate peroxidase (APX) Superoxide dismutase(SOD) Repetition(R) 2 0.004 n.s 0.001 n.s 63.82 n.s 0.00008 * Water deficit Stress(W) 2 0.38 ** 0.012 * 5305.87 ** 0.0004 * Error a(R*A) 4 0.0006 0.0007 27.99 0.00004 Fertilizers(B) 4 1.56 ** 0.035 ** 3803.93 ** 0.00020 ** W*B 8 0.45 ** 0.047 ** 3907.58 ** 0.00012 ** Error b 24 0.0003 0.0003 5.23 0.00002 C.V. (%) 1.77 8.59 6.2 16.38 ns, *, **: non-significantly difference and significantly differences at 5 and 1% of probability levels, respectively. The mean comparison of obtained data revealed a high level of essential oil production (7.15 g/plantlet) during the irrigation period of 12 days and with Pseudomonas bio-fertilizer application. This amount was reduced (3.15 g/plantlet) in the irrigation period of 7d with Azospirillum bio-fertilizer application. The effect of fertilizers on the essential oil production indicated that the Pseudomonas treatment had a significant effect on this parameter when compared to the control treatment (Fig. 1 b). Figure 1 Weight of flowering branches (a) and essential oil (b) in Thymus plants, 7, 12 and 17days after irrigation in the field condition. Plants were either non-inoculated with any fertilizer or were inoculated with one of three mycorrhiza, Azospirillum and Pseudomonas bio- fertilizers Inocula, and NKP fertilizer. Different letters denote significant differences between means of control and fertilizers treatments determined by a t test (P < 0.05) 3.2. Enzyme activity The results of the analysis of variance indicated that the interaction effect of drought stress and fertilizers treatments on the activity of tested enzymes was significant at the 1% probability level (Table 4 ). Catalase activity assay showed an enhancement of catalase activity upon prolongation of the drought period. In all irrigation intervals, the maximum activity of the catalase enzyme occurred in treated plants with Pseudomonas bio-fertilizer. During irrigation intervals of 12 days, mycorrhizae and Azospirillum application did not affect the enzyme activity when compared to control plants (Fig. 2 ). The maximum amount of peroxidase enzyme (0.043 u/g Fw) occurred during an irrigation interval of 12 days in plants treated with Azospirillum bio-fertilizer. The lowest rate of enzyme expression (0.015 u/gFw) was detected in plants treated with NPK fertilizer under water stress during an irrigation period of 7 days 12 days. Further, all bio-fertilizers caused increased peroxidase activity water stress caused in all treatments (Fig. 2 ). The greatest change in SOD enzyme activity occurred during the irrigation period of 12 days in plants treated with Azospirillum; as with other enzymes, the lowest enzyme activity was observed in the control plant (7d) for NPK application. Within 17-day irrigation, Pseudomonas bio-fertilizer caused high activity of SOD enzyme (Fig. 2 ). Unlike other enzymes, the use of fertilizer did not show any effect on APX enzyme activity. Almost in all three irrigation intervals, the expression of the APX enzyme was reduced. Table 4 Analysis of variance of flowering branches yield, essential oil yield and activity of antioxidant enzymes in treated Thymus plant with fertilizer under drought stress . Figure 2 Antioxidant Enzyme Changes in treated Thymus plants with fertilizer in response to drought stress. Vertical bars indicate SE of three replicates for each treatment. Values are means with standard error of the means ± SE and different letters indicate a significant difference at p < 0.01 3.3 Differential expression of thymus bio-synthesis genes in response to fertilizers application The relative gene expression levels between different samples were captured with the qRT-PCR method at three irrigation intervals. The plants treated with different fertilizers under water deficit stress were subjected to this investigation. The results of gene expression analysis showed that both investigated genes were differentially affected by fertilizer application. The higher transcription level of two tested genes was observed within 12-day irrigation as compared to other water-stress time periods (17 days). At this time period, the transcription level of CYP71d176 and CYP71D180 was significantly elevated for Azospirillum application. A 6- and 5.8-fold increase for CYP71d176 and CYP71D180 genes was observed in plants treated with Azospirillum bio-fertilizer during 12 and 17 days, respectively (Fig. 3 ). The lowest transcription level of both genes was observed in plants treated with NKP fertilizer when compared to bio-fertilizer treatments. A significant reduction of gene expression occurred during 17 days with different intensities for all genes. An insignificant difference was observed when NPK fertilizer was applied in both drought stresses. Figure 3 Gene expression analysis of CYP71d176 and CYP71D180 genes in treated Thymus plant with fertilizer under drought stress 4. Discussion Drought stress negatively affects crop growth and is the most important factor-limiting yield in agricultural systems around the world, especially in arid and semi- arid. Little is known about the efficiency of fertilizer application to reduce the water drought stress damages in plant farming under drought conditions. In medicinal plants, water deficit can reduce the quality and quantity of aromatic compounds such as terpenoids, thymol, and carvacrol. The glandular trichomes located on the aerial part of thyme species are the local production of essential oil in plants belonging to Lamiaceae. The maximum amount of essential oil secretion would occur at the flowering time. Our results indicated that some fertilizers in the single form including nitrogen-fixing bacterial Azospirillum and Rh. irregular fungi at irrigation intervals of 7days positively affected flowering branches but water overtime period led to a reduction of flowering. The maximum effect of fertilizer treatment on the flowering branch occurred with Azospirillum. It showed a direct relationship between flowering branch traits and bio-fertilizer treatments. The use of different elicitors should not have any physical damage to terpene structures (Martin et al, 2003 ). Exogenous application of MeJA and MeSA increased total terpene and linalool emission in the leaf of Norway Spruce plant ( Picea abies ) without any inflicting physical damage to these compounds. Thus, we suggest the use of nutritional supplements to induce plants to increase terpenoid compounds and elevate the thymol and carvacrol bio-synthesis in T. vulgaris . The application of biochemical and molecular methods can illustrate the mechanisms involved in the biosynthesis of phenolic monoterpenes and understanding the regulatory mechanisms by which secondary metabolic are modulated (Iijima 2014 ). The maximum effect of fertilizer treatment on the flowering branch occurred with Azospirillum. It showed a direct relationship between the flowering branch and activity of all investigated enzymes. The use of different elicitors does not have any physical damage to terpene structures (Martin et al, 2003 ). Exogenous application of MeJA and MeSA increased total terpene and linalool emission in the leaf of Norway Spruce plants ( Picea abies ) without any inflicting physical damage in response to these compounds. Thus, we suggest the use of nutritional supplements as plant inducers to increase terpenoid compounds in T. vulgaris. The application of biochemical and molecular methods can illustrate the mechanisms involved in the biosynthesis of phenolic monoterpenes and understanding the regulatory mechanisms by which secondary metabolic are modulated (Iijima 2014 ). Nitrogen resources in the rhizosphere can play a key role in plant tolerance in response to drought stress (Marino et al, 2007 ; Pimratch et al, 2008 ). Change in roots system which is influenced by the complementary treatment of organic and inorganic fertilizers could improve plant growth and response to water deficit stress. In this study, the impact of drought stress and fertilizers application on recuperating of some antioxidant enzymes, and expression level of some related genes to thymol bio-synthesis and also involved in drought stress resistance was investigated. Treatment of drought-stressed thyme plants with fertilizers led to a significant increase in the number and weight of flowering branches. Application of fertilizers in a single form also leads to changes in antioxidant enzyme activity. Antioxidant enzymes and reactive oxygen species (ROS) are involved in plant tolerance (Caverzan et al, 2016 ). Similar studies have shown that water and salinity stress may increase some antioxidant enzymes (Pan et al, 2006 ). In this research, all investigated enzymes showed higher activity when the thymus plant was irrigated for a period of 12 days. Our results are in accordance with previous results that have shown high antioxidant enzymes activity of maize plants in response to drought stress (Ali et al, 2010 ; Boaretto et al, 2014 ). Mohammadi and co-workers found that the use of mycorrhizal fungi can alleviate water deficit stress more than nitrogen-fixing bacteria and chemical fertilizers in the Oenothera biennis plant (Mohammadi et al, 2019 ). Unlike these results, our observation indicates reduce of enzyme activity in the mycorrhizal application under drought stress while enzyme activity was positively increased in treated plants with nitrogen-fixing bacteria. It can be due to an increase of electron donors in plant-bacteria association causing the increase in metabolic transport across cell membranes (Udvardi and Day 1997 ). Furthermore, researchers have reported that mycorrhizal