SarZ negatively regulates the lipase activity in Staphylococcus epidermidis

preprint OA: closed
Full text JSON View at publisher
Full text 121,586 characters · extracted from preprint-html · click to expand
SarZ negatively regulates the lipase activity in Staphylococcus epidermidis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article SarZ negatively regulates the lipase activity in Staphylococcus epidermidis Runan Tan, Nannan Zheng, Xiao Chen, Wenjun Xie, Wanyang Xu, Tao Zhu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7510667/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Mar, 2026 Read the published version in Archives of Microbiology → Version 1 posted 10 You are reading this latest preprint version Abstract S. epidermidis plays a crucial role in maintaining the skin immunity barrier. However, when host immunity is compromised, it can also lead to skin infections and bloodstream infections. Staphylococcal lipases contribute to bacterial growth, detoxification, and immune evasion, while their esterification capabilities also give them potential biotechnological applications. S. epidermidis secretes at least two lipases, GehC and GehD, which are indirectly regulated by the global regulators Agr and SarA. SarZ, a transcription factor of the SarA family, regulates the expression of various exoproteins, but its role in regulation of lipase synthesis remains unknown. A sarZ gene knockout strain of S epidermidis previously constructed was utilized in this study. First, lipase activity was found to be significantly elevated in the sarZ mutant relative to the wild-type strain, as determined by both the olive oil agar plate assay and the p-nitrophenol assay. Subsequently, qRT-PCR experiments revealed that SarZ controls the transcription of gehC and gehD divergently. Furthermore, EMSA experiments demonstrated that the recombinant SarZ protein can directly bind to the promoter regions of gehC and gehD . These findings demonstrate that SarZ negatively regulates lipase activity by directly modulating expression of lipase genes, providing a basis for further understanding the regulatory mechanism of lipase production in S. epidermidis . Staphylococcus epidermidis SarZ transcription factor lipase Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction The skin harbors a rich symbiotic microbial community, including bacteria and fungi, which play a crucial role in maintaining the skin's immune barrier function.[ 1 – 4 ]. Whether through traditional isolation and culture methods or metagenomic sequencing, S. epidermidis has been identified as one of the most prevalent species[ 5 , 6 ], Studies revealed that early colonization of S. epidermidis on the skin can foster immune tolerance to commensal microbiota through activation of regulatory T cells and mucosal-associated invariant T cells, while maintaining pathogen-specific immune responses, thereby facilitating the development and maturation of the skin immune system[ 7 ]. It can also enhance skin barrier homeostasis by secreting sphingomyelinase, which increases ceramide content on the skin and strengthens tight junctions between keratinocytes[ 8 ]. Additionally, studies have proven that it can accelerate skin wound healing by stimulating the secretion of type II cytokines and recruiting plasmacytoid dendritic cells, which produce type I interferon[ 9 , 10 ]. Interestingly, S. epidermidis even has an effect against skin neoplasia[ 11 ]. However, in addition to its role as a probiotic bacterium, S. epidermidis often leads a dual lifestyle as an opportunistic pathogen due to its strain diversity (more aggressive isolates) and encounters with immunocompromised hosts. Fluctuations in the levels of S. epidermidis colonization correlate with a variety of skin diseases, including atopic dermatitis[ 12 , 13 ], dandruff[ 14 , 15 ], seborrheic dermatitis[ 16 , 17 ] and rosacea[ 18 , 19 ]. Moreover, S. epidermidis is the leading pathogen responsible for implant-associated infections[ 20 ]. These infections often necessitate surgical removal of the implant as the feasible treatment, thereby posing an additional burden to healthcare systems[ 21 ]. S. epidermidis also causes 30%-40% of hospital-acquired bloodstream infections, most of which originate from catheter-related infections that subsequently disseminate into the bloodstream[ 22 ]. Bloodstream infection caused by S. epidermidis is also the primary cause of late-onset sepsis in preterm neonates[ 23 ]. Regardless of its role, S. epidermidis must colonize the skin first. Give that the skin is rich in lipids, primarily consisting of sebum-derived triglycerides[ 6 , 24 ], it is reasonable to infer that S. epidermidis is capable of producing lipase, which can liberate free fatty acids by hydrolyzing sebum to fulfill its nutritional requirement. Furthermore, lipases can be utilized by Staphylococcus to penetrate the hydrophobic barrier of sebum to settle into hair follicles[ 25 ]. It can also exert a detoxification function by catalyzing the esterification reaction between antibacterial fatty acids[ 26 ] and cholesterol[ 27 ]. Although the role of lipase in infection and dissemination remains incompletely elucidated, clinical study has revealed its participation in the pathogenicity of Staphylococcus . It has been disclosed that the lipase produced by Staphylococcus aureus can evade the recognition of the host's innate immune system and mitigate subsequent pro-inflammatory responses by hydrolyzing its own lipoprotein, a principal extracellular pathogen-associated molecular pattern[ 28 ]. Recent studies have shown that lipase can significantly decelerate the skin wound healing process in mice infected with S. aureus , which corroborates the aforementioned conclusion. Moreover, it has been demonstrated that some lipases also possess collagen-binding properties[ 29 ], which can facilitate persistent colonization on the surface of host skin and medical devices, thereby promoting biofilm formation in both S. epidermidis and S. aureus . S. epidermidis expresses at least two lipases, encoded by the gehC and gehD genes[ 30 ]. Lipase is highly conserved in Staphylococcus , with similar protein sequences that typically comprising three main parts: signal peptide (35 ~ 38 amino acids), pro-peptide (207 ~ 321 amino acids) and mature peptide (383 ~ 396 amino acids)[ 31 ]. The lipase precursor requires processing by the metalloprotease (aureolysin) prior to its secretion and conversion into a functionally mature form[ 32 ]. Currently, molecular mechanism underlying the regulation of lipase gene expression in Staphylococcus remains elusive. It was suggested that the expression of lipase was modulated by the global regulators Agr and SarA[ 33 , 34 ], and the mutant strains lacking Agr or SarA exhibited obvious defects in lipase activity. Further investigations have indicated that the regulation of Agr and SarA on lipase activity is achieved by regulating the expression of aureolysin and thus affecting the maturation of lipase, rather than directly impacting the transcription of lipase genes. The transcription factor SarZ, a member of the SarA protein family in Staphylococcus , has been reported to serves as a key regulator of tissue colonization and dissemination of infection[ 35 ]. In S. aureus , SarZ modulates the responses to oxidative stress[ 36 ] and regulates the expression of virulence factors[ 37 ], particularly exoproteins such as hemolysins and proteases. In S. epidermidis , it has been revealed that SarZ inhibits the expression of phenol-soluble modulins (PSMs) while enhancing protease secretion[ 38 ]. However, it remains unclear whether SarZ affects the expression of lipase genes. Therefore, based on the sarZ knockout mutant of S. epidermidis constructed in our laboratory, the present study further explored whether SarZ exerts a regulatory effect on the exoprotein-lipase via enzymatic activity and molecular biology experiments, providing a new perspective for in-depth comprehension of the symbiotic or pathogenic mechanism of S. epidermidis . Materials and Methods Bacterial strains and media S. epidermidis RP62A (WT) was preserved in our laboratory, and its derivative sarZ knockout strain ( ΔsarZ ), complementation strain (pCNcat- sarZ ) and empty vector strain (pCNcat) were generated by our laboratory previously. All strains were conventionally cultured in Tryptic Soy Broth (TSB) at 37°C with shaking at 220 rpm. Chloramphenicol was added to a final concentration of 10 µg·ml − 1 when necessary. The nucleotide sequence of the lip gene from S. epidermidis strain RP62A analyzed in this study is available under Ref-Seq genome accession number NC_002976.3 in the GenBank database at the National Center for Biotechnology Information (NCBI). The lipases gene can be located within the sequence using the annotated gene locus tag SERP2297, SERP2388, SERP0018. https://www.ncbi.nlm.nih.gov/nuccore/NC_002976.3 Olive oil agar plate assay The arabic gum solution was formulated as follows: 10% Arabic gum (w/v); 200 mM NaCl; and 50 mM CaCl 2 . The olive oil agar plate[ 39 ] was prepared according to the following composition: 10% arabic gum solution (v/v); 1% tryptone (w/v); 0.5% yeast extract (w/v); 0.5% NaCl (w/v); 1.5% agar (w/v); and 1% (v/v) olive oil. Olive oil and the other components in the medium should be autoclaved separately and then fully emulsified using a homogenizer. S. epidermidis RP62A and its sarZ mutant derivatives were spread onto olive oil agar plates and cultured at 37°C for 24 h to observe whether clear zones of hydrolysis were formed around the colonies. p-nitrophenol assay Single colonies of S. epidermidis RP62A and its sarZ mutant derivatives were inoculated respectively into SPM medium (3% tryptone; 1% yeast extract; 0.5% NaCl; 0.1% (v/v) tributyrin; 0.01% CaCl 2 ·2H 2 O)[ 40 ] for overnight culture. The overnight cultures were adjusted to an initial OD 600 of 0.1 in fresh SPM medium containing 4 µM CdCl 2 (for the induction of expression of sarZ gene in the complementation strain), and then incubated at 37°C with shaking at 220 rpm for 24 h. The bacterial cultures were centrifuged and the supernatants were collected as the crude enzyme extract. Lipase activity was quantified using p-nitrophenyl palmitate (pNPP) or p-nitrophenyl butyrate (pNPB) as substrate according to the procedure described by Gupta[ 41 ] with minor modifications. Briefly, 900 µl of 50 mM Tris-HCl buffer (pH 8.0) containing 0.5 mM PEG 8000 was pipetted into a 2 ml centrifuge tube, and then 100 µl of 6 mM pNPP / pNPB (prepared in isopropanol) was added and mixed thoroughly. Subsequently, 100 µl of crude enzyme extract was introduced to initiate the reaction. After incubation at 37°C for 5 minutes, the reaction was terminated by adding 100 µl of absolute ethanol. The reaction mixture was centrifuged, and the supernatant was collected for determination of absorbance at 410 nm. Enzyme activity was calculated based on the p-nitrophenol (pNP) standard curve. One unit of enzymatic activity (U) is defined as the amount of enzyme that liberate 1 µmol of p-nitrophenol (pNP) per minute. The experiment consisted of three independent biological replicates. RNA extraction and qRT-PCR The extraction of total RNA from S. epidermidis RP62A and its isogenic sarZ knockout mutant was carried out as previously described in our laboratory. Overnight cultures of S. epidermidis were diluted 1:100 in TSB medium and cultivated at 37°C with shaking at 220 rpm. Bacterial cells were harvested at the exponential (4 h) and stationary phases (10 h), respectively, and immediately stabilized through mixing with RNAprotect Bacteria Reagent (Qiagen, cat #76,506) at a 2:1 (v/v) ratio. Mechanical disruption of bacteria cells was performed using a Mini-Beadbeater (Biospec) at maximum speed, and subsequent total RNA was extracted using the RNeasy® Mini kit (Qiagen, cat#74,104) in accordance with the manufacturer's instructions. To eliminate DNA contamination, on-column DNase digestion was performed using the RNase-Free DNase Set (Qiagen, cat #79,254). The concentration and purity of the extracted RNA were assessed both quantitatively and qualitatively using a BioDrop spectrophotometer and 1% agarose gel electrophoresis, respectively. Two micrograms of total RNA were reversely transcribed into cDNA using GoScript™ Reverse Transcription kit (Promega, cat#A2800) following the manufacturer's instructions. Afterward, 5 µl of cDNA was employed to conduct the qRT-PCR reactions using FastStart Essential DNA Green Master (Roche, cat #06924204001). The qRT-PCR reactions were run on the LightCycler® 96 instrument under the following conditions: 95°C for 30 s; 95°C for 15 s; 60°C for 25 s; 45 cycles. The gyrB gene was used as the internal reference gene for normalization, and the relative expression of the target gene was calculated by the 2 −ΔΔct method. Specific primers were designed using the software Primer Premier 5.0 (Table. 