Secukinumab’ Cardioprotective Effect in Doxorubicin-induced cardiomyopathy: Targeting the NF-κB/NLRP3 Pathway in Rats

Secukinumab’ Cardioprotective Effect in Doxorubicin-induced cardiomyopathy: Targeting the NF-κB/NLRP3 Pathway in Rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Secukinumab’ Cardioprotective Effect in Doxorubicin-induced cardiomyopathy: Targeting the NF-κB/NLRP3 Pathway in Rats Mostafa D. Hassen, Nahla O. Mousa, Sara M. Radwan, Refaat M. Gabre This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4314388/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Mar, 2025 Read the published version in Inflammation → Version 1 posted You are reading this latest preprint version Abstract Doxorubicin (DOX) is a medication employed in the treatment of cancer as a chemotherapeutic agent. However, it induces cardiotoxicity via activating inflammatory pathways. Cytokines dysregulation is a key factor that can lead to activation of inflammatory mechanisms. Interleukin-17A (IL-17A) is a pro-inflammatory cytokine that triggers pathogenic immune responses. The objective of this study was to investigate the defensive power of secukinumab (SEC), a fully human monoclonal IgG1/κ antibody targeting IL-17A, designed to combat DOX-induced cardiotoxicity (DIC). Male Wistar rats were treated with DOX and co-treated with SEC for two weeks. The results showed that DOX caused heart tissue injury, increased cardiotoxicity markers significantly (P < 0.0001), oxidative stress and inflammation. Additionally, DOX activated the nuclear factor kappa beta (NF-κB) pathway and Pyrin domain containing 3 (NLRP3) inflammasome, potentially contributing to DIC. The co-treatment with SEC successfully reversed all DOX-related abnormalities by restoring cardiac functions to normal levels, decreasing levels of inflammatory cytokines, including IL-17A and Interleukin-1β (IL-1β), and improving oxidative stress by lowering malondialdhyde (MDA) levels and increasing reduced glutathione (GSH) levels. Furthermore, it also decreased the upregulation of the NF-κB/NLRP3 axis induced by doxorubicin. This study highlights the protective properties of SEC against DIC by modulating the NF-κB/NLRP3/caspase1/IL-1β axis. Doxorubicin Cardioprotective Interleukin-17A Nuclear factor kappa beta Secukinumab Pyrin domain containing 3. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Research Highlights - Administration of Anti-IL-17A monoclonal antibody has critical role in silencing of acute cardiotoxicity through management of inflammation. - Anti–inflammation strategy is achieved by blocking of IL-17R which downregulates NFκB / NLRP3 pathway. - The development of biologics targeting the IL-17A pathway has been exciting as they have opened a novel therapeutic target. 1. Introduction Doxorubicin (DOX), an antibiotic derived from anthracycline, has been widely employed in clinical settings as a chemotherapeutic agent to combat various forms of cancer [1]. Upon DOX administration, several intense adverse reactions are encountered including cardiotoxicity which is considered as the main major treatment side effect [2]. Many clinical findings showed that left ventricular dysfunction, dilated cardiomyopathy and heart failure are usually developed upon the completion of DOX treatment protocol [3]. Such complications are triggered by cardiomyocyte apoptosis and myocardial fibrosis occurring due to DOX-associated oxidative stress and mitochondrial damage [4]. To date, the cumulative dose of DOX is the main factor that contributes to the onset of cardiomyopathies induced by cancer therapy [5]. The cardiac remodeling is usually developed via aberrated inflammatory responses post-DOX therapy [6]. The complicated cytokines network constitutes a possible potent mechanistic link between DOX therapy and the deteriorated cardiac function [7]. Intriguingly, IL-17A, also referred to as Interleukin-17A, is an inflammatory cytokine that exacerbates the cardiovascular system and plays a crucial role in the development of cardiovascular diseases and myocardial infarction [8] and responsible for pathogenesis of multiple autoimmune and inflammatory conditions [9]. In addition, IL-17A upregulation was detected in sepsis, pneumonia, allograft rejection conditions, and notably in cancer [10]. As a defensive reaction from the innate immune system during various diseases and infections or stress conditions, a polymeric structure known as inflammasome composed of sensor proteins, junction molecules, and effectors is assembled [11]. The inflammatory response is triggered by the inflammasome, which releases various inflammatory factors such as Interleukin IL-1β (IL-1β), Interleukin IL-18 (IL-18), and Interleukin IL-37 [12]. The inflammasome activation is responsible for cardiac hypertrophy, pyroptosis and fibrosis hence they are involved in the pathogenesis of heart failure [13]. The NLRP3 inflammasome stands out as the unique inflammasome due to its nucleotide-binding domain, leucine-rich–containing family, and pyrin domain–containing-3 composition that is expressed in diverse types of cells including neutrophils, lymphocytes, macrophages, microglia, epithelial cells, neurons, osteoblasts and dendritic cells [14]. Activated NLRP3 inflammasomes induce the release of IL-1β and IL-18 which contribute in the pathophysiology of atherosclerosis and coronary heart diseases [15]. IL-17 inhibitors are medications that target IL-17, blocking its inflammatory effects by interfering with the binding of IL-17A to its receptor IL17RA. These inhibitors are commonly used to manage inflammatory conditions in gastroenterology, rheumatology, and dermatology [16]. Monoclonal antibody therapies have shown to be particularly effective among the various inhibition strategies. One such monoclonal antibody, Secukinumab (SEC), is approved for treating psoriasis, psoriatic arthritis, and ankylosing spondylitis, with ongoing research for other autoimmune disorders [17]. Recent studies have highlighted the role of IL-17A in connecting cardiovascular disease with psoriatic inflammation, suggesting that anti-IL-17A therapy could not only benefit skin conditions but also reduce cardiovascular inflammation. Administration of Secukinumab has been shown to improve left ventricular function by reducing levels of oxidative stress markers like MDA and protein carbonyl [18]. While the efficacy of IL-17A antagonists in inflammatory disorders has been well described, those on the cancer- and chemotherapy-associated cardiovascular diseases remain less explored. In this study, the potential cardioprotective effect of SEC was assessed in rat model of DOX-induced cardiotoxicity (DIC). SEC anti-inflammatory effect and its potential role in attenuating the cardiotoxic effects of DOX through modulation of NFκB/NLRP3/caspase1/IL-1β axis were elucidated. 2. Materials and methods 2.1. Ethics statement The research was given the green light by the ethics committee at Cairo University, and all experimental methods were authorized by the Animal Care and Use (CU-IACUC) Committee of Cairo University. Animal welfare and experimental procedures were conducted following protocols (Protocol # CU-I /F/15/23) and in compliance with NIH standards for animal research. 2.2. Drugs and chemicals Secukinumab (SEC) was acquired in the form of Cosentyx, a 150 mg/mL prefilled pen manufactured by Novartis Pharmaceuticals Corporation in the United States. Doxorubicin (DOX) was purchased from EMIC (EMIC United Pharmaceuticals Co, (Egypt). Biochemicals and substrates were purchased from Biodiagnostic (Egypt). 2.3. Animals In this study, male Wistar albino rats, aged eight weeks and weighing between 160-180 g, were utilized. Prior to the experiment, the animals were given a two-week acclimatization period and were housed in an environment with a humidity level of 55±5% and an ambient temperature of 22±1°C, which was controlled. The rats were provided with a standard diet and had access to water throughout the study. 