symbiosis in the biotic zone of the rhizosphere may lead to increases in leaf water potential transpiration rate, reduce leaf temperature, and restrain the decomposition of chlorophyll content under water deficit stress. Mycorrhizal fungi with a mild form of parasitism cause high osmotic adjustment by increasing the accumulation of inorganic ions (Na, Ca2+, and Mg2+) (Wu and Xia 2006). A combination of different organic and non-organic fertilizers can cause synergistic effects on water-deficit stress response (Abbaspour 2010 ). Nodulated soybean plants under water deficit stress showed less sensitivity to drought stress when compared to treated nitrate feed plants individually (Kirova et al, 2008 ). It seems that photo-respiratory flux under water stress can activate the root system to uptake soil nitrogen by nitrogen-fixing bacteria. The use of nitrogen and phosphorus with an irrigation frequency in Salvia officinalis L. plants showed no effect on essential oil (Rioba et al, 2015 ). But, in this work fertilizer treatments caused an increase in thymol and carvacrol-related gene expression. Thymol and carvacrol are two main components of some plant families such as Lamiaceae and Ranunculaceae. The potential of anti-stress effects of these compounds against various biotic and abiotic stresses have been demonstrated. The application of animal fertilizers leads to an increase of thymol percentage in the essential oil while the percentages of other terpenoid compounds were not affected (Naghdi Badi et al, 2017 ). The effect of some abiotic elicitors such as methyl jasmonate and salicylic on the relative expression gene related to thymol-biosynthesis showed that these factors affected the biosynthesis of these terpenoid compounds (Majdi et al, 2017 ). Bio- Fertilizer treatment could lead to an increase of pharmaceutically active compounds (PhACs) in the Lamiaceae family. In this research, the relative expression of two CYP71d176 and CYP71D180 genes in response to plant nutrition supplementation under water stress showed that the expression level of both tested genes could be affected by fertilizer application. The measure of the transcriptional level of CYP71d176 and CYP71D180 genes in thyme leaf at two irrigation periods of 12day and 17day and compared to irrigation period of 7d showed an increase in the gene expression in all treatments. On the other hand, the expression pattern of gene expression varied between treatments. Based on these results, we can conclude that this molecular marker will be useful in understanding the expression of drought-responsive genes in T. vulgaris when plant growth inducers are used for the increase drought resistance. 5. Conclusions In this work, we attempted to investigate the effect of nutritional supplements such as fertilizers in water-stressed T. vulgaris plants on changes of some antioxidant enzymes and relative expression of four genes involved in thymol biosynthesis and drought resistance. Our results revealed that the application of fertilizers can affect all tested enzymes. The change of enzyme activity was gradually variable depending on the type of bio-fertilizer. The maximum tolerance to water stress was determined during the 12-day irrigation period. An increase in the irrigation time period could reduce the adaptation of plants to water deficit. Based on these results, we suggest that at moderate water stress, the application of fertilizers can display a serial molecular and biochemical mechanism to tolerate drought stress. To elucidate the regulatory mechanism involved in the biosynthesis pathway of torpedoed compounds and drought resistance, transcriptional analysis through microarray is recommended. Declarations Author Contributions Statemen • F. G. Participated in designing the evaluation, performed parts of the statistical analysis and helped to draft the manuscript S.K.S conceived and designed the evaluation and drafted the manuscript, M. H . re-evaluated the acquired data, revised the manuscript and performed the statistical analysis and revised the manuscript, M.M . critical revision of the manuscript for important intellectual content. All authors read and approved the final manuscript. Acknowledgments We would like to thank the member of Department of biology at Yazd University to access of laboratory equipment's. We also thank Dr. Mohammad Reza Sarafraz Ardakani to help us in data analysis and Dr. Mahta Mazaheri for qRT-PCR data analysis. This study was supported by vice research of Yazd University (Grant No. 99/P/2728). Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Conflict of interests The authors declare no conflict of interest. References Abbaspour H (2010) Investigation of the effects of vesicular arbuscular mycorrhiza on mineral nutrition and growth of Carthamus tinctorius under salt stress conditions. Russian J Plant Physiol 57:526–531. https://doi.org/10.1134/S1021443710040102 Ahmad A, Khan A, Akhtar F, Yousuf S, Xess I, Khan L et al (2011) Fungicidal activity of thymol and carvacrol by disrupting ergosterol biosynthesis and membrane integrity against Candida. Eur J Clin Microbiol Infec Dis 30:41–50. https://doi.org/10.1007/s10096-010-1050-8 Ali Q, Ashraf M, Anwar F (2010) Seed composition and seed oil antioxidant activity of maize under water stress. J Am Oil Chem 87:1179–1187. https://doi.org/10.1007/s11746-010-1599-5 Allen RD (1995) Dissection of oxidative stress tolerance using transgenic plants. Plant Physiol 107:1049–1054. 10.1104/pp.107.4.1049 Baek K-H, Skinner DZ (2003) Alteration of antioxidant enzyme gene expression during cold acclimation of near-isogenic wheat lines. Plant Sci 165:1221–1227. 10.1016/S0168-9452(03)00329-7 Boaretto LF, Carvalho G, Borgo L, Creste S, Landell MG, Mazzafera P et al (2014) Water stress reveals differential antioxidant responses of tolerant and non-tolerant sugarcane genotypes. Plant Physiol Biochem 74:165–175. https://doi.org/10.1134/S1021443710040102 Caverzan A, Casassola A, Brammer SP (2016) Reactive oxygen species and antioxidant enzymes involved in plant tolerance to stress In: Shanker, A. an Shanker, Abiotic and biotic stress in plants-Recent advances and future perspectives. Publisher InTech 463–480. 10.5772/61368 Caverzan A, Passaia G, Rosa SB, Ribeiro CW, Lazzarotto F, Margis-Pinheiro M (2012) Plant responses to stresses: role of ascorbate peroxidase in the antioxidant protection. Gene Mol Biol 35:1011–1019. https://doi.org/10.1590/S1415-47572012000600016 Crocoll C (2011) Biosynthesis of the phenolic monoterpenes, thymol and carvacrol, by terpene synthases and cytochrome P450s in oregano and thyme. Academic Dissertation,der Biologisch-Pharmazeutischen Fakultät der Friedrich-Schiller-Universität Jena. http://doi: handle.net/11858/00-001M-0000-000F-511E-C da Silva EC, Nogueira R, da Silva MA, de Albuquerque MB (2011) Drought stress and plant nutrition. Plant Stress 5:32–41. https://www.academia.edu/download/46203050/Drought_Stress_and_Plant_Nutrition20160603-21495-1k6asbj.pdf Dauqan E, Abdullah A (2017) Medicinal and functional values of thyme ( Thymus vulgaris L.) herb. J Appl Biol Biotechnol 5:17–22. 10.7324/JABB.2017.50203 Ekoh S, Akubugwo E, Victor Chibueze U, Nzubechukwu E (2014) Anti-hyperglycemic and anti-hyperlipidemic effect of spices ( Thymus vulgaris , Murraya koenigii , Ocimum gratissimum and Piper guineense ) in alloxan-induced diabetic rats. Int J Biosci 4:179–187. http://dx.doi.org/10.12692/ijb/4.2.179-187 Faize M, Burgos L, Faize L, Piqueras A, Nicolas E, Barba-Espin G et al (2011) Involvement of cytosolic ascorbate peroxidase and Cu/Zn-superoxide dismutase for improved tolerance against drought stress. J Exp Bot 62:2599–2613. 10.1093/jxb/erq432 Fielding J, Hall J (1978) A biolchemical and cytochemical study of peroxidase activity in roots of Pisum sativum: I. a comparison of DAB-peroxidase and guaiacol-peroxidase with particular emphasis on the properties of cell wall activity. J Exp Bot 29:969–981. https://doi.org/10.1093/jxb/29.4.969 Goth L (1991) A simple method for determination of serum catalase activity and revision of reference range. Clin Chim Acta. 196: 143–151. doi I: 10.1016/0009-8981(91)90067-m Gursul S, Karabulut I, Durmaz G (2019) Antioxidant efficacy of thymol and carvacrol in microencapsulated walnut oil triacylglycerols. Food Chem 278:805–810. 10.1016/j.foodchem.2018.11.134 Hosseinzadeh S, Jafarikukhdan A, Hosseini A, Armand R (2015) The application of medicinal plants in traditional and modern medicine: a review of Thymus vulgaris . Int J Clin Med 6:635–644. 10.4236/ijcm.2015.69084 Iijima Y (2014) Recent advances in the application of metabolomics to studies of biogenic volatile organic compounds (BVOC) produced by plant. Metabolites 4:699–721. 10.3390/metabo4030699 Javed H, Erum S, Tabassum S, Ameen F (2013) An overview on medicinal importance of thymus vulgaris. J Asian Sci Res 3:974–986. http://aessweb.com/journal-detail.php?id=5003 Kajari D, Luna S, Gagan C (2000) A Modified Spectrophotometric Assay of Superoxide Dismutase Using Nitrite Formation by Superoxide Radicals. Indian j Biochem Biol 37:201–204 Kirova E, Tzvetkova N, Vaseva I, Ignatov G (2008) Photosynthetic responses of nitrate-fed and nitrogen-fixing soybeans to progressive water stress. J Plant Nut 31:445–458. https://doi.org/10.1080/01904160801894988 Lambert R, Skandamis PN, Coote PJ, Nychas GJ (2001) A study of the minimum inhibitory concentration and mode of action of oregano essential oil, thymol and carvacrol. J Appl Microbiol 91:453–462. 10.1046/j.1365-2672.2001.01428.x Li W, Ni Y (1996) Researches on application of microbial inoculant in crop production. Researches and application of En technology. Agriculture University, Beijing, China, pp 42–84 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2∆∆Ct method. Methods 25:402–408. 