1). Each experiment was conducted with three independent biological replicates. Electrophoretic mobility shift assay The promoter regions of gehC , gehD and serp0018 were amplified using 5'-biotin-labeled primers (Table. 1). And the biotin-labeled DNA fragments were incubated with the gradually increasing concentrations of recombinant SarZ protein in binding buffer (Shanghai Beyotime Biotech, cat#GS005). For competition reactions, unlabeled competitor fragments were pre-incubated with SarZ at 100-fold or 200-fold molar excess relative to the labeled probe. Following the binding reaction, protein-DNA complexes were resolved by electrophoresis on a 5% native polyacrylamide gel. Then the biotin-labeled DNA was transferred to the positively charged nylon membrane (Shanghai Beyotime Biotech, cat#FFN10). Subsequently, the membrane was UV-irradiated for 30 minutes to immobilize the DNA. Finally, Chemiluminescent EMSA Kit (Shanghai Beyotime Biotech, cat#GS009) was used for detection and analysis. The rpsJ (encoding 30S ribosomal protein S10) was used as a negative control for SarZ-DNA binding. The primers of gehC , gehD , serp0018 and rpsJ were synthesized by Shanghai Sangon Biotech. Table 1 Primers used in this study Primer name Sequence (5'→3') Product size (bp) Primers for qRT-PCR serp 0018 -F GTTAATGATCTGACAACGCAAGGTG 94 serp 0018 -R TCGCTGACCCTGTATAAGTAGTGTAG gehD -F TTCTGCCATAACGCTTGTGACC 104 gehD -R CAATTATGACCGTGCTGTTGAACTG gehC -F TTGTCGTCATCGTTCTTAGCAGTC 80 gehC -R GATAGCCAATCAACAGAAGAGGTAAAC gyrB -F CACCGTGAAGACCGCCAGATAC 99 gyrB -R AGATGGGACGCCCTGCTGTC Primers for EMSA P serp 0018 -F-biotin CGCATGCTACTTTTTTCATTTAATGATAC 291 P serp 0018 -R-biotin CAAAGAAATCACCTCTATAAGATTTTTCCC P gehD -F-biotin ATCACCTCTATAAGTTTTTTCCCCT 232 P gehD -R-biotin CATGCTTCTTCATCATGTGTAATGA P gehC -F-biotin GTCTTGTCTTCACAATTAGCACC 184 P gehC -R-biotin GATTATGGAAGCGTTTACCTTTGG P rpsJ -F-biotin GATTATGGAAGCGTTTACCTTTGG 119 P rpsJ -R-biotin AAGATTCTCGTGAACAATTC Statistical analysis Experimental data obtained were analyzed using GraphPad Prism 8. The data between the two groups were compared by t test, and the data above the two groups were analyzed by one-way analysis of variance (ANOVA). All data are expressed as means ± the SEM, and P < 0.05 indicates that the difference is statistically significant. Results and Discussion Inactivation of sarZ gene led to increased lipase activity in S. epidermidis Lipase plays an important role in bacterial growth and metabolism[ 42 ], colonization and adhesion[ 43 ], immune evasion[ 44 ] and dissemination of infection[ 45 , 46 ] in Staphylococcus . Moreover, lipase can address the global shortage of Influenza A virus vaccines by enhancing Influenza A Virus Replication[ 47 ], which contributes to resolution of a major public health concern. And it can catalyze esterification, transesterification and transesterification in non-aqueous media, possesses favorable adaptability to pH and temperature, thereby presenting broad application potential in many industrial fields[ 48 ]. Considering its biological significance and its increasing role played in the field of biotechnology, it is imperative to investigate the regulatory mechanism governing expression of staphylococcal lipase. Since SarZ has been proven to regulate the expression of exoproteins in Staphylococcus [ 49 ] to explore whether it can also impact the expression of lipase, the olive oil agar plate assay was employed to preliminarily detect changes in lipase activity between the sarZ knockout strain and its parent strain. As shown in Fig. 1 , the clear zone of hydrolysis surrounding the mutant strain on the olive oil agar plates was significantly larger than that of the wild-type strain, indicating that the lipase activity of the mutant strain was remarkably elevated. To further validate this observation, the lipase activity in the culture supernatants of S. epidermidis was determined by p-nitrophenol assay using pNPP (representing long-chain fatty acid esters) and pNPB (representing short-chain fatty acid esters) as the substrates, respectively. In the presence of lipase, p-nitrophenyl ester can be hydrolyzed to release yellow p-nitrophenol. The compound exhibits maximum absorption at a wavelength of 410 nm. Consequently, the lipase activity can be calculated based on variation in the absorption value. As depicted in Fig. 2 , whether pNPP (Fig. 2 a and 2 c) or pNPB (Fig. 2 b and 2 d) was used as the reaction substrate, the supernatants of the mutant strain showed remarkably higher lipase activity compared to that of the wild-type strain, whereas the lipase activity of the complementation strain was comparable to that of the wild strain. The introduction of empty vector had no effect on the lipase activity for the mutant strain, which further suggested that inactivation of SarZ could notably increase the lipase activity of S. epidermidis . To our knowledge, this is the first report demonstrating that SarZ can regulate the lipase activity in Staphylococcus , which enriches the understanding of the regulatory mechanism underlying lipase expression in Staphylococcus . SarZ regulates the transcription of gehC and gehD genes in S. epidermidis To elucidate whether the regulation of lipase activity by SarZ is achieved through the regulation of lipase genes expression, qRT-PCR was performed to compare the transcription levels of lipase genes between the mutant strain and the wild-type strain. Three lipase genes, namely two known genes ( gehC and gehD ) [ 50 ]and one putative gene ( serp0018 )[ 51 ] were chosen for measurement during both the exponential and stationary phases. As illustrated in Fig. 3 a-c, during the exponential phase, the transcription levels of gehC and serp0018 in the mutant strain were 23-fold and 3.75-fold higher respectively, than those in the wild-type strain, Conversely, the transcription of gehD was downregulated by 2.5-fold. When the bacteria entered the stationary phase, as shown in Fig. 3 d-e, the transcription levels of gehC and serp0018 in the mutant strain remained higher than those in the wild-type strain, with up-regulation of 35-fold and 4-fold, respectively. In contrast, the transcription level of gehD in the mutant strain was almost equivalent to that in the wild-type strain. This finding is consistent with a prior transcriptional analysis of a sarZ insertion mutant in S. epidermidis strain 1457 using gene microarrays[ 51 ]. These observations imply that SarZ modulates lipase activity through transcriptional regulation of lipase gene expression. Specifically, it represses the transcription of gehC and serp0018 and activate the transcription of gehD. The gehC gene (SERP2297) is composed of 2067 nucleotides, encoding a lipase precursor protein with a molecular weight of about 77-kDa, which is converted into a 43-kDa[ 52 , 53 ] mature lipase after processing. Biochemical characterization of the lipase revealed that the optimal pH for the enzyme is 6, and it exhibits high stability under low pH conditions. Its activity depends on the presence of calcium ions and prefers to decompose short-chain fatty acid esters[ 54 ]. The gehD gene (SERP2388) consists of 1932 nucleotides and encodes a lipase precursor with a molecular weight of approximately 72.2-kDa. Unlike GehC, GehD exhibits broader substrate specificity and is capable of hydrolyzing both long-chain and short-chain fatty acid esters, with a marked preference for long-chain substrates[ 55 ]. Although they display 52% amino acid identity in their mature parts, phylogenetic analysis indicated that they occupy distinct branches within the staphylococcal lipase family. GehC is evolutionarily closer to GehA[ 56 ] from S. aureus , whereas GehD exhibits a higher homology with GehB [ 25 ] in S. aureus . It is noteworthy that the divergent regulation of lipase gene expression by SarZ contradicts the overall negative effect of SarZ on lipase activity observed in our experiments. We propose that this discrepancy may be attributed to GehC functioning as the primary lipase in S. epidermidis , with its transcription being subject to the most pronounced regulation by SarZ. This speculation is further supported by qRT-PCR analysis, indicating higher mRNA abundance of gehC compared to gehD , as well as lipase activity assays demonstrating significantly stronger hydrolysis of short-chain fatty acid esters than of long-chain substrates by the culture supernatants of S. epidermidis . Nonetheless, the physiological significance of SarZ-mediated upregulation of gehD transcription during the exponential phase remains to be clarified. The serp0018 gene (SERP0018) comprises 2046 nucleotides and encodes a putative lipase with a molecular weight of approximately 76-kDa. Therefore, the significant increase in lipase activity observed in the sarZ mutant strain may also be ascribed to the enhanced transcription of the serp0018 gene. SarZ can directly bind to the promoter region of the lipase genes. The SarZ protein possesses DNA-binding activity. In S. aureus , it can directly bind to the promoters of the hla and hlb genes, thereby modulating the expression of α-hemolysin and β-hemolysin[ 37 ]. This let us speculated that SarZ might directly regulate the expression of lipase genes through its role as a transcription factor in S. epidermidis . Therefore, EMSA experiment was conducted to clarify whether SarZ directly regulates the expression of lipase genes. Recombinant His-tagged SarZ protein was incubated with biotin-labeled promoter fragments of the lipase genes, followed by non-denaturing gel electrophoresis. As shown in Fig. 4 , the promoter fragments of gehC, gehD and serp0018 each formed DNA-protein complexes with SarZ in a dose-dependent manner. The mobility of these complexes was significantly reduced compared to that of the free DNA probes without bound protein, and a clear band shift was observed. (Fig. 4 a-c, lane 2 to lane 4). The addition of a 200-fold excess of the same unlabeled DNA fragment as a competitive probe completely blocked the formation of a complex between the labeled probe and the SarZ protein (Fig. 4 a-c, lane 6). As a negative control, the DNA fragment containing the rpsJ gene promoter did not form a complex with SarZ under the same conditions (Fig. 4 d), indicating that SarZ could specifically bind to the promoter region of the lipase gene. Conclusion In conclusion, SarZ modulates the lipase activity of S. epidermidis by affecting the transcription of lipase genes as a transcription factor. It suppresses the expression of gehC and serp0018 genes while promoting the expression of gehD gene by directly binding to their promoter regions. These findings provide a theoretical foundation for the future development of new antibacterial drugs and the industrial application of staphylococcal lipase. Statements and Declarations Funding This work was supported by the Key Program of Educational Commission of Anhui Province (2023AH051737, KJ2020A0602), the Support Program for University Outstanding Youth Talent of Anhui Province (gxyq2019043), and Fudan University (FDMV-2020005). Competing Interests The authors declare that they have no competing interests. Author Contributions Tao Zhu and Runan Tan were responsible for the conception and design of the study. Nannan Zheng conducted the olive oil agar plate assay. Xiao Chen constructed SarZ protein expression strain, Wenjun Xie and Wanyang Xu carried out the qRT-PCR experiments. Runan Tan performed EMSA experiment. Tao Zhu and Runan Tan carried out the analysis and interpretation of data. Runan Tan and Tao Zhu wrote the manuscript. All authors read and approved the final manuscript. Data Availability The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. Ethics approval This article did not contain any studies with animals performed by any of the authors. References Byrd AL, Belkaid Y, Segre JA (2018) The human skin microbiome. Nat Rev Microbiol 16(3):143–155. https://doi.org/10.1038/nrmicro.2017.157 Lee HJ, Kim M (2022) Skin Barrier Function and the Microbiome. Int J Mol Sci 23(21):13071. https://doi.org/10.3390/ijms232113071 Chen YE, Fischbach MA, Belkaid Y (2018) Skin microbiota-host interactions. Nature 553(7689):427–436. https://doi.org/10.1038/nature25177 Harris-Tryon TA, Grice EA (2022) Microbiota and maintenance of skin barrier function. Science 376(6596):940–945. https://doi.org/10.1126/science.abo0693 Staphylococcus epidermidis pan-genome sequence analysis reveals diversity of skin commensal and hospital infection-associated isolates | Genome Biology. Accessed August 30 (2025) https://link.springer.com/article/ 10.1186/gb-2012-13-7-r64 Grice EA, Segre JA (2011) The skin microbiome. Nat Rev Microbiol 9(4):244–253. https://doi.org/10.1038/nrmicro2537 Laborel-Préneron E, Bianchi P, Boralevi F et al (2015) Effects of the Staphylococcus aureus and Staphylococcus epidermidis Secretomes Isolated from the Skin Microbiota of Atopic Children on CD4 + T Cell Activation. PLoS ONE 10(10):e0141067. https://doi.org/10.1371/journal.pone.0141067 Zheng Y, Hunt RL, Villaruz AE et al (2022) Commensal Staphylococcus epidermidis contributes to skin barrier homeostasis by generating protective ceramides. Cell Host Microbe 30(3):301–313e9. https://doi.org/10.1016/j.chom.2022.01.004 Severn MM, Horswill AR (2023) Staphylococcus epidermidis and its dual lifestyle in skin health and infection. Nat Rev Microbiol 21(2):97–111. https://doi.org/10.1038/s41579-022-00780-3 Fukuda K, Ito Y, Amagai M (2025) Barrier Integrity and Immunity: Exploring the Cutaneous Front Line in Health and Disease. Annual Review of Immunology. 