2.4. Experimental design Twenty-eight Wistar rats were weighed and then separated into 4 groups, with 7 rats in each group. The first group, known as the control group, received 0.9 ml/kg of 0.9% saline intraperitoneally three times a week for 2 weeks. The second group, treated with DOX, received 2.5 mg/kg of DOX intraperitoneally three times a week for 2 weeks, totaling 15 mg/kg [19]. The third group, the SEC control group, received 0.9 mg/kg of SEC intraperitoneally three times a week for 2 weeks [20]. Lastly, the fourth group, SEC+DOX, received 0.9 mg/kg of SEC along with 2.5 mg/kg of intraperitoneal DOX injection three times a week for 2 weeks, as illustrated in (Fig.1) of the study design. The initial body weight was documented. The animals' overall health and mortality rate were monitored daily for duration of two weeks. The day after the final administration, the animals' final body weights were measured. They were then anesthetized using dimethyl ether and underwent ECG recording. Samples of blood were collected from the retro-orbital plexus and left to coagulate. Subsequently, the samples underwent centrifugation at a speed of 3000 rpm and a temperature of 4°C for duration of 10 minutes in order to separate the serum. Portions of the serum were then stored at -80°C for subsequent biochemical analysis. The animals were decapitated, and the weights of their hearts were recorded. The hearts were isolated and quickly rinsed with ice-cold saline. A portion of the heart tissues was fixed in 10% phosphate-buffered formalin for 24 hours for pathological examination. The remaining portion was swiftly frozen in liquid nitrogen and preserved at -80°C for future examination. Homogenization was carried out using ice-cooled phosphate buffer saline with a pH of 7.4. Subsequently, the mixture was subjected to centrifugation at 10,000 rpm for 10 minutes at 4°C, and the resultant supernatant was meticulously gathered for analysis. 2.5. Electrocardiography (ECG) An ECG was conducted at the start of the study to verify the typical ECG pattern of the rats. On the final day of the study, the rats were anesthetized with dimethyl ether and their ECG was recorded for duration of 1 minute. The heart rate, P duration, QRS Interval, QTc, and ST height were observed using the ECG Power lab module, which includes Power-lab/8sp and Animal Bio-Amplifier from Australia, along with Lab Chart 7 software featuring ECG analyzer [21, 22]. 2.6. Weight of the body and ratio of heart weight to body weight Body weight was measured at the start and end of the research in each group. The heart weight (HW) to body weight (BW) ratio was determined through computation [23]. 2.7. Histopathological examination The cardiac tissues underwent fixation in 10% paraformaldehyde and subsequent dehydration. Following this, the processed samples were encased in paraffin wax and sectioned into 5-μm thick slices using tissue-processing equipment. These sections were then deparaffinized and stained with Hematoxylin and Eosin (HE) for histological examination using conventional methods. The slides were then qualitatively assessed under a light microscope (Olympus Soft Imaging Solution GmbH, Germany) to detect various histopathological alterations [24]. 2.8. Assessment of Total Protein Protein levels were quantified in heart tissue homogenate utilizing the bicinchoninic acid (BCA) protein assay purchased from Abcam (Waltham, MA, USA) for each sample. 2.9. Assessment of Oxidative Stress The levels of oxidative stress were evaluated by measuring MDA and GSH in cardiac homogenate using commercial kits (Bio-diagnostic, Cairo, Egypt) as per the manufacturer's protocol. 2.10. Assessment of serum cardiotoxicity indices The spectrophotometric method was employed to determine the activity of serum creatine kinase isoenzyme-MB (CK-MB) utilizing a commercial kit acquired from Spectrum diagnostics in Cairo, Egypt. Furthermore, the serum cardiac troponin I (cTn-I) level was assessed using an enzyme-linked immunosorbent assay (ELISA) kit (Sun Long Biotech Co, China; Cat. No. : SL0121Mo) in accordance with the manufacturer's guidelines. 2.11. Assessment of inflammatory cytokines The levels of IL-1β and IL-17A, which are inflammatory cytokines, were assessed in heart tissue homogenate. A commercial ELISA kit was utilized for this analysis, following the instructions provided by the manufacturer (bt-laboratory Co, China; Cat. No. E0119 Ra & AFG Bioscience Co, USA Cat. No. EK720975). 2.12. Assessment of NLRP3 inflammasome marker NLRP3 level was analyzed in cardiac tissue homogenate using a commercial ELISA kit according to the manufacturer’s instructions (Aviva System Biology Corp, USA; Cat. No.: OKCD04232). 2.13. Assessment of NFκB gene expression The heart tissues were used to extract total RNA using the TRIzol reagent Mini kit (Invitrogen R, Carlsbad, CA) following the manufacturer's instructions. The isolated RNA was then converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA; Cat.No.4368814). To assess the expression of NFκB, real-time PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems, USA; Cat.No.4309155). The thermo-cycling conditions recommended by the manufacturer were followed, including an initial denaturation at 95 o C for 10 min, followed by 40 cycles of denaturation at 95 o C for 30 s, annealing at 55 o C (NFκB) / 56 o C (GAPDH) for 30 s, and extension at 72 o C for 30 s. The PCR cycle was completed with a final extension at 72 o C for 5 min. The real-time PCR reaction was carried out using a Step One Plus thermal cycler (Applied Biosystems, USA). The primer sequences can be found in Table 1 . The data was analyzed using ABI Prism R 7000 SDS Software. Finally, the fold expression of each gene was calculated using the standard curve provided by each kit. The NFκB mRNA levels were standardized against the expression of the reference gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) [25, 26]. Table 1 The primer sequences for real-time PCR. Gene Primer Accession number NFκB Forward:5’- AATTGCCCCGGCAT -3' Reverse: 5’- TCCCGTAACCGCGTA -3’ [NM_01276711.1] GAPDH Forward: 5’- ATGACTCTACCCACGGCAAG -3' Reverse: 5’- CTGGAAGATGGTGATGGGTT -3’ [NM_017008.3] 2.14. Assessment of caspase-1 marker The manufacturer's protocol was followed to perform immunohistochemical staining for Caspase-1. Cardiac sections were deparaffinized, rehydrated, and unmasked with antigen in 10 mM sodium citrate buffer (pH 6.0) at 60°C for 10 minutes. Subsequently, the slides were cooled for 30 minutes. Afterward, the slides were washed with phosphate buffer solution (PBS) three times and then blocked with 1% BSA in PBS for 1 hour at room temperature. The sections were immunostained with primary anti-caspase-1 antibody (Novus biologicals, 0.1 mL USA; Cat.No. NB100-56565) overnight at 4°C, followed by another wash with PBS. HRP-conjugated secondary antibody was then incubated with the sections, which were subsequently reacted with DAB (3, 3’-diaminobenzidine). In order to calculate the levels of positive immune-expression for caspase-1 immunohistochemical staining, six distinct fields (magnification, ×400) were chosen at random for each tissue section of every sample. The Leica application module for tissue sections analysis, connected to a Full HD microscope imaging system (Leica Microsystems GmbH, Germany), was utilized to collect morphological measurements and analyze the data. Image quantitation was carried out with image software (version 1.48) to determine the area percent (A %) [27] 2.15. Statistical analysis. The data was presented using the mean ± standard deviation (SD). To compare parametric data from more than two groups, analysis of variance (ANOVA) with post hoc test (Tukey’s Multiple Comparison Test) was employed to evaluate individual groups. Statistical significance was determined at P < 0.05. The data analysis was performed using IBM SPSS statistics (V.19.0, IBM Corp., USA, 2010). 