10.1006/meth.2001.1262 Majdi M, Malekzadeh-Mashhady A, Maroufi A, Crocoll C (2017) Tissue-specific gene-expression patterns of genes associated with thymol/carvacrol biosynthesis in thyme ( Thymus vulgaris L.) and their differential changes upon treatment with abiotic elicitors. Plant Physiol Biochem. 115: 152–162. doi I: 10.1016/j.plaphy.2017.03.016 Marino D, Frendo P, Ladrera R, Zabalza A, Puppo A, Arrese-Igor C et al (2007) Nitrogen fixation control under drought stress. Localized or systemic? Plant Physiol 143:1968–1974. 10.1104/pp.106.097139 Martin DM, Gershenzon J, Bohlmann J (2003) Induction of volatile terpene biosynthesis and diurnal emission by methyl jasmonate in foliage of Norway spruce. Plant Physiol 132:1586–1599. https://doi.org/10.1104/pp.103.021196 Mehrabad Pour-Benab S, Fabriki-Ourang S, Mehrabi A-A (2019) Expression of dehydrin and antioxidant genes and enzymatic antioxidant defense under drought stress in wild relatives of wheat. Biotechnol Equip 33:1063–1073. 10.1080/13102818.2019.1638300 Mohammadi M, Modarres-Sanavy SAM, Pirdashti H, Zand B, Tahmasebi-Sarvestani Z (2019) Arbuscular mycorrhizae alleviate water deficit stress and improve antioxidant response, more than nitrogen fixing bacteria or chemical fertilizer in the evening primrose. Rhizosphere 9:76–89. https://doi.org/10.1016/j.rhisph.2018.11.008 Naghdi Badi H, Abdollahi M, Mehrafarin A, Ghorbanpour M, Tolyat M, Qaderi A et al (2017) An Overview on Two Valuable Natural and Bioactive Compounds, Thymol and Carvacrol, in Medicinal Plants. J Med Plants 16:1–32. http://jmp.ir/article-1-1828-en.html Nakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol 22:867–880. https://doi.org/10.1093/oxfordjournals.pcp.a076232 Pan Y, Wu LJ, Yu ZL (2006) Effect of salt and drought stress on antioxidant enzymes activities and SOD isoenzymes of liquorice ( Glycyrrhiza uralensis Fisch). Plant Grow Regul 49:157–165. https://doi.org/10.1007/s10725-006-9101-y Pimratch S, Jogloy S, Vorasoot N, Toomsan B, Patanothai A, Holbrook C (2008) Relationship between biomass production and nitrogen fixation under drought-stress conditions in peanut genotypes with different levels of drought resistance. J Agri Crop Sci 194:15–25. https://doi.org/10.1111/j.1439-037X.2007.00286.x Rioba NB, Itulya FM, Saidi M, Dudai N, Bernstein N (2015) Effects of nitrogen, phosphorus and irrigation frequency on essential oil content and composition of sage ( Salvia officinalis L). J Appl Res Med Arom Plants 2:21–29. https://doi.org/10.1016/j.jarmap.2015.01.003 Sabbagh SK, Mazaheri M, Panjehkeh N, Salari M (2012) Transcriptomic analysis of Sporisorium reilianum in response to the strigolactone analogue GR24. Phytopathol Medi 51(2):283–291. https://oajournals.fupress.net/index.php/pm/article/view/5483 Udvardi MK, Day DA (1997) Metabolite transport across symbiotic membranes of legume nodules. Ann Rev Plant Biol 48:493–523. 10.1146/annurev.arplant.48.1.493 Waraich EA, Ahmad R, Ashraf M (2011) Role of mineral nutrition in alleviation of drought stress in plants. Australian J Crop Sci 5:764–777. https://doi.org/10.1038/s41598-019-49404-6 Zhang J, Kirkham M (1994) Drought-stress-induced changes in activities of superoxide dismutase, catalase, and peroxidase in wheat species. Plant Cell Physiol 35:785–791. https://doi.org/10.1093/oxfordjournals.pcp.a078658 Supplementary Files highlight.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4726162","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":333652975,"identity":"7da3ecd0-459b-469e-81ae-dc1a8f4f1f4c","order_by":0,"name":"Farideh Goshasbi","email":"","orcid":"","institution":"Shahrood University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Farideh","middleName":"","lastName":"Goshasbi","suffix":""},{"id":333652976,"identity":"83194b8a-d80b-4708-b9e3-954fbc3ef933","order_by":1,"name":"Seyed Kazem Sabbagh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYDACHgYGZsYGBgYDdiDBwAYSAnGJ0sJzgGQtEgkwLQSAfM/xh58Ld9jZbZd8Y/jxRxmDPH8Dc9sHfFoMzvYYS888k5y8c3aOsYTEOQbDGQcYm2fg1cLPwyDN28acbHA7x0DCsI2BcQMDYzN+h/WzP/7N21afbHDzjPGPxDYGe4JaGM42mAFtOWxncIPHTOJgG0MiQS0GZ86YWc88czzB4ExamWXDOYnkGYcJOawn/fHtwh3V9gbHD2+++aPMxra/vf0xfodBQWIDA4cBkJYARhNRGhgY7BkY2B8QqXYUjIJRMApGGgAAEmtJKmbq2bUAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-4241-268X","institution":"Yazd University Faculty of Science, Dep. of Biology","correspondingAuthor":true,"prefix":"","firstName":"Seyed","middleName":"Kazem","lastName":"Sabbagh","suffix":""},{"id":333652977,"identity":"c57960c5-9b00-41a3-8cbc-4f9d14314805","order_by":2,"name":"Mostfa Heydari","email":"","orcid":"","institution":"Shahroud University of Medical Sciences: Shahrood University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mostfa","middleName":"","lastName":"Heydari","suffix":""}],"badges":[],"createdAt":"2024-07-11 18:41:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4726162/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4726162/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63305315,"identity":"dbc4bd1a-cec9-474f-b1e3-e4be82fe08a7","added_by":"auto","created_at":"2024-08-26 17:21:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":109611,"visible":true,"origin":"","legend":"\u003cp\u003eThe change of essential oil and flowering branche in treated Thymus plant with fertilizer under drought stress\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4726162/v1/325fb3f7956d5c497bdb05e6.png"},{"id":63305318,"identity":"de5bcc69-34cf-4177-949b-ec635e4250ed","added_by":"auto","created_at":"2024-08-26 17:21:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":198798,"visible":true,"origin":"","legend":"\u003cp\u003eThe change of enzyme activity in treated Thymus plant with fertilizer under drought stress\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4726162/v1/d355e05b49b6b67c69d2575e.png"},{"id":63305316,"identity":"fa2fc470-3233-47ca-951f-17f6db778b20","added_by":"auto","created_at":"2024-08-26 17:21:15","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":140935,"visible":true,"origin":"","legend":"\u003cp\u003eGene expression analysis of CYP71d176 and CYP71D180 genes in treated Thymus plant with fertilizer under drought stress\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4726162/v1/7e6907913288cb02d65654fc.jpeg"},{"id":64935056,"identity":"dcea0362-4db6-4a28-82a1-1cfa45a88660","added_by":"auto","created_at":"2024-09-20 14:34:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":991540,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4726162/v1/a5b985a9-f043-4c39-8dfa-126d10c3a1d3.pdf"},{"id":63305319,"identity":"532a9d0a-97a5-4c16-813b-bb594a38cdc5","added_by":"auto","created_at":"2024-08-26 17:21:16","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":14607,"visible":true,"origin":"","legend":"","description":"","filename":"highlight.docx","url":"https://assets-eu.researchsquare.com/files/rs-4726162/v1/36fface0779c0417077272d0.docx"}],"financialInterests":"","formattedTitle":"Nitrogen Fixing Bacteria Reduces Drought Stress and Improve Molecular and Biochemical Response in the Garden Thyme","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cem\u003eThymus vulgaris\u003c/em\u003e belonging to the Lamiaceae family is originally cultivated in Southern Europe and has a worldwide distribution. In the field of plant medicine, this species is known as thyme. The use of thyme has been recommended in traditional medicine as an infusion to treat cough, decrease blood insulin levels, control infectious diseases, and for digestive conditions in a syrup form (Ekoh et al, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The antiseptic, antibiotic, and antifungal properties of thyme have been demonstrated by several studies (Dauqan and Abdullah \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Hosseinzadeh et al, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Javed et al, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Under water stress conditions, reactive species oxygen (ROS) is necessary to retain energy balance in influenced cells. The key role of Ascorbate peroxidase, peroxidase, and catalase as an antioxidant enzyme in free radical scavenging to water stress responses has been well demonstrated (Caverzan et al, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Faize et al, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Zhang and Kirkham \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Drought stress in soybean leads to a clear increase in the activity of antioxidant enzymes (Caverzan et al, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Faize et al, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Zhang and Kirkham \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Abiotic stresses such as water-deficient are the most important factor that could impress the agricultural process causing a reduction of crop yield. The physiology and growth of plants under drought stress can be influenced in many ways (Waraich et al, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Soil moisture plays an important role in the mineral nutrient transport from the soil solution to the roots. Thus, any decrease of soil moisture due to water deficiency stress can affect nutrient transport from the roots to the shoots (da Silva et al, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The use of bio-fertilizers in higher plants under drought stress can ameliorate the drought effect and enhance the soil\u0026rsquo;s water retention capacity and increase the root growth plus yield (Li and Ni \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Thymol and its isomer carvacrol are the main constituents of essential oil in thyme species. The biological and pharmacological properties of thymol and carvacrol as biocidal and antiseptic effects have been well documented (Ahmad et al, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Gursul et al, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Lambert et al, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe objective of this study was to investigate the effect of bio-fertilizers on the change of antioxidant enzymes and expression level of two CYP171 d178 and CYP171D180 genes involved in the biosynthesis of thymol and carvacrol and also two SOD and APX genes involve in plant drought resistance in thymus vulgaris under water deficit stress.