Full text
121,284 characters
Β· extracted from
preprint-html
Β· click to expand
NR6A1 is essential for neural crest cell specification, formation and survival | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results NR6A1 is essential for neural crest cell specification, formation and survival View ORCID Profile Emma L. Moore Zajic , William A. MuΓ±oz , Jennifer F Dennis , View ORCID Profile Shachi Bhatt , Daisuke Sakai , View ORCID Profile Annita Achilleos , Ruonan Zhao , View ORCID Profile Maureen Lamb , View ORCID Profile Andrew J Price , Chris Seidel , View ORCID Profile MarΓa Tiana , View ORCID Profile Antonio Barral , View ORCID Profile Delaney Clawson , View ORCID Profile Miguel Manzanares , View ORCID Profile Paul A. Trainor doi: https://doi.org/10.1101/2025.01.02.630962 Emma L. Moore Zajic 1 1Stowers Institute for Medical Research , Kansas City , MO , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Emma L. Moore Zajic William A. MuΓ±oz 1 1Stowers Institute for Medical Research , Kansas City , MO , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jennifer F Dennis 1 1Stowers Institute for Medical Research , Kansas City , MO , USA 2 Department of Anatomy & Cell Biology, The University of Kansas School of Medicine , Kansas City , MO , USA 3 Department of Academic Affairs, Kansas Health Science Center, Kansas College of Osteopathic Medicine , Wichita , KS , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shachi Bhatt 1 1Stowers Institute for Medical Research , Kansas City , MO , USA 2 Department of Anatomy & Cell Biology, The University of Kansas School of Medicine , Kansas City , MO , USA 4 Rockefeller University Press , New York, NY , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Shachi Bhatt Daisuke Sakai 5 Department of Biology, Kanazawa Medical University , Ishikawa , Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Annita Achilleos 6 Department of Basic and Clinical Sciences, University of Nicosia Medical School Nicosia , Cyprus Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Annita Achilleos Ruonan Zhao 1 1Stowers Institute for Medical Research , Kansas City , MO , USA 3 Department of Academic Affairs, Kansas Health Science Center, Kansas College of Osteopathic Medicine , Wichita , KS , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Maureen Lamb 1 1Stowers Institute for Medical Research , Kansas City , MO , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Maureen Lamb Andrew J Price 1 1Stowers Institute for Medical Research , Kansas City , MO , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Andrew J Price Chris Seidel 1 1Stowers Institute for Medical Research , Kansas City , MO , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site MarΓa Tiana 7 Centro de Biologia Molecular Severo Ochoa, CSIC-UAM , Madrid, Spain 8 Facultad de C.C. Experimentales, Universidad Francisco de Vitoria , Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for MarΓa Tiana Antonio Barral 7 Centro de Biologia Molecular Severo Ochoa, CSIC-UAM , Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Antonio Barral Delaney Clawson 1 1Stowers Institute for Medical Research , Kansas City , MO , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Delaney Clawson Miguel Manzanares 7 Centro de Biologia Molecular Severo Ochoa, CSIC-UAM , Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Miguel Manzanares Paul A. Trainor 1 1Stowers Institute for Medical Research , Kansas City , MO , USA 2 Department of Anatomy & Cell Biology, The University of Kansas School of Medicine , Kansas City , MO , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Paul A. Trainor For correspondence: pat{at}stowers.org Abstract Full Text Info/History Metrics Preview PDF Abstract Neural crest cells (NCC) are a migratory progenitor cell population considered unique to vertebrates. Derived from the neuroepithelium during early embryogenesis, NCC contribute to nearly every tissue and organ system throughout the body, and disruptions in NCC development can result in congenital disorders, termed neurocristopathies. Despite decades of research, we have a poor understanding of the cellular mechanisms and signals that govern mammalian NCC formation. We discovered nuclear receptor superfamily 6 group member 1 (NR6A1/GCNF/RTR), is a novel, critical regulator of mammalian NCC specification, formation and survival. Nr6a1 is expressed throughout the neuroepithelium in mouse embryos from E8.0 to E9.5 and briefly in newly delaminated NCC. Nr6a1 loss-of-function perturbs anterior cranial NCC formation and survival, and results in the complete agenesis of migratory NCC caudal to the first pharyngeal arch. Using mouse ESC and human iPSC differentiation into NCC, chromatin immunoprecipitation, and multiomic approaches, we demonstrate that these phenotypes are associated with perturbation of NCC specification ( Foxd3, Sox9, Sox10 ) and epithelial-mesenchymal transition (EMT; Snail1, Zeb2 ), in concert with persistent expression of pluripotency-associated factors ( Oct4 and Nanog ) in the neuroepithelium. Conditional deletion revealed that Nr6a1 is required during mid-late gastrulation, demonstrating that murine NCC specification occurs earlier than previously thought. Consistent with these observations, in vivo overexpression of Oct4 in gastrulating mouse embryos disrupts NCC specification and formation. Therefore, Nr6a1 is essential for mammalian NCC formation and moreover, may function as a bimodal switch repressing pluripotency-associated factors in the neuroepithelium, while concomitantly activating NCC specifiers and regulators of EMT. Introduction Neural crest cells (NCC) are a heterogeneous migratory cell population. With varying degrees of potential, NCC contribute to nearly every tissue and organ system throughout the body and are therefore essential for proper development. During early embryogenesis, NCC are specified at the neural plate border, undergo an epithelial-mesenchymal transition (EMT), delaminate from the neuroepithelium and then migrate throughout the embryo. Depending on their axial level, NCC differentiate into cartilage, bone and connective tissues in the head and neck, neurons and glia of the peripheral nervous system, smooth muscle and cardiomyocytes in the heart, endocrine cells in many organs, and pigment cells in the skin, among many others ( Le Douarin and Dupin 2018 ). Imbued with considerable inherent plasticity, NCC have served as a conduit for intraspecies and interspecies variation, and the evolution of anatomical novelties - particularly in the head and face (Trainor and Krumlauf 2000; 2001; 2002). However, perturbations in NCC development are responsible for a diverse class of congenital anomalies known as neurocristopathies ( Watt 2014 , Vega-Lopez, Cerrizuela et al. 2018 , Dash and Trainor 2020 ). Uncovering the mechanisms by which NCC regulate vertebrate development and evolution, and devising therapeutic approaches for preventing congenital neurocristopathies, requires a comprehensive understanding of the signals, switches and gene regulatory networks that govern each stage of NCC development. Decades of research have elucidated many of the tissue interactions and signals that drive NCC specification and formation. NCC are induced at the neural plate border through contact-mediated interactions between the neural ectoderm, surface ectoderm and paraxial mesoderm ( Goulding, Lumsden et al. 1993 , Dickinson, Selleck et al. 1995 , Liem, Tremml et al. 1995 , Selleck and Bronner-Fraser 1995 , Mancilla and Mayor 1996 , Bonstein, Elias et al. 1998 , Marchant, Linker et al. 1998 , Basch and Bronner-Fraser 2006 ). Signals from these surrounding tissues include BMP, FGF and WNT which influence the expression of neural plate border genes Zic1 , Msx1 and Pax 3/7 ( Goulding, Lumsden et al. 1993 , Dickinson, Selleck et al. 1995 , Liem, Tremml et al. 1995 , Suzuki, Ueno et al. 1997 , Wilson, Graziano et al. 2000 , Marchal, Luxardi et al. 2009 , Patthey and Gunhaga 2014 ). These inductive signals together with the neural plate border factors upregulate NCC-specifier genes Foxd3, Sox9 , and Sox10 and EMT genes Snai1/2 , Zeb2 and Twist1 to facilitate NCC specification and formation ( Nieto, Sargent et al. 1994 , LaBonne and Bronner-Fraser 1998 , Carl, Dufton et al. 1999 , LaBonne and Bronner-Fraser 2000 , Dottori, Gross et al. 2001 , Garcia-Castro, Marcelle et al. 2002 , Spokony, Aoki et al. 2002 , Aoki, Saint-Germain et al. 2003 , Aybar, Nieto et al. 2003 , Cheung and Briscoe 2003 , Honore, Aybar et al. 2003 , Nitta, Tanegashima et al. 2004 , Monsoro-Burq, Wang et al. 2005 , Sato, Sasai et al. 2005 , Hong and Saint-Jeannet 2007 , Rogers, Jayasena et al. 2012 , Lander, Nasr et al. 2013 , Rogers, Saxena et al. 2013 ). However, many of these factors and their functions, which were uncovered in non-mammalian model organisms, appear dispensable in mouse ( Trainor 2005 , Trainor 2005 , Barriga, Trainor et al. 2015 ). For example, BMP4 and BMP7 function as critical inductive signals that regulate NCC specification in chicken, but when BMP4 and BMP7 are knocked out in mouse, either individually or in combination, NCC still form ( Dudley, Lyons et al. 1995 , Liem, Tremml et al. 1995 , Luo, Hofmann et al. 1995 , Winnier, Blessing et al. 1995 , Selleck, Garcia-Castro et al. 1998 , Solloway and Robertson 1999 , Trainor, Sobieszczuk et al. 2002 ). Similarly, BMP2 is also not required for NCC induction in the mouse, although it is important for NCC migration (Catarina Correia et al., 2007). Neural plate border genes Pax3 and Pax7 are also expendable for NCC formation in mouse as is evident from single and double knockouts ( Mansouri, Stoykova et al. 1996 , Conway, Henderson et al. 1997 , Zalc, Rattenbach et al. 2015 ). Finally, NCC still form, delaminate and migrate in mouse embryos even when EMT master regulators Snai1 , Snai2 , Zeb2 or Twist1 are knocked out ( Van de Putte, Maruhashi et al. 2003 , Murray and Gridley 2006 , Van de Putte, Francis et al. 2007 , Bildsoe, Loebel et al. 2009 ). These discrepancies between mammalian and non-mammalian species are surprising given the fundamental importance of NCC in vertebrate development, but may be attributable to developmental heterochronies, and differences in species-specific experimental approaches ( Barriga, Trainor et al. 2015 ). Thus, the gene regulatory network underpinning mammalian NCC formation has been difficult to define and remains poorly understood. We discovered nuclear receptor subfamily 6 group A member 1 (NR6A1) as a novel pivotal regulator of murine NCC specification, formation and survival. NR6A1 is an orphan nuclear receptor, first isolated from testes and heart tissue, that was originally named germ cell nuclear factor (GCNF) and retinoid receptor-related testis-specific receptor (RTR) ( Chen, Cooney et al. 1994 , Hirose, OβBrien et al. 1995 ). Dynamically expressed during folliculogenesis and spermatogenesis, as well as in the embryo throughout pre- and post-implantation, Nr6a1 is critical for mouse embryo development and survival ( Katz, Niederberger et al. 1997 , Zhang, Akmal et al. 1998 , Chung, Katz et al. 2001 , Lan, Xu et al. 2009 ). NR6A1 loss-of-function in mouse results in an open neural tube, axial truncation, cardiac defects, and failure of chorioallantoic fusion, which leads to embryonic lethality by embryonic day (E) 10.5 ( Chung, Katz et al. 2001 ). We uncovered Nr6a1 as transcriptionally downregulated in a mouse model of the craniofacial neurocristopathy, Treacher Collins syndrome ( Jones et al., 2008 ). We then determined that Nr6a1 is spatiotemporally expressed in the neuroepithelium and newly emigrating NCC and hypothesized that Nr6a1 regulates NCC formation. Indeed, through loss-of-function analyses in mice we show that Nr6a1 null embryos exhibit a deficiency in anterior cranial NCC, and complete agenesis of migrating NCC caudal to the first pharyngeal arch. These phenotypes were associated with downregulation of NCC specifiers ( Foxd3, Sox9, Sox10 ) and EMT master regulators ( Snail1, Zeb2 ), in concert with expansion of the neural stem cell marker Sox2, increased proliferation, and persistent expression of pluripotency-associated factors ( Oct4 and Nanog ) in the neuroepithelium. Using mouse embryonic stem cells (ESC), and human induced pluripotent stem cells (iPSC) differentiated into NCC, as well as chromatin immunoprecipitation and multiomic approaches, we demonstrate that Nr6a1 modulates the chromatin landscape and directly binds to putative DR0 motifs in the promoter regions of NCC, EMT and pluripotency-associated factors, to regulate their expression. Furthermore, global temporal, and conditional spatiotemporal deletion revealed that Nr6a1 is specifically required during mid-late gastrulation, suggesting that NCC specification in mouse embryos commences earlier than previously recognized. Consistent with this model, in vivo overexpression of Oct4 in gastrulating mouse embryos disrupts NCC specification and formation. Altogether, our work has uncovered NR6A1 as a novel regulator of mammalian NCC specification and formation. Nr6a1 may therefore function as a bimodal switch that represses pluripotency factors associated with neural stem cell maintenance and proliferation, while being required to activate a gene regulatory network of NCC specifiers and regulators of EMT. Results Spatial distribution and timing of Nr6a1 expression coincides with NCC development Treacher Collins syndrome is a neurocristopathy caused primarily by variants in the TCOF1 gene ( Dixon, Trainor et al. 2007 , Trainor, Dixon et al. 2009 , Falcon, Watt et al. 2022 ). Characterized by downward slanting of the palpebral fissures, hypoplasia of the zygomatic complex, micrognathia and cleft palate ( Dixon, Trainor et al. 2007 , Trainor, Dixon et al. 2009 ), previous studies of mouse and zebrafish models of Treacher Collins syndrome determined these characteristic craniofacial anomalies to be caused by a deficiency in NCC. Tcof1 +/- haploinsufficiency results in diminished rRNA synthesis and ribosome biogenesis, leading to increased p53-dependent apoptosis, which compromises the formation, proliferation and survival of NCC (Dixon et al., 2006; Jones et al., 2008 ) (Noack Watt, Achilleos et al. 2016 , Sakai, Dixon et al. 2016 , Watt, Neben et al. 2018 , Falcon, Watt et al. 2022 ). Transcriptomic analyses of E8.5 Tcof1 +/- and control littermate embryos revealed numerous gene expression changes in