3. Results 3.1. Mortality rate and morphological changes Throughout the duration of the experiment, all animals in the four groups were found to have survived. Additionally, a decrease in daily food intake and physical activity was noted in both the DOX group and the SEC+DOX-treated group. It is worth mentioning that a significant fever was observed for only 48 hours at the beginning of the experiment. 3.2. Effect of SEC on final body weight, heart weight and cardiac index In comparison to the control group, rats treated with DOX experienced a noticeable decrease in final body weight by 7.48%. Additionally, there was a significant increase in cardiac weight and cardiac index by 25% and 35.1% respectively (P < 0.0001). Conversely, when intoxicated rats were administered SEC, their body weight increased significantly by 6.31%. Furthermore, there was a decrease in both their cardiac weight and index by 15.1% and 20.1% respectively compared to the DOX group (P < 0.0001). Rats that received both SEC and DOX displayed a significant increase in body weight by 4.62%. Moreover, there was a significant reduction in cardiac weight and index by 7.1% and 11.1% respectively compared to the DOX group (P < 0.0001) (Table 2) . Table 2 Effect of SEC on body weight, heart weight and cardiac index. Effect of SEC on body weight, heart weight and cardiac index. Tested groups Body Weight (gm) Heart Weight(gm) Cardiac index x 10^3 Initial Final Control 166.9 ± 3.33 173.7 ± 2.98 0.55 ± 0.029 3.16 DOX 176.0 ± 3.92 a 160.7 ± 2.81 a 0.69 ± 0.014 a 4.27 a SEC 166.1 ± 4.45 b 170.9 ± 4.33 b 0.58 ± 0.032 b 3.41 b SEC+DOX 172.0 ± 6.22 168.1 ± 5.96 b 0.64 ± 0.066 a,b,c 3.79 a,b,c Data are represented as mean ± SD (n = 7). a, b, c: Statistically significant from the control, DOX and SEC group, respectively at P < 0.05 using one-way ANOVA followed by Tukey‘s test for multiple comparisons. 3.3. Protective Effect of SEC on abnormal ECG The intoxication of DOX resulted in bradycardia, prolonged durations QRS complex, PR interval, and QTc interval exhibited significant differences in comparison to the control group. Conversely, the administration of SEC to intoxicated rats successfully reversed all ECG abnormalities induced by DOX. This was demonstrated by an increase in heart rate and a decrease in the duration of QRS interval, PR interval, and QTc when compared to the DOX group (Fig.2) . 3.4. Effect of SEC on histopathological alterations The heart tissue from the normal group displayed well-organized cardiomyocytes with normal histological features and no signs of degeneration or necrosis. In contrast, the DOX group exhibited degenerative changes in cardiomyocytes, myofibril fragmentation, pyknosis, and inflammatory cell infiltrates. However, co-treatment with SEC and DOX effectively improved these abnormalities. SEC co-treatment demonstrated significant cytoprotective effects on myocardial cells, reducing infiltration and degenerative changes in cardiomyocytes. Treatment with SEC alone also showed well-organized cardiomyocytes with some degenerated cardiac cells. These findings indicate the cardioprotective effects of SEC against DOX-induced cardiomyopathy in rats (Fig.3) 3.5. Effect of SEC on the serum cardiotoxicity indices Serum levels of CK-MB and c-TnI were evaluated as markers for myocardial injury. In the DOX group, there was a notable increase in serum CK-MB by 56.9% and c-TnI by 63.2% compared to the control group (P < 0.0001). However, co-treatment with SEC resulted in a significant decrease in serum CK-MB by 23.9% and c-TnI by 16.6% when compared to the DOX group (P < 0.0001) (Table 3). Table 3 Effect of SEC on serum CK-MB and cTnI. Tested groups CK-MB (U/l) cTnI (Pg/ml) Control 19.9 ± 0.86 24.6 ± 0.55 DOX 31.2 ± 1.43 a 40.1 ± 4.36 a SEC 21.9 ± 0.98 b 26.9 ± 1.05 b SEC+DOX 23.7 ± 1.91 a,b 33.4 ± 0.83 a,b,c Data are represented as mean ± SD (n = 7). a, b, c: Statistically significant from the control, DOX and SEC group, respectively at P < 0.05 using one-way ANOVA followed by Tukey‘s test for multiple comparisons. 3.6. Effect of SEC on DOX-Induced Oxidative Stress Table 4 displays the MDA and GSH concentrations in the cardiac homogenate. The DOX group exhibited a notable decrease in GSH levels (20.4%), while the content of MDA increased significantly (116.7%) compared to the normal group (P < 0.0001). Conversely, rats administered with SEC+DOX demonstrated a significant rise in GSH levels (15.9%) and a decrease in MDA levels (36%) compared to the DOX group (P < 0.0001), indicating the antioxidant properties of SEC in combating DIC. Table 4 Effect of SEC on MDA and GSH in cardiomyocytes. Tested groups MDA GSH (nmol/mg total protein) (mmol/mg total protein) Control 7.6 ± 0.58 0.63 ± 0.023 DOX 16.5 ± 2.21 a 0.50 ± 0.007 a SEC 9.2 ± 1.55 b 0.61 ± 0.064 b SEC+DOX 10.5 ± 1.71 a,b 0.58 ± 0.060 b Data are represented as mean ± SD (n = 7). a, b,: Statistically significant from the control and DOX group, respectively at P < 0.05 using one-way ANOVA followed by Tukey‘s test for multiple comparisons. 3.7. Effect of SEC treatment on inflammatory markers DOX treatment significantly increased the production of IL-17A and IL-1β in cardiomyocytes by 463% and 127.3%, respectively, compared to the normal group (P < 0.0001). Conversely, co-administration of SEC led to a notable decrease in these cytokines by 22.5% and 38.9% when compared to the DOX group (P < 0.0001) ( Table 5 ). Table 5: Effect of SEC on IL-17A and IL-1β in heart tissue Tested groups IL-17A IL-1β (Pg/mg total protein) (ng/mg total protein) Control 141.01 ± 11.68 0.77 ± 0.03 DOX 794.02 ± 60.01 A 1.74 ± 0.24 A SEC 155.37 ± 24.19 B 0.72 ± 0.06 B SEC+DOX 615.52 ± 43.70 a,b,c 1.06 ± 0.08 a,b,c Data are represented as mean ± SD (n = 7). a, b, c: Statistically significant from the control, DOX and SEC group, respectively at P < 0.05 using one-way ANOVA followed by Tukey‘s test for multiple comparisons. 3.8. Effect of SEC treatment on NFκB Gene Expression In (Fig.4), it is evident that rats administered with DOX experienced a 1.81-fold increase in NF-kB mRNA expression level, in contrast to the control group (P < 0.0001). Conversely, NF-kB mRNA expression level was reduced by 0.79-fold in SEC co-treatment compared to the DOX group (P < 0.0001). 3.9. Effect of SEC treatment on NLRP3 level Administration of DOX resulted in a notable increase of 130.4% in NLRP3 level in cardiomyocytes compared to the control group (P < 0.0001). Conversely, rats co-treated with SEC showed a significant reduction of 36.5% in NLRP3 level compared to the DOX group (P < 0.0001) (Fig.5). 3.10. Effect of SEC treatment on caspase-1 protein expression Upon DOX intoxication, the immunohistochemical analysis of caspase 1 expression displayed a significant increase, indicated by the intense brown staining (164.3%). in contrast to the control group (P < 0.0001). Conversely, pretreatment of intoxicated rats with SEC resulted in a notable decrease in caspase 1 content, as evidenced by the faint brown staining (41.2%) compared to the DOX group (P < 0.0001) (Fig.6). 