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Plant materials and culture condition\u003c/h2\u003e \u003cp\u003eThis experimental field was performed during 2018\u0026ndash;2019 at the Yazd province, Iran (Longitude 51\u0026deg; 17', Latitude 31\u0026deg; 53', Height 1230.2 m). At the first step, prior to thyme seedling transportation, chemical analysis of cultivation soil was performed on the soil sample (upper 25-cm layer) to determine soil texture and characteristics (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalysis of soil texture and physical and chemicals characteristics of sample cultivation soil\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eP (mg/Kg)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eK (mg/kg)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCO (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eLoam (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eClay (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSand (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eEC (ds/m)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eSoil Texture\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0.029\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e190.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.339\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e7.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eSandy loam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMeteorological and climate data were obtained from nearest weather station at Yazd province, Iran.\u003c/p\u003e \u003cp\u003eMeteorological and climate data were obtained from nearest weather station at Yazd province, Iran. Average annual of atmospheric characteristics of weather are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe annual average of climate data in Yazd province\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of sunny hours\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eannual evaporation\u003c/p\u003e \u003cp\u003e(mm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003cp\u003eannual rainfall (mm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAverage maximum annual relative humidity (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAverage minimum annual relative humidity (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAverage annual relative humidity\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAverage maximum annual temperature (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eAverage\u003c/p\u003e \u003cp\u003eminimum annual temperature (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eAverage annual temperature (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eStation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3409.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3063.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e71.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e27.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e27.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e14.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eYazd\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eSeeds of \u003cem\u003eThymus vulgaris\u003c/em\u003e were surface sterilized by 1% chloramine T (Sigma) and then were rinsed three times with tap water. Disinfected seeds were planted in Gifi pot containing peat moss and were maintained in the nursery. Seedlings were transported (50 plantlet/ plot) from the nursery to the main field designed ( October) to blocking plots with determined size (4 \u0026times; 3.5 m). The first irrigation after transplanting was performed by the flooding method. After installing plants in the soil, plants were irrigated by the drip irrigation system. The volume of consumed water was the same for all treatments. The periods of irrigation were continued until sampling time at the flowering stage.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.3 The treatments\u003c/h2\u003e \u003cp\u003eThe treatments consisted of: drought stress: three irrigation intervals (W\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;7day, W\u003csub\u003e2\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;12 day, and W\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;17d), Bio-fertilizer treatments (B\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;control, B\u003csub\u003e2\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;Mycorrhiza (Rhizophagus irregular fungi; 5%,150gr/plant), B\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;\u003cem\u003eAzospirillum brasilense;\u003c/em\u003e200gr/10lit water, B\u003csub\u003e4\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;\u003cem\u003ePseudomonas fluorescens\u003c/em\u003e bacterial; 200gr/10lit water and B5\u0026thinsp;=\u0026thinsp;NKP (20:20:20) fertilizer;200kg/ha). Controls were drought-stressed plants without bio-fertilizer application. Three independent replicates were done for all treatments.The treatments were arranged in a completely randomized design with a total of 45 experimental units.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Flowering branches yield and essential oil measurement\u003c/h2\u003e \u003cp\u003eDuring the experiment from Two months after the date of transplanting to the field and at the flowering stage for a week, Thymus flowers were counted and removed three times, and the individual counts were combined. At the end of the experiment (at the flowering stage ), shoots were separated from stems, and shoot fresh weight (FW) was recorded. Flowers were then dried at 80\u0026deg;C for 2 days, and dry weight (DW) was recorded. Clevenger apparatus was used to extract the essential oil in treated plants with bio-fertilizer under drought stress. Essential oils were stored in dark glass containers and in the refrigerator for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Plant extraction and enzyme activity assay\u003c/h2\u003e \u003cp\u003ePlant materials were frozen in liquid nitrogen and then were grinded into a fine powder with a mortar and pestle. Sodium phosphate buffer (50mM, pH 7.0) containing 0.1 mM EDTA and polyvinyl pyrrolidone (1% w/v) was used as extraction buffer. The homogenate was filtered through cheesecloth and the filtrate was centrifuged at 14 000 g for 25 min at 4\u0026ordm; C. Enzyme activity was determined using aliquots of the supernatant as a crude extract. Catalase activity (\u0026micro;mol(H2O2) g- /min) was done by the method of Goth (Goth \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). One unit of CAT activity was defined as the absorbance change of 0.01 per min. Guaiacol is a hydrogen donor was used to determine peroxidase activity (Fielding and Hall \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1978\u003c/span\u003e) Nitroblue tetrazolium (NBT) reagent was used to measure Superoxide dismutase (SOD) activity. SOS can inhibit photochemical reduction of NBT (Kjari et al, 2000). Ascorbate peroxidase activity was determined by the Nakano and Asada Method (Nakano and Asada \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1981\u003c/span\u003e) based on the oxidation of ascorbate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 mRNA extraction and cDNA synthesis\u003c/h2\u003e \u003cp\u003e Total RNA of 50mg of leaf tissue from treated and non-treated thyme plants was extracted by the Pure Plant RNA Purification Kit (TopazGene, Iran) according to the manufacturer\u0026rsquo;s instructions. RNase-free DNase I (Sinaclon, Iran) was used to eliminate genomic DNA contamination. Total RNA was quantified using a Nanodrop ND-100 spectrophotometer and RNA quality was assessed by 1% agarose gel electrophoresis stained by Ethidium bromide (Sabbagh, et al, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Purified RNA was subjected to first-strand cDNA synthesis using a superscript reverse transcriptase kit (Sinaclon, Iran). The Actin gene was used as a reference gene. Sequences of CYP71D178 and CYP71D180 genes were provided from Crocoll (Crocoll \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The primers for SOD, APX genes were selected from Baek and Mehrabadi pour-began (Baek and Skinner \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Mehrabad Pour-Benab et al, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The character of primer sequences for the selected genes is summarized in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNucleotide sequences of primers used in PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003egene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer 5\u0026prime; -3\u0026prime;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer 5\u0026prime; -3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCYP178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGCCTTTGGAAGCGTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGGCTCATTCCAATAGAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMajidi\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCYP180\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTAAACTGGCGGACTTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAACGGGATTAACTCGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMajidi\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eactin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTCTTACCCTCAAGTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATGATCTGAGTCATCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Relative gene expression analysis\u003c/h2\u003e \u003cp\u003eReal-time PCR (qRT-PCR) was done in a Rotor gene Real-Time PCR System (Corbett 3000, Australia) a volume of 25 \u0026micro;L containing 8 \u0026micro;L of Eva Green qPCR Mix (5x Hot FIREPOL, ROX, Ampliqon), 3 \u0026micro;L of diluted cDNA, 2 \u0026micro;L of forward and reverse primers ( 0.5 \u0026micro;mol/L) of, and 10 \u0026micro;L of RNase-free water. The PCR temperature cycling conditions were as follows: a first initial denaturation in 95\u0026deg;C for 4 min followed by: 95\u0026deg;C for 20 seconds, 20-second primer annealing at optimum degree for each primer, and elongation at 72\u0026deg;C for 30 seconds in 40 cycles, with a five-minute extension at 72\u0026deg;C after the final cycle. The reactions were repeated two times (as two technical replications) for each of two biological samples The Ct values of the calibrator and the samples were normalized to the endogenous housekeeping gene. Relative gene expressions were determined according to the ∆∆Ct method, using the formula: 2-∆∆Ct where, ∆∆Ct= [∆] Ct sample -[∆]Ct reference where, [∆] Ct sample was the Ct value for any sample normalized to the endogenous actin gene as reference gene, and -[∆]Ct reference value for the reference sample normalized to the endogenous housekeeping gene (Livak and Schmittgen \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Data analysis\u003c/h2\u003e \u003cp\u003eEnzymes activity was measured on three independent experiments. One-way analysis of variance (ANOVA) with three replications was carried out. If significant differences were found, pairs of samples were compared by Tukey's test. Statistical analysis was performed with SAS software SAS 9.1 software package. The relative expression level of targets genes was analyzed with ∆∆Ct method and was normalized to the expression level of the actin gene. SPSS (v. 22) software was used to the analysis of gene expression data obtained using the qRT-PCR method. All data were statistically analyzed using LSD 0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Flowering branches and Essential oil\u003c/h2\u003e \u003cp\u003eThe results of analysis of variance of flowering branch trait showed that the interaction effect of irrigation periods and fertilizers on the yield of flowering branches was significant at the 1% probability level (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The highest yield of flowering branches was observed during the irrigation period of 7d (W1) and in NPK fertilizer treatment (30.2 g/plantlet), while the lowest amount of this trait was related to the irrigation period of 17 days with mycorrhizae application (11.7 g/plantlet). The reduction of this trait (61%) showed a close relation between drought stress and flowering branch production (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnalysis of variance of flowering branches yield, essential oil yield and activity of antioxidant enzymes in treated Thymus plant with fertilizer under drought stress.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMean square\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource of Variance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCatalase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePeroxidase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAscorbate peroxidase (APX)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSuperoxide dismutase(SOD)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRepetition(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.004\u003csup\u003en.s\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.001 \u003csup\u003en.s\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e63.82 \u003csup\u003en.s\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00008\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWater deficit Stress(W)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.38\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.012\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5305.87\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.0004\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError a(R*A)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0007\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e27.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00004\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFertilizers(B)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.56\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.035\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3803.93\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00020\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eW*B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.45\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.047\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3907.58\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00012\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eError b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00002\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC.V. (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16.38\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ens, *, **: non-significantly difference and significantly differences at 5 and 1% of probability levels, respectively.\u003c/p\u003e \u003cp\u003eThe mean comparison of obtained data revealed a high level of essential oil production (7.15 g/plantlet) during the irrigation period of 12 days and with Pseudomonas bio-fertilizer application. This amount was reduced (3.15 g/plantlet) in the irrigation period of 7d with Azospirillum bio-fertilizer application. The effect of fertilizers on the essential oil production indicated that the Pseudomonas treatment had a significant effect on this parameter when compared to the control treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e Weight of flowering branches (a) and essential oil (b) in Thymus plants, 7, 12 and 17days after irrigation in the field condition. Plants were either non-inoculated with any fertilizer or were inoculated with one of three mycorrhiza, Azospirillum and Pseudomonas bio- fertilizers Inocula, and NKP fertilizer. Different letters denote significant differences between means of control and fertilizers treatments determined by a t test (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Enzyme activity\u003c/h2\u003e \u003cp\u003eThe results of the analysis of variance indicated that the interaction effect of drought stress and fertilizers treatments on the activity of tested enzymes was significant at the 1% probability level (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Catalase activity assay showed an enhancement of catalase activity upon prolongation of the drought period. In all irrigation intervals, the maximum activity of the catalase enzyme occurred in treated plants with Pseudomonas bio-fertilizer. During irrigation intervals of 12 days, mycorrhizae and Azospirillum application did not affect the enzyme activity when compared to control plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The maximum amount of peroxidase enzyme (0.043 u/g Fw) occurred during an irrigation interval of 12 days in plants treated with Azospirillum bio-fertilizer. The lowest rate of enzyme expression (0.015 u/gFw) was detected in plants treated with NPK fertilizer under water stress during an irrigation period of 7 days 12 days. Further, all bio-fertilizers caused increased peroxidase activity water stress caused in all treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The greatest change in SOD enzyme activity occurred during the irrigation period of 12 days in plants treated with Azospirillum; as with other enzymes, the lowest enzyme activity was observed in the control plant (7d) for NPK application. Within 17-day irrigation, Pseudomonas bio-fertilizer caused high activity of SOD enzyme (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Unlike other enzymes, the use of fertilizer did not show any effect on APX enzyme activity. Almost in all three irrigation intervals, the expression of the APX enzyme was reduced.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e Analysis of variance of flowering branches yield, essential oil yield and activity of antioxidant enzymes in treated Thymus plant with fertilizer under drought stress\u003c/p\u003e \u003cp\u003e.