association with the molecular and cellular pathogenesis of Treacher Collins syndrome ( Jones, Lynn et al. 2008 ). We hypothesized that downregulated genes in this mouse neurocristopathy model might also be important for normal NCC development. Interestingly, Nr6a1 , which was shown to regulate the transition of primitive neural stem cells to definitive neural stem cells ( Akamatsu, DeVeale et al. 2009 ), was decreased two-fold in Tcof1 +/- embryos compared to controls ( Jones, Lynn et al. 2008 ). We therefore posited that Nr6a1 may also play a critical role in NCC development. Nr6a1 is initially expressed in embryonic stem cells at E4.5 ( Gu, LeMenuet et al. 2005 ) and then localizes to the embryonic ectoderm at E6.5 ( Chung, Katz et al. 2001 ) and the neural ectoderm and primitive streak during gastrulation (E6.5 β 7.5) ( Chung, Katz et al. 2001 ). To further characterize the spatiotemporal expression of Nr6a1 during NCC development, we performed in situ hybridization on CD1 mouse embryos from E8.0 to E12.5 ( Figure 1 ). At E8.0 Nr6a1 continues to be expressed in the neural plate (arrowheads) and primitive streak (arrows), becoming more pronounced along the entire neuraxis from E8.5-9.5 ( Figure 1A-F ). Transverse histological sections of stained E8.5-E8.75 embryos showed Nr6a1 is dynamically expressed in the dorsal most region of the neuroepithelium and in presumptive newly delaminated NCC ( Figure 1E , arrows). By E10.5, Nr6a1 is no longer expressed in the embryo, and this continues through at least E12.5 ( Figure 1G-I ), consistent with previous studies ( Chung et al., 2001 ; Chang et al., 2022 ). Our expression analyses therefore indicated that Nr6a1 is expressed at the right time and in the right locations to potentially function in the specification, formation and early migration of NCC. Download figure Open in new tab Figure 1. Nr6a1 expression overlaps with regions of early NCC development. In situ hybridization of Nr6a1 on CD1 embryos from E8.0-12.5. A-B. At E8.0, Nr6a1 is expressed across the primitive streak and posterior regions of the embryo (arrows). C-D. Nr6a1 is then expressed along the neuroepithelium and dorsal neural folds (arrowheads) at E8.5. Note that C has been reflected to maintain a similar orientation. E. Transverse sections across the first pharyngeal arch of E8.75 embryos shows Nr6a1 is expressed in the dorsal region of the neuroepithelium and in cells just outside of the neuroepithelium fanning out ventrally where NCC would be located. F. By E9.5, Nr6a1 expression is restricted to the neural tube. G-I. Nr6a1 is no longer expressed in the embryo at E10.5 through to E12.5. Nr6a1 is required for NCC formation, delamination and survival Nr6a1 null mutant mice are embryonic lethal by E10.5 due to cardiac defects and a failure of chorioallantoic fusion ( Chung, Katz et al. 2001 ). Nr6a1 -/- embryos also exhibit significant defects in axial elongation and tail bud formation ( Chung, Katz et al. 2001 , Chung, Xu et al. 2006 , Chang, Manent et al. 2022 ). To determine if Nr6a1 is required for NCC development, we evaluated the expression of NCC-specifier genes Foxd3 , Sox9 and Sox10 in E9.0 Nr6a1 -/- embryos, prior to embryonic lethality ( Figure 2A ). Foxd3 is one of the earliest markers of NCC specification and it maintains the potency of NCC ( Mundell and Labosky 2011 ), while also regulating cadherin turnover to facilitate delamination by EMT ( Dottori, Gross et al. 2001 ). Compared to wildtype littermate controls, Foxd3 expression was absent from the NCC-derived mesenchyme in the Nr6a1 null embryos ( Figure 2A ). Sox9 is also required for NCC formation and delamination and is expressed in pre-migratory and early migratory NCC, as well as later during their chondrogenic differentiation ( Ng, Wheatley et al. 1997 , Zhao, Eberspaecher et al. 1997 , Cheung and Briscoe 2003 ). We could detect only a few, if any, cells expressing Sox9 in the craniofacial mesenchyme, with no labeled cells in the frontonasal prominences in Nr6a1 null embryos ( Figure 2A ). Similarly, Sox10 , a marker of migrating NCC ( Aoki, Saint-Germain et al. 2003 , Honore, Aybar et al. 2003 ), was absent from the pharyngeal arch mesenchyme. Only a few Sox10 labeled cells were present in the peri-optic mesenchyme, contrasting with the widespread pattern of Sox10 -positive NCC in the peri-optic mesenchyme and pharyngeal arch mesenchyme in controls ( Figure 2A ). Download figure Open in new tab Figure 2. NCC-specifier and EMT genes are downregulated in the Nr6a1 null embryos resulting in NCC deficiency. A. In situ hybridization of NCC and EMT genes on Nr6a1 null and heterozygous littermate (control) embryos at E9.0. Foxd3 , Sox9 , Sox10 , Snai1 and Zeb2 are downregulated in the Nr6a1 null embryo compared to controls. Twist1 is still expressed in the mesoderm but is not expressed in NCC until late migration. B. Beta-galactosidase staining of Nr6a1 -/- ;Wnt1-Cre;R26R-LacZ and Wnt1-Cre;R26R-LacZ embryos at E9.5. Nr6a1 null embryos lack expression of LacZ caudal to the first pharyngeal arch indicating a loss of NCC. C. eYFP expression in Nr6a1 -/- ;Wnt1-Cre;R26R-eYFP and Wnt1-Cre;R26R-eYFP embryos at E9.0 shows a loss of NCC caudal to the first pharyngeal arch and fewer NCC in the cranial region consistent with the LacZ stained embryos in B . Transverse histological sections through the first pharyngeal arch (PA1) in both embryos shows a reduction in migratory NCC in the null embryos. No NCC are present in the second arch (PA2) in the null embryo. We next evaluated whether the expression of NCC EMT master regulators Snai1 , Zeb2 and Twist1 was also disrupted in Nr6a1 -/- embryos. Snai1 is typically expressed in neuroepithelial cells during NCC formation and its expression persists in delaminating and migrating NCC ( Nieto, Sargent et al. 1994 , Sefton, Sanchez et al. 1998 , Carl, Dufton et al. 1999 , Aybar, Nieto et al. 2003 ). However, Snai1 expression was absent in Nr6a1 -/- embryos, except for a few scattered labeled cells in the peri-optic mesenchyme ( Figure 2A ). Zeb2 is also expressed in the neuroepithelium and migratory NCC ( Van de Putte, Maruhashi et al. 2003 , Nitta, Tanegashima et al. 2004 ). Although Zeb2 was expressed in the neural plate in Nr6a1 -/- embryos, it was absent from the NCC derived facial and pharyngeal mesenchyme ( Figure 2A ). Twist1 , like Snai1 and Zeb2, is considered a master regulator of EMT. Interestingly, Nr6a1 -/- embryos exhibit Twist1 expressing cells in the frontonasal prominences and pharyngeal arches, but to a lesser degree than in controls ( Figure 2A ). However, previous studies have shown that Twist1 is not required for NCC formation but instead regulates NCC migration and differentiation during mouse embryo development ( Gitelman 1997 , Tavares, Izpisuja-Belmonte et al. 2001 , Bildsoe, Loebel et al. 2009 ). Altogether, our gene expression analysis suggested Nr6a1 is required for the expression of NCC-specifier and EMT genes during development. Gene expression is not necessarily an indicator of lineage, but the perturbations in NCC-specifier and EMT gene expression implied that Nr6a1 null embryos might be deficient in NCC formation and delamination. However, the expression of Twist1 suggested there were some mesenchymal cells present in the frontonasal prominences and pharyngeal arches. Therefore, to more conclusively assess the presence or absence of NCC in Nr6a1 null embryos, we performed lineage tracing by crossing Wnt1-Cre driven reporter transgenes ( Chai, Jiang et al. 2000 ) into the background of Nr6a1 -/- embryos. Interestingly, E9.0-9.5 Nr6a1 -/- ;Wnt1-Cre;R26R-LacZ embryos completely lacked migrating NCC caudal to the first pharyngeal arch ( Figure 2B ). Surprisingly, even though the expression of many NCC-specifier and EMT genes are lost in Nr6a1 -/- embryos, the presence of LacZ-positive cells within the frontonasal region and first pharyngeal arch suggests some cells are still capable of delaminating and migrating from the midbrain and anterior hindbrain neuroepithelium ( Figure 2B ). We observed identical cranial and trunk patterns using an eYFP reporter instead of LacZ ( Figure 2C ). E9.0-9.5 Nr6a1 -/- ;Wnt1-Cre;R26R-eYFP embryos exhibited fewer migrating cranial NCC and a complete absence of migrating NCC caudal to the first pharyngeal arch. Transverse histological sections of E9.0-9.5 Nr6a1 -/- ;Wnt1-Cre;R26R-eYFP embryos further illustrate the diminishment of eYFP-labeled putative NCC within the first pharyngeal arch and their complete absence from the second pharyngeal arch compared to controls ( Figure 2C ). Given the expression of Twist1 in Nr6a1 null embryos, these eYFP- or LacZ-positive cells are likely to be mesenchymal ( Figure 2A ). However, the absence or downregulated expression of NCC-specifier and other EMT genes suggested these putative NCC were of undefined character, which raised questions about their long-term potential. TUNEL staining of E8.75 Nr6a1 -/- ;Wnt1- Cre;R26R-eYFP revealed visibly higher levels of cell death in Nr6a1 mutants compared to Wnt1-Cre;R26R-eYFP littermate controls (Supplemental Figure 1). The cell death was predominantly located in the craniofacial mesenchyme and within regions of eYFP labeled cells (Supplemental Figure 1). Altogether, these results indicate Nr6a1 is required for murine NCC formation and survival. Nr6a1 is required for the transition of neural stem cells to NCC Nr6a1 is predominantly expressed in the neural ectoderm during early NCC development and is required for neural tube closure ( Chung, Katz et al. 2001 ). This raised the question of whether the deficiency in NCC formation and migration in Nr6a1 null embryos was a secondary consequence of abnormal specification and patterning of the neural ectoderm. Sox2 is a pan-neural marker of progenitor cells in the neural ectoderm and is sufficient to maintain their proliferation and stemness properties ( Graham, Khudyakov et al. 2003 , Wakamatsu, Endo et al. 2004 ). Through in situ hybridization, we observed that Sox2 is expressed in the open neural plate in Nr6a1 null embryos ( Figure 3A ), indicating that pan-neural specification of the neural plate occurs in Nr6a1 mutants. Wnt1 and Pax3 are also expressed within the neural ectoderm, but specifically in dorsal domains that help establish dorsoventral patterning ( Goulding, Lumsden et al. 1993 , Dickinson, Selleck et al. 1995 ). Their spatiotemporal patterns of expression remain unchanged in Nr6a1 null embryos compared to controls indicating that proper dorsal pattering is established in the neural plate of Nr6a1 mutants. Immunostaining of transverse sections confirmed SOX2 and PAX3 were expressed in the neural ectoderm of the Nr6a1 -/- embryos but also illustrated the increased thickness of the neural plate compared to controls ( Figure 3B ). SOX2 is a key regulator of proliferating neural progenitor cells throughout the entire anterior-posterior axis of the central nervous system from neural plate stages of embryogenesis through to adulthood ( Ellis, Fagan et al. 2004 ). PAX3 also functions to maintain the neuroepithelium in a proliferative, undifferentiated state, allowing neurulation to proceed ( Sudiwala, Palmer et al. 2019 ). We therefore hypothesized that the thickened neuroepithelium in the Nr6a1 mutants was due to increased proliferation. Indeed, phospho-histone H3 (pHH3) immunostaining of transverse histological sections confirmed that Nr6a1 -/- embryos exhibit considerably higher proliferation than littermate controls ( Figure 3B ). Download figure Open in new tab Figure 3. Nr6a1 is required for the transition from neural stem to NCC. A. In situ hybridization of neuroepithelial markers in null and wildtype littermate control embryos at E9.0. Sox2 , Wnt1 and Pax3 are all expressed in the Nr6a1 null embryos, indicating the neural ectoderm has formed and patterned. B. Immunostaining of SOX2, PAX3 and pHH3 on transverse histological sections at E9.0. SOX2 and PAX3 are expressed in the neural plate in both null and control embryos. SOX2 expression is expanded to dorsal regions of the neural plate. PAX3 expression is maintained in the Nr6a1 null, although no PAX3 positive migratory cells could be observed further demonstrating the NCC deficiency. More pHH3 staining can be seen in the neural plate of the Nr6a1 null embryos suggesting the neural ectoderm is maintained in a highly proliferative state. Additionally, we also observed that the expression of SOX2 persisted in the dorsolateral border region of Nr6a1 -/- embryos compared to controls ( Figure 3B ). Downregulation of Sox2 in the dorsolateral border of the neural ectoderm is essential for neural stem cells to differentiate into NCC and occurs as part of a SoxB (Sox1, Sox2) to SoxE (Sox9, Sox10) switch ( Wakamatsu, Endo et al. 2004 , Remboutsika, Elkouris et al. 2011 ). Furthermore, although the dorsal domain of PAX3 in the neural ectoderm appeared unchanged in Nr6a1 mutants, PAX3 expression was not observed outside of the neuroepithelium, consistent with the deficiency of migratory NCC in Nr6a1 mutants compared to littermate controls ( Figure 3B ). Thus, Nr6a1 loss-of-function does not result in mis-patterning of the pan-neural or dorsal character of the neural ectoderm. Collectively, these results indicate the neural ectoderm forms and is appropriately patterned in Nr6a1 null embryos. However, the persistence of SOX2 expression in the dorsolateral border region together with elevated proliferation, suggested that the neural ectoderm in the Nr6a1 null mutants was maintained in a proliferative stem cell state which may restrict the neural stem cells from differentiating into NCC. To better understand how Nr6a1 regulates NCC formation and survival, we initially performed microarray based transcriptomic analyses of E9.0 wildtype and Nr6a1 null mutant embryos. Consistent with our in situ hybridization results ( Figure 2A ), the expression of NCC-specifier genes, Foxd3 , Sox9 , and Sox10 was downregulated in Nr6a1 null embryos, together with EMT master regulators Snai1 , Zeb2 and Twist1 ( Table 1 ). Although the downregulation of these factors in the microarray did not reach statistical significance, this was likely due to the entire embryo being sampled, of which the NCC are but a relatively small portion at this stage of development. Therefore, we also performed bulk RNA-sequencing, on only the anterior portion of the embryo, and again we observed considerable downregulation of NCC-specifier