43(Volume 43, 2025):219–252. https://doi.org/10.1146/annurev-immunol-082323-030832 Nakatsuji T, Chen TH, Butcher AM et al (2018) A commensal strain of staphylococcus epidermidis protects against skin neoplasia. Sci Adv 4(2):eaao4502. https://doi.org/10.1126/sciadv.aao4502 Byrd AL, Deming C, Cassidy SKB et al (2017) Staphylococcus aureus and Staphylococcus epidermidis strain diversity underlying pediatric atopic dermatitis. Sci Transl Med 9(397):eaal4651. https://doi.org/10.1126/scitranslmed.aal4651 Cau L, Williams MR, Butcher AM et al (2021) Staphylococcus epidermidis protease EcpA can be a deleterious component of the skin microbiome in atopic dermatitis. J Allergy Clin Immunol 147(3):955–966e16. https://doi.org/10.1016/j.jaci.2020.06.024 Saxena R, Mittal P, Clavaud C et al (2018) Comparison of Healthy and Dandruff Scalp Microbiome Reveals the Role of Commensals in Scalp Health. Front Cell Infect Microbiol 8:346. https://doi.org/10.3389/fcimb.2018.00346 Saxena R, Mittal P, Clavaud C et al (2018) Comparison of Healthy and Dandruff Scalp Microbiome Reveals the Role of Commensals in Scalp Health. Front Cell Infect Microbiol 8. https://doi.org/10.3389/fcimb.2018.00346 Sanders MGH, Nijsten T, Verlouw J, Kraaij R, Pardo LM (2021) Composition of cutaneous bacterial microbiome in seborrheic dermatitis patients: A cross-sectional study. PLoS ONE 16(5):e0251136. https://doi.org/10.1371/journal.pone.0251136 High Staphylococcus epidermidis Colonization and Impaired Permeability Barrier in Facial Seborrheic Dermatitis | Chinese Medical Journal. Accessed August 30 (2025) https://mednexus.org/doi/full/10.4103/0366-6999.209895 Woo YR, Lee SH, Cho SH, Lee JD, Kim HS (2020) Characterization and Analysis of the Skin Microbiota in Rosacea: Impact of Systemic Antibiotics. J Clin Med 9(1):185. https://doi.org/10.3390/jcm9010185 Whitfeld M, Gunasingam N, Leow LJ, Shirato K, Preda V (2011) Staphylococcus epidermidis: A possible role in the pustules of rosacea. J Am Acad Dermatol 64(1):49–52. https://doi.org/10.1016/j.jaad.2009.12.036 Oliveira WF, Silva PMS, Silva RCS et al (2018) Staphylococcus aureus and Staphylococcus epidermidis infections on implants. J Hosp Infect 98(2):111–117. https://doi.org/10.1016/j.jhin.2017.11.008 McCann MT, Gilmore BF, Gorman SP (2008) Staphylococcus epidermidis device-related infections: pathogenesis and clinical management. J Pharm Pharmacol 60(12):1551–1571. https://doi.org/10.1211/jpp.60.12.0001 Siciliano V, Passerotto RA, Chiuchiarelli M, Leanza GM, Ojetti V (2023) Difficult-to-Treat Pathogens: A Review on the Management of Multidrug-Resistant Staphylococcus epidermidis. Life (Basel) 13(5):1126. https://doi.org/10.3390/life13051126 Dong Y, Speer CP, Glaser K (2018) Beyond sepsis: Staphylococcus epidermidis is an underestimated but significant contributor to neonatal morbidity. Virulence 9(1):621–633. https://doi.org/10.1080/21505594.2017.1419117 Kengmo Tchoupa A, Kretschmer D, Schittek B, Peschel A (2023) The epidermal lipid barrier in microbiome–skin interaction. Trends Microbiol 31(7):723–734. https://doi.org/10.1016/j.tim.2023.01.009 Nakamura K, Williams MR, Kwiecinski JM, Horswill AR, Gallo RL (2021) Staphylococcus aureus Enters Hair Follicles Using Triacylglycerol Lipases Preserved through the Genus Staphylococcus. J Invest Dermatol 141(8):2094–2097. https://doi.org/10.1016/j.jid.2021.02.009 Palmitoleic acid isomer (C16:1∆6) in human skin sebum is effective against gram-positive bacteria | skin pharmacology and physiology karger publishers. Accessed August 30 (2025) https://karger.com/spp/article-abstract/16/3/176/383503/Palmitoleic-Acid-Isomer-C16-1-6-in-Human-Skin Kengmo Tchoupa A, Elsherbini AMA, Camus J et al (2024) Lipase-mediated detoxification of host-derived antimicrobial fatty acids by Staphylococcus aureus. Commun Biol 7(1):572. https://doi.org/10.1038/s42003-024-06278-3 Chen X, Alonzo F (2019) Bacterial lipolysis of immune-activating ligands promotes evasion of innate defenses. Proc Natl Acad Sci U S A 116(9):3764–3773. https://doi.org/10.1073/pnas.1817248116 Bowden MG, Visai L, Longshaw CM, Holland KT, Speziale P, Hook M (2002) Is the GehD lipase from Staphylococcus epidermidis a collagen binding adhesin? J Biol Chem 277(45):43017–43023. https://doi.org/10.1074/jbc.M207921200 Götz F, Verheij HM, Rosenstein R (1998) Staphylococcal lipases: Molecular characterisation, secretion, and processing. Chem Phys Lipids 93(1):15–25. https://doi.org/10.1016/S0009-3084(98)00025-5 Rosenstein R, Götz F (2000) Staphylococcal lipases: biochemical and molecular characterization. Biochimie 82(11):1005–1014. https://doi.org/10.1016/s0300-9084(00)01180-9 Cadieux B, Vijayakumaran V, Bernards MA, McGavin MJ, Heinrichs DE (2014) Role of lipase from community-associated methicillin-resistant Staphylococcus aureus strain USA300 in hydrolyzing triglycerides into growth-inhibitory free fatty acids. J Bacteriol 196(23):4044–4056. https://doi.org/10.1128/JB.02044-14 Blevins JS, Beenken KE, Elasri MO, Hurlburt BK, Smeltzer MS (2002) Strain-dependent differences in the regulatory roles of sarA and agr in Staphylococcus aureus. Infect Immun 70(2):470–480. https://doi.org/10.1128/IAI.70.2.470-480.2002 Construction (2025) and characterization of anagr deletion mutant of staphylococcus epidermidis infection and immunity. Accessed August 31. https://journals.asm.org/doi/full/ 10.1128/iai.68.3.1048-1053.2000 Tamber S, Cheung AL (2009) SarZ promotes the expression of virulence factors and represses biofilm formation by modulating SarA and agr in Staphylococcus aureus. Infect Immun 77(1):419–428. https://doi.org/10.1128/IAI.00859-08 Chen PR, Nishida S, Poor CB et al (2009) A new oxidative sensing and regulation pathway mediated by the MgrA homologue SarZ in Staphylococcus aureus. Mol Microbiol 71(1):198–211. https://doi.org/10.1111/j.1365-2958.2008.06518.x Kaito C, Morishita D, Matsumoto Y, Kurokawa K, Sekimizu K (2006) Novel DNA binding protein SarZ contributes to virulence in Staphylococcus aureus. Mol Microbiol 62(6):1601–1617. https://doi.org/10.1111/j.1365-2958.2006.05480.x Chen X, Sun H, Wang W, Wang H, Tan R, Zhu T (2024) SarZ inhibits the hemolytic activity through regulation of phenol soluble modulins in Staphylococcus epidermidis. Front Cell Infect Microbiol 14:1476287. https://doi.org/10.3389/fcimb.2024.1476287 Kouker G, Jaeger KE (1987) Specific and sensitive plate assay for bacterial lipases. Appl Environ Microbiol 53(1):211–213. https://doi.org/10.1128/aem.53.1.211-213.1987 Xie W, Khosasih V, Suwanto A, Kim HK (2012) Characterization of lipases from Staphylococcus aureus and Staphylococcus epidermidis isolated from human facial sebaceous skin. J Microbiol Biotechnol 22(1):84–91. https://doi.org/10.4014/jmb.1107.07060 Gupta N, Rathi P, Gupta R (2002) Simplified para-nitrophenyl palmitate assay for lipases and esterases. Anal Biochem 311(1):98–99. https://doi.org/10.1016/s0003-2697(02)00379-2 Delekta PC, Shook JC, Lydic TA, Mulks MH, Hammer ND (2018) Staphylococcus aureus Utilizes Host-Derived Lipoprotein Particles as Sources of Fatty Acids. J Bacteriol 200(11):e00728–e00717. https://doi.org/10.1128/JB.00728-17 Nguyen MT, Luqman A, Bitschar K et al (2018) Staphylococcal (phospho)lipases promote biofilm formation and host cell invasion. Int J Med Microbiol 308(6):653–663. https://doi.org/10.1016/j.ijmm.2017.11.013 Rollof J, Braconier JH, Söderström C, Nilsson-Ehle P (1988) Interference of Staphylococcus aureus lipase with human granulocyte function. Eur J Clin Microbiol Infect Dis 7(4):505–510. https://doi.org/10.1007/BF01962601 Hu C, Xiong N, Zhang Y, Rayner S, Chen S (2012) Functional characterization of lipase in the pathogenesis of Staphylococcus aureus. Biochem Biophys Res Commun 419(4):617–620. https://doi.org/10.1016/j.bbrc.2012.02.057 Rollof J, Hedström SA, Nilsson-Ehle P (1987) Lipolytic activity of staphylococcus aureus strains from disseminated and localized infections. Acta Pathol Microbiol Immunol Scand B 95(2):109–113. https://doi.org/10.1111/j.1699-0463.1987.tb03096.x Goncheva MI, Conceicao C, Tuffs SW et al (2020) Staphylococcus aureus lipase 1 enhances influenza a virus replication. mBio 11(4):e00975–e00920. https://doi.org/10.1128/mBio.00975-20 Horchani H, Aissa I, Ouertani S, Zarai Z, Gargouri Y, Sayari A (2012) Staphylococcal lipases: Biotechnological applications. J Mol Catal B: Enzymatic 76:125–132. https://doi.org/https://doi.org/10.1016/j.molcatb.2011.11.018 Ballal A, Ray B, Manna AC (2009) sarZ, a sarA family gene, is transcriptionally activated by MgrA and is involved in the regulation of genes encoding exoproteins in Staphylococcus aureus. J Bacteriol 191(5):1656–1665. https://doi.org/10.1128/JB.01555-08 Otto M (2004) Virulence factors of the coagulase-negative staphylococci. Front Biosci 9:841–863. https://doi.org/10.2741/1295 Wang L, Li M, Dong D et al (2008) SarZ is a key regulator of biofilm formation and virulence in Staphylococcus epidermidis. J Infect Dis 197(9):1254–1262. https://doi.org/10.1086/586714 Keller LJ, Lentz CS, Chen YE et al (2020) Characterization of Serine Hydrolases Across Clinical Isolates of Commensal Skin Bacteria Staphylococcus epidermidis Using Activity-Based Protein Profiling. ACS Infect Dis 6(5):930–938. https://doi.org/10.1021/acsinfecdis.0c00095 Liu CH, Chen YT, Hou MH, Hu NJ, Chen CS, Shaw JF (2018) Crystallographic analysis of the staphylococcus epidermidis lipase involved in esterification in aqueous solution. Acta Crystallogr F Struct Biol Commun 74(6):351–354. https://doi.org/10.1107/S2053230X18006775 Simons JW, van Kampen MD, Riel S, Götz F, Egmond MR, Verheij HM (1998) Cloning, purification and characterisation of the lipase from Staphylococcus epidermidis–comparison of the substrate selectivity with those of other microbial lipases. Eur J Biochem 253(3):675–683. https://doi.org/10.1046/j.1432-1327.1998.2530675.x Longshaw CM, Farrell AM, Wright JD, Holland KT (2000) Identification of a second lipase gene, gehD, in Staphylococcus epidermidis: comparison of sequence with those of other staphylococcal lipases. Microbiol (Reading) 146(Pt 6):1419–1427. https://doi.org/10.1099/00221287-146-6-1419 Nikoleit K, Rosenstein R, Verheij HM, Götz F (1995) Comparative biochemical and molecular analysis of the staphylococcus hyicus, staphylococcus aureus and a hybrid lipase. Indication for a C-terminal phospholipase domain. Eur J Biochem 228(3):732–738 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 14 Mar, 2026 Read the published version in Archives of Microbiology → Version 1 posted Editorial decision: Revision requested 21 Oct, 2025 Reviews received at journal 13 Oct, 2025 Reviewers agreed at journal 13 Sep, 2025 Reviews received at journal 10 Sep, 2025 Reviewers agreed at journal 09 Sep, 2025 Reviewers agreed at journal 09 Sep, 2025 Reviewers invited by journal 06 Sep, 2025 Editor assigned by journal 04 Sep, 2025 Submission checks completed at journal 04 Sep, 2025 First submitted to journal 01 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7510667","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":513176609,"identity":"ed728ca6-4765-4f6c-97dd-e7af1a520338","order_by":0,"name":"Runan Tan","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Runan","middleName":"","lastName":"Tan","suffix":""},{"id":513176610,"identity":"1ab5cb0b-e5b0-4cbe-913a-a4ef366beceb","order_by":1,"name":"Nannan Zheng","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Nannan","middleName":"","lastName":"Zheng","suffix":""},{"id":513176611,"identity":"9d046444-713f-4752-ada4-7c45a3a4ef1a","order_by":2,"name":"Xiao