4. Discussion The primary adverse effect of DOX as a potent anticancer medication is dose-dependent cardiotoxicity, leading to cardiomyopathy and significantly limiting its clinical application [28]. Hence, there is a critical requirement for novel therapeutic strategies to safeguard against DIC. Inflammation plays a crucial role in various cardiovascular diseases (CVDs), and the potential use of anti-inflammatory treatment in CVDs could be a key area for future investigation [29]. The anti-inflammatory approach is vital in managing the inflammatory cascade at an early stage [30]. The specific neutralization of IL-1 through Canakinumab (CANTOS trial) in patients with myocardial infarction notably decreased cardiovascular mortality [31]. Conversely, cardiovascular mortality remained unaffected following the use of non-specific anti-inflammatory treatment [32]. Given these points, highly specific molecular therapies directed at individual cytokines or their receptors are urgently warranted. Monoclonal antibodies directed against the IL-17-IL-17R pathway offer promising treatment possibilities for inflammatory autoimmune disorders [33]. SEC, a human monoclonal antibody that specifically blocks the interaction between IL-17A and its receptor, has shown long-lasting effectiveness in individuals suffering from psoriasis and ankylosing spondylitis [17]. While it has shown success in trials for treating inflammatory disorders clinically [34], its impact on CVDs remains uncertain. Therefore, the objective of this study was to explore and compare the potential cardioprotective effects of SEC against DIC. In this investigation, rats co-administered with DOX experienced substantial myocardial damage, as confirmed by histopathological analysis and the presence of ECG abnormalities. These abnormalities included bradycardia, prolonged QTc, and elevated PR interval durations. Additionally, the activities of two serum cardiac markers, CK-MB and cTnI, were significantly elevated. Previous studies have suggested that DOX-induced cardiotoxicity may be mediated by both oxidative stress and inflammation [28, 35-36]. Consistent with these findings, our data demonstrated that DOX administration to rats resulted in a notable increase in lipid peroxidation, as evidenced by elevated levels of cardiac MDA and a significant decrease in GSH. This pronounced oxidative stress within cardiomyocytes may contribute to degenerative changes in heart tissue, such as necrosis [19]. Interestingly, co-administration of SEC maintained the normal structure of cardiomyocytes, cardiac conduction, and biochemical cardiac indicators. Additionally, it diminished cardiac MDA levels and preserved cardiac GSH production that was reduced by DOX toxicity, indicating its cardioprotective function against DIC. Numerous studies advocate that inflammation plays a crucial role in the development of DIC [37, 38]. DOX can enhance various inflammatory factors, including IL-1β, IL-6, IL-8, IL-10, IL-17, and TNF-α [36, 37]. IL-17A is recognized as a potent proinflammatory factor and is the most extensively studied member of the IL-17 family [8]. Markedly elevated cardiac levels of IL-17A were observed following DOX treatment. The interaction of IL-17A with IL-17RA has been shown to stimulate interstitial remodeling, proliferation, and inflammation through IL17R/NF-κB signaling [39], as evidenced by the upregulation of NF-κB gene expression in DOX-intoxicated rats in our study. Furthermore, our findings highlighted the robust anti-inflammatory properties of SEC as another critical mechanism underlying its promising cardioprotective impact against DIC, as demonstrated by the suppression of both IL-17A and NF-κB inflammatory markers. NF-κB is recognized as a key regulator of cellular inflammatory responses triggered by proinflammatory stimuli [40]. It plays a pivotal role in modulating molecular pathways associated with inflammation [41]. Activation of NF-κB signaling induces the transcription of pro-IL-1β and NLRP3, which is essential for inflammasome activation [42]. NLRP3 is the most extensively studied inflammasome sensor in the heart [43], forming oligomers and binding to pro-caspase-1 via apoptosis-associated speck-like, resulting in caspase-1 activation [42]. Active caspase-1 then cleaves pro-IL-1β into its mature form, after which the activated NLRP3 inflammasome and caspase-1 are partially released from the cells along with IL-1β [44]. This pathway was confirmed in the current study, where administration of DOX increased the levels of NLRP3, caspase-1, and IL-1β in the heart. Conversely, co-treatment with SEC reduced their levels, indicating that the cardioprotective role of SEC in DIC may be achieved through modulation of the NFκB/NLRP3/caspase1/IL-1β axis. In conclusion, our research demonstrated that co-administration of SEC with DOX maintained serum cardiac indices and cardiac levels of GSH, while also decreasing cardiac MDA, IL-17A, and IL-1β levels. This suggests the potent antioxidative and anti-inflammatory properties of SEC. Moreover, this is the initial study to highlight the role of SEC in improving the NFKB/NLRP3/caspase1/IL-1β axis in DIC. Further investigations are necessary to elucidate the precise mechanism of SEC. It is advisable to conduct additional clinical trials utilizing different doses of SEC to uncover its beneficial effects in a clinical environment. Declarations Author contributions all authors contributed to the study conception and design. material preparation, data collection and analysis were performed by mostafa drawy hassen. the first draft of the manuscript was written by nahla osama mohamed. the review and editing were carried out by sara mustafa abd elsalam radwan. all these work was under supervision of refaat mohamed refaat gabr. Funding No funding was received to assist with the preparation of this manuscript. Conflict of interest All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or non-financial interest in the subject matter or materials discussed in this manuscript. References Haupt, L. P., Rebs, S., Maurer, W., Hübscher, D., Tiburcy, M., Pabel, S., ... & Streckfuss-Bömeke, K. (2022). Doxorubicin induces cardiotoxicity in a pluripotent stem cell model of aggressive B cell lymphoma cancer patients. Basic research in cardiology, 117(1), 13. https://doi.org/10.1007/s00395-022-00918-7 Jain, A., & Rani, V. (2018). Assessment of herb-drug synergy to combat doxorubicin induced cardiotoxicity. Life Sciences, 205, 97-106.https://doi.org/10.1016/j.lfs.2018.05.021 Al-Salam, S., Kandhan, K., Sudhadevi, M., & Tariq, S. (2022). Nootkatone Ameliorates Doxorubicin Induced Myocardial Injury through Modulation of NF-κB Signals and Oxidative Stress. Cell Physiol. Biochem, 56, 401-417. DOI: 10.33594/000000559 Renu, K., Abilash, V. G., PB, T. P., & Arunachalam, S. (2018). Molecular mechanism of doxorubicin-induced cardiomyopathy–An update. European journal of pharmacology, 818, 241-253.https://doi.org/10.1016/j.ejphar.2017.10.043 Zhao, L., & Zhang, B. (2017). Doxorubicin induces cardiotoxicity through upregulation of death receptors mediated apoptosis in cardiomyocytes. Scientific reports, 7(1), 44735.https://doi.org/10.1038/srep44735 Yang, H. L., Hsieh, P. L., Hung, C. H., Cheng, H. C., Chou, W. C., Chu, P. M., ... & Tsai, K. L. (2020). Early moderate intensity aerobic exercise intervention prevents doxorubicin-caused cardiac dysfunction through inhibition of cardiac fibrosis and inflammation. Cancers, 12(5), 1102.https://doi.org/10.3390/cancers12051102 Shi, S., Chen, Y., Luo, Z., Nie, G., & Dai, Y. (2023). Role of oxidative stress and inflammation-related signaling pathways in doxorubicin-induced cardiomyopathy. Cell Communication and Signaling, 21(1), 61.https://doi.org/10.1186/s12964-023-01077-5 Wang, B., Hou, X., Sun, Y., Lei, C., Yang, S., Zhu, Y., ... & Song, L. (2022). Interleukin-17A influences the vulnerability rather than the size of established atherosclerotic plaques in apolipoprotein E-deficient mice. Open Life Sciences, 17(1), 1104-1115. https://doi.org/10.1515/biol-2022-0072 Robert, M., & Miossec, P. (2020). Interleukin-17 and lupus: enough to be a target? For which patients?. Lupus, 29(1), 6-14.https://doi.org/10.1177/0961203319891243 Ge, Y., Huang, M., & Yao, Y. M. (2020). Biology of interleukin-17 and its pathophysiological significance in sepsis. Frontiers in immunology, 11, 548387.https://doi.org/10.3389/fimmu.2020.01558 Shi, W., Jin, M., Chen, H., Wu, Z., Yuan, L., Liang, S., ... & Ou, C. (2023). Inflammasome activation by viral infection: mechanisms of activation and regulation. Frontiers in Microbiology, 14, 1247377. https://doi.org/10.3389/fmicb.2023.1247377 Chan, A. H., & Schroder, K. (2019). Inflammasome signaling and regulation of interleukin-1 family cytokines. Journal of Experimental Medicine, 217(1), e20190314. https://doi.org/10.1084/jem.20190314 Wu, J., Dong, E., Zhang, Y., & Xiao, H. (2021). The role of the inflammasome in heart failure. Frontiers in physiology, 12, 709703.https://doi.org/10.3389/fphys.2021.709703 Zahid, A., Li, B., Kombe, A. J. K., Jin, T., & Tao, J. (2019). Pharmacological inhibitors of the NLRP3 inflammasome. Frontiers