and EMT master regulator gene expression in Nr6a1 -/- embryos compared to littermate controls ( Table 1 ). In contrast, we found that that pluripotency associated factors such as Oct4 and Nanog, were significantly upregulated in Nr6a1 -/- embryos compared to littermate controls through each of the transcriptomic approaches ( Table 1 ). Oct4 and Nanog, together with Sox2, play essential coordinated roles in preserving the pluripotency and self-renewal capacity of ESCs and adult stem cells ( Nichols, Smith et al. 1998 , Avilion, Nicolis et al. 2003 , Wang, Rao et al. 2006 ). Interestingly, previous studies have shown that Nr6a1 plays a direct role in repressing Oct4 and Nanog during peri-implantation development (Fuhrmann, Chung et al. 2001 , Hummelke and Cooney 2001 , Gu, LeMenuet et al. 2005 ). To test this model in the context of NCC development, we performed a time course analysis of OCT4 expression using the Oct4-EGFP reporter line ( Lengner, Camargo et al. 2007 ). Oct4-EGFP is strongly expressed and clearly observed in the epiblast at E7.5 but is then downregulated by E8.5 ( Figure 4A ). We then crossed Oct4-EGFP into the background of Nr6a1 null embryos and observed persistent ectopic Oct4-EGFP expression throughout the neural ectoderm in E8.5 Nr6a1 -/- ;Oct4-EGFP embryos compared to control littermates ( Figure 4B ). Although GFP is an indirect readout of OCT4 activity, persistent ectopic Oct4 expression has previously been reported in the Nr6a1 -/- embryo (Fuhrmann, Chung et al. 2001 ). Collectively, these results indicate that OCT4 is typically downregulated in the neural ectoderm in association with NCC formation. The persistent expression of pluripotency associated genes such as Sox2 , Oct4 and Nanog, therefore suggest that the neural ectoderm in Nr6a1 null mutants is maintained in a proliferative stem cell state which restricts neural stem cells from differentiating into NCC. Thus, Nr6a1 may be required for the transition of neural ectoderm or neural stem cells to NCC by repressing pluripotency and stem cell maintenance genes while concomitantly being required for the expression of NCC specification and EMT genes. Download figure Open in new tab Figure 4. Oct4 must be downregulated by NR6A1 prior to NCC formation. A. Oct4-EGFP expression at E7.5 and E8.5. Oct4 is highly expressed in the embryo proper at E7.5according to high GFP expression but is downregulated by E8.5 as evidenced by the absence of GFP expression. B. Oct4-EGFP expression in Nr6a1 null and control littermates. Oct4 is exogenously expressed in the null compared to control embryos which do not display Oct4 (GFP) expression. C. scRNA-seq of cranial tissue from Wnt1-Cre;R26R-eYFP and Mef2c-F10n-LacZ embryos shows a transcriptional signature isolating pluripotency-associated gene expression to neural ectodermal (NE) cells compared to NCC. Any expression of Oct4 and Nanog is restricted to a very small population of NE cells (see dot size for percent expressed). D. In situ hybridization of NCC-specifier and EMT genes in Oct4/rtTA embryos treated with doxycycline (+Dox) as compared to untreated embryos (-Dox). Consistent with the Nr6a1 null embryos, NCC and EMT marker expression is no longer present through the cranial mesenchyme of the embryos, indicating a disruption in NCC formation. View this table: View inline View popup Download powerpoint Table 1. Key pluripotency-associated and NCC-specifier genes are differentially expressed in Nr6a1 null embryos compared to control littermates. scRNA-seq was performed at E8.75-9.0 on the whole embryo. Bulk RNA-seq was performed at E9.5 on the anterior of the embryos. Finally, microarray was performed at E9.0 on the whole embryo. Genes that are upregulated are in green, whereas genes that are downregulated are in red. Across all three datasets, it was found that pluripotency-associated factors Oct4 and Nanog were upregulated while NCC-specifier and EMT genes were downregulated. NR6A1 functions by upregulating NCC-specifier and EMT genes and repressing pluripotency and stem cell maintenance NR6A1 is an orphan member of the nuclear receptor superfamily and shares the highest homology with COUP-TF, which functions as both a transcriptional repressor and activator ( Chen, Cooney et al. 1994 , Hummelke and Cooney 2001 ). The downregulation of NCC specification and EMT genes in Nr6a1 -/- embryos suggest NR6A1 could function by activating these genes during development in parallel with repressing the pluripotency-associated genes. NR6A1 binds to a double repeat of the consensus sequence AGGTCA with zero spacing (DR0) motif, to transcriptionally regulate target genes such as Oct4 and Nanog ( Chen, Cooney et al. 1994 , Cooney, Hummelke et al. 1998 , Chung, Xu et al. 2006 ). We therefore searched for this putative binding site or motif in NCC-specification and EMT genes to determine the potential for NR6A1 to directly regulate these genes. Sox9 , Sox10 , Snai1 and Zeb2 each possess DR0 binding sites in their promoter regions, which is consistent with downregulation of their expression in Nr6a1 null embryos. To further understand how NR6A1 regulates NCC-specifier and EMT genes within the neural ectoderm during NCC development, we performed single cell multiomic analyses of E8.75 Nr6a1 null mutant and control littermate embryos. Combining single cell RNA-sequencing (scRNA-seq) with single nucleus transposase-accessible chromatin sequencing (snATAC-seq) allows for the assessment of differential gene expression and chromatin accessibility between cell populations in the Nr6a1 null and control littermate embryos. The scRNA-seq results from the control were used to annotate cell populations (Supplemental Figure 2A-B). The neural plate border cells were identified based on high differential expression of Wnt1 , Pax3/7 and Zic1 ( Sauka-Spengler and Bronner-Fraser 2008 , Simoes-Costa and Bronner 2015 , Zhao, Moore et al. 2024 ) (Supplemental Figure 2A-B). NCC were annotated based on high differential expression of the NCC-specifier genes Foxd3 , Sox9 , Sox10 , Crabp1 , Snai1 and Zeb2 ( Trainor 2005 , Stuhlmiller and Garcia-Castro 2012 , Prasad, Charney et al. 2019 , Zhao, Moore et al. 2024 ) (Supplemental Figure 2A-B). The neural ectoderm was identified by high differential expression of Sox2 , Pax2 , Otx2 and Sox3 ( Simoes-Costa and Bronner 2015 , Martik and Bronner 2017 , Zhao, Moore et al. 2024 ) (Supplemental Figure 2A-B). Finally, neural progenitors were annotated based on the high expression of Olig2 , Sox2 and Pax6 ( Ericson, Rashbass et al. 1997 , Graham, Khudyakov et al. 2003 , Lee, Lee et al. 2005 , Zhao, Moore et al. 2024 ) (Supplemental Figure 2A-B). Comparison of the Nr6a1 -/- embryo scRNA-seq dataset to the control littermate scRNA-seq dataset revealed the NCC population was substantially decreased, reaffirming the results obtained from Nr6a1 -/- ;Wnt1-Cre;R26R-eYFP lineage tracing (Supplemental Figure 2C). Furthermore, the few cells that clustered as NCC in the mutant embryos exhibited a significant decrease in Sox10 expression, while in contrast the neural plate border (NPB) cells exhibited increased Oct4 and Nanog expression compared to control littermates, consistent with our previous microarray, bulk RNA-seq, in situ hybridization, immunostaining and transgenic reporter mouse analyses ( Table 1 ). Next, we evaluated changes in chromatin accessibility between Nr6a1 -/- mutant embryos and control littermates (Supplemental Figure 3). It is well established that NR6A1 directly binds to and represses Oct4 . Therefore, we first evaluated the chromatin accessibility of Oct4 in the NCC and ectodermal populations in Nr6a1 -/- mutant embryos compared to control littermates ( Figure 5A ). Nr6a1 -/- embryo NCC exhibited increased chromatin accessibility compared to controls, consistent with NR6A1 loss-of-function preventing the repression of Oct4 ( Figure 5A ). Furthermore, peaks illustrating the increased accessibility of open chromatin upstream of Oct4, aligned with the locations of putative DR0 bindings sites, demonstrating mechanistically how Nr6a1 represses Oct4 expression ( Figure 5A ). We next evaluated chromatin accessibility around Sox10 , which is significantly decreased in Nr6a1 -/- embryos ( Figure 5B ). If NR6A1 regulates the transcription of Sox10 , then we would expect Sox10 to be less accessible or no longer be accessible in Nr6a1 null embryos. Indeed, Nr6a1 -/- embryo NCC exhibited decreased chromatin accessibility at Sox10 compared to controls, consistent with NR6A1 being required for access and transcription of Sox10 ( Figure 5B ). The DR0 sites overlapped with the Sox10 peaks as well, supporting the idea that NR6A1 binds to and regulates the transcription of Sox10 ( Figure 5B ). Download figure Open in new tab Figure 5. Multiomic scRNA-seq and snATAC-seq demonstrate chromatin accessibility changes around pluripotency-associated and NCC-specifier genes within the NCC and neural plate populations upon loss of NR6A1 function. For both A and B , the snATAC-seq fragment density across each gene is shown alongside a violin plot displaying gene expression within each cell population. A map of the gene is shown below the fragment density to provide locational reference. Peak coverage is displayed below the gene and the ranges below the peak coverage label Nr6a1 DR0 binding sites along the genome. A. Oct4 expression is increased in mutant cell populations compared to wild type as displayed by the violin plot. Consistent with the increased gene expression in the mutant cell populations, the fragment density if higher along Oct4 indicating the chromatin is more accessible along the gene. Finally, peak coverage overlaps with footprints of DR0 sites which aligns with the requirement of NR6A1 to downregulate Oct4 expression. B. Sox10 expression is decreased in the mutant NCC population compared to wild type cells as displayed by the violin plot and matches our previous data showing Sox10 expression is downregulated in the null. Note that this is normalized to account for fewer NCC in the mutant. When comparing the density of fragments observed along Sox10 in the snATAC-seq data, there is a reduction in density in the null compared to control NCC. Further, peak coverage overlaps with DR0 bindings sites. Collectively, the data shows there is a reduction in chromatin accessibility along Sox10 in the null NCC compared to wild type which translates to decreased expression. It is possible this is due to a role of NR6A1 as a regulator of Sox10 expression according to the overlap in peak coverage and DR0 binding sites. Due to the loss of NR6A1 function, NR6A1 cannot bind to the DR0 sites along Sox10 in the null thus the chromatin remains inaccessible for transcription. ATAC-seq demonstrated that NR6A1 can modulate the accessibility of pluripotency-associated and NCC-specifier genes like Oct4 and Sox10 respectively ( Figure 5 ). To validate NR6A1βs ability to directly bind to the DR0 binding sites we performed electrophoretic mobility shift assays (EMSA) and competitive inhibition assays. EMSA revealed the presence of shifted Zeb2 and Sox10 bands following the addition of NR6A1, indicating NR6A1 can directly bind to the DR0 sites in their promoter regions ( Figure 6A ). For the competitive inhibition assay, wildtype and mutated DR0 site DNA were introduced in increasing amounts ( Figure 6B ). We observed diminished binding in the presence of increasing wildtype DNA compared to mutated DR0 site DNA, supporting the ability of NR6A1 to selectively bind to the DR0 sites of Zeb2 and Sox10 ( Figure 6B ). To confirm Nr6a1 binding occurs in vivo and to evaluate all of our NCC and EMT genes of interest, we performed a targeted ChIP assay using mESC that were differentiated into NCC. NR6A1 bound the DR0 sites in Sox9 , Sox10 , Snai1 and Zeb2 ( Figure 6C ). We also confirmed NR6A1 that can bind Nanog DR0 sites, which had previously been shown ( Gu, LeMenuet et al. 2005 ), further supporting our results ( Figure 6C ). Download figure Open in new tab Figure 6. NR6A1 directly binds to putative DR0 binding sites in NCC-specifier and EMT genes. A. The ability for NR6A1 to bind to predicted sites of regulation on Zeb2 and Sox10 was analyzed by EMSA. When NR6A1 was present, a super-shifted band can be seen, representing positive interactions between NR6A1 and the predicted DR0 sequence. B. Unlabeled wildtype sequences or sequences with mutated NR6A1 binding sites for Zeb2 and Sox10 were added in a dose-dependent manner resulting in reduced binding to labelled sequences in wildtype and minimal effect with mutant sequence. C. A targeted ChIP assay was conducted in mESCs differentiated to NCC using antibodies against endogenous NR6A1 and binding was assessed by qPCR of predicted binding sites. NR6A1 binds to NCC-specifier and EMT factors in vivo (*p<0.0, **p<0.005). In conclusion, NR6A1 can modulate chromatin accessibility and bind to the DR0 sites found in the promoter regions of NCC-specifier and EMT genes, and pluripotency associated factors. The downregulation of NCC-specifier and EMT genes in Nr6a1 null embryos indicates NR6A1 may function as a transcriptional regulator of NCC-specifier and EMT genes. At the same time, Nr6a1 transcriptionally represses pluripotency associated factors. Collectively these results indicate that Nr6a1 governs the transition of neural stem cells to NCC, by repressing stem cell maintenance and proliferation in the neural ectoderm, while concomitantly regulating the expression of NCC-specifier and EMT genes within the neural plate border and newly emigrating NCC. Temporal and tissue-specific excision of Nr6a1 reveals NCC specification begins at mid-late gastrulation Nr6a1 null embryos are embryonic lethal by E10.5 due to the failure of chorioallantoic fusion ( Chung, Katz et al. 2001 ). This early lethality prevents the assessment of a role for Nr6a1 in later NCC differentiation at all axial levels. However, given the important role of Nr6a1 in NCC formation, we posited that Nr6a1 should therefore be essential for craniofacial, cardiac, peripheral nervous system, and gastrointestinal development, as each of these tissues and organs depend heavily on NCC for their proper development. To bypass the early embryonic lethality of Nr6a1 null embryos, we conditionally deleted NR6A1 specifically in the NCC, using Wnt1-Cre . Surprisingly, no phenotypic abnormalities were found in Nr6a1 fx/fx ;Wnt1-Cre embryos compared to controls (Supplemental