\u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e Antioxidant Enzyme Changes in treated Thymus plants with fertilizer in response to drought stress. \u003cem\u003eVertical bars\u003c/em\u003e indicate SE of three replicates for each treatment. Values are means with standard error of the means\u0026thinsp;\u0026plusmn;\u0026thinsp;SE and different letters indicate a significant difference at p\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Differential expression of thymus bio-synthesis genes in response to fertilizers application\u003c/h2\u003e \u003cp\u003eThe relative gene expression levels between different samples were captured with the qRT-PCR method at three irrigation intervals. The plants treated with different fertilizers under water deficit stress were subjected to this investigation. The results of gene expression analysis showed that both investigated genes were differentially affected by fertilizer application. The higher transcription level of two tested genes was observed within 12-day irrigation as compared to other water-stress time periods (17 days). At this time period, the transcription level of CYP71d176 and CYP71D180 was significantly elevated for Azospirillum application. A 6- and 5.8-fold increase for CYP71d176 and CYP71D180 genes was observed in plants treated with Azospirillum bio-fertilizer during 12 and 17 days, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The lowest transcription level of both genes was observed in plants treated with NKP fertilizer when compared to bio-fertilizer treatments. A significant reduction of gene expression occurred during 17 days with different intensities for all genes. An insignificant difference was observed when NPK fertilizer was applied in both drought stresses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e Gene expression analysis of \u003cem\u003eCYP71d176\u003c/em\u003e and \u003cem\u003eCYP71D180\u003c/em\u003e genes in treated Thymus plant with fertilizer under drought stress\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eDrought stress negatively affects crop growth and is the most important factor-limiting yield in agricultural systems around the world, especially in arid and semi- arid. Little is known about the efficiency of fertilizer application to reduce the water drought stress damages in plant farming under drought conditions. In medicinal plants, water deficit can reduce the quality and quantity of aromatic compounds such as terpenoids, thymol, and carvacrol. The glandular trichomes located on the aerial part of thyme species are the local production of essential oil in plants belonging to Lamiaceae. The maximum amount of essential oil secretion would occur at the flowering time. Our results indicated that some fertilizers in the single form including nitrogen-fixing bacterial Azospirillum and Rh. irregular fungi at irrigation intervals of 7days positively affected flowering branches but water overtime period led to a reduction of flowering. The maximum effect of fertilizer treatment on the flowering branch occurred with Azospirillum. It showed a direct relationship between flowering branch traits and bio-fertilizer treatments. The use of different elicitors should not have any physical damage to terpene structures (Martin et al, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Exogenous application of MeJA and MeSA increased total terpene and linalool emission in the leaf of Norway Spruce plant (\u003cem\u003ePicea abies\u003c/em\u003e) without any inflicting physical damage to these compounds. Thus, we suggest the use of nutritional supplements to induce plants to increase terpenoid compounds and elevate the thymol and carvacrol bio-synthesis in \u003cem\u003eT. vulgaris\u003c/em\u003e. The application of biochemical and molecular methods can illustrate the mechanisms involved in the biosynthesis of phenolic monoterpenes and understanding the regulatory mechanisms by which secondary metabolic are modulated (Iijima \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe maximum effect of fertilizer treatment on the flowering branch occurred with Azospirillum. It showed a direct relationship between the flowering branch and activity of all investigated enzymes. The use of different elicitors does not have any physical damage to terpene structures (Martin et al, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Exogenous application of MeJA and MeSA increased total terpene and linalool emission in the leaf of Norway Spruce plants (\u003cem\u003ePicea abies\u003c/em\u003e) without any inflicting physical damage in response to these compounds. Thus, we suggest the use of nutritional supplements as plant inducers to increase terpenoid compounds in T. vulgaris.\u003c/p\u003e \u003cp\u003eThe application of biochemical and molecular methods can illustrate the mechanisms involved in the biosynthesis of phenolic monoterpenes and understanding the regulatory mechanisms by which secondary metabolic are modulated (Iijima \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Nitrogen resources in the rhizosphere can play a key role in plant tolerance in response to drought stress (Marino et al, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Pimratch et al, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Change in roots system which is influenced by the complementary treatment of organic and inorganic fertilizers could improve plant growth and response to water deficit stress. In this study, the impact of drought stress and fertilizers application on recuperating of some antioxidant enzymes, and expression level of some related genes to thymol bio-synthesis and also involved in drought stress resistance was investigated.\u003c/p\u003e \u003cp\u003eTreatment of drought-stressed thyme plants with fertilizers led to a significant increase in the number and weight of flowering branches. Application of fertilizers in a single form also leads to changes in antioxidant enzyme activity. Antioxidant enzymes and reactive oxygen species (ROS) are involved in plant tolerance (Caverzan et al, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Similar studies have shown that water and salinity stress may increase some antioxidant enzymes (Pan et al, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In this research, all investigated enzymes showed higher activity when the thymus plant was irrigated for a period of 12 days. Our results are in accordance with previous results that have shown high antioxidant enzymes activity of maize plants in response to drought stress (Ali et al, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Boaretto et al, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Mohammadi and co-workers found that the use of mycorrhizal fungi can alleviate water deficit stress more than nitrogen-fixing bacteria and chemical fertilizers in the Oenothera biennis plant (Mohammadi et al, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Unlike these results, our observation indicates reduce of enzyme activity in the mycorrhizal application under drought stress while enzyme activity was positively increased in treated plants with nitrogen-fixing bacteria. It can be due to an increase of electron donors in plant-bacteria association causing the increase in metabolic transport across cell membranes (Udvardi and Day \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). Furthermore, researchers have reported that mycorrhizal symbiosis in the biotic zone of the rhizosphere may lead to increases in leaf water potential transpiration rate, reduce leaf temperature, and restrain the decomposition of chlorophyll content under water deficit stress. Mycorrhizal fungi with a mild form of parasitism cause high osmotic adjustment by increasing the accumulation of inorganic ions (Na, Ca2+, and Mg2+) (Wu and Xia 2006). A combination of different organic and non-organic fertilizers can cause synergistic effects on water-deficit stress response (Abbaspour \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Nodulated soybean plants under water deficit stress showed less sensitivity to drought stress when compared to treated nitrate feed plants individually (Kirova et al, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). It seems that photo-respiratory flux under water stress can activate the root system to uptake soil nitrogen by nitrogen-fixing bacteria. The use of nitrogen and phosphorus with an irrigation frequency in Salvia officinalis L. plants showed no effect on essential oil (Rioba et al, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). But, in this work fertilizer treatments caused an increase in thymol and carvacrol-related gene expression. Thymol and carvacrol are two main components of some plant families such as Lamiaceae and Ranunculaceae. The potential of anti-stress effects of these compounds against various biotic and abiotic stresses have been demonstrated. The application of animal fertilizers leads to an increase of thymol percentage in the essential oil while the percentages of other terpenoid compounds were not affected (Naghdi Badi et al, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The effect of some abiotic elicitors such as methyl jasmonate and salicylic on the relative expression gene related to thymol-biosynthesis showed that these factors affected the biosynthesis of these terpenoid compounds (Majdi et al, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Bio- Fertilizer treatment could lead to an increase of pharmaceutically active compounds (PhACs) in the Lamiaceae family.\u003c/p\u003e \u003cp\u003eIn this research, the relative expression of two CYP71d176 and CYP71D180 genes in response to plant nutrition supplementation under water stress showed that the expression level of both tested genes could be affected by fertilizer application. The measure of the transcriptional level of CYP71d176 and CYP71D180 genes in thyme leaf at two irrigation periods of 12day and 17day and compared to irrigation period of 7d showed an increase in the gene expression in all treatments. On the other hand, the expression pattern of gene expression varied between treatments.