Chen","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Chen","suffix":""},{"id":513176612,"identity":"5b47de9c-4588-4518-8bf3-e22bd0bc8f99","order_by":3,"name":"Wenjun Xie","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Wenjun","middleName":"","lastName":"Xie","suffix":""},{"id":513176613,"identity":"664e416c-ab7a-42bd-a1f4-77c69b98dd91","order_by":4,"name":"Wanyang Xu","email":"","orcid":"","institution":"Wannan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Wanyang","middleName":"","lastName":"Xu","suffix":""},{"id":513176614,"identity":"12f1ad13-d565-45c6-be4d-fbe24e27ac26","order_by":5,"name":"Tao Zhu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYDACCTBpA+WxEaeFsYGBIY10LYdJ0CI/u8f8wY+K84nbxQ4/YPhQdpiBf3YDfi2Mc84YNvacuZ24c3aaAeOMc4cZJO4cwK+FWSLHsIG37Xbuhts5DMy8bYcZDCQS8GthA2pp/Nt2DqLlLzFaeIBamnnbDkC0MBKjRUIirXC2zJnk+g230wwO9pxL55G4QUCL/IzkDR/fVNgZG9xOfvjgR5m1HP8MAlpQwAGQS0lQPwpGwSgYBaMAFwAA9aFDmkFLQEYAAAAASUVORK5CYII=","orcid":"","institution":"Wannan Medical College","correspondingAuthor":true,"prefix":"","firstName":"Tao","middleName":"","lastName":"Zhu","suffix":""}],"badges":[],"createdAt":"2025-09-01 17:23:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7510667/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7510667/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00203-026-04809-6","type":"published","date":"2026-03-14T15:59:29+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":91176095,"identity":"968c7082-fa55-4a06-a33c-5b6084559536","added_by":"auto","created_at":"2025-09-12 12:10:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":65152,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of lipase activity by olive oil agar plates\u003c/strong\u003e \u003cem\u003eS. epidermidis\u003c/em\u003e RP62A (wt) and its \u003cem\u003esarZ\u003c/em\u003e knockout strain (\u003cem\u003eΔsarZ\u003c/em\u003e) were inoculated onto olive oil agar plates and incubated at 37°C for 24 h to observe the clear zone of hydrolysis formed around the colony.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7510667/v1/72723e480f43d541d2b0e77b.png"},{"id":91176104,"identity":"cbe6b301-2f75-472b-a267-2733ca38a150","added_by":"auto","created_at":"2025-09-12 12:10:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":82671,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of lipase activity by p-nitrophenol assay\u003c/strong\u003e The culture supernatants were taken as the crude lipases. The substrate (pNPB / pNPP) was hydrolyzed by lipase to release p-nitrophenol (pNP), which exhibits yellow color under alkaline conditions. The absorbance value was measured at OD\u003csub\u003e410\u003c/sub\u003e, and the enzyme activity was calculated by referring to the standard curve of pNP. a and c represent the substrate pNPB, b and d represent the substrate pNPP. The experiments were performed with three biological replicates, and the data were expressed as means ± the SEM. One-way analysis of variance (ANOVA) was used. * * P \u0026lt; 0.01; * * * P \u0026lt; 0.001; * * * * P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7510667/v1/f8af808742dd1ad6c81a31b2.png"},{"id":91176506,"identity":"b8216792-6e23-4538-9b60-b580ee32b40c","added_by":"auto","created_at":"2025-09-12 12:18:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":41978,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDisruption of\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e sarZ\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e resulted in the altered transcription of lipase genes\u003c/strong\u003e The qRT-PCR experiment was employed to detect the relative expression of \u003cem\u003egehC\u003c/em\u003e, \u003cem\u003egehD\u003c/em\u003e and \u003cem\u003eserp0018\u003c/em\u003e genes against the constitutively expressed \u003cem\u003egyrB\u003c/em\u003e gene in \u003cem\u003eS. epidermidis\u003c/em\u003e RP62A and its \u003cem\u003esarZ \u003c/em\u003emutant strain (a-f). The experiments were repeated three times, and the t test was used to determine the statistical significance. * * P \u0026lt; 0.01; * * * P \u0026lt; 0.001; * * ** P \u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7510667/v1/b3fd9ed3756ef94c89739cc4.png"},{"id":91176092,"identity":"e312b0f1-3420-4afc-936b-2624928369ff","added_by":"auto","created_at":"2025-09-12 12:10:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":104713,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEMSA analysis of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eSaphylococcus epidermidis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e SarZ with the promoter regions \u003c/strong\u003eThe promoter region of the lipase gene was biotin-labeled by PCR amplification. The labeled probe was incubated with an increasing concentration of SarZ (ranging from 2.4 to 9.4 pmol) for gel retardation.\u003cstrong\u003e \u003c/strong\u003eLane 1,5 and 6 contain a protein-free control, 100-fold and 200-fold excess of unlabeled probe competitor control, respectively. All samples were subjected to electrophoresis on a 5% non-denatured polyacrylamide gel and subsequently transferred to a nylon membrane for chemiluminescence imaging detection. The DNA fragment of the \u003cem\u003erpsJ\u003c/em\u003e coding region was used as a negative control.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7510667/v1/3dee882d07118130c3feef51.png"},{"id":104739657,"identity":"9e5810f9-f35c-41df-81be-b7ff26e56f17","added_by":"auto","created_at":"2026-03-16 16:11:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1110270,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7510667/v1/d60eb83b-58cd-4d05-93fd-d56a9641d01f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"SarZ negatively regulates the lipase activity in Staphylococcus epidermidis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe skin harbors a rich symbiotic microbial community, including bacteria and fungi, which play a crucial role in maintaining the skin's immune barrier function.[\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Whether through traditional isolation and culture methods or metagenomic sequencing, \u003cem\u003eS. epidermidis\u003c/em\u003e has been identified as one of the most prevalent species[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], Studies revealed that early colonization of \u003cem\u003eS. epidermidis\u003c/em\u003e on the skin can foster immune tolerance to commensal microbiota through activation of regulatory T cells and mucosal-associated invariant T cells, while maintaining pathogen-specific immune responses, thereby facilitating the development and maturation of the skin immune system[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It can also enhance skin barrier homeostasis by secreting sphingomyelinase, which increases ceramide content on the skin and strengthens tight junctions between keratinocytes[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Additionally, studies have proven that it can accelerate skin wound healing by stimulating the secretion of type II cytokines and recruiting plasmacytoid dendritic cells, which produce type I interferon[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Interestingly, \u003cem\u003eS. epidermidis\u003c/em\u003e even has an effect against skin neoplasia[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHowever, in addition to its role as a probiotic bacterium, \u003cem\u003eS. epidermidis\u003c/em\u003e often leads a dual lifestyle as an opportunistic pathogen due to its strain diversity (more aggressive isolates) and encounters with immunocompromised hosts. Fluctuations in the levels of \u003cem\u003eS. epidermidis\u003c/em\u003e colonization correlate with a variety of skin diseases, including atopic dermatitis[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], dandruff[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], seborrheic dermatitis[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and rosacea[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Moreover, \u003cem\u003eS. epidermidis\u003c/em\u003e is the leading pathogen responsible for implant-associated infections[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. These infections often necessitate surgical removal of the implant as the feasible treatment, thereby posing an additional burden to healthcare systems[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. \u003cem\u003eS. epidermidis\u003c/em\u003e also causes 30%-40% of hospital-acquired bloodstream infections, most of which originate from catheter-related infections that subsequently disseminate into the bloodstream[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Bloodstream infection caused by \u003cem\u003eS. epidermidis\u003c/em\u003e is also the primary cause of late-onset sepsis in preterm neonates[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eRegardless of its role, \u003cem\u003eS. epidermidis\u003c/em\u003e must colonize the skin first. Give that the skin is rich in lipids, primarily consisting of sebum-derived triglycerides[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], it is reasonable to infer that \u003cem\u003eS. epidermidis\u003c/em\u003e is capable of producing lipase, which can liberate free fatty acids by hydrolyzing sebum to fulfill its nutritional requirement. Furthermore, lipases can be utilized by \u003cem\u003eStaphylococcus\u003c/em\u003e to penetrate the hydrophobic barrier of sebum to settle into hair follicles[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. It can also exert a detoxification function by catalyzing the esterification reaction between antibacterial fatty acids[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] and cholesterol[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Although the role of lipase in infection and dissemination remains incompletely elucidated, clinical study has revealed its participation in the pathogenicity of \u003cem\u003eStaphylococcus\u003c/em\u003e. It has been disclosed that the lipase produced by \u003cem\u003eStaphylococcus aureus\u003c/em\u003e can evade the recognition of the host's innate immune system and mitigate subsequent pro-inflammatory responses by hydrolyzing its own lipoprotein, a principal extracellular pathogen-associated molecular pattern[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Recent studies have shown that lipase can significantly decelerate the skin wound healing process in mice infected with \u003cem\u003eS. aureus\u003c/em\u003e, which corroborates the aforementioned conclusion. Moreover, it has been demonstrated that some lipases also possess collagen-binding properties[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], which can facilitate persistent colonization on the surface of host skin and medical devices, thereby promoting biofilm formation in both \u003cem\u003eS. epidermidis\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003cem\u003eS. epidermidis\u003c/em\u003e expresses at least two lipases, encoded by the \u003cem\u003egehC\u003c/em\u003e and \u003cem\u003egehD\u003c/em\u003e genes[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Lipase is highly conserved in \u003cem\u003eStaphylococcus\u003c/em\u003e, with similar protein sequences that typically comprising three main parts: signal peptide (35\u0026thinsp;~\u0026thinsp;38 amino acids), pro-peptide (207\u0026thinsp;~\u0026thinsp;321 amino acids) and mature peptide (383\u0026thinsp;~\u0026thinsp;396 amino acids)[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The lipase precursor requires processing by the metalloprotease (aureolysin) prior to its secretion and conversion into a functionally mature form[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Currently, molecular mechanism underlying the regulation of lipase gene expression in \u003cem\u003eStaphylococcus\u003c/em\u003e remains elusive. It was suggested that the expression of lipase was modulated by the global regulators Agr and SarA[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], and the mutant strains lacking Agr or SarA exhibited obvious defects in lipase activity. Further investigations have indicated that the regulation of Agr and SarA on lipase activity is achieved by regulating the expression of aureolysin and thus affecting the maturation of lipase, rather than directly impacting the transcription of lipase genes.