Figure 4). E18.5 Nr6a1 fx/fx ;Wnt1-Cre embryos appeared morphologically normal, and the NCC derived craniofacial skeleton (evaluated by alizarin red and alcian blue staining), peripheral nervous system and enteric nervous system (evaluated by TUJ1 immunostaining) were indistinguishable from controls. Furthermore, the NCC-specific knockouts were produced in Mendelian ratios and survived until adulthood with full reproductive capabilities. This indicated that NCC development was unaffected (Supplemental Figure 4), which is in stark contrast to all of our other data clearly showing that Nr6a1 is required for NCC specification, formation and survival. Recently, however, it was proposed that Wnt1-Cre excision occurs too late during neurulation to properly asses gene function during NCC specification and formation in mouse embryos (Barriga 2015). Wnt1-Cre facilitates Cre excision of floxed alleles at approximately E8.5. This is important because it suggests that Nr6a1 may not be required for NCC development after E8.5. Furthermore, it also implies that Nr6a1 may instead be needed earlier in development to elicit its role in NCC specification and formation To test this idea, and establish when Nr6a1 is specifically required, we globally deleted NR6A1 in a temporally-specific manner using the tamoxifen inducible Cre line, ERT2-Cre ( Indra, Warot et al. 1999 ). Consistent with the Wnt1-Cre knockout, no morphological differences were observed when Nr6a1 was temporally excised with ERT2-Cre at E8.5. We then excised Nr6a1 via tamoxifen administration at progressively earlier half-day time points. Global excision at E7.75 or E7.25 resulted in no observable phenotypic differences in NCC gene expression in conditional Nr6a1 mutants compared to controls ( Figure 7 ). However, we discovered that global excision of Nr6a1 by E6.75 resulted in a phenotype matching the original Nr6a1 null embryos as evidenced by the downregulated expression of NCC-specifier and EMT genes ( Figure 7 ). Thus, Nr6a1 is required to induce NCC specification during mid-late gastrulation in mouse embryogenesis, which is considerably earlier than previously appreciated or recognized. Download figure Open in new tab Figure 7. Nr6a1 activity is required during mid-to-late gastrulation to induce NCC specification. In situ hybridization of NCC markers on control ( Nr6a1 fl/fl ) and Nr6a1 fl/fl ;ErT2-Cre embryos treated with tamoxifen for excision of Nr6a1 at E7.25 and E6.75. Embryos with Nr6a1 excision by E7.25 and controls show normal expression patterns of NCC and EMT markers. Once Nr6a1 is excised by E6.75, NCC and EMT marker expression is lost. Auto-color was applied to enhance the contrast above background. The downregulation of pluripotency and stem cell maintenance factors is required for NCC formation Interestingly, it was recently proposed that NCC retain or re-activate pluripotency-associated genes to facilitate their characteristic capacity to generate a wide variety of cell and tissue derivatives ( Buitrago-Delgado, Nordin et al. 2015 , Lignell, Kerosuo et al. 2017 , Zalc, Sinha et al. 2021 , Hovland, Bhattacharya et al. 2022 , Patel and Parchem 2022 , Pajanoja, Hsin et al. 2023 ). However, our analyses of Nr6a1 -/- mutant embryos indicate that the expression of pluripotency-associated factors including Oct4 , Nanog and Sox2 , persists in Nr6a1 -/- mutant embryos, coinciding with deficient NCC generation. This suggests that retention of pluripotency-associated factors may actually restrict the generation of NCC from neural stem cells. Consistent with this idea, our analyses of wildtype Oct4-EGFP mouse embryos revealed that Oct4-EGFP expression in E7.5 mouse embryos is downregulated by E8.5, coinciding with the formation of NCC ( Figure 4 ). In further support of these findings, our multiomic analyses revealed a similar absence of Oct4 and Nanog expression in E8.75 wildtype mouse embryos (Supplemental Figure 2A). To better substantiate whether Oct4 and other pluripotency and stem cell maintenance factors are downregulated in concert with NCC formation, we analyzed our scRNA-seq data of cranial tissues from pre-migratory and migratory NCC stage mouse embryos ( Falcon, Watt et al. 2022 , Moore, Zhao et al. 2024 , Zhao, Moore et al. 2024 ). Sox2, Sox1 and Nr6a1 are highly expressed in the neural ectoderm, in contrast to Oct4 and Nanog ( Figure 4C , Supplemental Figure 5). Furthermore, the expression of each of these genes is downregulated in the progenitor NCC population ( Figure 4C , Supplemental Figure 5). In contrast, NCC-specification ( Foxd3 , Sox9 , Sox10 ) and EMT ( Snai1 , Zeb2 ) genes are highly enriched in progenitor NCC as compared to the neural ectoderm, distinguishing these two populations ( Figure 4C , Supplemental Figure 5). Other groups have reported a similar absence of pluripotency-associated factor expression during NCC development aligning with our data ( Briggs, Weinreb et al. 2018 ). Therefore, to expand and further substantiate our assessment of the dynamics of Oct4 , Nanog and Sox2 expression during development, we also analyzed a publicly available scRNA-seq dataset that covered gastrulation to neurulation stage in mouse embryos ( Pijuan-Sala, Griffiths et al. 2019 ). Complementary to our data, Oct4 , Nanog and Sox2 were absent from the progenitor NCC cluster, and a definitive boundary was evident in the pseudotime trajectory separating the primitive neuroectoderm from progenitor NCC (Supplemental Figure 6). Nr6a1 expression in this dataset aligned with our in situ data confirming that Nr6a1 is expressed in the epiblast during gastrulation, before becoming enriched in the neural ectoderm during neurulation (Supplemental Figure 6). To further evaluate pluripotency and stem cell maintenance factor expression during NCC formation, we measured by RT-qPCR, the dynamics of Oct4 , Nanog , Sox2 , Sox9 and Sox10 expression during mESC and hiPSC derivation of NCC (Supplemental Figure 7A and C). Each approach revealed the absence of pluripotency-associated factor expression in the forming NCC populations, and this was strikingly exemplified by their immediate downregulation in hiPSC upon provision of NCC differentiation media (Supplemental Figure 7A and C). Interestingly, Nr6a1 was also specifically elevated (days 1 and 2) in hiPSC during the switch between pluripotent stem cell maintenance, and NCC specification (Supplemental Figure 7C). Immunostaining further substantiated the downregulation in expression of pluripotency-associated factors and upregulation of NCC-specifier genes (Supplemental Figure 7B and D). To conclusively show that downregulation of pluripotency and stem cell maintenance regulators is required for NCC formation, we overexpressed Oct4 in mouse embryos from E6.5 to E8.5 (during NCC specification and formation) using a doxycycline inducible system ( Hochedlinger, Yamada et al. 2005 ) ( Figure 4D ). The temporal initiation of Oct4 overexpression was designed to correlate with the temporal requirement for Nr6a1. Embryos overexpressing Oct4 presented with neural tube closure defects and craniofacial abnormalities, mimicking the Nr6a1 null phenotype. Moreover, the expression of NCC-specifier ( Foxd3 , Sox9 , Sox10 ) and EMT ( Zeb2 , Snai1 ) genes in these Oct4 overexpressing embryos was downregulated, similar to that in Nr6a1 null mutant embryos ( Figure 4D ). Downregulation of pluripotency and stem cell maintenance factor expression is therefore required for proper NCC formation. Altogether, our data suggests that NR6A1 is a key regulator of the transition of neural stem cells to NCC by repressing pluripotency-associated genes and regulating the expression of NCC-specification and EMT genes during mid-late gastrulation. Discussion Despite decades of research, we have a poor understanding of the mechanisms, signals and gene regulatory networks that regulate mammalian NCC formation. In fact, to date, very few factors essential for mammalian NCC formation have been identified. Here, we demonstrate that NR6A1 is essential for NCC formation as a novel regulator of the transition of neural stem cells to NCC. Nr6a1 is dynamically expressed in the neural ectoderm and newly emigrating NCC, and NR6A1 loss-of-function results in a deficiency of anterior cranial NCC, and an absence of migrating NCC caudal to the first pharyngeal arch. This cellular phenotype occurs in association with the downregulated expression of NCC specifier ( Foxd3 , Sox9 , Sox10 ) and EMT ( Snai1 , Zeb2 ) genes, and the persistent expression of pluripotency and stem cell maintenance factors ( Sox2 , Oct4 , Nanog ). Analysis of NR6A1 binding to DR0 sites in the promoter regions of NCC-specifier and EMT genes and pluripotency associated genes, correlated with changes in chromatin accessibility, suggesting that NR6A1 directly regulates the activity of these factors. Thus, we propose that NR6A1 regulates murine NCC formation by repressing pluripotency and stem cell maintenance gene expression, while concomitantly inducing NCC specification and EMT genes, which collectively facilitates the transition of neural stem cells to neural crest cells. Our evaluation of Nr6a1 in NCC development through tissue-specific and temporally restricted excision allowed us to determine when Nr6a1 was precisely required to elicit its functions. Although Nr6a1 null mutant embryos exhibit clear defects in NCC development, conditional excision of Nr6a1, specifically in pre-migratory NCC using the gold standard Wnt1-Cre transgenic line, did not result in an observable phenotype. This was surprising, but it has been posited that Wnt1-Cre excision occurs too late to asses gene function during NCC specification and formation in mouse embryos (Barriga 2015). Our work provides some of the first evidence in accord with this idea, since global temporal deletion revealed that Nr6a1 is precisely required by E6.75 to replicate the original Nr6a1 null mutant phenotype. Interestingly, the onset of NCC specification was classically considered to occur during neurulation, after establishment of the three germ layers and subsequent subdivision of the ectoderm into neural ectoderm and non-neural ectoderm ( Selleck and Bronner-Fraser 1995 ). However, recent studies have suggested that NCC induction and specification begin earlier, during, or even preceding gastrulation ( Basch and Bronner-Fraser 2006 , Steventon, Araya et al. 2009 , Buitrago-Delgado, Nordin et al. 2015 , Betters, Charney et al. 2018 , Prasad, Charney et al. 2020 ). Similar to these studies in avian and frog embryos ( Basch and Bronner-Fraser 2006 , Steventon, Araya et al. 2009 ), our results imply that murine NCC specification also begins during mid-gastrulation. In support of this model and the temporal role of Nr6a1, itβs important to note that Nr6a1 has also been proposed to regulate the transition from primitive to definitive neural stem cells in the neural ectoderm during gastrulation ( Akamatsu, DeVeale et al. 2009 ). The ability of NR6A1 to act as a transcriptional repressor of pluripotency-associated factors and activator of NCC-specifiers, combined with the deficiency of NCC in Nr6a1 mutants, supports a model in which pluripotency and stem cell maintenance regulators must be downregulated for NCC formation. However, some recently published studies have argued that NCC either retain or re-acquire the expression of pluripotency-associated factors such as Oct4 and that this underpins their formation, multipotency and other properties ( Buitrago-Delgado, Nordin et al. 2015 , Lignell, Kerosuo et al. 2017 , Zalc, Sinha et al. 2021 , Hovland, Bhattacharya et al. 2022 , Patel and Parchem 2022 , Pajanoja, Hsin et al. 2023 ) . For instance, when Oct4 was knocked out in mouse embryos at E7.5 this resulted in a smaller frontonasal mass which was interpreted to mean that Oct4 is required for ectomesenchyme differentiation of NCC ( Zalc, Sinha et al. 2021 ). However, the expression of AP2 and Sox10 was not affected and changes in proliferation were not evaluated despite the global loss of Oct4. Itβs also important to note that conditional knockout of Oct4 in the epiblast during gastrulation affected EMT which could impact the generation of NCC (Mulas et al Nichols 2018). Our analyses of Nr6a1 null embryos challenge the reacquisition model and role for Oct4 in NCC specification and formation. We evaluated the expression of Oct4 during normal development using the Oct4-EGFP transgenic mouse line, which revealed that although Oct4 is strongly expressed in the epiblast at E7.5, it is downregulated by E8.5 coinciding with the specification and formation of NCC. Furthermore, Oct4 expression persists ectopically in the neural ectoderm of Nr6a1 -/- ;Oct4-EGFP embryos in concert with deficient NCC formation. Subsequent evaluation of pluripotency-associated gene and stem cell maintenance factor expression during NCC development through analyses of our own and publicly available scRNA-seq datasets, each revealed a similar downregulation of Oct4 and Nanog expression in concert with NCC formation. Notably, by utilizing both Wnt1-Cre and Mef2c-F10N-LacZ embryos in our scRNA-seq, we were able to finely cluster the NCC populations based on the expression of one or both markers (Zhao, Moore et al. 2024 ). Wnt1-Cre demarcates dorsal neural ectoderm, pre-migratory and migratory NCC, whereas Mef2c-F10N-LacZ demarcates only migratory NCC. ( Chai, Jiang et al. 2000 , Aoto, Sandell et al. 2015 ). Our scRNA-seq results matched those obtained in Xenopus where even when clustering with a bias towards re-activation of pluripotency, presumptive NCC do not express these factors ( Briggs, Weinreb et al. 2018 ). Collectively, this data argues against the need for the retention of pluripotency-associated factor expression for proper NCC development. To conclusively test the idea that downregulation of pluripotency-associated factor expression is required for NCC development, we overexpressed Oct4 in mouse embryos from E6.5-E8.5 coinciding with the specification and formation of NCC. This perturbed NCC formation, mimicking the Nr6a1 null mutant phenotype. Thus, persistent Oct4 expression inhibits NCC formation. However, although Oct4, Nanog and Sox2 comprise a core regulatory complex that maintains the pluripotency in various stem cells, itβs important to note that that simply overexpressing Sox2 in the neuroepithelium of avian embryos represses NCC formation ( Wakamatsu, Endo et al. 2004 , Remboutsika, Elkouris