in immunology, 10, 2538. https://doi.org/10.3389/fimmu.2019.02538 Tanase, D. M., Valasciuc, E., Gosav, E. M., Ouatu, A., Buliga-Finis, O. N., Floria, M., ... & Serban, I. L. (2023). Portrayal of NLRP3 inflammasome in atherosclerosis: current knowledge and therapeutic targets. International Journal of Molecular Sciences, 24(9), 8162. https://doi.org/10.3390/ijms24098162 Țiburcă, L., Bembea, M., Zaha, D. C., Jurca, A. D., Vesa, C. M., Rațiu, I. A., & Jurca, C. M. (2022). The treatment with interleukin 17 inhibitors and immune-mediated inflammatory diseases. Current Issues in Molecular Biology, 44(5), 1851-1866. https://doi.org/10.3390/cimb44050127 Frieder, J., Kivelevitch, D., & Menter, A. (2018). Secukinumab: a review of the anti-IL-17A biologic for the treatment of psoriasis. Therapeutic advances in chronic disease, 9(1), 5-21. https://doi.org/10.1177/2040622317738910 Medovic, M. V., Jakovljevic, V. L., Zivkovic, V. I., Jeremic, N. S., Jeremic, J. N., Bolevich, S. B., ... & Srejovic, I. M. (2022). Psoriasis between autoimmunity and oxidative stress: changes induced by different therapeutic approaches. Oxidative medicine and cellular longevity, 2022. https://doi.org/10.1155/2022/2249834 Haybar, H., Goudarzi, M., Mehrzadi, S., Aminzadeh, A., Khodayar, M. J., Kalantar, M., & Fatemi, I. (2019). Effect of gemfibrozil on cardiotoxicity induced by doxorubicin in male experimental rats. Biomedicine & Pharmacotherapy, 109, 530-535. https://doi.org/10.1016/j.biopha.2018.10.101 Liu, S. P., Huang, L., Flores, J., Ding, Y., Li, P., Peng, J., ... & Tang, J. P. (2019). Secukinumab attenuates reactive astrogliosis via IL‐17RA/(C/EBPβ)/SIRT1 pathway in a rat model of germinal matrix hemorrhage. CNS neuroscience & therapeutics, 25(10), 1151-116. https://doi.org/10.1111/cns.13144 Mustafa, H. N., Hegazy, G. A., El Awdan, S. A., & AbdelBaset, M. (2017). Protective role of CoQ10 or L-carnitine on the integrity of the myocardium in doxorubicin induced toxicity. Tissue and Cell, 49(3), 410-426.https://doi.org/10.1016/j.tice.2017.03.007 Saleh, D., Abdelbaset, M., Hassan, A., Sharaf, O., Mahmoud, S., & Hegazy, R. (2020). Omega-3 fatty acids ameliorate doxorubicin-induced cardiorenal toxicity: In-vivo regulation of oxidative stress, apoptosis and renal Nox4, and in-vitro preservation of the cytotoxic efficacy. Plos one, 15(11), e0242175. https://doi.org/10.1371/journal.pone.0242175 Razmaraii, N., Babaei, H., Nayebi, A. M., Asadnasab, G., Helan, J. A., & Azarmi, Y. (2016). Cardioprotective effect of phenytoin on doxorubicin-induced cardiac toxicity in a rat model. Journal of cardiovascular pharmacology, 67(3), 237-245. DOI: 10.1097/FJC.0000000000000339 Bancroft, J. D., & Gamble, M. (Eds.). (2008). Theory and practice of histological techniques. Elsevier health sciences. Chen, W., Chen, W., Zhu, J., Chen, N., & Lu, Y. (2016). Potent anti-inflammatory activity of tetramethylpyrazine is mediated through suppression of NF-k. Iranian journal of pharmaceutical research: IJPR, 15(1), 197. PMID: 27610159 .PMCID: PMC4986104 Abo-El Fetoh, M. E., Abdel-Fattah, M. M., Mohamed, W. R., Ramadan, L. A., & Afify, H. (2023). Cyclooxygenase-2 activates EGFR–ERK1/2 pathway via PGE2-mediated ADAM-17 signaling in testosterone-induced benign prostatic hyperplasia. Inflammopharmacology, 31(1), 499-516.https://doi.org/10.1007/s10787-022-01123-7 El-Rous, M. A., Saber, S., Raafat, E. M., & Ahmed, A. A. (2021). Dapagliflozin, an SGLT2 inhibitor, ameliorates acetic acid-induced colitis in rats by targeting NFκB/AMPK/NLRP3 axis. Inflammopharmacology, 29(4), 1169-1185. https://doi.org/10.1007/s10787-021-00818-7 Eisvand, F., Imenshahidi, M., Ghasemzadeh Rahbardar, M., Tabatabaei Yazdi, S. A., Rameshrad, M., Razavi, B. M., & Hosseinzadeh, H. (2022). Cardioprotective effects of alpha‐mangostin on doxorubicin‐induced cardiotoxicity in rats. Phytotherapy research, 36(1), 506-524.https://doi.org/10.1002/ptr.7356 Wang, Y., Liu, X., Shi, H., Yu, Y., Yu, Y., Li, M., & Chen, R. (2020). NLRP3 inflammasome, an immune‐inflammatory target in pathogenesis and treatment of cardiovascular diseases. Clinical and Translational Medicine, 10(1), 91-106. https://doi.org/10.1002/ctm2.13 Zhang, Z., Chen, F., Wan, J., & Liu, X. (2023). Potential traditional Chinese medicines with anti-inflammation in the prevention of heart failure following myocardial infarction. Chinese Medicine, 18(1), 28.https://doi.org/10.1186/s13020-023-00732-w Ridker, P. M., Everett, B. M., Thuren, T., MacFadyen, J. G., Chang, W. H., Ballantyne, C., ... & Glynn, R. J. (2017). Antiinflammatory therapy with canakinumab for atherosclerotic disease. New England journal of medicine, 377(12), 1119-1131. DOI: 10.1056/NEJMoa1707914 Ridker, P. M., Everett, B. M., Pradhan, A., MacFadyen, J. G., Solomon, D. H., Zaharris, E., ... & Glynn, R. J. (2019). Low-dose methotrexate for the prevention of atherosclerotic events. New England Journal of Medicine, 380(8), 752-762. DOI: 10.1056/NEJMoa1809798 Sisto, M., & Lisi, S. (2023). Targeting Interleukin-17 as a Novel Treatment Option for Fibrotic Diseases. Journal of Clinical Medicine, 13(1), 164. https://doi.org/10.3390/jcm13010164 Klint, S., Feldwisch, J., Gudmundsdotter, L., Dillner Bergstedt, K., Gunneriusson, E., Höidén Guthenberg, I., ... & Frejd, F. Y. (2023, December). Izokibep: preclinical development and first-in-human study of a novel IL-17A neutralizing Affibody molecule in patients with plaque psoriasis. In MAbs (Vol. 15, No. 1, p. 2209920). Taylor & Francis. https://doi.org/10.1080/19420862.2023.2209920 Quagliariello, V., Vecchione, R., Coppola, C., Di Cicco, C., De Capua, A., Piscopo, G., ... & Maurea, N. (2018). Cardioprotective effects of nanoemulsions loaded with anti-inflammatory nutraceuticals against doxorubicin-induced cardiotoxicity. Nutrients, 10(9), 1304.https://doi.org/10.3390/nu10091304 Wang, Z., Wang, M., Liu, J., Ye, J., Jiang, H., Xu, Y., ... & Wan, J. (2018). Inhibition of TRPA1 attenuates doxorubicin-induced acute cardiotoxicity by suppressing oxidative stress, the inflammatory response, and endoplasmic reticulum stress. Oxidative Medicine and Cellular Longevity, 2018. https://doi.org/10.1155/2018/5179468 Reis-Mendes, A., Padrão, A. I., Duarte, J. A., Gonçalves-Monteiro, S., Duarte-Araújo, M., Remião, F., ... & Costa, V. M. (2021). Role of inflammation and redox status on doxorubicin-induced cardiotoxicity in infant and adult CD-1 male mice. Biomolecules, 11(11), 1725. https://doi.org/10.3390/biom11111725 Reis-Mendes, A., Ferreira, M., Duarte, J. A., Duarte-Araújo, M., Remião, F., Carvalho, F., ... & Costa, V. M. (2023). The role of inflammation and antioxidant defenses in the cardiotoxicity of doxorubicin in elderly CD-1 male mice. Archives of Toxicology, 97(12), 3163-3177. https://doi.org/10.1007/s00204-023-03586-1 Ma, L., Jiang, M., Zhao, X., Sun, J., Pan, Q., & Chu, S. (2020). Cigarette and IL-17A synergistically induce bronchial epithelial-mesenchymal transition via activating IL-17R/NF-κB signaling. BMC Pulmonary Medicine, 20, 1-7. https://doi.org/10.1186/s12890-020-1057-6 Ucci, M., Di Tomo, P., Tritschler, F., Cordone, V. G., Lanuti, P., Bologna, G., ... & Pandolfi, A. (2019). Anti-inflammatory role of carotenoids in endothelial cells derived from umbilical cord of women affected by gestational diabetes mellitus. Oxidative medicine and cellular longevity, 2019.https://doi.org/10.1155/2019/8184656 Luo, Q., Ma, H., Guo, E., Yu, L., Jia, L., Zhang, B., ... & Liu, R. (2022). MicroRNAs promote the progression of sepsis-induced cardiomyopathy and neurovascular dysfunction through upregulation of NF-kappaB signaling pathway-associated HDAC7/ACTN4. Frontiers in Neurology, 13, 909828. https://doi.org/10.3389/fneur.2022.909828 Acevedo, W., Morán-Figueroa, R., Vargas-Chacoff, L., Morera, F. J., & Pontigo, J. P. (2023). Revealing the Salmo salar NLRP3 Inflammasome: Insights from Structural Modeling and Transcriptome Analysis. International Journal of Molecular Sciences, 24(19), 14556.https://doi.org/10.3390/ijms241914556 