\u003c/p\u003e\u003cp\u003eThe transcription factor SarZ, a member of the SarA protein family in \u003cem\u003eStaphylococcus\u003c/em\u003e, has been reported to serves as a key regulator of tissue colonization and dissemination of infection[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In \u003cem\u003eS. aureus\u003c/em\u003e, SarZ modulates the responses to oxidative stress[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] and regulates the expression of virulence factors[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], particularly exoproteins such as hemolysins and proteases. In \u003cem\u003eS. epidermidis\u003c/em\u003e, it has been revealed that SarZ inhibits the expression of phenol-soluble modulins (PSMs) while enhancing protease secretion[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. However, it remains unclear whether SarZ affects the expression of lipase genes. Therefore, based on the \u003cem\u003esarZ\u003c/em\u003e knockout mutant of \u003cem\u003eS. epidermidis\u003c/em\u003e constructed in our laboratory, the present study further explored whether SarZ exerts a regulatory effect on the exoprotein-lipase via enzymatic activity and molecular biology experiments, providing a new perspective for in-depth comprehension of the symbiotic or pathogenic mechanism of \u003cem\u003eS. epidermidis\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eBacterial strains and media\u003c/h2\u003e\u003cp\u003e\u003cem\u003eS. epidermidis\u003c/em\u003e RP62A (WT) was preserved in our laboratory, and its derivative \u003cem\u003esarZ\u003c/em\u003e knockout strain (\u003cem\u003eΔsarZ\u003c/em\u003e), complementation strain (pCNcat-\u003cem\u003esarZ\u003c/em\u003e) and empty vector strain (pCNcat) were generated by our laboratory previously. All strains were conventionally cultured in Tryptic Soy Broth (TSB) at 37\u0026deg;C with shaking at 220 rpm. Chloramphenicol was added to a final concentration of 10 \u0026micro;g\u0026middot;ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e when necessary. The nucleotide sequence of the lip gene from \u003cem\u003eS. epidermidis\u003c/em\u003e strain RP62A analyzed in this study is available under Ref-Seq genome accession number NC_002976.3 in the GenBank database at the National Center for Biotechnology Information (NCBI). The lipases gene can be located within the sequence using the annotated gene locus tag SERP2297, SERP2388, SERP0018.\u003c/p\u003e\u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/nuccore/NC_002976.3\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/nuccore/NC_002976.3\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eOlive oil agar plate assay\u003c/h3\u003e\n\u003cp\u003eThe arabic gum solution was formulated as follows: 10% Arabic gum (w/v); 200 mM NaCl; and 50 mM CaCl\u003csub\u003e2\u003c/sub\u003e. The olive oil agar plate[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] was prepared according to the following composition: 10% arabic gum solution (v/v); 1% tryptone (w/v); 0.5% yeast extract (w/v); 0.5% NaCl (w/v); 1.5% agar (w/v); and 1% (v/v) olive oil. Olive oil and the other components in the medium should be autoclaved separately and then fully emulsified using a homogenizer. \u003cem\u003eS. epidermidis\u003c/em\u003e RP62A and its \u003cem\u003esarZ\u003c/em\u003e mutant derivatives were spread onto olive oil agar plates and cultured at 37\u0026deg;C for 24 h to observe whether clear zones of hydrolysis were formed around the colonies.\u003c/p\u003e\n\u003ch3\u003ep-nitrophenol assay\u003c/h3\u003e\n\u003cp\u003eSingle colonies of \u003cem\u003eS. epidermidis\u003c/em\u003e RP62A and its \u003cem\u003esarZ\u003c/em\u003e mutant derivatives were inoculated respectively into SPM medium (3% tryptone; 1% yeast extract; 0.5% NaCl; 0.1% (v/v) tributyrin; 0.01% CaCl\u003csub\u003e2\u003c/sub\u003e\u0026middot;2H\u003csub\u003e2\u003c/sub\u003eO)[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] for overnight culture. The overnight cultures were adjusted to an initial OD\u003csub\u003e600\u003c/sub\u003e of 0.1 in fresh SPM medium containing 4 \u0026micro;M CdCl\u003csub\u003e2\u003c/sub\u003e (for the induction of expression of \u003cem\u003esarZ\u003c/em\u003e gene in the complementation strain), and then incubated at 37\u0026deg;C with shaking at 220 rpm for 24 h. The bacterial cultures were centrifuged and the supernatants were collected as the crude enzyme extract. Lipase activity was quantified using p-nitrophenyl palmitate (pNPP) or p-nitrophenyl butyrate (pNPB) as substrate according to the procedure described by Gupta[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] with minor modifications. Briefly, 900 \u0026micro;l of 50 mM Tris-HCl buffer (pH 8.0) containing 0.5 mM PEG 8000 was pipetted into a 2 ml centrifuge tube, and then 100 \u0026micro;l of 6 mM pNPP / pNPB (prepared in isopropanol) was added and mixed thoroughly. Subsequently, 100 \u0026micro;l of crude enzyme extract was introduced to initiate the reaction. After incubation at 37\u0026deg;C for 5 minutes, the reaction was terminated by adding 100 \u0026micro;l of absolute ethanol. The reaction mixture was centrifuged, and the supernatant was collected for determination of absorbance at 410 nm. Enzyme activity was calculated based on the p-nitrophenol (pNP) standard curve. One unit of enzymatic activity (U) is defined as the amount of enzyme that liberate 1 \u0026micro;mol of p-nitrophenol (pNP) per minute. The experiment consisted of three independent biological replicates.\u003c/p\u003e\n\u003ch3\u003eRNA extraction and qRT-PCR\u003c/h3\u003e\n\u003cp\u003eThe extraction of total RNA from \u003cem\u003eS. epidermidis\u003c/em\u003e RP62A and its isogenic \u003cem\u003esarZ\u003c/em\u003e knockout mutant was carried out as previously described in our laboratory. Overnight cultures of \u003cem\u003eS. epidermidis\u003c/em\u003e were diluted 1:100 in TSB medium and cultivated at 37\u0026deg;C with shaking at 220 rpm. Bacterial cells were harvested at the exponential (4 h) and stationary phases (10 h), respectively, and immediately stabilized through mixing with RNAprotect Bacteria Reagent (Qiagen, cat #76,506) at a 2:1 (v/v) ratio. Mechanical disruption of bacteria cells was performed using a Mini-Beadbeater (Biospec) at maximum speed, and subsequent total RNA was extracted using the RNeasy\u0026reg; Mini kit (Qiagen, cat#74,104) in accordance with the manufacturer's instructions. To eliminate DNA contamination, on-column DNase digestion was performed using the RNase-Free DNase Set (Qiagen, cat #79,254). The concentration and purity of the extracted RNA were assessed both quantitatively and qualitatively using a BioDrop spectrophotometer and 1% agarose gel electrophoresis, respectively. Two micrograms of total RNA were reversely transcribed into cDNA using GoScript\u0026trade; Reverse Transcription kit (Promega, cat#A2800) following the manufacturer's instructions. Afterward, 5 \u0026micro;l of cDNA was employed to conduct the qRT-PCR reactions using FastStart Essential DNA Green Master (Roche, cat #06924204001). The qRT-PCR reactions were run on the LightCycler\u0026reg; 96 instrument under the following conditions: 95\u0026deg;C for 30 s; 95\u0026deg;C for 15 s; 60\u0026deg;C for 25 s; 45 cycles. The \u003cem\u003egyrB\u003c/em\u003e gene was used as the internal reference gene for normalization, and the relative expression of the target gene was calculated by the 2\u003csup\u003e\u0026minus;ΔΔct\u003c/sup\u003e method. Specific primers were designed using the software Primer Premier 5.0 (Table. 1). Each experiment was conducted with three independent biological replicates.\u003c/p\u003e\n\u003ch3\u003eElectrophoretic mobility shift assay\u003c/h3\u003e\n\u003cp\u003eThe promoter regions of \u003cem\u003egehC\u003c/em\u003e, \u003cem\u003egehD\u003c/em\u003e and \u003cem\u003eserp0018\u003c/em\u003e were amplified using 5'-biotin-labeled primers (Table. 1). And the biotin-labeled DNA fragments were incubated with the gradually increasing concentrations of recombinant SarZ protein in binding buffer (Shanghai Beyotime Biotech, cat#GS005). For competition reactions, unlabeled competitor fragments were pre-incubated with SarZ at 100-fold or 200-fold molar excess relative to the labeled probe. Following the binding reaction, protein-DNA complexes were resolved by electrophoresis on a 5% native polyacrylamide gel. Then the biotin-labeled DNA was transferred to the positively charged nylon membrane (Shanghai Beyotime Biotech, cat#FFN10). Subsequently, the membrane was UV-irradiated for 30 minutes to immobilize the DNA. Finally, Chemiluminescent EMSA Kit (Shanghai Beyotime Biotech, cat#GS009) was used for detection and analysis. The \u003cem\u003erpsJ\u003c/em\u003e (encoding 30S ribosomal protein S10) was used as a negative control for SarZ-DNA binding. The primers of \u003cem\u003egehC\u003c/em\u003e, \u003cem\u003egehD\u003c/em\u003e, \u003cem\u003eserp0018\u003c/em\u003e and \u003cem\u003erpsJ\u003c/em\u003e were synthesized by Shanghai Sangon Biotech.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers used in this study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence (5'\u0026rarr;3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProduct size (bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimers for qRT-PCR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eserp 0018\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTTAATGATCTGACAACGCAAGGTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e94\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eserp 0018\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCGCTGACCCTGTATAAGTAGTGTAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003egehD\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCTGCCATAACGCTTGTGACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e104\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003egehD\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAATTATGACCGTGCTGTTGAACTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003egehC\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTGTCGTCATCGTTCTTAGCAGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e80\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003egehC\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGATAGCCAATCAACAGAAGAGGTAAAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003egyrB\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCACCGTGAAGACCGCCAGATAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e99\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003egyrB\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGATGGGACGCCCTGCTGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimers for EMSA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP\u003csub\u003e\u003cem\u003eserp 0018\u003c/em\u003e\u003c/sub\u003e -F-biotin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGCATGCTACTTTTTTCATTTAATGATAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e291\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP\u003csub\u003e\u003cem\u003eserp 0018\u003c/em\u003e\u003c/sub\u003e-R-biotin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAAAGAAATCACCTCTATAAGATTTTTCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP\u003csub\u003e\u003cem\u003egehD\u003c/em\u003e\u003c/sub\u003e -F-biotin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATCACCTCTATAAGTTTTTTCCCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e232\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP\u003csub\u003e\u003cem\u003egehD\u003c/em\u003e\u003c/sub\u003e -R-biotin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCATGCTTCTTCATCATGTGTAATGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP\u003csub\u003e\u003cem\u003egehC\u003c/em\u003e\u003c/sub\u003e -F-biotin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTCTTGTCTTCACAATTAGCACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e184\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP\u003csub\u003e\u003cem\u003egehC\u003c/em\u003e\u003c/sub\u003e -R-biotin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGATTATGGAAGCGTTTACCTTTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP\u003csub\u003e\u003cem\u003erpsJ\u003c/em\u003e\u003c/sub\u003e -F-biotin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGATTATGGAAGCGTTTACCTTTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e119\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP\u003csub\u003e\u003cem\u003erpsJ\u003c/em\u003e\u003c/sub\u003e -R-biotin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAGATTCTCGTGAACAATTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eExperimental data obtained were analyzed using GraphPad Prism 8. The data between the two groups were compared by t test, and the data above the two groups were analyzed by one-way analysis of variance (ANOVA). All data are expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;the SEM, and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicates that the difference is statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results and Discussion","content":"\u003cp\u003e\u003cb\u003eInactivation of\u003c/b\u003e \u003cb\u003esarZ\u003c/b\u003e \u003cb\u003egene led to increased lipase activity in\u003c/b\u003e \u003cb\u003eS. epidermidis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eLipase plays an important role in bacterial growth and metabolism[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], colonization and adhesion[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], immune evasion[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] and dissemination of infection[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] in \u003cem\u003eStaphylococcus\u003c/em\u003e. Moreover, lipase can address the global shortage of Influenza A virus vaccines by enhancing Influenza A Virus Replication[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], which contributes to resolution of a major public health concern. And it can catalyze esterification, transesterification and transesterification in non-aqueous media, possesses favorable adaptability to pH and temperature, thereby presenting broad application potential in many industrial fields[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Considering its biological significance and its increasing role played in the field of biotechnology, it is imperative to investigate the regulatory mechanism governing expression of staphylococcal lipase. Since SarZ has been proven to regulate the expression of exoproteins in \u003cem\u003eStaphylococcus\u003c/em\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] to explore whether it can also impact the expression of lipase, the olive oil agar plate assay was employed to preliminarily detect changes in lipase activity between the \u003cem\u003esarZ\u003c/em\u003e knockout strain and its parent strain. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the clear zone of hydrolysis surrounding the mutant strain on the olive oil agar plates was significantly larger than that of the wild-type strain, indicating that the lipase activity of the mutant strain was remarkably elevated.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo further validate this observation, the lipase activity in the culture supernatants of \u003cem\u003eS. epidermidis\u003c/em\u003e was determined by p-nitrophenol assay using pNPP (representing long-chain fatty acid esters) and pNPB (representing short-chain fatty acid esters) as the substrates, respectively. In the presence of lipase, p-nitrophenyl ester can be hydrolyzed to release yellow p-nitrophenol. The compound exhibits maximum absorption at a wavelength of 410 nm. Consequently, the lipase activity can be calculated based on variation in the absorption value. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, whether pNPP (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec) or pNPB (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed) was used as the reaction substrate, the supernatants of the mutant strain showed remarkably higher lipase activity compared to that of the wild-type strain, whereas the lipase activity of the complementation strain was comparable to that of the wild strain. The introduction of empty vector had no effect on the lipase activity for the mutant strain, which further suggested that inactivation of SarZ could notably increase the lipase activity of \u003cem\u003eS. epidermidis\u003c/em\u003e. To our knowledge, this is the first report demonstrating that SarZ can regulate the lipase activity in \u003cem\u003eStaphylococcus\u003c/em\u003e, which enriches the understanding of the regulatory mechanism underlying lipase expression in \u003cem\u003eStaphylococcus\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eSarZ regulates the transcription of\u003c/b\u003e \u003cb\u003egehC\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003egehD\u003c/b\u003e \u003cb\u003egenes in\u003c/b\u003e \u003cb\u003eS. epidermidis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo elucidate whether the regulation of lipase activity by SarZ is achieved through the regulation of lipase genes expression, qRT-PCR was performed to compare the transcription levels of lipase genes between the mutant strain and the wild-type strain. Three lipase genes, namely two known genes (\u003cem\u003egehC\u003c/em\u003e and \u003cem\u003egehD\u003c/em\u003e) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]and one putative gene (\u003cem\u003eserp0018\u003c/em\u003e)[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] were chosen for measurement during both the exponential and stationary phases. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-c, during the exponential phase, the transcription levels of \u003cem\u003egehC\u003c/em\u003e and \u003cem\u003eserp0018\u003c/em\u003e in the mutant strain were 23-fold and 3.75-fold higher respectively, than those in the wild-type strain, Conversely, the transcription of \u003cem\u003egehD\u003c/em\u003e was downregulated by 2.5-fold. When the bacteria entered the stationary phase, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed-e, the transcription levels of \u003cem\u003egehC\u003c/em\u003e and \u003cem\u003eserp0018\u003c/em\u003e in the mutant strain remained higher than those in the wild-type strain, with up-regulation of 35-fold and 4-fold, respectively. In contrast, the transcription level of \u003cem\u003egehD\u003c/em\u003e in the mutant strain was almost equivalent to that in the wild-type strain. This finding is consistent with a prior transcriptional analysis of a \u003cem\u003esarZ\u003c/em\u003e insertion mutant in \u003cem\u003eS. epidermidis\u003c/em\u003e strain 1457 using gene microarrays[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. These observations imply that SarZ modulates lipase activity through transcriptional regulation of lipase gene expression. Specifically, it represses the transcription of \u003cem\u003egehC\u003c/em\u003e and \u003cem\u003eserp0018\u003c/em\u003e and activate the transcription of \u003cem\u003egehD.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe \u003cem\u003egehC\u003c/em\u003e gene (SERP2297) is composed of 2067 nucleotides, encoding a lipase precursor protein with a molecular weight of about 77-kDa, which is converted into a 43-kDa[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e] mature lipase after processing. Biochemical characterization of the lipase revealed that the optimal pH for the enzyme is 6, and it exhibits high stability under low pH conditions. Its activity depends on the presence of calcium ions and prefers to decompose short-chain fatty acid esters[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. The \u003cem\u003egehD\u003c/em\u003e gene (SERP2388) consists of 1932 nucleotides and encodes a lipase precursor with a molecular weight of approximately 72.2-kDa. Unlike GehC, GehD exhibits broader substrate specificity and is capable of hydrolyzing both long-chain and short-chain fatty acid esters, with a marked preference for long-chain substrates[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Although they display 52% amino acid identity in their mature parts, phylogenetic analysis indicated that they occupy distinct branches within the staphylococcal lipase family. GehC is evolutionarily closer to GehA[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] from \u003cem\u003eS. aureus\u003c/em\u003e, whereas GehD exhibits a higher homology with GehB [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] in \u003cem\u003eS. aureus\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eIt is noteworthy that the divergent regulation of lipase gene expression by SarZ contradicts the overall negative effect of SarZ on lipase activity observed in our experiments. We propose that this discrepancy may be attributed to GehC functioning as the primary lipase in \u003cem\u003eS. epidermidis\u003c/em\u003e, with its transcription being subject to the most pronounced regulation by SarZ. This speculation is further supported by qRT-PCR analysis, indicating higher mRNA abundance of \u003cem\u003egehC\u003c/em\u003e compared to \u003cem\u003egehD\u003c/em\u003e, as well as lipase activity assays demonstrating significantly stronger hydrolysis of short-chain fatty acid esters than of long-chain substrates by the culture supernatants of \u003cem\u003eS. epidermidis\u003c/em\u003e. Nonetheless, the physiological significance of SarZ-mediated upregulation of \u003cem\u003egehD\u003c/em\u003e transcription during the exponential phase remains to be clarified. The \u003cem\u003eserp0018\u003c/em\u003e gene (SERP0018) comprises 2046 nucleotides and encodes a putative lipase with a molecular weight of approximately 76-kDa. Therefore, the significant increase in lipase activity observed in the \u003cem\u003esarZ\u003c/em\u003e mutant strain may also be ascribed to the enhanced transcription of the \u003cem\u003eserp0018\u003c/em\u003e gene.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eSarZ can directly bind to the promoter region of the lipase genes.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe SarZ protein possesses DNA-binding activity. In \u003cem\u003eS. aureus\u003c/em\u003e, it can directly bind to the promoters of the hla and hlb genes, thereby modulating the expression of α-hemolysin and β-hemolysin[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. This let us speculated that SarZ might directly regulate the expression of lipase genes through its role as a transcription factor in \u003cem\u003eS. epidermidis\u003c/em\u003e. Therefore, EMSA experiment was conducted to clarify whether SarZ directly regulates the expression of lipase genes. Recombinant His-tagged SarZ protein was incubated with biotin-labeled promoter fragments of the lipase genes, followed by non-denaturing gel electrophoresis. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the promoter fragments of \u003cem\u003egehC, gehD\u003c/em\u003e and \u003cem\u003eserp0018\u003c/em\u003e each formed DNA-protein complexes with SarZ in a dose-dependent manner. The mobility of these complexes was significantly reduced compared to that of the free DNA probes without bound protein, and a clear band shift was observed. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-c, lane 2 to lane 4). The addition of a 200-fold excess of the same unlabeled DNA fragment as a competitive probe completely blocked the formation of a complex between the labeled probe and the SarZ protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-c, lane 6). As a negative control, the DNA fragment containing the \u003cem\u003erpsJ\u003c/em\u003e gene promoter did not form a complex with SarZ under the same conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed), indicating that SarZ could specifically bind to the promoter region of the lipase gene.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, SarZ modulates the lipase activity of \u003cem\u003eS. epidermidis\u003c/em\u003e by affecting the transcription of lipase genes as a transcription factor. It suppresses the expression of \u003cem\u003egehC\u003c/em\u003e and \u003cem\u003eserp0018\u003c/em\u003e genes while promoting the expression of \u003cem\u003egehD\u003c/em\u003e gene by directly binding to their promoter regions. These findings provide a theoretical foundation for the future development of new antibacterial drugs and the industrial application of staphylococcal lipase.\u003c/p\u003e"},{"header":"Statements and Declarations","content":"\u003ch3\u003eFunding\u003c/h3\u003e\n\u003cp\u003eThis work was supported by the Key Program of Educational Commission of Anhui Province (2023AH051737, KJ2020A0602), the Support Program for University Outstanding Youth Talent of Anhui Province (gxyq2019043), and Fudan University (FDMV-2020005).\u003c/p\u003e\n\u003ch3\u003eCompeting Interests\u003c/h3\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003ch3\u003eAuthor\u0026nbsp;Contributions\u003c/h3\u003e\n\u003cp\u003eTao Zhu and Runan Tan were responsible for the conception and design of the study. Nannan Zheng conducted the olive oil agar plate assay. Xiao Chen constructed SarZ protein expression strain, Wenjun Xie and Wanyang Xu carried out the qRT-PCR experiments. Runan Tan performed EMSA experiment. Tao Zhu and Runan Tan carried out the analysis and interpretation of data. Runan Tan and Tao Zhu wrote the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003ch3\u003eData Availability\u003c/h3\u003e\n\u003cp\u003eThe datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003ch3\u003eEthics approval\u0026nbsp;\u003c/h3\u003e\n\u003cp\u003eThis article did not contain any studies with animals performed by any of the authors.