et al. 2011 ). Furthermore, neurospheres selected for high levels of Sox2 expression fail to generate NCC upon transplantation into the neuroepithelium of chicken embryos ( Remboutsika, Elkouris et al. 2011 ). Additionally, expressing Oct4 and Sox2 in late migratory NCC disrupts their differentiation ( Hovland, Bhattacharya et al. 2022 ). Collectively this corroborates the requirement to downregulate pluripotency-associated factors for proper NCC development, and our data indicates that Nr6a1 is a key regulator of this process. The duality of NR6A1 to both downregulate pluripotency-associated factors and activate NCC-specification and EMT genes suggest it functions as a bi-modal switch. However, future studies will be necessary to determine how exactly NR6A1 activates NCC-specification gene expression and whether it is truly direct. NR6A1 lacks the canonical activation function-2 (AF-2) domain which bestows activation activity to nuclear receptors in the superfamily ( Greschik and Schule 1998 , Hummelke and Cooney 2001 ). However, mutations in the H12 region of Nr6a1 , where the AF2 domain is typically located in other nuclear receptors, demonstrated the ligand binding domain remains capable of undergoing conformational changes consistent with switching between activator and repressor functions ( Greschik, Wurtz et al. 1999 , Hummelke and Cooney 2001 ). Identification of NR6A1βs ligand with subsequent assays to assess direct transcriptional upregulation will help elucidate whether NR6A1 is indeed a bi-modal switch capable of repression and activation like its most homologous nuclear receptor superfamily member, COUP-TF. Regardless of whether NR6A1 directly regulates NCC-specifier and EMT genes, we have rigorously demonstrated that NR6A1 is required for proper NCC specification and formation. Interestingly, although the expression of NCC-specification and EMT genes are largely absent in Nr6a1 null embryos, lineage tracing revealed that some Wnt1-Cre -positive cells delaminate and migrate into the facial prominences and first pharyngeal arch. These putative NCC cells, which are of undefined character, ultimately undergo cell death as evidenced by TUNEL staining, demonstrating that NR6A1 is required for NCC survival. How these cells remain capable of delamination without the expression of EMT master regulators Snai1 and Zeb2 remains a mystery. However, it should be noted that individual knockouts of Snai1 and Zeb2 and even compound Snai1/2 double knockouts in mice do not prevent NCC specification and delamination ( Van de Putte, Maruhashi et al. 2003 , Murray and Gridley 2006 , Van de Putte, Francis et al. 2007 ). In these scenarios, Snai1 and Zeb2 have been proposed to compensate for each other to justify the presence of delaminated NCC. However, in Nr6a1 null embryos, the expression of both of these factors is downregulated, and yet some putative NCC still delaminate from the neural ectoderm and migrate into the facial prominences and first pharyngeal arch. The expression of Twist1 in these cells indicates they are likely mesenchymal which could explain their migratory ability. However, Twist1 is not expressed by NCC in mouse embryos until after their delamination from the neural ectoderm, and consistent with this behavior, Twist1 loss-of-function does not affect NCC specification and delamination ( Gitelman 1997 , Tavares, Izpisuja-Belmonte et al. 2001 , Bildsoe, Loebel et al. 2009 ). Thus, Twist1 expression in Nr6a1 null mutants does not explain the ability of Wnt1-Cre;R26R-eYFP- positive cells to delaminate from the neural ectoderm. Interestingly, we recently discovered that a subpopulation of NCC can delaminate via a novel cell extrusion mechanism in parallel with canonical EMT (Moore, Zhao et al. 2024 ). This could explain the presence of delaminated migratory cells in Nr6a1 mutant embryos, however future experiments are needed to determine if this is indeed the case in addition to identifying specific markers of NCC extrusion. In summary, our work has demonstrated that pluripotency and stem cell maintenance factors need to be downregulated in association with the activation of NCC-specification and EMT genes, to facilitate the differentiation of neural stem cells to NCC. This transition in signaling is facilitated by NR6A1, which is required during mid-late gastrulation. Altogether, our findings have expanded our knowledge of the regulatory signals and mechanisms driving NCC formation as well as the timing of NCC specification in mammals, deepening our overall understanding of NCC development. Methods Animal husbandry and embryo collection All mice were housed in the Laboratory Animal Services Facility at the Stowers Institute for Medical Research under a 14 hour light/10 hour dark, light cycle, and experiments were performed according to IACUC animal welfare guidelines and approved protocol (#2022-014). Embryos were obtained by timed mating, with the morning of the vaginal plug defined as embryonic day (E)0.5 and genotyping of yolk sac tissue was performed as previously described ( Chung, Katz et al. 2001 , Lan, Xu et al. 2003 ). For temporal excision of Nr6a1 , pregnant dams were orally gavaged with 5 mg of Tamoxifen and 1 mg of progesterone dissolved in 100 Β΅L of corn oil. Treatment was performed one day prior to the desired stage of allele excision as it takes at least 24-hours for complete recombination to occur. To overexpress Oct4 , CD1 females were mated with Oct4/rtTA (Col1a1-tetO-Oct4;R26R-M2rtTA) transgenic males (Jax stock #006911). Transgene expression was induced from E6.5 until the desired stage by replacing drinking water of pregnant females with a 7.5% sucrose solution containing 0.5 mg/mL doxycycline. Embryos from non-treated mice of the same genotype were used as controls. In situ hybridization Following dissection, embryos were fixed in 4% paraformaldehyde overnight at 4Β°C. In situ hybridization was then performed with anti-sense digoxigenin-labeled mRNA riboprobes as previously described (Nagy 2003). Immunohistochemistry For section immunohistochemistry, Nr6a1 litters were collected at E9.0 and fixed overnight in 1% PFA at 4Β°C. Embryos were processed through a sucrose gradient, mounted in Tissue Tek OCT (VWR, West Chester, PA) and sectioned at 10 microns. Sections were rinsed 3 times with PBS 0.1% TritionX-100 (PBT) for 5 minutes and blocked in 10% goat serum (Invitrogen, Carlsbad, CA) in PBT for 1 hour at room temperature. Slides were incubated in primary antibody diluted in blocking solution at 4Β°Covernight. The monoclonal antibodies SOX2 (R & D Systems, Minneapolis, MN) and pHH3 (Upstate/Millipore, Billerica, MA) were both used at 1:500. The antibody to PAX3 was obtained from the Developmental Studies Hybridoma Bank (Iowa City, IA 52242). TUNEL staining (Roche Life Sciences) was performed according to the manufacturerβs instructions. Slides were rinsed 3 times for 10 minutes in PBT at room temperature on a shaker and incubated in the appropriate Alexa secondary antibody (Molecular probes/Invitrogen, Carlsbad, CA) at 1:250 for 2 hours at 4Β°C. Sections were counterstained with a 1:1000 dilution of 2mg/mL DAPI (Sigma, St. Louis, MO) in PBS for 5 minutes, followed by rinses in PBS before mounting slides with VectaShield (Vector Laboratories, Newark, CA). All images were collected using a Zeiss Axioplan microscope and processed using Photoshop CS2 (Adobe, San Jose, CA). Immunostaining of whole embryos and cultured cells was performed as previously described ( Barlow, Dixon et al. 2012 , Leung, Murdoch et al. 2016 ). The WTC-11 human induced pluripotent stem cell line, was obtained from the Coriell Institute (#GM25256). hiPSCs were plated in an iBidi 8-well plate (Ibidi #80826), and maintained as pluripotent stem cells or differentiated into neural crest cells. Cells were fixed in 4% PFA (Alfa Aesar via VWR Cat. No. AA43368-9M) for 15 minutes at room temperature and then permeabilized in PBS + 0.3% Tx-100 (Millipore Sigma, #TX1568, PBST) for 20 minutes at room temperature. Cells were blocked using PBST + 0.5% BSA (Millipore Sigma, #2910) for 1-2 hours at room temperature, and incubated in primary antibody in blocking buffer overnight at 4Β°C. The following primary antibodies were used: Oct4 (R&D Systems, #MAB1759 1:50), Nanog (R&D Systems, #1997 1:40), Sox10 (R&D Systems, #2864 1:100), and Tfap2a (Invitrogen, #3B5 1:50). The cells were washed 3 times for 5 minutes with PBST and 0.5% BSA(Millipore Sigma, #2910) before incubating in secondary antibody and blocking solution. The following secondary antibodies were used at a 1:500 dilution: Donkey anti-Rabbit IgG (H+L) Alexa Fluorβ’ 546 (ThermoFisher #A10040), Donkey anti-Goat IgG (H+L) Alexa Fluorβ’ 488 (ThermoFisher, #A11055), and Donkey anti-Mouse IgG (H+L) Alexa Fluorβ’ 546 (ThermoFisher, #10036) at room temperature for 1-2 hours. The cells were then washed 3 times for 5 minutes with PBST and 0.5% BSA, mounted in Vectashield in DAPI (Vector Labratories, #H-1200-10) and imaged. All images were individually acquired with the same settings, and brightness and contrast were adjusted the same throughout. Microarray E9.0 wild type embryos and Nr6a1 -/- embryos were isolated and total RNA was extracted from whole embryos using TRIzol reagent. Concentration and quality of RNA were determined by spectrophotometer and Agilent bioanalyzer analysis (Agilent Technologies, Inc., Palo Alto, CA). For array analysis, labeled mRNA targets were prepared with 150 ng total RNA using MessageAmp III RNA Amplification Kit (Applied Biosystems / Ambion, Austin, TX) according to the manufacturerβs specifications. Array analysis was performed using Affymetrix GeneChip Mouse Genome 430 2.0 Arrays processed with the GeneChip Fluidics Station 450 and scanned with a GeneChip Scanner 3000 7G using standard protocols. Resulting CEL files were analyzed using RMA and limma in the R statistical environment ( Chang, Manent et al. 2022 ). The microarray data is publicly available in the Gene Expression Omnibus using accession number GSE166458. Bulk RNA-sequencing E8.75 Nr6a1 -/- and wild type control littermates of between 9-11 somites were isolated and bisected into anterior (rostral to and including the first branchial arch) and posterior (caudal to and including the second branchial arch) samples. Total RNA was extracted from whole embryos using an RNA micro Kit. Concentration and quality of RNA was determined by bioanalyzer analysis. RNA-seq was run using single-end 50bp sequencing reads with Illumina HiSeq 4000. FASTQ files were aligned with STAR, and EdgeR was used for differential expression analysis between mutant and wild type ( Chang, Manent et al. 2022 ). The RNA-seq data is publicly available in the Gene Expression Omnibus using accession number GSE180427. Single-cell RNA sequencing Single-cell RNA sequencing of E8.5 Wnt1-Cre;R26R-eYFP and Mef2c-F10N-LacZ embryos, and subsequent bioinformatic analyses were performed as previously described ( Falcon, Watt et al. 2022 , Moore, Zhao et al. 2024 , Zhao, Moore et al. 2024 ) and the data set is publicly available at the Gene Expression Omnibus using accession number GSE168351. For single cell RNA sequencing gastrulation to neurulation time courses, the data was obtained and images generated from the interactive server: https://marionilab.cruk.cam.ac.uk/MouseGastrulation2018/ described in ( Pijuan-Sala, Griffiths et al. 2019 ). Multiomic single-cell RNA-sequencing and single-nucleotide ATAC-sequencing Nr6a1 -/- and wild type control littermates were collected at E8.75. 3-4 embryos were used per genotype across two litters. Nuclei was isolated with the 10X Genomics Nuclei Isolation kit. Following isolation, the quality of nuclei was assessed via bright field imaging and standard QC analysis. A total of 3,200-3,500 nuclei were captured per sample. Libraries were prepared and pooled such that the pooled gene expression and ATAC libraries could then be run on individual flow cells, resulting in 20,000 reads per nuclei for scRNA-seq and 25,000 reads per nuclei for snATAC-seq. Paired end sequencing was performed on an Illumina NextSeq 2000. Raw data was processed with 10X Cell Ranger and analysis was performed in R (v4.4.1) with Seurat (v5) ( Hao, Stuart et al. 2024 ). Data was filtered using standard QC methods: ATAC reads greater than 50,000 and less than 500 were filtered out along with RNA reads greater than 25,000 and less than 1,000. Cells with percent RNA mitochondria reads greater than 10% were filtered out. Finally, cells in which transcription start site enrichment was greater than 1 or nucleosome signal less than 2 were also filtered out. The final dataset analyzed following filtering and SCT normalization ( Choudhary and Satija 2022 ) included 2,987 mutant cells and 2,728 wild type cells. Clustering was performed on the wild type dataset at a resolution of 0.5 using the find nearest neighbor method. Mutant cells were merged with wild type cells and integrated with CCA Integration ( Butler, Hoffman et al. 2018 ) to compare clusters between the datasets. Annotations from the scRNA-seq clustering were used to annotate the snATAC-seq. Electrophoretic mobility shift assay (EMSA) and Competition Binding Assay We produced NR6A1 protein in vitro using the TNT translation system (Promega). Oligo DNA 5β β hydroxyl end labeled with (Ο- 32 P) ATP using T4 PNK system was used as a probe. EMSA experiments were performed at 30Β°Cfor 30 minutes in 10 Β΅L of EMSA buffer (10mM HEPES, pH 7.5; 50mM KCl; 1mM EDTA, 5mM MgCl 2 ; 2mM DTT; 10% Glycerol; Poly [dI-dC] 1Β΅g). For competition assays unlabeled wild type or mutated competitor DNA was added to the reaction at 5x, 10x or 50x concentrations relative to labelled probe. The total reactions were directly loaded onto a 5% acrylamide gel. Electrophoresis was carried out at 4Β°C for 100 minutes at 300V. The WT sequence for the competition assay was AGGTCA and the Mutant sequence was CTTGAC. Mouse stem cell to primitive neural crest cell differentiation KH2 cells were maintained on MEFs in KOSR media. Prior to initiating differentiation, the cells were adapted to feeder free conditions for 1 passage. For differentiation, 12,500 cells/cm 2 were plated on Matrigel (Sigma-Adlrich) coated plates. Base differentiation media consisted of DMEM/F12 with Glutamax:Neurobasal 1:1 media containing 1X Embryomax, 2-mercaptoethanol, 0.5X N2, 0.5X, B27, and 1X NEAA. bFGF (10ng/mL) (Stemcell technologies) and Heparin solution (0.0002%) (Stemcell technologies) were added to the media for the entirety of differentiation. After the first 4 days of differentiation, Bmp2 (10 ng/mL) was added to the culture until the cells were harvested. Human induced pluripotent stem cell to neural crest differentiation Undifferentiated hiPSCs were maintained and passaged on plates coated with hESC-qualified Matrigel (Corning #354277) in mTeSR1 (Stem Cell Technologies #85850) media supplemented with 1% penicillin/streptomycin (ThermoFisher, #15070063). Cells were passaged approximately every 3β5 days (70β85% confluency) using Accutase (Gibco, #11105β01) to detach cells. Cells were then plated in mTeSR1 + 1% P/S and 10 ΞΌM Rock Inhibitor (Y-27632, StemCell Technologies, #72308). For NCC differentiation, hiPSCs were detached with Accutase (Gibco, #11105β01) and resuspended in STEMdiff TM Neural Crest Differentiation media (StemCell Technologies, #08610). Cells were plated at 7,000 cells/cm 2 in STEMdiff TM Neural Crest Differentiation media supplemented with 1% penicillin/streptomycin (ThermoFisher, #15070063) and 10 ΞΌM Rock Inhibitor (Y-27632, StemCell Technologies, #72308) for the first 24 hrs. Media was changed every day. On day 8 of differentiation, cells were harvested for RNA extraction or fixed for immunostaining. Chromatin Immunoprecipitation ChIP experiments were performed as previously described ( Smith, Martin-Brown et al. 2010 ), using mouse KH2 stem cells that were differentiated into to NCC over 5 days These experiments were repeated 5 times for rigor, reproducibility and statistical analysis. Antibodies used were: NR6A1 (Proteintech Ca. No. 12712-1-AP) and IgG control (Proteintech Ca. No. 30000-0-AP). Snai1 promoter sequence: CAGCGCCCAAAGGTCAGCAGCTCGGGGATG; Snai2 promoter sequence: AAGCCAAGTCGCCGTAGGTCACCTAGCGGAA; Sox9 Exon 3 sequence: GTTCCGGCCACCCACGGCCAGGTCACCTACAC; Sox9 3β UTR sequence: GCTGTTCCCCGTGGAGGTCAGAGGGGAGAGGTA; Sox10 Exon 2 sequence: GTGAACTGGGCAAGGTCAAGAAGGAACAGCA; Zeb2 Intron 2 sequence: CTTGGCTCCAGCAGTGAGGTCAAGCCACAGCC; Zeb2 Intron 2 sequence 2: AGAGGTCATGTGAACCTCAGAGTCAGGCCCTCG. Quantitative PCR RNA was extracted from WTC-11 hiPSC or differentiated NCC using the Qiagen miRNeasy Micro Kit (Qiagen, #217084) with on-column DNase treatment (Qiagen, #79254). The Superscript III Kit (Invitrogen, 18080051) was used to synthesize cDNA for quantitative RT-PCR (qPCR) using random hexamer primers. qPCR was performed on ABI7000 (Thermo QuantStudio 7) using Perfecta Sybr Green (Quantbio # 95072-250). Primers are listed in Table 2.1. No template controls were run as negative controls. The ΞΞCt method was used to calculate fold change. Studentβs t-test and ANOVA were used for statistical analysis and significance was determined based on p < 0.05. View this table: View inline View popup Download powerpoint Imaging and image analysis Brightfield images of in situ hybridization stained embryos were captured as previously described (Zhao, Moore et al. 2024 ). In brief, images were taken on a Leica MZ16 microscope using a Nikon DS-Ri1 camera. Manual Z-stacks were acquired and then images were merged using Helicon Focus. Fluorescent images were taken on upright Zeiss LSM-700, inverted Zeiss LSM-800 equipped with a GaAsP detector and a Nikon CSU-W1 inverted spinning disk equipped with a sCMOS camera. Image analysis was performed using Fiji. Statistical analysis Results were expressed as a mean with error bars representing standard error of the mean (SEM). Statistical analysis was performed by Studentβs t-test, and p-values <0.05 were considered significant. Skeletal staining of Wnt1-conditional knockout E18.5 embryos were anesthetized by immersion in ice cold PBS for at least 60 minutes until no reflex movements were observed following a pinch test. The embryos were then fixed in 95% ethanol for 1 hour and dehydrated in fresh ethanol overnight at 4Β°C. The skin and viscera were manually removed, and the embryos were incubated in 70% ethanol/5% acetic acid for 30 minutes at room temperature, before staining overnight in alizarin red/alcian blue at room temperature as previously described ( Nagy, Gertsenstein et al. 2009 , Nagy, Gertsenstein et al. 2009 ). The embryos were then washed in 70% ethanol/5% acetic acid for 30 minutes and quickly rinsed in water. Soft tissue digestion was performed in 2% KOH overnight for at least 6 hours, followed by further digestion and clearing, initially in 0.25% KOH, and then through an increasing gradient of glycerol in 0.25% KOH before being stored in 50% glycerol. Funding Statement This work was supported by the Stowers Institute for Medical Research (PAT), a National Institute for Dental and Craniofacial Research F31 Ruth L. Kirschstein Predoctoral Individual National Research Service Award (DE032256; ELM), American Association for Anatomy Postdoctoral Scholar Awards (WAM and AA), and grants PID2020-115755GB-I00 and PID2023-151742NB-I00 (MCIN/AEI/10.13039/501100011033; MM). The Centro de BiologΓa Molecular is supported by an institutional grant from the FundaciΓ³n RamΓ³n Areces and is a Severo Ochoa Center of Excellence (grant CEX2021-001154-S, MICIN/AEI/10.13039/501100011033; MM). Conflicts of Interest Statement The authors declare they have no conflicts of interest. Download figure Open in new tab Supplemental Figure 1. N r 6a1 is required for NCC survival. TUNEL staining of Nr6a1 -/- ;Wnt1-Cre;R26R-mT/mG and Wnt1-Cre;R26R-mT/mG control littermates at E8.75 shows high amounts of cell death in the GFP labeled NCC population throughout the head. Therefore, the migratory NCC population in the null embryos do not survive and undergo cell death. Download figure Open in new tab Supplemental Figure 2. Annotation and integration of scRNA-seq acquired at E8.75-9.0 from Nr6a1 null and control littermate embryos. A. Clustering the control dataset at a resolution of 0.5 resulted in 19 distinct cell populations which were identified based on the expression of canonical marker genes. Notably, Oct4 and Nanog are minimally expressed in the embryo at these stages of development (red box). Neural ectoderm cells were identified by the high expression of Sox2 , Pax2 and Otx2 and low expression of other neural plate genes. Neural plate border cells were identified by the expression of Sox2 , Pax2 , Wnt1 , Pax3 , and Pax7 and low expression of NCC genes. NCC were identified by the high expression of NCC genes Pax3 , Pax7 , Foxd3 , Sox9 , Sox10 , Crabp1 , Snai1 and Zeb2 . Finally, the neural progenitors were identified based on expression of Sox2 , Pax6 and Olig2 . B. UMAP of the fully annotated control scRNA-seq dataset. C. UMAP of the Nr6a1 -/- (mutant, red) scRNA-seq dataset integrated with the control scRNA-seq dataset (blue). D. Zooming into view the NCC cluster, we can visualize the deficiency of NCC we have consistently observed in the Nr6a1 null. Download figure Open in new tab Supplemental Figure 3. UMAP of the snATAC-seq dataset using the cell population annotations from the scRNA-seq data. A. UMAP of the control littermate snATAC-seq dataset displaying the annotated cell populations identified from the scRNA-seq analysis. B. UMAP of the Nr6a1 -/- embryo snATAC-seq dataset integrated and overlaid with the control snATAC-seq dataset. Download figure Open in new tab Supplemental Figure 4. W n t1 -Cre excises Nr6a1 after it is required for NCC specification and formation. A-B. Brightfield images of Nr6a1 fl/fl and Nr6a1 fl/fl ;Wnt1-Cre;R26R-eYFP embryos at E18.5. No differences were observed in the craniofacial morphology. C-D. Alcian blue (cartilage) and alizarin red (bone) skeletal staining at E18.5 showed the craniofacial skeleton was normal, supporting our initial assessment of the craniofacial morphology. E-F. DAPI (blue) and neurofilament (TUJ1, green) immunostaining of E10.5. embryos indicated no overall changes in the peripheral nervous system. Cranial nerves are labeled with an arrowhead. G-H. DAPI (blue) and neurofilament (TUJ1, green) immunostaining of intestines isolated from E14. 5 showed no differences in the pattern of neurofilament formation between the conditional and wildtype embryos. The arrowhead indicates the distal tip of the colon. Download figure Open in new tab Supplemental Figure 5. NCC downregulate pluripotency-associated genes prior to undergoing EMT. scRNA-seq of cranial tissue from Wnt1-Cre;R26R-eYFP and Mef2c-F10N-LacZ embryos covering stages of NCC development. A. UMAP plot showing color coded cells annotated by defined cell type. A box outlines the NCC cluster. B-O. Expression levels of indicated gene, overlaid on the UMAP of all cell clusters. Oct4 and Nanog are not expressed in the NCC cluster. Wnt1 expression is restricted to the neural ectoderm while Pax3 is expressed in the neural ectoderm and early NCC populations. Foxd3, Sox9, Sox10 and Tfap2a are specifically expressed in the NCC cluster. Download figure Open in new tab Supplemental Figure 6. NCC progress through neural ectodermal fate prior to commitment. scRNA-seq data from gastrulation to neurulation stages of development in mouse ( Pijuan-Sala, Griffiths et al. 2019 ). A. UMAP plot showing color coded cells annotated by defined cell type. B. UMAP plot showing stage profiles color coded based on Theiler stage at time of collection. The box outlines the NCC population in both plots. C-P. Expression levels of indicated genes overlaid on the UMAP of all cell types. Oct4 and Nanog are absent from the NCC cluster where expression of NCC-specifiers Sox9 , Sox10 and Foxd3 are enriched. Download figure Open in new tab Supplemental Figure 7. Pluripotency-associated factors are immediately downregulated upon inducing the differentiation of stem cells into NCC. A-B. mESCs were induced to become NCC through the provision of FGF to culture media. Samples were collected prior to induction (mESCs) and 6 days of differentiation, when cells are differentiated and considered NC-like. A. RT-qPCR analyses of samples at mESC and Day6 stages for pluripotency ( Oct4, Nanog and Sox2) , NCC specification ( Tfap2a , Sox9 and Sox10 ) and EMT ( Snai1 , Slug and Twist1 ). Expression levels are normalized to mESC controls (day 0). At day 6, cells exhibit a downregulation of Oct4 and Nanog and an upregulation of NCC-specifier and EMT genes. In contrast, mESCs do not express the NCC-specifier and EMT factors. B. Immunostaining of OCT3/4, NANOG, SOX2, SOX9 and SOX10 on mESCs and at 6 days of differentiation. mESCs express OCT4, NANOG and SOX2, but after 6 days of differentiation, the NC-like cells do not express these factors. C-D. hiPSCs induced to NCC in a 8-day differentiation culture. C. RT-qPCR analyses of hiPSCs for pluripotency ( Oct4 , Nanog and Sox2 ), NCC differentiation ( Sox9 and Sox10 ), and Nr6a1 . Expression levels are normalized to hiPSC controls (day 0). Oct4 and Nanog are downregulated upon the provision of differentiation media and expression is lost by Day 3. Nr6a1 expression is highest during days 1-2, consistent with a function as a repressor of pluripotency and stem cell maintenance and with activating NCC specification and EMT. D. Immunostaining of OCT3/4, NANOG, SOX10 and TFAP2A in hiPSCs and at day 8 of NCC differentiation (NCC). OCT4 and NANOG are no longer expressed in the day 8 cells where NCC factors are expressed. Acknowledgements The authors thank past and present members of the Trainor lab and Manzanares lab for their thoughtful insights, constructive feedback and discussions during the progress of this work. We are extremely grateful to Melissa Childers, Marina Thexton and the Laboratory Animal Services Core for their care and maintenance of our mouse colonies, and we appreciate Kaitlyn Petentler, Allison Scott and the Sequencing Core for their molecular biology support. We especially thank Dr. Austin Cooney for providing the Nr6a1 +/ - and Nr6a1 fx/fx mice to establish our own lines. Nr6a1, Pax3 , Snai1 , Sox9 , Sox10 and Wnt1 riboprobe plasmids were generously provided by Dr. Austin Cooney, Dr. Takayoshi Inoue, Dr. Angela Nieto, Dr. Trevor Williams, Dr. Martin Gassmann and Dr. Antony Gavalas respectively. References β΅ Akamatsu , W. , B. DeVeale , H. Okano , A. J. Cooney and D. van der Kooy ( 2009 ). β Suppression of Oct4 by germ cell nuclear factor restricts pluripotency and promotes neural stem cell development in the early neural lineage .β J Neurosci 29 ( 7 ): 2113 β 2124 . OpenUrl Abstract / FREE Full Text β΅ Aoki , Y. , N. Saint-Germain , M. Gyda , E. Magner-Fink , Y. H. Lee , C. Credidio and J. P. Saint-Jeannet ( 2003 ). β Sox10 regulates the development of neural crest-derived melanocytes in Xenopus .β Dev Biol 259 ( 1 ): 19 β 33 . OpenUrl CrossRef PubMed Web of Science β΅ Aoto , K. , L. L. Sandell , N. E. Butler Tjaden , K. C. Yuen , K. E. Watt , B. L. Black , M. Durnin and P. A. Trainor ( 2015 ). β Mef2c-F10N enhancer driven beta-galactosidase (LacZ) and Cre recombinase mice facilitate analyses of gene function and lineage fate in neural crest cells .β Dev Biol 402 ( 1 ): 3 β 16 . OpenUrl CrossRef PubMed β΅ Avilion , A. A. , S. K. Nicolis , L. H. Pevny , L. Perez , N. Vivian and R. Lovell-Badge ( 2003 ). β Multipotent cell lineages in early mouse development depend on SOX2 function .β Genes Dev 17 ( 1 ): 126 β 140 . OpenUrl Abstract / FREE Full Text β΅ Aybar , M. J. , M. A. Nieto and R. Mayor ( 2003 ). β Snail precedes slug in the genetic cascade required for the specification and migration of the Xenopus neural crest .β Development 130 ( 3 ): 483 β 494 . OpenUrl Abstract / FREE Full Text β΅ Barlow , A. J. , J. Dixon , M. J. Dixon and P. A. Trainor ( 2012 ). β Balancing neural crest cell intrinsic processes with those of the microenvironment in Tcof1 haploinsufficient mice enables complete enteric nervous system formation .β Hum Mol Genet 21 ( 8 ): 1782 β 1793 . OpenUrl CrossRef PubMed Web of Science β΅ Barriga , E. H. , P. A. Trainor , M. Bronner and R. Mayor ( 2015 ). β Animal models for studying neural crest development: is the mouse different? β Development 142 ( 9 ): 1555 β 1560 . OpenUrl Abstract / FREE Full Text Barriga , E. H. T. , P. A. ; Bronner , M.; and Mayor , R. ( 2015 ). β Animal models for studying neural crest development: is the mouse different? β Development 142 ( 9 ): 1555 β 1560 . OpenUrl Abstract / FREE Full Text β΅ Basch , M. L. and M. Bronner-Fraser ( 2006 ). β Neural crest inducing signals .β Adv Exp Med Biol 589 : 24 β 31 . OpenUrl CrossRef PubMed β΅ Betters , E. , R. M. Charney and M. I. Garcia-Castro ( 2018 ). β Early specification and development of rabbit neural crest cells .