Napodano, C., Carnazzo, V., Basile, V., Pocino, K., Stefanile, A., Gallucci, S., ... & Marino, M. (2023). NLRP3 Inflammasome Involvement in Heart, Liver, and Lung Diseases—A Lesson from Cytokine Storm Syndrome. International Journal of Molecular Sciences, 24(23), 16556. https://doi.org/10.3390/ijms242316556 Baroja-Mazo, A., Martín-Sánchez, F., Gomez, A. I., Martínez, C. M., Amores-Iniesta, J., Compan, V., ... & Pelegrín, P. (2014). The NLRP3 inflammasome is released as a particulate danger signal that amplifies the inflammatory response. Nature immunology, 15(8), 738-748.https://doi.org/10.1038/ni.2919 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 10 Mar, 2025 Read the published version in Inflammation → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4314388","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":295062130,"identity":"4261a5ea-5460-4f7c-884d-e7f98f6c2741","order_by":0,"name":"Mostafa D. Hassen","email":"","orcid":"","institution":"Ain Shams University","correspondingAuthor":false,"prefix":"","firstName":"Mostafa","middleName":"D.","lastName":"Hassen","suffix":""},{"id":295062132,"identity":"56568d63-a82c-4525-83e2-90e9561a4a82","order_by":1,"name":"Nahla O. Mousa","email":"","orcid":"","institution":"Cairo University","correspondingAuthor":false,"prefix":"","firstName":"Nahla","middleName":"O.","lastName":"Mousa","suffix":""},{"id":295062133,"identity":"696b177e-6002-4ade-90d4-505b9aae8a4f","order_by":2,"name":"Sara M. Radwan","email":"","orcid":"","institution":"Ain Shams University","correspondingAuthor":false,"prefix":"","firstName":"Sara","middleName":"M.","lastName":"Radwan","suffix":""},{"id":295062134,"identity":"2ce1b73a-5ebe-4c7c-b087-329fd712397b","order_by":3,"name":"Refaat M. Gabre","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIiWNgGAWjYHACNiC2YWBghvAYG4jUkka6lsNwHmEt5v2Lnz2uqDhvz9/OwPiZh8FGdsMB5sMv8GmRufHM3PDMmduJMw4zMEvzMKQZbzjAlmaBT4uExAEzyca22wkGzAxszDwMhxM3HOAxM8Cv5fg3ycZ/5+yhWv4DtfB/w6+FvwdoS8MBxg0QLQdAtjA/wG8LT7lhw7FkoF8YmyXnGCQbzzzMZoZPB9CW49seNtTY2fP3Hz744U2FnWzf8ebHH/DrSYCxQDEC8gTQhRJ4tfAfwBRjxm/LKBgFo2AUjDQAANMyRKYxNcYMAAAAAElFTkSuQmCC","orcid":"","institution":"Cairo University","correspondingAuthor":true,"prefix":"","firstName":"Refaat","middleName":"M.","lastName":"Gabre","suffix":""}],"badges":[],"createdAt":"2024-04-23 21:54:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4314388/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4314388/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10753-024-02187-z","type":"published","date":"2025-03-11T00:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":55494021,"identity":"4f2b70ff-b6dd-454b-b8a6-e57c522a8c84","added_by":"auto","created_at":"2024-04-29 08:04:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":118155,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental design and timeline: Rats were allocated into four groups: Control, DOX, SEC, and SEC + DOX groups.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4314388/v1/71f62f1e9bd82938a004cbfd.png"},{"id":55493505,"identity":"c89c4dea-1e75-4536-939e-a5f6f46e8ca9","added_by":"auto","created_at":"2024-04-29 07:56:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":101639,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SEC on ECG abnormalities in DIC. (A) ECG graph, (B) QRS interval, (C) PR interval, (D) QTc and (E) Heart rate (beat/min). Data are represented as mean ± SD (n = 7). a, b, c: Statistically significant from the control, DOX and SEC group, respectively at P \u003cem\u003e\u0026lt; \u003c/em\u003e0.05 using one-way ANOVA followed by Tukey‘s test for multiple comparisons.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4314388/v1/915c014dbd629e63d43b5598.png"},{"id":55494020,"identity":"e16007be-2cf5-4c0b-9629-3398ba140ae2","added_by":"auto","created_at":"2024-04-29 08:04:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":904291,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SEC on DOX-induced histological alterations of the heart tissue (n = 7). \u003cstrong\u003e(A)\u003c/strong\u003e Control group: demonstrated well organized apparent intact cardiomyocytes (Arrows) with normal histological features without abnormal alterations, with no visible signs of degeneration or necrosis, \u003cstrong\u003e(B) \u003c/strong\u003eDOX treated group (15 mg/kg) showed marked distortion (blue arrow) and Wide separation (black stars) of cardiac myocytes in presence of focal subendocardial necrosis of cardiomyocytes with patches of fragmented cardiomyocytes (black arrow) and degenerated fibers with nuclear pyknosis (dashed arrow) as well as inflammatory cells infiltrates (red arrow), \u003cstrong\u003e(C)\u003c/strong\u003e SEC (0.9 mg/kg) treated group showed higher records of well-organized apparent intact cardiomyocytes (arrow) alternated with few records of degenerated cardiac cells (dashed arrow) and \u003cstrong\u003e(D)\u003c/strong\u003eSEC (0.9 mg/kg) and DOX (15 mg/kg) treated group: showed milder degenerative changes of cardiomyocytes (=Group B annotations) with few congested intermuscular blood vessels (red star) and minimal inflammatory cells infiltrates.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4314388/v1/592d602f5f4c3c935cfd3b85.png"},{"id":55493503,"identity":"acd52bab-a292-4bef-9fff-f53ccb2ad6c0","added_by":"auto","created_at":"2024-04-29 07:56:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":12990,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SEC on Gene expression of NFκB in heart tissue in DIC. Values are means ± SD (n = 7). a, b, c: Statistically significant from the control, DOX and SEC+DOX group, respectively at P \u003cem\u003e\u0026lt; \u003c/em\u003e0.05 using one-way ANOVA followed by Tukey‘s test for multiple comparisons.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4314388/v1/67a7f29e3b322b13efd308a5.png"},{"id":55493504,"identity":"074deaa8-3357-4328-8534-f11d8e528e74","added_by":"auto","created_at":"2024-04-29 07:56:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":10938,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of SEC on cardiac NLRP3 in DIC. Data are presented as mean ± SD (n = 7). a, b: Statistically significant from the control and DOX group, respectively at P \u0026lt; 0.05 using one-way ANOVA followed by Tukey‘s test for multiple comparisons.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4314388/v1/e3d242a48f278c8d0bfd30e8.png"},{"id":55493507,"identity":"4554b390-75e8-459f-9b6b-9d25eafabb91","added_by":"auto","created_at":"2024-04-29 07:56:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":831101,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of SEC on cardiac caspase-1 (40 x) in DIC. A-E: Immunohistochemical staining of cardiac caspase-1 expression. (A) Control group (B) DOX (15 mg/kg) group (C) SEC treated group (D) SEC+DOX treated group (E) Quantitative image analysis for caspase-1 immunohistochemical staining expressed as mean area percent. Data are presented as mean ± SD (n = 7). a, b, c: Statistically significant from the control, DOX and SEC group, respectively at P \u003cem\u003e\u0026lt; \u003c/em\u003e0.05 using one-way ANOVA followed by Tukey‘s test for multiple comparisons.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4314388/v1/3e3e90464842f367acaf8cb8.png"},{"id":79373262,"identity":"40be03f6-fdaa-4126-8cca-d6934d11c114","added_by":"auto","created_at":"2025-03-27 14:49:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3133370,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4314388/v1/cba4ef68-42e8-4ee3-b1db-b5db6ff6ff70.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Secukinumab’ Cardioprotective Effect in Doxorubicin-induced cardiomyopathy: Targeting the NF-κB/NLRP3 Pathway in Rats","fulltext":[{"header":"Research Highlights","content":"\u003cp\u003e- \u0026nbsp;Administration of Anti-IL-17A monoclonal antibody has critical role in silencing of acute \u0026nbsp; cardiotoxicity through management of inflammation.\u003c/p\u003e\n\u003cp\u003e- \u0026nbsp;Anti–inflammation strategy is achieved by blocking of IL-17R which downregulates NFκB / NLRP3 pathway.