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eByrd AL, Belkaid Y, Segre JA (2018) The human skin microbiome. Nat Rev Microbiol 16(3):143\u0026ndash;155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrmicro.2017.157\u003c/span\u003e\u003cspan address=\"10.1038/nrmicro.2017.157\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee HJ, Kim M (2022) Skin Barrier Function and the Microbiome. Int J Mol Sci 23(21):13071. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms232113071\u003c/span\u003e\u003cspan address=\"10.3390/ijms232113071\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen YE, Fischbach MA, Belkaid Y (2018) Skin microbiota-host interactions. Nature 553(7689):427\u0026ndash;436. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature25177\u003c/span\u003e\u003cspan address=\"10.1038/nature25177\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHarris-Tryon TA, Grice EA (2022) Microbiota and maintenance of skin barrier function. Science 376(6596):940\u0026ndash;945. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.abo0693\u003c/span\u003e\u003cspan address=\"10.1126/science.abo0693\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStaphylococcus epidermidis pan-genome sequence analysis reveals diversity of skin commensal and hospital infection-associated isolates | Genome Biology. Accessed August 30 (2025) \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://link.springer.com/article/\u003c/span\u003e\u003cspan address=\"https://link.springer.com/article/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/gb-2012-13-7-r64\u003c/span\u003e\u003cspan address=\"10.1186/gb-2012-13-7-r64\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrice EA, Segre JA (2011) The skin microbiome. Nat Rev Microbiol 9(4):244\u0026ndash;253. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrmicro2537\u003c/span\u003e\u003cspan address=\"10.1038/nrmicro2537\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLaborel-Pr\u0026eacute;neron E, Bianchi P, Boralevi F et al (2015) Effects of the Staphylococcus aureus and Staphylococcus epidermidis Secretomes Isolated from the Skin Microbiota of Atopic Children on CD4\u003csup\u003e+\u003c/sup\u003e T Cell Activation. PLoS ONE 10(10):e0141067. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0141067\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0141067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng Y, Hunt RL, Villaruz AE et al (2022) Commensal Staphylococcus epidermidis contributes to skin barrier homeostasis by generating protective ceramides. Cell Host Microbe 30(3):301\u0026ndash;313e9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.chom.2022.01.004\u003c/span\u003e\u003cspan address=\"10.1016/j.chom.2022.01.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSevern MM, Horswill AR (2023) Staphylococcus epidermidis and its dual lifestyle in skin health and infection. Nat Rev Microbiol 21(2):97\u0026ndash;111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41579-022-00780-3\u003c/span\u003e\u003cspan address=\"10.1038/s41579-022-00780-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFukuda K, Ito Y, Amagai M (2025) Barrier Integrity and Immunity: Exploring the Cutaneous Front Line in Health and Disease. Annual Review of Immunology. 43(Volume 43, 2025):219\u0026ndash;252. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-immunol-082323-030832\u003c/span\u003e\u003cspan address=\"10.1146/annurev-immunol-082323-030832\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakatsuji T, Chen TH, Butcher AM et al (2018) A commensal strain of staphylococcus epidermidis protects against skin neoplasia. Sci Adv 4(2):eaao4502. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/sciadv.aao4502\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.aao4502\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eByrd AL, Deming C, Cassidy SKB et al (2017) Staphylococcus aureus and Staphylococcus epidermidis strain diversity underlying pediatric atopic dermatitis. Sci Transl Med 9(397):eaal4651. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/scitranslmed.aal4651\u003c/span\u003e\u003cspan address=\"10.1126/scitranslmed.aal4651\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCau L, Williams MR, Butcher AM et al (2021) Staphylococcus epidermidis protease EcpA can be a deleterious component of the skin microbiome in atopic dermatitis. J Allergy Clin Immunol 147(3):955\u0026ndash;966e16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaci.2020.06.024\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2020.06.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaxena R, Mittal P, Clavaud C et al (2018) Comparison of Healthy and Dandruff Scalp Microbiome Reveals the Role of Commensals in Scalp Health. Front Cell Infect Microbiol 8:346. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcimb.2018.00346\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2018.00346\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaxena R, Mittal P, Clavaud C et al (2018) Comparison of Healthy and Dandruff Scalp Microbiome Reveals the Role of Commensals in Scalp Health. Front Cell Infect Microbiol 8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcimb.2018.00346\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2018.00346\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSanders MGH, Nijsten T, Verlouw J, Kraaij R, Pardo LM (2021) Composition of cutaneous bacterial microbiome in seborrheic dermatitis patients: A cross-sectional study. PLoS ONE 16(5):e0251136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0251136\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0251136\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHigh Staphylococcus epidermidis Colonization and Impaired Permeability Barrier in Facial Seborrheic Dermatitis | Chinese Medical Journal. Accessed August 30 (2025) \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mednexus.org/doi/full/10.4103/0366-6999.209895\u003c/span\u003e\u003cspan address=\"https://mednexus.doi/full/10.4103/0366-6999.209895\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWoo YR, Lee SH, Cho SH, Lee JD, Kim HS (2020) Characterization and Analysis of the Skin Microbiota in Rosacea: Impact of Systemic Antibiotics. J Clin Med 9(1):185. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jcm9010185\u003c/span\u003e\u003cspan address=\"10.3390/jcm9010185\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWhitfeld M, Gunasingam N, Leow LJ, Shirato K, Preda V (2011) Staphylococcus epidermidis: A possible role in the pustules of rosacea. J Am Acad Dermatol 64(1):49\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jaad.2009.12.036\u003c/span\u003e\u003cspan address=\"10.1016/j.jaad.2009.12.036\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOliveira WF, Silva PMS, Silva RCS et al (2018) Staphylococcus aureus and Staphylococcus epidermidis infections on implants. J Hosp Infect 98(2):111\u0026ndash;117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jhin.2017.11.008\u003c/span\u003e\u003cspan address=\"10.1016/j.jhin.2017.11.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcCann MT, Gilmore BF, Gorman SP (2008) Staphylococcus epidermidis device-related infections: pathogenesis and clinical management. J Pharm Pharmacol 60(12):1551\u0026ndash;1571. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1211/jpp.60.12.0001\u003c/span\u003e\u003cspan address=\"10.1211/jpp.60.12.0001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSiciliano V, Passerotto RA, Chiuchiarelli M, Leanza GM, Ojetti V (2023) Difficult-to-Treat Pathogens: A Review on the Management of Multidrug-Resistant Staphylococcus epidermidis. Life (Basel) 13(5):1126. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/life13051126\u003c/span\u003e\u003cspan address=\"10.3390/life13051126\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong Y, Speer CP, Glaser K (2018) Beyond sepsis: Staphylococcus epidermidis is an underestimated but significant contributor to neonatal morbidity. Virulence 9(1):621\u0026ndash;633. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/21505594.2017.1419117\u003c/span\u003e\u003cspan address=\"10.1080/21505594.2017.1419117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKengmo Tchoupa A, Kretschmer D, Schittek B, Peschel A (2023) The epidermal lipid barrier in microbiome\u0026ndash;skin interaction. Trends Microbiol 31(7):723\u0026ndash;734. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tim.2023.01.009\u003c/span\u003e\u003cspan address=\"10.1016/j.tim.2023.01.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakamura K, Williams MR, Kwiecinski JM, Horswill AR, Gallo RL (2021) Staphylococcus aureus Enters Hair Follicles Using Triacylglycerol Lipases Preserved through the Genus Staphylococcus. J Invest Dermatol 141(8):2094\u0026ndash;2097. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jid.2021.02.009\u003c/span\u003e\u003cspan address=\"10.1016/j.jid.2021.02.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePalmitoleic acid isomer (C16:1∆6) in human skin sebum is effective against gram-positive bacteria | skin pharmacology and physiology karger publishers. Accessed August 30 (2025) \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://karger.com/spp/article-abstract/16/3/176/383503/Palmitoleic-Acid-Isomer-C16-1-6-in-Human-Skin\u003c/span\u003e\u003cspan address=\"https://karger.com/spp/article-abstract/16/3/176/383503/Palmitoleic-Acid-Isomer-C16-1-6-in-Human-Skin\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKengmo Tchoupa A, Elsherbini AMA, Camus J et al (2024) Lipase-mediated detoxification of host-derived antimicrobial fatty acids by Staphylococcus aureus. Commun Biol 7(1):572. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s42003-024-06278-3\u003c/span\u003e\u003cspan address=\"10.1038/s42003-024-06278-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen X, Alonzo F (2019) Bacterial lipolysis of immune-activating ligands promotes evasion of innate defenses. Proc Natl Acad Sci U S A 116(9):3764\u0026ndash;3773. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1817248116\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1817248116\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBowden MG, Visai L, Longshaw CM, Holland KT, Speziale P, Hook M (2002) Is the GehD lipase from Staphylococcus epidermidis a collagen binding adhesin? J Biol Chem 277(45):43017\u0026ndash;43023. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M207921200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M207921200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eG\u0026ouml;tz F, Verheij HM, Rosenstein R (1998) Staphylococcal lipases: Molecular characterisation, secretion, and processing. Chem Phys Lipids 93(1):15\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0009-3084(98)00025-5\u003c/span\u003e\u003cspan address=\"10.1016/S0009-3084(98)00025-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRosenstein R, G\u0026ouml;tz F (2000) Staphylococcal lipases: biochemical and molecular characterization. Biochimie 82(11):1005\u0026ndash;1014. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0300-9084(00)01180-9\u003c/span\u003e\u003cspan address=\"10.1016/s0300-9084(00)01180-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCadieux B, Vijayakumaran V, Bernards MA, McGavin MJ, Heinrichs DE (2014) Role of lipase from community-associated methicillin-resistant Staphylococcus aureus strain USA300 in hydrolyzing triglycerides into growth-inhibitory free fatty acids. J Bacteriol 196(23):4044\u0026ndash;4056. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/JB.02044-14\u003c/span\u003e\u003cspan address=\"10.1128/JB.02044-14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBlevins JS, Beenken KE, Elasri MO, Hurlburt BK, Smeltzer MS (2002) Strain-dependent differences in the regulatory roles of sarA and agr in Staphylococcus aureus. Infect Immun 70(2):470\u0026ndash;480. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/IAI.70.2.470-480.2002\u003c/span\u003e\u003cspan address=\"10.1128/IAI.70.2.470-480.2002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eConstruction (2025) and characterization of anagr deletion mutant of staphylococcus epidermidis infection and immunity. Accessed August 31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://journals.asm.org/doi/full/\u003c/span\u003e\u003cspan address=\"https://journals.asm.org/doi/full/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/iai.68.3.1048-1053.2000\u003c/span\u003e\u003cspan address=\"10.1128/iai.68.3.1048-1053.2000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTamber S, Cheung AL (2009) SarZ promotes the expression of virulence factors and represses biofilm formation by modulating SarA and agr in Staphylococcus aureus. Infect Immun 77(1):419\u0026ndash;428. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/IAI.00859-08\u003c/span\u003e\u003cspan address=\"10.1128/IAI.00859-08\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen PR, Nishida S, Poor CB et al (2009) A new oxidative sensing and regulation pathway mediated by the MgrA homologue SarZ in Staphylococcus aureus. Mol Microbiol 71(1):198\u0026ndash;211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2958.2008.06518.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2958.2008.06518.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKaito C, Morishita D, Matsumoto Y, Kurokawa K, Sekimizu K (2006) Novel DNA binding protein SarZ contributes to virulence in Staphylococcus aureus. Mol Microbiol 62(6):1601\u0026ndash;1617. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2958.2006.05480.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2958.2006.05480.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen X, Sun H, Wang W, Wang H, Tan R, Zhu T (2024) SarZ inhibits the hemolytic activity through regulation of phenol soluble modulins in Staphylococcus epidermidis. Front Cell Infect Microbiol 14:1476287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcimb.2024.1476287\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2024.1476287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKouker G, Jaeger KE (1987) Specific and sensitive plate assay for bacterial lipases. Appl Environ Microbiol 53(1):211\u0026ndash;213. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/aem.53.1.211-213.1987\u003c/span\u003e\u003cspan address=\"10.1128/aem.53.1.211-213.1987\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie W, Khosasih V, Suwanto A, Kim HK (2012) Characterization of lipases from Staphylococcus aureus and Staphylococcus epidermidis isolated from human facial sebaceous skin. J Microbiol Biotechnol 22(1):84\u0026ndash;91. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4014/jmb.1107.07060\u003c/span\u003e\u003cspan address=\"10.4014/jmb.1107.07060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGupta N, Rathi P, Gupta R (2002) Simplified para-nitrophenyl palmitate assay for lipases and esterases. Anal Biochem 311(1):98\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0003-2697(02)00379-2\u003c/span\u003e\u003cspan address=\"10.1016/s0003-2697(02)00379-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDelekta PC, Shook JC, Lydic TA, Mulks MH, Hammer ND (2018) Staphylococcus aureus Utilizes Host-Derived Lipoprotein Particles as Sources of Fatty Acids. J Bacteriol 200(11):e00728\u0026ndash;e00717. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/JB.00728-17\u003c/span\u003e\u003cspan address=\"10.1128/JB.00728-17\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNguyen MT, Luqman A, Bitschar K et al (2018) Staphylococcal (phospho)lipases promote biofilm formation and host cell invasion. Int J Med Microbiol 308(6):653\u0026ndash;663. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijmm.2017.11.013\u003c/span\u003e\u003cspan address=\"10.1016/j.ijmm.2017.11.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRollof J, Braconier JH, S\u0026ouml;derstr\u0026ouml;m C, Nilsson-Ehle P (1988) Interference of Staphylococcus aureus lipase with human granulocyte function. Eur J Clin Microbiol Infect Dis 7(4):505\u0026ndash;510. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF01962601\u003c/span\u003e\u003cspan address=\"10.1007/BF01962601\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu C, Xiong N, Zhang Y, Rayner S, Chen S (2012) Functional characterization of lipase in the pathogenesis of Staphylococcus aureus. Biochem Biophys Res Commun 419(4):617\u0026ndash;620. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2012.02.057\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2012.02.057\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRollof J, Hedstr\u0026ouml;m SA, Nilsson-Ehle P (1987) Lipolytic activity of staphylococcus aureus strains from disseminated and localized infections. Acta Pathol Microbiol Immunol Scand B 95(2):109\u0026ndash;113. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1699-0463.1987.tb03096.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1699-0463.1987.tb03096.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGoncheva MI, Conceicao C, Tuffs SW et al (2020) Staphylococcus aureus lipase 1 enhances influenza a virus replication. mBio 11(4):e00975\u0026ndash;e00920. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/mBio.00975-20\u003c/span\u003e\u003cspan address=\"10.1128/mBio.00975-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHorchani H, Aissa I, Ouertani S, Zarai Z, Gargouri Y, Sayari A (2012) Staphylococcal lipases: Biotechnological applications. J Mol Catal B: Enzymatic 76:125\u0026ndash;132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.molcatb.2011.11.018\u003c/span\u003e\u003cspan address=\"10.1016/j.molcatb.2011.11.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBallal A, Ray B, Manna AC (2009) sarZ, a sarA family gene, is transcriptionally activated by MgrA and is involved in the regulation of genes encoding exoproteins in Staphylococcus aureus. J Bacteriol 191(5):1656\u0026ndash;1665. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/JB.01555-08\u003c/span\u003e\u003cspan address=\"10.1128/JB.01555-08\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOtto M (2004) Virulence factors of the coagulase-negative staphylococci. Front Biosci 9:841\u0026ndash;863. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2741/1295\u003c/span\u003e\u003cspan address=\"10.2741/1295\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang L, Li M, Dong D et al (2008) SarZ is a key regulator of biofilm formation and virulence in Staphylococcus epidermidis. J Infect Dis 197(9):1254\u0026ndash;1262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1086/586714\u003c/span\u003e\u003cspan address=\"10.1086/586714\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKeller LJ, Lentz CS, Chen YE et al (2020) Characterization of Serine Hydrolases Across Clinical Isolates of Commensal Skin Bacteria Staphylococcus epidermidis Using Activity-Based Protein Profiling. ACS Infect Dis 6(5):930\u0026ndash;938. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acsinfecdis.0c00095\u003c/span\u003e\u003cspan address=\"10.1021/acsinfecdis.0c00095\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu CH, Chen YT, Hou MH, Hu NJ, Chen CS, Shaw JF (2018) Crystallographic analysis of the staphylococcus epidermidis lipase involved in esterification in aqueous solution. Acta Crystallogr F Struct Biol Commun 74(6):351\u0026ndash;354. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1107/S2053230X18006775\u003c/span\u003e\u003cspan address=\"10.1107/S2053230X18006775\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSimons JW, van Kampen MD, Riel S, G\u0026ouml;tz F, Egmond MR, Verheij HM (1998) Cloning, purification and characterisation of the lipase from Staphylococcus epidermidis\u0026ndash;comparison of the substrate selectivity with those of other microbial lipases. Eur J Biochem 253(3):675\u0026ndash;683. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1432-1327.1998.2530675.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1432-1327.1998.2530675.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLongshaw CM, Farrell AM, Wright JD, Holland KT (2000) Identification of a second lipase gene, gehD, in Staphylococcus epidermidis: comparison of sequence with those of other staphylococcal lipases. Microbiol (Reading) 146(Pt 6):1419\u0026ndash;1427. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/00221287-146-6-1419\u003c/span\u003e\u003cspan address=\"10.1099/00221287-146-6-1419\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNikoleit K, Rosenstein R, Verheij HM, G\u0026ouml;tz F (1995) Comparative biochemical and molecular analysis of the staphylococcus hyicus, staphylococcus aureus and a hybrid lipase. Indication for a C-terminal phospholipase domain. Eur J Biochem 228(3):732\u0026ndash;738\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"archives-of-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aomi","sideBox":"Learn more about [Archives of Microbiology](https://www.springer.com/journal/203)","snPcode":"203","submissionUrl":"https://submission.nature.com/new-submission/203/3","title":"Archives of Microbiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Staphylococcus epidermidis, SarZ, transcription factor, lipase","lastPublishedDoi":"10.21203/rs.3.rs-7510667/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7510667/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eS. \u003cem\u003eepidermidis\u003c/em\u003e plays a crucial role in maintaining the skin immunity barrier. However, when host immunity is compromised, it can also lead to skin infections and bloodstream infections. Staphylococcal lipases contribute to bacterial growth, detoxification, and immune evasion, while their esterification capabilities also give them potential biotechnological applications. \u003cem\u003eS. epidermidis\u003c/em\u003e secretes at least two lipases, GehC and GehD, which are indirectly regulated by the global regulators Agr and SarA. SarZ, a transcription factor of the SarA family, regulates the expression of various exoproteins, but its role in regulation of lipase synthesis remains unknown. A \u003cem\u003esarZ\u003c/em\u003e gene knockout strain of \u003cem\u003eS epidermidis\u003c/em\u003e previously constructed was utilized in this study. First, lipase activity was found to be significantly elevated in the sarZ mutant relative to the wild-type strain, as determined by both the olive oil agar plate assay and the p-nitrophenol assay. Subsequently, qRT-PCR experiments revealed that SarZ controls the transcription of \u003cem\u003egehC\u003c/em\u003e and \u003cem\u003egehD\u003c/em\u003e divergently. Furthermore, EMSA experiments demonstrated that the recombinant SarZ protein can directly bind to the promoter regions of \u003cem\u003egehC\u003c/em\u003e and \u003cem\u003egehD\u003c/em\u003e. These findings demonstrate that SarZ negatively regulates lipase activity by directly modulating expression of lipase genes, providing a basis for further understanding the regulatory mechanism of lipase production in \u003cem\u003eS. epidermidis\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"SarZ negatively regulates the lipase activity in Staphylococcus epidermidis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-12 12:08:29","doi":"10.21203/rs.3.rs-7510667/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-21T04:45:11+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-13T16:15:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"329975073409871545988981985668107997639","date":"2025-09-13T08:47:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-10T14:38:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"81424942736621789881472567231897106557","date":"2025-09-09T15:01:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"335609778022647961867683746271657389094","date":"2025-09-09T12:45:02+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-07T02:23:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-04T14:03:22+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-04T08:45:06+00:00","index":"","fulltext":""},{"type":"submitted","content":"Archives of Microbiology","date":"2025-09-01T17:08:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"archives-of-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aomi","sideBox":"Learn more about [Archives of Microbiology](https://www.springer.com/journal/203)","snPcode":"203","submissionUrl":"https://submission.nature.com/new-submission/203/3","title":"Archives of Microbiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e918820d-29d2-474a-9f99-ae8bcf3dcd06","owner":[],"postedDate":"September 12th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-16T16:07:06+00:00","versionOfRecord":{"articleIdentity":"rs-7510667","link":"https://doi.org/10.1007/s00203-026-04809-6","journal":{"identity":"archives-of-microbiology","isVorOnly":false,"title":"Archives of Microbiology"},"publishedOn":"2026-03-14 15:59:29","publishedOnDateReadable":"March 14th, 2026"},"versionCreatedAt":"2025-09-12 12:08:29","video":"","vorDoi":"10.1007/s00203-026-04809-6","vorDoiUrl":"https://doi.org/10.1007/s00203-026-04809-6","workflowStages":[]},"version":"v1","identity":"rs-7510667","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7510667","identity":"rs-7510667","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00