β Dev Biol 444 Suppl 1 S181 β S192 . OpenUrl CrossRef PubMed β΅ Bildsoe , H. , D. A. Loebel , V. J. Jones , Y. T. Chen , R. R. Behringer and P. P. Tam ( 2009 ). β Requirement for Twist1 in frontonasal and skull vault development in the mouse embryo .β Dev Biol 331 ( 2 ): 176 β 188 . OpenUrl CrossRef PubMed Web of Science β΅ Bonstein , L. , S. Elias and D. Frank ( 1998 ). β Paraxial-fated mesoderm is required for neural crest induction in Xenopus embryos .β Dev Biol 193 ( 2 ): 156 β 168 . OpenUrl CrossRef PubMed Web of Science β΅ Briggs , J. A. , C. Weinreb , D. E. Wagner , S. Megason , L. Peshkin , M. W. Kirschner and A. M. Klein ( 2018 ). β The dynamics of gene expression in vertebrate embryogenesis at single-cell resolution .β Science 360 ( 6392 ). β΅ Buitrago-Delgado , E. , K. Nordin , A. Rao , L. Geary and C. LaBonne ( 2015 ). β NEURODEVELOPMENT. Shared regulatory programs suggest retention of blastula-stage potential in neural crest cells .β Science 348 ( 6241 ): 1332 β 1335 . OpenUrl Abstract / FREE Full Text β΅ Butler , A. , P. Hoffman , P. Smibert , E. Papalexi and R. Satija ( 2018 ). β Integrating single-cell transcriptomic data across different conditions, technologies, and species .β Nat Biotechnol 36 ( 5 ): 411 β 420 . OpenUrl CrossRef PubMed β΅ Carl , T. F. , C. Dufton , J. Hanken and M. W. Klymkowsky ( 1999 ). β Inhibition of neural crest migration in Xenopus using antisense slug RNA .β Dev Biol 213 ( 1 ): 101 β 115 . OpenUrl CrossRef PubMed Web of Science β΅ Chai , Y. , X. Jiang , Y. Ito , P. Bringas , Jr. , J. Han , D. H. Rowitch , P. Soriano , A. P. McMahon and H. M. Sucov ( 2000 ). β Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis .β Development 127 ( 8 ): 1671 β 1679 . OpenUrl Abstract β΅ Chang , Y. C. , J. Manent , J. Schroeder , S. F. L. Wong , G. M. Hauswirth , N. A. Shylo , E. L. Moore , A. Achilleos , V. Garside , J. M. Polo , P. Trainor and E. McGlinn ( 2022 ). β Nr6a1 controls Hox expression dynamics and is a master regulator of vertebrate trunk development .β Nat Commun 13 ( 1 ): 7766 . OpenUrl CrossRef PubMed β΅ Chen , F. , A. J. Cooney , Y. Wang , S. W. Law and B. W. OβMalley ( 1994 ). β Cloning of a novel orphan receptor (GCNF) expressed during germ cell development .β Mol Endocrinol 8 ( 10 ): 1434 β 1444 . OpenUrl CrossRef PubMed Web of Science β΅ Cheung , M. and J. Briscoe ( 2003 ). β Neural crest development is regulated by the transcription factor Sox9 .β Development 130 ( 23 ): 5681 β 5693 . OpenUrl Abstract / FREE Full Text β΅ Choudhary , S. and R. Satija ( 2022 ). β Comparison and evaluation of statistical error models for scRNA-seq .β Genome Biol 23 ( 1 ): 27 . OpenUrl CrossRef PubMed β΅ Chung , A. C. , D. Katz , F. A. Pereira , K. J. Jackson , F. J. DeMayo , A. J. Cooney and B. W. OβMalley ( 2001 ). β Loss of orphan receptor germ cell nuclear factor function results in ectopic development of the tail bud and a novel posterior truncation .β Mol Cell Biol 21 ( 2 ): 663 β 677 . OpenUrl Abstract / FREE Full Text β΅ Chung , A. C. , X. Xu , K. A. Niederreither and A. J. Cooney ( 2006 ). β Loss of orphan nuclear receptor GCNF function disrupts forebrain development and the establishment of the isthmic organizer .β Dev Biol 293 ( 1 ): 13 β 24 . OpenUrl CrossRef PubMed Web of Science β΅ Conway , S. J. , D. J. Henderson and A. J. Copp ( 1997 ). β Pax3 is required for cardiac neural crest migration in the mouse: evidence from the splotch (Sp2H) mutant .β Development 124 ( 2 ): 505 β 514 . OpenUrl Abstract β΅ Cooney , A. J. , G. C. Hummelke , T. Herman , F. Chen and K. J. Jackson ( 1998 ). β Germ cell nuclear factor is a response element-specific repressor of transcription .β Biochem Biophys Res Commun 245 ( 1 ): 94 β 100 . OpenUrl CrossRef PubMed Web of Science β΅ Dash , S. and P. A. Trainor ( 2020 ). β The development, patterning and evolution of neural crest cell differentiation into cartilage and bone .β Bone 137 : 115409 . OpenUrl CrossRef PubMed β΅ Dickinson , M. E. , M. A. Selleck , A. P. McMahon and M. Bronner-Fraser ( 1995 ). β Dorsalization of the neural tube by the non-neural ectoderm .β Development 121 ( 7 ): 2099 β 2106 . OpenUrl Abstract β΅ Dixon , J. , P. Trainor and M. J. Dixon ( 2007 ). β Treacher Collins syndrome .β Orthod Craniofac Res 10 ( 2 ): 88 β 95 . OpenUrl CrossRef PubMed Web of Science β΅ Dottori , M. , M. K. Gross , P. Labosky and M. Goulding ( 2001 ). β The winged-helix transcription factor Foxd3 suppresses interneuron differentiation and promotes neural crest cell fate .β Development 128 ( 21 ): 4127 β 4138 . OpenUrl Abstract / FREE Full Text β΅ Dudley , A. T. , K. M. Lyons and E. J. Robertson ( 1995 ). β A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye .β Genes Dev 9 ( 22 ): 2795 β 2807 . OpenUrl Abstract / FREE Full Text β΅ Ellis , P. , B. M. Fagan , S. T. Magness , S. Hutton , O. Taranova , S. Hayashi , A. McMahon , M. Rao and L. Pevny ( 2004 ). β SOX2, a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the embryo or the adult .β Dev Neurosci 26 ( 2-4 ): 148 β 165 . OpenUrl CrossRef PubMed Web of Science β΅ Ericson , J. , P. Rashbass , A. Schedl , S. Brenner-Morton , A. Kawakami , V. van Heyningen , T. M. Jessell and J. Briscoe ( 1997 ). β Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signaling .β Cell 90 ( 1 ): 169 β 180 . OpenUrl CrossRef PubMed Web of Science β΅ Falcon , K. T. , K. E. N. Watt , S. Dash , R. Zhao , D. Sakai , E. L. Moore , S. Fitriasari , M. Childers , M. E. Sardiu , S. Swanson , D. Tsuchiya , J. Unruh , G. Bugarinovic , L. Li , R. Shiang , A. Achilleos , J. Dixon , M. J. Dixon and P. A. Trainor ( 2022 ). β Dynamic regulation and requirement for ribosomal RNA transcription during mammalian development .β Proc Natl Acad Sci U S A 119 ( 31 ): e2116974119 . OpenUrl CrossRef PubMed Fuhrmann , G. , A. C. Chung , K. J. Jackson , G. Hummelke , A. Baniahmad , J. Sutter , I. Sylvester , H. R. Scholer and A. J. Cooney ( 2001 ). β Mouse germline restriction of Oct4 expression by germ cell nuclear factor .β Dev Cell 1 ( 3 ): 377 β 387 . OpenUrl CrossRef PubMed Web of Science β΅ Garcia-Castro , M. I. , C. Marcelle and M. Bronner-Fraser ( 2002 ). β Ectodermal Wnt function as a neural crest inducer .β Science 297 ( 5582 ): 848 β 851 . OpenUrl Abstract / FREE Full Text β΅ Gitelman , I . ( 1997 ). β Twist protein in mouse embryogenesis .β Dev Biol 189 ( 2 ): 205 β 214 . OpenUrl CrossRef PubMed Web of Science β΅ Goulding , M. D. , A. Lumsden and P. Gruss ( 1993 ). β Signals from the notochord and floor plate regulate the region-specific expression of two Pax genes in the developing spinal cord .β Development 117 ( 3 ): 1001 β 1016 . OpenUrl Abstract β΅ Graham , V. , J. Khudyakov , P. Ellis and L. Pevny ( 2003 ). β SOX2 functions to maintain neural progenitor identity .β Neuron 39 ( 5 ): 749 β 765 . OpenUrl CrossRef PubMed Web of Science β΅ Greschik , H. and R. Schule ( 1998 ). β Germ cell nuclear factor: an orphan receptor with unexpected properties .β J Mol Med (Berl ) 76 ( 12 ): 800 β 810 . OpenUrl CrossRef PubMed β΅ Greschik , H. , J. M. Wurtz , P. Hublitz , F. Kohler , D. Moras and R. Schule ( 1999 ). β Characterization of the DNA-binding and dimerization properties of the nuclear orphan receptor germ cell nuclear factor .β Mol Cell Biol 19 ( 1 ): 690 β 703 . OpenUrl Abstract / FREE Full Text β΅ Gu , P. , D. LeMenuet , A. C. Chung , M. Mancini , D. A. Wheeler and A. J. Cooney ( 2005 ). β Orphan nuclear receptor GCNF is required for the repression of pluripotency genes during retinoic acid-induced embryonic stem cell differentiation .β Mol Cell Biol 25 ( 19 ): 8507 β 8519 . OpenUrl Abstract / FREE Full Text β΅ Hao , Y. , T. Stuart , M. H. Kowalski , S. Choudhary , P. Hoffman , A. Hartman , A. Srivastava , G. Molla , S. Madad , C. Fernandez-Granda and R. Satija ( 2024 ). β Dictionary learning for integrative, multimodal and scalable single-cell analysis .β Nat Biotechnol 42 ( 2 ): 293 β 304 . OpenUrl CrossRef PubMed β΅ Hirose , T. , D. A. OβBrien and A. M. Jetten ( 1995 ). β RTR: a new member of the nuclear receptor superfamily that is highly expressed in murine testis .β Gene 152 ( 2 ): 247 β 251 . OpenUrl CrossRef PubMed Web of Science β΅ Hochedlinger , K. , Y. Yamada , C. Beard and R. Jaenisch ( 2005 ). β Ectopic expression of Oct-4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues .β Cell 121 ( 3 ): 465 β 477 . OpenUrl CrossRef PubMed Web of Science β΅ Hong , C. S. and J. P. Saint-Jeannet ( 2007 ). β The activity of Pax3 and Zic1 regulates three distinct cell fates at the neural plate border .β Mol Biol Cell 18 ( 6 ): 2192 β 2202 . OpenUrl Abstract / FREE Full Text Honore , S. M. , M. J. Aybar and R. Mayor ( 2003 ). β Sox10 is required for the early development of the prospective neural crest in Xenopus embryos .β Dev Biol 260 ( 1 ): 79 β 96 . OpenUrl CrossRef PubMed Web of Science β΅ Hovland , A. S. , D. Bhattacharya , A. P. Azambuja , D. Pramio , J. Copeland , M. Rothstein and M. Simoes-Costa ( 2022 ). β Pluripotency factors are repurposed to shape the epigenomic landscape of neural crest cells .β Dev Cell 57 ( 19 ): 2257 β 2272 e2255. OpenUrl CrossRef PubMed β΅ Hummelke , G. C. and A. J. Cooney ( 2001 ). β Germ cell nuclear factor is a transcriptional repressor essential for embryonic development .β Front Biosci 6 : D1186 β 1191 . OpenUrl CrossRef PubMed Web of Science β΅ Indra , A. K. , X. Warot , J. Brocard , J. M. Bornert , J. H. Xiao , P. Chambon and D. Metzger ( 1999 ). β Temporally-controlled site-specific mutagenesis in the basal layer of the epidermis: comparison of the recombinase activity of the tamoxifen-inducible Cre-ER(T) and Cre-ER(T2) recombinases .β Nucleic Acids Res 27 ( 22 ): 4324 β 4327 . OpenUrl CrossRef PubMed Web of Science β΅ Jones , N. C. , M. L. Lynn , K. Gaudenz , D. Sakai , K. Aoto , J. P. Rey , E. F. Glynn , L. Ellington , C. Du , J. Dixon , M. J. Dixon and P. A. Trainor ( 2008 ). β Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function .β Nat Med 14 ( 2 ): 125 β 133 . OpenUrl CrossRef PubMed β΅ Katz , D. , C. Niederberger , G. R. Slaughter and A. J. Cooney ( 1997 ). β Characterization of germ cell-specific expression of the orphan nuclear receptor, germ cell nuclear factor .β Endocrinology 138 ( 10 ): 4364 β 4372 . OpenUrl CrossRef PubMed Web of Science β΅ LaBonne , C. and M. Bronner-Fraser ( 1998 ). β Neural crest induction in Xenopus: evidence for a two-signal model .β Development 125 ( 13 ): 2403 β 2414 . OpenUrl Abstract β΅ LaBonne , C. and M. Bronner-Fraser ( 2000 ). β Snail-related transcriptional repressors are required in Xenopus for both the induction of the neural crest and its subsequent migration .β Dev Biol 221 ( 1 ): 195 β 205 . OpenUrl CrossRef PubMed Web of Science β΅ Lan , Z. J. , X. Xu , A. C. Chung and A. J. Cooney ( 2009 ). β Extra-germ cell expression of mouse nuclear receptor subfamily 6, group A, member 1 (NR6A1) .β Biol Reprod 80 ( 5 ): 905 β 912 . OpenUrl CrossRef PubMed β΅ Lan , Z. J. , X. Xu and A. J. Cooney ( 2003 ). β Generation of a germ cell nuclear factor conditional allele in mice .β Genesis 37 ( 4 ): 172 β 179 . OpenUrl CrossRef PubMed β΅ Lander , R. , T. Nasr , S. D. Ochoa , K. Nordin , M. S. Prasad and C. Labonne ( 2013 ). β Interactions between Twist and other core epithelial-mesenchymal transition factors are controlled by GSK3-mediated phosphorylation .β Nat Commun 4 : 1542 . OpenUrl CrossRef PubMed β΅ Le Douarin , N. M. and E. Dupin ( 2018 ). β The βbeginningsβ of the neural crest .β Dev Biol 444 Suppl 1 : S3 β S13 . OpenUrl CrossRef PubMed β΅ Lee , S. K. , B. Lee , E. C. Ruiz and S. L. Pfaff ( 2005 ). β Olig2 and Ngn2 function in opposition to modulate gene expression in motor neuron progenitor cells .β Genes Dev 19 ( 2 ): 282 β 294 . OpenUrl Abstract / FREE Full Text β΅ Lengner , C. J. , F. D. Camargo , K. Hochedlinger , G. G. Welstead , S. Zaidi , S. Gokhale , H. R. Scholer , A. Tomilin and R. Jaenisch ( 2007 ). β Oct4 expression is not required for mouse somatic stem cell self-renewal .β Cell Stem Cell 1 ( 4 ): 403 β 415 . OpenUrl CrossRef PubMed Web of Science β΅ Leung , A. W. , B. Murdoch , A. F. Salem , M. S. Prasad , G. A. Gomez and M. I. Garcia-Castro ( 2016 ). β WNT/beta-catenin signaling mediates human neural crest induction via a pre-neural border intermediate .β Development 143 ( 3 ): 398 β 410 . OpenUrl Abstract / FREE Full Text β΅ Liem , K. F. , Jr. , G. Tremml , H. Roelink and T. M. Jessell ( 1995 ). β Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm .β Cell 82 ( 6 ): 969 β 979 . OpenUrl CrossRef PubMed Web of Science β΅ Lignell , A. , L. Kerosuo , S. J. Streichan , L. Cai and M. E. Bronner ( 2017 ). β Identification of a neural crest stem cell niche by Spatial Genomic Analysis .β Nat Commun 8 ( 1 ): 1830 . OpenUrl CrossRef PubMed β΅ Luo , G. , C. Hofmann , A. L. Bronckers , M. Sohocki , A. Bradley and G. Karsenty ( 1995 ). β BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning .β Genes Dev 9 ( 22 ): 2808 β 2820 . OpenUrl Abstract / FREE Full Text β΅ Mancilla , A. and R. Mayor ( 1996 ). β Neural crest formation in Xenopus laevis: mechanisms of Xslug induction .β Dev Biol 177 ( 2 ): 580 β 589 . OpenUrl CrossRef PubMed Web of Science β΅ Mansouri , A. , A. Stoykova , M. Torres and P. Gruss ( 1996 ). β Dysgenesis of cephalic neural crest derivatives in Pax7-/- mutant mice .β Development 122 ( 3 ): 831 β 838 . OpenUrl Abstract β΅ Marchal , L. , G. Luxardi , V. Thome and L. Kodjabachian ( 2009 ). β BMP inhibition initiates neural induction via FGF signaling and Zic genes .β Proc Natl Acad Sci U S A 106 ( 41 ): 17437 β 17442 . OpenUrl Abstract / FREE Full Text β΅ Marchant , L. , C. Linker , P. Ruiz , N. Guerrero and R. Mayor ( 1998 ). β The inductive properties of mesoderm suggest that the neural crest cells are specified by a BMP gradient .β Dev Biol 198 ( 2 ): 319 β 329 . OpenUrl CrossRef PubMed Web of Science β΅ Martik , M. L. and M. E. Bronner ( 2017 ). β Regulatory Logic Underlying Diversification of the Neural Crest .β Trends Genet 33 ( 10 ): 715 β 727 . OpenUrl CrossRef PubMed β΅ Monsoro-Burq , A. H. , E. Wang and R. Harland ( 2005 ). β Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals during Xenopus neural crest induction .β Dev Cell 8 ( 2 ): 167 β 178 . OpenUrl CrossRef PubMed Web of Science β΅ Moore , E. , R. Zhao , M. C. McKinney , K. Yi , C. Wood and P. Trainor ( 2024 ). β Cell extrusion - a novel mechanism driving neural crest cell delamination .