\u003c/p\u003e\n\u003cp\u003e- The development of biologics targeting the IL-17A pathway has been exciting as they have opened a novel therapeutic target.\u003c/p\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eDoxorubicin (DOX), an antibiotic derived from anthracycline, has been widely employed in clinical settings as a chemotherapeutic agent to combat various forms of cancer\u0026nbsp;[1]. Upon DOX administration, several intense adverse reactions are encountered including cardiotoxicity which is considered as the main major treatment side effect [2]. Many clinical findings showed that left ventricular dysfunction, dilated cardiomyopathy and heart failure are usually developed upon the completion of DOX treatment protocol [3].\u0026nbsp;Such complications are triggered by cardiomyocyte apoptosis and myocardial fibrosis occurring due to DOX-associated oxidative stress and mitochondrial damage\u0026nbsp;[4]. To date, the cumulative dose of DOX is the main factor that contributes to the onset of cardiomyopathies induced by cancer therapy [5].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe cardiac remodeling is usually developed via aberrated inflammatory responses post-DOX therapy [6].\u0026nbsp;The complicated cytokines network constitutes a possible potent mechanistic link between DOX therapy and the deteriorated cardiac\u0026nbsp;function [7].\u0026nbsp;Intriguingly, IL-17A, also referred to as Interleukin-17A, is an inflammatory cytokine that exacerbates the cardiovascular system and plays a crucial role in the development of cardiovascular diseases and myocardial infarction [8] and responsible for pathogenesis of multiple autoimmune and inflammatory conditions [9]. In addition, IL-17A upregulation was detected in sepsis, pneumonia, allograft rejection conditions, and notably in cancer [10].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;As a defensive reaction from the innate immune system during various diseases and infections or stress conditions, a polymeric structure known as inflammasome composed of sensor proteins, junction molecules, and effectors is assembled [11].\u0026nbsp;The inflammatory response is triggered by the inflammasome, which releases various inflammatory factors such as Interleukin IL-1β (IL-1β), Interleukin IL-18 (IL-18), and Interleukin IL-37 [12].\u0026nbsp;The inflammasome activation is responsible for cardiac hypertrophy, pyroptosis and fibrosis hence they are involved in the pathogenesis of heart failure [13].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe NLRP3 inflammasome stands\u0026nbsp;out as the unique inflammasome due to its nucleotide-binding domain, leucine-rich–containing family, and pyrin domain–containing-3 composition that is expressed in diverse types of cells including neutrophils, lymphocytes, macrophages, microglia, epithelial cells, neurons, osteoblasts and dendritic cells\u0026nbsp;[14].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eActivated NLRP3 inflammasomes induce the release of IL-1β and IL-18 which contribute in the pathophysiology of atherosclerosis and coronary heart diseases [15]. IL-17 inhibitors are medications that target IL-17, blocking its inflammatory effects by interfering with the binding of IL-17A to its receptor IL17RA. These inhibitors are commonly used to manage inflammatory conditions in gastroenterology, rheumatology, and dermatology\u0026nbsp;[16]. Monoclonal antibody therapies have shown to be particularly effective among the various inhibition strategies. One such monoclonal antibody, Secukinumab (SEC), is approved for treating psoriasis, psoriatic arthritis, and ankylosing spondylitis, with ongoing research for other autoimmune disorders\u0026nbsp;[17]. Recent studies have highlighted the role of IL-17A in connecting cardiovascular disease with psoriatic inflammation, suggesting that anti-IL-17A therapy could not only benefit skin conditions but also reduce cardiovascular inflammation. Administration of Secukinumab has been shown to improve left ventricular function by reducing levels of oxidative stress markers like MDA and protein carbonyl\u0026nbsp;[18].\u003c/p\u003e\n\u003cp\u003eWhile the efficacy of IL-17A antagonists in inflammatory disorders has been well described, those on the cancer- and chemotherapy-associated cardiovascular diseases remain less explored. In this study, the potential cardioprotective effect of SEC was assessed in rat model of DOX-induced cardiotoxicity (DIC). SEC anti-inflammatory effect and its potential role in attenuating the cardiotoxic effects of DOX through modulation of NFκB/NLRP3/caspase1/IL-1β axis were elucidated.\u003c/p\u003e"},{"header":"2. Materials and methods ","content":"\u003cp\u003e\u003cstrong\u003e2.1. Ethics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research was given the green light by the ethics committee at Cairo University, and all experimental methods were authorized by the Animal Care and Use (CU-IACUC) Committee of Cairo University. Animal welfare and experimental procedures were conducted following protocols (Protocol # CU-I /F/15/23) and in compliance with NIH standards for animal research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Drugs and chemicals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSecukinumab (SEC) was acquired in the form of Cosentyx, a 150 mg/mL prefilled pen manufactured by Novartis Pharmaceuticals Corporation in the United States.\u0026nbsp;Doxorubicin (DOX) was purchased from EMIC (EMIC\u0026nbsp;United Pharmaceuticals Co, (Egypt). Biochemicals and substrates were purchased from Biodiagnostic (Egypt).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. Animals\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, male Wistar albino rats, aged eight weeks and weighing between 160-180 g, were utilized. Prior to the experiment, the animals were given a two-week acclimatization period and were housed in an environment with a humidity level of 55\u0026plusmn;5% and an ambient temperature of 22\u0026plusmn;1\u0026deg;C, which was controlled. The rats were provided with a standard diet and had access to water throughout the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. Experimental design\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTwenty-eight Wistar rats were weighed and then separated into 4 groups, with 7 rats in each group. The first group, known as the control group, received 0.9 ml/kg of 0.9% saline intraperitoneally three times a week for 2 weeks. The second group, treated with DOX, received 2.5 mg/kg of DOX intraperitoneally three times a week for 2 weeks, totaling 15 mg/kg [19]. The third group, the SEC control group, received 0.9 mg/kg of SEC intraperitoneally three times a week for 2 weeks [20]. Lastly, the fourth group, SEC+DOX, received 0.9 mg/kg of SEC along with 2.5 mg/kg of intraperitoneal DOX injection three times a week for 2 weeks, as illustrated in \u003cstrong\u003e(Fig.1)\u003c/strong\u003e of the study design.\u003c/p\u003e\n\u003cp\u003eThe initial body weight was documented. The animals\u0026apos; overall health and mortality rate were monitored daily for duration of two weeks. The day after the final administration, the animals\u0026apos; final body weights were measured. They were then anesthetized using dimethyl ether and underwent ECG recording. Samples of blood were collected from the retro-orbital plexus and left to coagulate. Subsequently, the samples underwent centrifugation at a speed of 3000 rpm and a temperature of 4\u0026deg;C for duration of 10 minutes in order to separate the serum. Portions of the serum were then stored at -80\u0026deg;C for subsequent biochemical analysis. The animals were decapitated, and the weights of their hearts were recorded. The hearts were isolated and quickly rinsed with ice-cold saline. A portion of the heart tissues was fixed in 10% phosphate-buffered formalin for 24 hours for pathological examination. The remaining portion was swiftly frozen in liquid nitrogen and preserved at -80\u0026deg;C for future examination. Homogenization was carried out using ice-cooled phosphate buffer saline with a pH of 7.4. Subsequently, the mixture was subjected to centrifugation at 10,000 rpm for 10 minutes at 4\u0026deg;C, and the resultant supernatant was meticulously gathered for analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5. Electrocardiography (ECG)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAn ECG was conducted at the start of the study to verify the typical ECG pattern of the rats. On the final day of the study, the rats were anesthetized with dimethyl ether and their ECG was recorded for duration of 1 minute. The heart rate, P duration, QRS Interval, QTc, and ST height were observed using the ECG Power lab module, which includes Power-lab/8sp and Animal Bio-Amplifier from Australia, along with Lab Chart 7 software featuring ECG analyzer\u0026nbsp;[21, 22].