\u003c/p\u003e \u003cp\u003eBased on these results, we can conclude that this molecular marker will be useful in understanding the expression of drought-responsive genes in T. vulgaris when plant growth inducers are used for the increase drought resistance.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn this work, we attempted to investigate the effect of nutritional supplements such as fertilizers in water-stressed \u003cem\u003eT. vulgaris\u003c/em\u003e plants on changes of some antioxidant enzymes and relative expression of four genes involved in thymol biosynthesis and drought resistance. Our results revealed that the application of fertilizers can affect all tested enzymes. The change of enzyme activity was gradually variable depending on the type of bio-fertilizer. The maximum tolerance to water stress was determined during the 12-day irrigation period. An increase in the irrigation time period could reduce the adaptation of plants to water deficit. Based on these results, we suggest that at moderate water stress, the application of fertilizers can display a serial molecular and biochemical mechanism to tolerate drought stress. To elucidate the regulatory mechanism involved in the biosynthesis pathway of torpedoed compounds and drought resistance, transcriptional analysis through microarray is recommended.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions Statemen\u003c/strong\u003e\u0026bull;\u003cstrong\u003eF. G.\u003c/strong\u003e\u0026nbsp; Participated in designing the evaluation, performed parts of the statistical analysis and helped to draft the manuscript \u003cstrong\u003eS.K.S\u0026nbsp;\u003c/strong\u003econceived and designed the evaluation and drafted the manuscript, \u003cstrong\u003eM. H\u003c/strong\u003e. re-evaluated the acquired data, revised the manuscript and performed the statistical analysis and revised the manuscript, \u003cstrong\u003eM.M\u003c/strong\u003e. critical revision of the manuscript for important intellectual content. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank the member of Department of biology at Yazd University to access of laboratory equipment\u0026apos;s. We also thank Dr. Mohammad Reza Sarafraz Ardakani to help us in data analysis and Dr. Mahta Mazaheri for qRT-PCR data analysis. This study was supported by vice research of Yazd University (Grant No. 99/P/2728).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbbaspour H (2010) Investigation of the effects of vesicular arbuscular mycorrhiza on mineral nutrition and growth of Carthamus tinctorius under salt stress conditions. Russian J Plant Physiol 57:526\u0026ndash;531. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1134/S1021443710040102\u003c/span\u003e\u003cspan address=\"10.1134/S1021443710040102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmad A, Khan A, Akhtar F, Yousuf S, Xess I, Khan L et al (2011) Fungicidal activity of thymol and carvacrol by disrupting ergosterol biosynthesis and membrane integrity against Candida. Eur J Clin Microbiol Infec Dis 30:41\u0026ndash;50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10096-010-1050-8\u003c/span\u003e\u003cspan address=\"10.1007/s10096-010-1050-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAli Q, Ashraf M, Anwar F (2010) Seed composition and seed oil antioxidant activity of maize under water stress. J Am Oil Chem 87:1179\u0026ndash;1187. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11746-010-1599-5\u003c/span\u003e\u003cspan address=\"10.1007/s11746-010-1599-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllen RD (1995) Dissection of oxidative stress tolerance using transgenic plants. Plant Physiol 107:1049\u0026ndash;1054. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1104/pp.107.4.1049\u003c/span\u003e\u003cspan address=\"10.1104/pp.107.4.1049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaek K-H, Skinner DZ (2003) Alteration of antioxidant enzyme gene expression during cold acclimation of near-isogenic wheat lines. Plant Sci 165:1221\u0026ndash;1227. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0168-9452(03)00329-7\u003c/span\u003e\u003cspan address=\"10.1016/S0168-9452(03)00329-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoaretto LF, Carvalho G, Borgo L, Creste S, Landell MG, Mazzafera P et al (2014) Water stress reveals differential antioxidant responses of tolerant and non-tolerant sugarcane genotypes. Plant Physiol Biochem 74:165\u0026ndash;175. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1134/S1021443710040102\u003c/span\u003e\u003cspan address=\"10.1134/S1021443710040102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaverzan A, Casassola A, Brammer SP (2016) Reactive oxygen species and antioxidant enzymes involved in plant tolerance to stress In: Shanker, A. an Shanker, Abiotic and biotic stress in plants-Recent advances and future perspectives. Publisher InTech 463\u0026ndash;480. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5772/61368\u003c/span\u003e\u003cspan address=\"10.5772/61368\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaverzan A, Passaia G, Rosa SB, Ribeiro CW, Lazzarotto F, Margis-Pinheiro M (2012) Plant responses to stresses: role of ascorbate peroxidase in the antioxidant protection. Gene Mol Biol 35:1011\u0026ndash;1019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/S1415-47572012000600016\u003c/span\u003e\u003cspan address=\"10.1590/S1415-47572012000600016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrocoll C (2011) Biosynthesis of the phenolic monoterpenes, thymol and carvacrol, by terpene synthases and cytochrome P450s in oregano and thyme. Academic Dissertation,der Biologisch-Pharmazeutischen Fakult\u0026auml;t der Friedrich-Schiller-Universit\u0026auml;t Jena. http://doi: handle.net/11858/00-001M-0000-000F-511E-C\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eda Silva EC, Nogueira R, da Silva MA, de Albuquerque MB (2011) Drought stress and plant nutrition. Plant Stress 5:32\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.academia.edu/download/46203050/Drought_Stress_and_Plant_Nutrition20160603-21495-1k6asbj.pdf\u003c/span\u003e\u003cspan address=\"https://www.academia.edu/download/46203050/Drought_Stress_and_Plant_Nutrition20160603-21495-1k6asbj.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDauqan E, Abdullah A (2017) Medicinal and functional values of thyme (\u003cem\u003eThymus vulgaris\u003c/em\u003e L.) herb. J Appl Biol Biotechnol 5:17\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7324/JABB.2017.50203\u003c/span\u003e\u003cspan address=\"10.7324/JABB.2017.50203\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEkoh S, Akubugwo E, Victor Chibueze U, Nzubechukwu E (2014) Anti-hyperglycemic and anti-hyperlipidemic effect of spices (\u003cem\u003eThymus vulgaris\u003c/em\u003e, \u003cem\u003eMurraya koenigii\u003c/em\u003e, \u003cem\u003eOcimum gratissimum\u003c/em\u003e and \u003cem\u003ePiper guineense\u003c/em\u003e) in alloxan-induced diabetic rats. Int J Biosci 4:179\u0026ndash;187. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.12692/ijb/4.2.179-187\u003c/span\u003e\u003cspan address=\"10.12692/ijb/4.2.179-187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaize M, Burgos L, Faize L, Piqueras A, Nicolas E, Barba-Espin G et al (2011) Involvement of cytosolic ascorbate peroxidase and Cu/Zn-superoxide dismutase for improved tolerance against drought stress. J Exp Bot 62:2599\u0026ndash;2613. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/jxb/erq432\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erq432\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFielding J, Hall J (1978) A biolchemical and cytochemical study of peroxidase activity in roots of Pisum sativum: I. a comparison of DAB-peroxidase and guaiacol-peroxidase with particular emphasis on the properties of cell wall activity. J Exp Bot 29:969\u0026ndash;981. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/29.4.969\u003c/span\u003e\u003cspan address=\"10.1093/jxb/29.4.969\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoth L (1991) A simple method for determination of serum catalase activity and revision of reference range. Clin Chim Acta. 196: 143\u0026ndash;151. doi I: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0009-8981(91)90067-m\u003c/span\u003e\u003cspan address=\"10.1016/0009-8981(91)90067-m\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGursul S, Karabulut I, Durmaz G (2019) Antioxidant efficacy of thymol and carvacrol in microencapsulated walnut oil triacylglycerols. Food Chem 278:805\u0026ndash;810. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.foodchem.2018.11.134\u003c/span\u003e\u003cspan address=\"10.1016/j.foodchem.2018.11.134\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHosseinzadeh S, Jafarikukhdan A, Hosseini A, Armand R (2015) The application of medicinal plants in traditional and modern medicine: a review of \u003cem\u003eThymus vulgaris\u003c/em\u003e. Int J Clin Med 6:635\u0026ndash;644. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4236/ijcm.2015.69084\u003c/span\u003e\u003cspan address=\"10.4236/ijcm.2015.69084\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIijima Y (2014) Recent advances in the application of metabolomics to studies of biogenic volatile organic compounds (BVOC) produced by plant. Metabolites 4:699\u0026ndash;721. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/metabo4030699\u003c/span\u003e\u003cspan address=\"10.3390/metabo4030699\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaved H, Erum S, Tabassum S, Ameen F (2013) An overview on medicinal importance of thymus vulgaris. J Asian Sci Res 3:974\u0026ndash;986. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://aessweb.com/journal-detail.php?id=5003\u003c/span\u003e\u003cspan address=\"http://aessweb.com/journal-detail.php?id=5003\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKajari D, Luna S, Gagan C (2000) A Modified Spectrophotometric Assay of Superoxide Dismutase Using Nitrite Formation by Superoxide Radicals. Indian j Biochem Biol 37:201\u0026ndash;204\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKirova E, Tzvetkova N, Vaseva I, Ignatov G (2008) Photosynthetic responses of nitrate-fed and nitrogen-fixing soybeans to progressive water stress. J Plant Nut 31:445\u0026ndash;458. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/01904160801894988\u003c/span\u003e\u003cspan address=\"10.1080/01904160801894988\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLambert R, Skandamis PN, Coote PJ, Nychas GJ (2001) A study of the minimum inhibitory concentration and mode of action of oregano essential oil, thymol and carvacrol. J Appl Microbiol 91:453\u0026ndash;462. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1046/j.1365-2672.2001.01428.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-2672.2001.01428.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Ni Y (1996) Researches on application of microbial inoculant in crop production. Researches and application of En technology. Agriculture University, Beijing, China, pp 42\u0026ndash;84\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2∆∆Ct method. Methods 25:402\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMajdi M, Malekzadeh-Mashhady A, Maroufi A, Crocoll C (2017) Tissue-specific gene-expression patterns of genes associated with thymol/carvacrol biosynthesis in thyme (\u003cem\u003eThymus vulgaris\u003c/em\u003e L.) and their differential changes upon treatment with abiotic elicitors. Plant Physiol Biochem. 115: 152\u0026ndash;162. doi I: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.plaphy.2017.03.016\u003c/span\u003e\u003cspan address=\"10.1016/j.plaphy.2017.03.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarino D, Frendo P, Ladrera R, Zabalza A, Puppo A, Arrese-Igor C et al (2007) Nitrogen fixation control under drought stress. Localized or systemic? Plant Physiol 143:1968\u0026ndash;1974. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1104/pp.106.097139\u003c/span\u003e\u003cspan address=\"10.1104/pp.106.097139\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin DM, Gershenzon J, Bohlmann J (2003) Induction of volatile terpene biosynthesis and diurnal emission by methyl jasmonate in foliage of Norway spruce. Plant Physiol 132:1586\u0026ndash;1599. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.103.021196\u003c/span\u003e\u003cspan address=\"10.1104/pp.103.021196\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehrabad Pour-Benab S, Fabriki-Ourang S, Mehrabi A-A (2019) Expression of dehydrin and antioxidant genes and enzymatic antioxidant defense under drought stress in wild relatives of wheat. Biotechnol Equip 33:1063\u0026ndash;1073. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/13102818.2019.1638300\u003c/span\u003e\u003cspan address=\"10.1080/13102818.2019.1638300\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohammadi M, Modarres-Sanavy SAM, Pirdashti H, Zand B, Tahmasebi-Sarvestani Z (2019) Arbuscular mycorrhizae alleviate water deficit stress and improve antioxidant response, more than nitrogen fixing bacteria or chemical fertilizer in the evening primrose. Rhizosphere 9:76\u0026ndash;89. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.rhisph.2018.11.008\u003c/span\u003e\u003cspan address=\"10.1016/j.rhisph.2018.11.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaghdi Badi H, Abdollahi M, Mehrafarin A, Ghorbanpour M, Tolyat M, Qaderi A et al (2017) An Overview on Two Valuable Natural and Bioactive Compounds, Thymol and Carvacrol, in Medicinal Plants. J Med Plants 16:1\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://jmp.ir/article-1-1828-en.html\u003c/span\u003e\u003cspan address=\"http://jmp.ir/article-1-1828-en.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol 22:867\u0026ndash;880. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/oxfordjournals.pcp.a076232\u003c/span\u003e\u003cspan address=\"10.1093/oxfordjournals.pcp.a076232\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan Y, Wu LJ, Yu ZL (2006) Effect of salt and drought stress on antioxidant enzymes activities and SOD isoenzymes of liquorice (\u003cem\u003eGlycyrrhiza uralensis\u003c/em\u003e Fisch). Plant Grow Regul 49:157\u0026ndash;165. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10725-006-9101-y\u003c/span\u003e\u003cspan address=\"10.1007/s10725-006-9101-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePimratch S, Jogloy S, Vorasoot N, Toomsan B, Patanothai A, Holbrook C (2008) Relationship between biomass production and nitrogen fixation under drought-stress conditions in peanut genotypes with different levels of drought resistance. J Agri Crop Sci 194:15\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1439-037X.2007.00286.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1439-037X.2007.00286.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRioba NB, Itulya FM, Saidi M, Dudai N, Bernstein N (2015) Effects of nitrogen, phosphorus and irrigation frequency on essential oil content and composition of sage (\u003cem\u003eSalvia officinalis\u003c/em\u003e L). J Appl Res Med Arom Plants 2:21\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jarmap.2015.01.003\u003c/span\u003e\u003cspan address=\"10.1016/j.jarmap.2015.01.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSabbagh SK, Mazaheri M, Panjehkeh N, Salari M (2012) Transcriptomic analysis of Sporisorium reilianum in response to the strigolactone analogue GR24. Phytopathol Medi 51(2):283\u0026ndash;291. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://oajournals.fupress.net/index.php/pm/article/view/5483\u003c/span\u003e\u003cspan address=\"https://oajournals.fupress.net/index.php/pm/article/view/5483\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUdvardi MK, Day DA (1997) Metabolite transport across symbiotic membranes of legume nodules. Ann Rev Plant Biol 48:493\u0026ndash;523. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.arplant.48.1.493\u003c/span\u003e\u003cspan address=\"10.1146/annurev.arplant.48.1.493\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWaraich EA, Ahmad R, Ashraf M (2011) Role of mineral nutrition in alleviation of drought stress in plants. Australian J Crop Sci 5:764\u0026ndash;777. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-019-49404-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-019-49404-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Kirkham M (1994) Drought-stress-induced changes in activities of superoxide dismutase, catalase, and peroxidase in wheat species. Plant Cell Physiol 35:785\u0026ndash;791. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/oxfordjournals.pcp.a078658\u003c/span\u003e\u003cspan address=\"10.1093/oxfordjournals.pcp.a078658\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Plant medicinal, Essentials oil, Gene expression, Thymol, Carvacrol","lastPublishedDoi":"10.21203/rs.3.rs-4726162/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4726162/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAbiotic stresses such as water-deficient are the most important factor that could impress the agricultural process causing a reduction of crop yield. Use of Bio-fertilizers could improve growth condition of drought stressed plant to reduce the damage of water deficit. The objective of this work is to assay comparative effect of some organic and non-organic fertilizers on the flowering branches essential and some antioxidant activity (APX, PO, CAT), then expression analysis of two thymus and carvacrol bio-synthesis related genes(CYP171 d178 and CYP171D180 ) in \u003cem\u003eThymus vulgaris\u003c/em\u003e under water deficit stress in a field trial was investigated using qRT-PCR method. The treatments were arranged in a completely randomized design with a total of 42 experimental separate blocks. The highest and lowest yield of flowering branches was observed in NPK and mycorrhizae treatments Approximately, Azospirillum bio-fertilizer showed high effect on enzyme activity in treated plants. Unlike, chemical fertilizer showed minimum efficiency on enzyme activity. A high expression level (approximately, 6-fold change) of both genes was observed in treated plants with Azospirillum bio-fertilizer while the lowest expression level (1.3-fold change) was observed in chemical fertilizer application when compared to other fertilizers. According to the obtained results of this work, we conclude that yearly fertilizer application could have a significant effect on molecular and biochemical traits and resulted in increase of yield component via decrease of drought stress.\u003c/p\u003e","manuscriptTitle":"Nitrogen Fixing Bacteria Reduces Drought Stress and Improve Molecular and Biochemical Response in the Garden Thyme","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-26 17:21:11","doi":"10.21203/rs.3.rs-4726162/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1d0b8b4c-d63f-4e8f-a6f6-acd06b4f4a68","owner":[],"postedDate":"August 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-20T14:34:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-26 17:21:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4726162","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4726162","identity":"rs-4726162","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}