β bioRxiv . β΅ Mundell , N. A. and P. A. Labosky ( 2011 ). β Neural crest stem cell multipotency requires Foxd3 to maintain neural potential and repress mesenchymal fates .β Development 138 ( 4 ): 641 β 652 . OpenUrl Abstract / FREE Full Text β΅ Murray , S. A. and T. Gridley ( 2006 ). β Snail family genes are required for left-right asymmetry determination, but not neural crest formation, in mice .β Proc Natl Acad Sci U S A 103 ( 27 ): 10300 β 10304 . OpenUrl Abstract / FREE Full Text β΅ Nagy , A. , M. Gertsenstein , K. Vintersten and R. Behringer ( 2009 ). β Alcian blue staining of the mouse fetal cartilaginous skeleton .β Cold Spring Harb Protoc 2009 ( 3 ): pdb prot5169. OpenUrl Nagy , A. , M. Gertsenstein , K. Vintersten and R. Behringer ( 2009 ). β Alizarin red staining of post-natal bone in mouse .β Cold Spring Harb Protoc 2009 ( 3 ): pdb prot5171. OpenUrl Nagy , A. G. , M.; Vintersten , K. ; and Behringer , R. ( 2003 ). Techniques for Visualizing Gene Products, Cells, Tissues and Organ Systems. Manipulating the Mouse Embryo , Cold Spring Harbor Laboratory Press . β΅ Ng , L. J. , S. Wheatley , G. E. Muscat , J. Conway-Campbell , J. Bowles , E. Wright , D. M. Bell , P. P. Tam , K. S. Cheah and P. Koopman ( 1997 ). β SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse .β Dev Biol 183 ( 1 ): 108 β 121 . OpenUrl CrossRef PubMed Web of Science β΅ Nichols , J. , A. Smith and M. Buehr ( 1998 ). β Rat and mouse epiblasts differ in their capacity to generate extraembryonic endoderm .β Reprod Fertil Dev 10 ( 7-8 ): 517 β 525 . OpenUrl CrossRef PubMed β΅ Nieto , M. A. , M. G. Sargent , D. G. Wilkinson and J. Cooke ( 1994 ). β Control of cell behavior during vertebrate development by Slug, a zinc finger gene .β Science 264 ( 5160 ): 835 β 839 . OpenUrl Abstract / FREE Full Text β΅ Nitta , K. R. , K. Tanegashima , S. Takahashi and M. Asashima ( 2004 ). β XSIP1 is essential for early neural gene expression and neural differentiation by suppression of BMP signaling .β Dev Biol 275 ( 1 ): 258 β 267 . OpenUrl CrossRef PubMed Web of Science β΅ Noack Watt , K. E. A. Achilleos , C. L. Neben , A. E. Merrill and P. A. Trainor ( 2016 ). β The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome .β PLoS Genet 12 ( 7 ): e1006187 . OpenUrl CrossRef PubMed β΅ Pajanoja , C. , J. Hsin , B. Olinger , A. Schiffmacher , R. Yazejian , S. Abrams , A. Dapkunas , Z. Zainul , A. D. Doyle , D. Martin and L. Kerosuo ( 2023 ). β Maintenance of pluripotency-like signature in the entire ectoderm leads to neural crest stem cell potential .β Nat Commun 14 ( 1 ): 5941 . OpenUrl CrossRef PubMed β΅ Patel , I. and R. J. Parchem ( 2022 ). β Regulation of Oct4 in stem cells and neural crest cells .β Birth Defects Res 114 ( 16 ): 983 β 1002 . OpenUrl CrossRef PubMed β΅ Patthey , C. and L. Gunhaga ( 2014 ). β Signaling pathways regulating ectodermal cell fate choices .β Exp Cell Res 321 ( 1 ): 11 β 16 . OpenUrl CrossRef PubMed β΅ Pijuan-Sala , B. , J. A. Griffiths , C. Guibentif , T. W. Hiscock , W. Jawaid , F. J. Calero-Nieto , C. Mulas , X. Ibarra-Soria , R. C. V. Tyser , D. L. L. Ho , W. Reik , S. Srinivas , B. D. Simons , J. Nichols , J. C. Marioni and B. Gottgens ( 2019 ). β A single-cell molecular map of mouse gastrulation and early organogenesis .β Nature 566 ( 7745 ): 490 β 495 . OpenUrl CrossRef PubMed β΅ Prasad , M. S. , R. M. Charney and M. I. Garcia-Castro ( 2019 ). β Specification and formation of the neural crest: Perspectives on lineage segregation .β Genesis 57 ( 1 ): e23276 . OpenUrl CrossRef PubMed β΅ Prasad , M. S. , R. M. Charney , L. J. Patel and M. I. Garcia-Castro ( 2020 ). β Distinct molecular profile and restricted stem cell potential defines the prospective human cranial neural crest from embryonic stem cell state .β Stem Cell Res 49 : 102086 . OpenUrl CrossRef PubMed β΅ Remboutsika , E. , M. Elkouris , A. Iulianella , C. L. Andoniadou , M. Poulou , T. A. Mitsiadis , P. A. Trainor and R. Lovell-Badge ( 2011 ). β Flexibility of neural stem cells .β Front Physiol 2 : 16 . OpenUrl CrossRef PubMed β΅ Rogers , C. D. , C. S. Jayasena , S. Nie and M. E. Bronner ( 2012 ). β Neural crest specification: tissues, signals, and transcription factors .β Wiley Interdiscip Rev Dev Biol 1 ( 1 ): 52 β 68 . OpenUrl CrossRef PubMed β΅ Rogers , C. D. , A. Saxena and M. E. Bronner ( 2013 ). β Sip1 mediates an E-cadherin-to-N-cadherin switch during cranial neural crest EMT .β J Cell Biol 203 ( 5 ): 835 β 847 . OpenUrl Abstract / FREE Full Text β΅ Sakai , D. , J. Dixon , A. Achilleos , M. Dixon and P. A. Trainor ( 2016 ). β Prevention of Treacher Collins syndrome craniofacial anomalies in mouse models via maternal antioxidant supplementation .β Nat Commun 7 : 10328 . OpenUrl CrossRef PubMed β΅ Sato , T. , N. Sasai and Y. Sasai ( 2005 ). β Neural crest determination by co-activation of Pax3 and Zic1 genes in Xenopus ectoderm .β Development 132 ( 10 ): 2355 β 2363 . OpenUrl Abstract / FREE Full Text β΅ Sauka-Spengler , T. and M. Bronner-Fraser ( 2008 ). β A gene regulatory network orchestrates neural crest formation .β Nat Rev Mol Cell Biol 9 ( 7 ): 557 β 568 . OpenUrl CrossRef PubMed Web of Science β΅ Sefton , M. , S. Sanchez and M. A. Nieto ( 1998 ). β Conserved and divergent roles for members of the Snail family of transcription factors in the chick and mouse embryo .β Development 125 ( 16 ): 3111 β 3121 . OpenUrl Abstract β΅ Selleck , M. A. and M. Bronner-Fraser ( 1995 ). β Origins of the avian neural crest: the role of neural plate-epidermal interactions .β Development 121 ( 2 ): 525 β 538 . OpenUrl Abstract β΅ Selleck , M. A. , M. I. Garcia-Castro , K. B. Artinger and M. Bronner-Fraser ( 1998 ). β Effects of Shh and Noggin on neural crest formation demonstrate that BMP is required in the neural tube but not ectoderm .β Development 125 ( 24 ): 4919 β 4930 . OpenUrl Abstract β΅ Simoes-Costa , M. and M. E. Bronner ( 2015 ). β Establishing neural crest identity: a gene regulatory recipe .β Development 142 ( 2 ): 242 β 257 . OpenUrl Abstract / FREE Full Text β΅ Smith , K. T. , S. A. Martin-Brown , L. Florens , M. P. Washburn and J. L. Workman ( 2010 ). β Deacetylase inhibitors dissociate the histone-targeting ING2 subunit from the Sin3 complex .β Chem Biol 17 ( 1 ): 65 β 74 . OpenUrl CrossRef PubMed β΅ Solloway , M. J. and E. J. Robertson ( 1999 ). β Early embryonic lethality in Bmp5;Bmp7 double mutant mice suggests functional redundancy within the 60A subgroup .β Development 126 ( 8 ): 1753 β 1768 . OpenUrl Abstract β΅ Spokony , R. F. , Y. Aoki , N. Saint-Germain , E. Magner-Fink and J. P. Saint-Jeannet ( 2002 ). β The transcription factor Sox9 is required for cranial neural crest development in Xenopus .β Development 129 ( 2 ): 421 β 432 . OpenUrl CrossRef PubMed Web of Science β΅ Steventon , B. , C. Araya , C. Linker , S. Kuriyama and R. Mayor ( 2009 ). β Differential requirements of BMP and Wnt signalling during gastrulation and neurulation define two steps in neural crest induction .β Development 136 ( 5 ): 771 β 779 . OpenUrl Abstract / FREE Full Text β΅ Stuhlmiller , T. J. and M. I. Garcia-Castro ( 2012 ). β Current perspectives of the signaling pathways directing neural crest induction .β Cell Mol Life Sci 69 ( 22 ): 3715 β 3737 . OpenUrl CrossRef PubMed β΅ Sudiwala , S. , A. Palmer , V. Massa , A. J. Burns , L. P. E. Dunlevy , S. C. P. de Castro , D. Savery , K. Y. Leung , A. J. Copp and N. D. E. Greene ( 2019 ). β Cellular mechanisms underlying Pax3-related neural tube defects and their prevention by folic acid .β Dis Model Mech 12 ( 11 ). OpenUrl β΅ Suzuki , A. , N. Ueno and A. Hemmati-Brivanlou ( 1997 ). β Xenopus msx1 mediates epidermal induction and neural inhibition by BMP4 .β Development 124 ( 16 ): 3037 β 3044 . OpenUrl Abstract β΅ Tavares , A. T. , J. C. Izpisuja-Belmonte and J. Rodriguez-Leon ( 2001 ). β Developmental expression of chick twist and its regulation during limb patterning .β Int J Dev Biol 45 ( 5-6 ): 707 β 713 . OpenUrl CrossRef PubMed Web of Science β΅ Trainor , P. A . ( 2005 ). β Specification and patterning of neural crest cells during craniofacial development .β Brain Behav Evol 66 ( 4 ): 266 β 280 . OpenUrl CrossRef PubMed Trainor , P. A . ( 2005 ). β Specification of neural crest cell formation and migration in mouse embryos .β Semin Cell Dev Biol 16 ( 6 ): 683 β 693 . OpenUrl CrossRef PubMed Web of Science β΅ Trainor , P. A. , J. Dixon and M. J. Dixon ( 2009 ). β Treacher Collins syndrome: etiology, pathogenesis and prevention .β Eur J Hum Genet 17 ( 3 ): 275 β 283 . OpenUrl CrossRef PubMed β΅ Trainor , P. A. , D. Sobieszczuk , D. Wilkinson and R. Krumlauf ( 2002 ). β Signalling between the hindbrain and paraxial tissues dictates neural crest migration pathways .β Development 129 ( 2 ): 433 β 442 . OpenUrl CrossRef PubMed β΅ Van de Putte , T. , A. Francis , L. Nelles , L. A. van Grunsven and D. Huylebroeck ( 2007 ). β Neural crest-specific removal of Zfhx1b in mouse leads to a wide range of neurocristopathies reminiscent of Mowat-Wilson syndrome .β Hum Mol Genet 16 ( 12 ): 1423 β 1436 . OpenUrl CrossRef PubMed Web of Science β΅ Van de Putte , T. , M. Maruhashi , A. Francis , L. Nelles , H. Kondoh , D. Huylebroeck and Y. Higashi ( 2003 ). β Mice lacking ZFHX1B, the gene that codes for Smad-interacting protein-1, reveal a role for multiple neural crest cell defects in the etiology of Hirschsprung disease-mental retardation syndrome .β Am J Hum Genet 72 ( 2 ): 465 β 470 . OpenUrl CrossRef PubMed Web of Science β΅ Vega-Lopez , G. A. , S. Cerrizuela , C. Tribulo and M. J. Aybar ( 2018 ). βNeurocristopathies: New insights 150 years after the neural crest discovery .β Dev Biol 444 Suppl 1 : S110 β S143 . OpenUrl CrossRef PubMed β΅ Wakamatsu , Y. , Y. Endo , N. Osumi and J. A. Weston ( 2004 ). β Multiple roles of Sox2, an HMG-box transcription factor in avian neural crest development .β Dev Dyn 229 ( 1 ): 74 β 86 . OpenUrl CrossRef PubMed Web of Science β΅ Wang , J. , S. Rao , J. Chu , X. Shen , D. N. Levasseur , T. W. Theunissen and S. H. Orkin ( 2006 ). β A protein interaction network for pluripotency of embryonic stem cells .β Nature 444 ( 7117 ): 364 β 368 . OpenUrl CrossRef PubMed Web of Science β΅ Watt , K. E. N. , C. L. Neben , S. Hall , A. E. Merrill and P. A. Trainor ( 2018 ). β tp53-dependent and independent signaling underlies the pathogenesis and possible prevention of Acrofacial Dysostosis-Cincinnati type .β Hum Mol Genet 27 ( 15 ): 2628 β 2643 . OpenUrl CrossRef PubMed β΅ Watt , K. E. N. a. T. , P.A. ( 2014 ). Neurocristopathies: The Etiology and Pathogenesis of Disorders Arising from Defects in Neural Crest Cell Development . Neural Crest Cells , Academic Press : 361 β 394 . β΅ Wilson , S. I. , E. Graziano , R. Harland , T. M. Jessell and T. Edlund ( 2000 ). β An early requirement for FGF signalling in the acquisition of neural cell fate in the chick embryo .β Curr Biol 10 ( 8 ): 421 β 429 . OpenUrl CrossRef PubMed Web of Science β΅ Winnier , G. , M. Blessing , P. A. Labosky and B. L. Hogan ( 1995 ). β Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse .β Genes Dev 9 ( 17 ): 2105 β 2116 . OpenUrl Abstract / FREE Full Text β΅ Zalc , A. , R. Rattenbach , F. Aurade , B. Cadot and F. Relaix ( 2015 ). β Pax3 and Pax7 play essential safeguard functions against environmental stress-induced birth defects .β Dev Cell 33 ( 1 ): 56 β 66 . OpenUrl CrossRef PubMed β΅ Zalc , A. , R. Sinha , G. S. Gulati , D. J. Wesche , P. Daszczuk , T. Swigut , I. L. Weissman and J. Wysocka ( 2021 ). β Reactivation of the pluripotency program precedes formation of the cranial neural crest .β Science 371 ( 6529 ). β΅ Zhang , Y. L. , K. M. Akmal , J. K. Tsuruta , Q. Shang , T. Hirose , A. M. Jetten , K. H. Kim and D. A. OβBrien ( 1998 ). β Expression of germ cell nuclear factor (GCNF/RTR) during spermatogenesis .β Mol Reprod Dev 50 ( 1 ): 93 β 102 . OpenUrl CrossRef PubMed Web of Science β΅ Zhao , Q. , H. Eberspaecher , V. Lefebvre and B. De Crombrugghe ( 1997 ). β Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis .β Dev Dyn 209 ( 4 ): 377 β 386 . OpenUrl CrossRef PubMed Web of Science β΅ Zhao , R. , E. L. Moore , M. M. Gogol , J. R. Unruh , Z. Yu , A. Scott , Y. Wang , N. K. Rajendran and P. A. Trainor ( 2024 ). β Identification and characterization of intermediate states in mammalian neural crest cell epithelial to mesenchymal transition and delamination .β bioRxiv . Zhao , R. , E. L. Moore , M. M. Gogol , J. R. Unruh , Z. Yu , A. R. Scott , Y. Wang , N. K. Rajendran and P. A. Trainor ( 2024 ). β Identification and characterization of intermediate states in mammalian neural crest cell epithelial to mesenchymal transition and delamination .β Elife 13 . View the discussion thread. Back to top Previous Next Posted January 03, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following NR6A1 is essential for neural crest cell specification, formation and survival Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share NR6A1 is essential for neural crest cell specification, formation and survival Emma L. Moore Zajic , William A. MuΓ±oz , Jennifer F Dennis , Shachi Bhatt , Daisuke Sakai , Annita Achilleos , Ruonan Zhao , Maureen Lamb , Andrew J Price , Chris Seidel , MarΓa Tiana , Antonio Barral , Delaney Clawson , Miguel Manzanares , Paul A. Trainor bioRxiv 2025.01.02.630962; doi: https://doi.org/10.1101/2025.01.02.630962 Share This Article: Copy Citation Tools NR6A1 is essential for neural crest cell specification, formation and survival Emma L. Moore Zajic , William A. MuΓ±oz , Jennifer F Dennis , Shachi Bhatt , Daisuke Sakai , Annita Achilleos , Ruonan Zhao , Maureen Lamb , Andrew J Price , Chris Seidel , MarΓa Tiana , Antonio Barral , Delaney Clawson , Miguel Manzanares , Paul A. Trainor bioRxiv 2025.01.02.630962; doi: https://doi.org/10.1101/2025.01.02.630962 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7619) Biochemistry (17641) Bioengineering (13865) Bioinformatics (41860) Biophysics (21408) Cancer Biology (18545) Cell Biology (25434) Clinical Trials (138) Developmental Biology (13357) Ecology (19863) Epidemiology (2067) Evolutionary Biology (24288) Genetics (15587) Genomics (22466) Immunology (17701) Microbiology (40301) Molecular Biology (17142) Neuroscience (88441) Paleontology (666) Pathology (2825) Pharmacology and Toxicology (4814) Physiology (7633) Plant Biology (15108) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9811) Zoology (2268)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source β PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.