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6. Weight of the body and ratio of heart weight to body weight\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBody weight was measured at the start and end of the research in each group. The heart weight (HW) to body weight (BW) ratio was determined through computation [23].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7. Histopathological examination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cardiac tissues underwent fixation in 10% paraformaldehyde and subsequent dehydration. Following this, the processed samples were encased in paraffin wax and sectioned into 5-\u0026mu;m thick slices using tissue-processing equipment. These sections were then deparaffinized and stained with Hematoxylin and Eosin (HE) for histological examination using conventional methods. The slides were then qualitatively assessed under a light microscope (Olympus Soft Imaging Solution GmbH, Germany) to detect various histopathological alterations\u003cem\u003e\u0026nbsp;\u003c/em\u003e[24].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8. Assessment of Total Protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProtein levels were quantified in heart tissue homogenate utilizing the bicinchoninic acid (BCA) protein assay purchased from Abcam (Waltham, MA, USA) for each sample.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9. Assessment of Oxidative Stress\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe levels of oxidative stress were evaluated by measuring MDA and GSH in cardiac homogenate using commercial kits (Bio-diagnostic, Cairo, Egypt) as per the manufacturer\u0026apos;s protocol.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10. Assessment of serum cardiotoxicity indices\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe spectrophotometric method was employed to determine the activity of serum creatine kinase isoenzyme-MB (CK-MB) utilizing a commercial kit acquired from Spectrum diagnostics in Cairo, Egypt. Furthermore, the serum cardiac troponin I (cTn-I) level was assessed using an enzyme-linked immunosorbent assay (ELISA) kit (Sun Long Biotech Co, China; Cat. No. : SL0121Mo) in accordance with the manufacturer\u0026apos;s guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.11. Assessment of inflammatory cytokines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe levels of IL-1\u0026beta; and IL-17A, which are inflammatory cytokines, were assessed in heart tissue homogenate. A commercial ELISA kit was utilized for this analysis, following the instructions provided by the manufacturer (bt-laboratory Co, China; Cat. No. E0119 Ra \u0026amp; AFG Bioscience Co, USA Cat. No. EK720975).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.12. Assessment of NLRP3 inflammasome marker\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNLRP3 level was analyzed in cardiac tissue homogenate using a commercial ELISA kit according to the manufacturer\u0026rsquo;s instructions (Aviva System Biology\u0026nbsp;Corp, USA; Cat. No.: OKCD04232).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.13.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAssessment of NF\u0026kappa;B gene expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe heart tissues were used to extract total RNA using the TRIzol reagent Mini kit (Invitrogen R, Carlsbad, CA) following the manufacturer\u0026apos;s instructions. The isolated RNA was then converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA; Cat.No.4368814). To assess the expression of NF\u0026kappa;B, real-time PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems, USA; Cat.No.4309155). The thermo-cycling conditions recommended by the manufacturer were followed, including an initial denaturation at 95 \u003csup\u003eo\u003c/sup\u003eC for 10 min, followed by 40 cycles of denaturation at 95 \u003csup\u003eo\u003c/sup\u003eC for 30 s, annealing at 55 \u003csup\u003eo\u003c/sup\u003eC (NF\u0026kappa;B) / 56 \u003csup\u003eo\u003c/sup\u003eC (GAPDH) for 30 s, and extension at 72 \u003csup\u003eo\u003c/sup\u003eC for 30 s. The PCR cycle was completed with a final extension at 72 \u003csup\u003eo\u003c/sup\u003eC for 5 min. The real-time PCR reaction was carried out using a Step One Plus thermal cycler (Applied Biosystems, USA). The primer sequences can be found in \u003cstrong\u003eTable 1\u003c/strong\u003e. The data was analyzed using ABI Prism R 7000 SDS Software. Finally, the fold expression of each gene was calculated using the standard curve provided by each kit.\u0026nbsp;The NF\u0026kappa;B mRNA levels were standardized against the expression of the reference gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH)\u0026nbsp;[25, 26].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003eTable\u003c/u\u003e\u003c/strong\u003e\u003cu\u003e\u0026nbsp;\u003cstrong\u003e1\u0026nbsp;\u003c/strong\u003e\u003c/u\u003eThe primer sequences for real-time PCR.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.62135922330097%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"58.25242718446602%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.12621359223301%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession number\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.62135922330097%\"\u003e\n \u003cp\u003e\u003cstrong\u003eNF\u0026kappa;B\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"58.25242718446602%\"\u003e\n \u003cp\u003eForward:5\u0026rsquo;-\u0026nbsp;AATTGCCCCGGCAT\u0026nbsp;-3\u0026apos;\u003c/p\u003e\n \u003cp\u003eReverse: 5\u0026rsquo;-\u0026nbsp;TCCCGTAACCGCGTA\u0026nbsp;-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.12621359223301%\"\u003e\n \u003cp\u003e[NM_01276711.1]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.62135922330097%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGAPDH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"58.25242718446602%\"\u003e\n \u003cp\u003eForward: 5\u0026rsquo;-\u0026nbsp;ATGACTCTACCCACGGCAAG\u0026nbsp;-3\u0026apos;\u003c/p\u003e\n \u003cp\u003eReverse: \u0026nbsp;5\u0026rsquo;- CTGGAAGATGGTGATGGGTT -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.12621359223301%\"\u003e\n \u003cp\u003e[NM_017008.3]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e2.14. Assessment of caspase-1 marker \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe manufacturer\u0026apos;s protocol was followed to perform immunohistochemical staining for Caspase-1. Cardiac sections were deparaffinized, rehydrated, and unmasked with antigen in 10 mM sodium citrate buffer (pH 6.0) at 60\u0026deg;C for 10 minutes. Subsequently, the slides were cooled for 30 minutes. Afterward, the slides were washed with phosphate buffer solution (PBS) three times and then blocked with 1% BSA in PBS for 1 hour at room temperature. The sections were immunostained with primary anti-caspase-1 antibody (Novus biologicals, 0.1 mL USA; Cat.No. NB100-56565) overnight at 4\u0026deg;C, followed by another wash with PBS. HRP-conjugated secondary antibody was then incubated with the sections, which were subsequently reacted with DAB (3, 3\u0026rsquo;-diaminobenzidine). In order to calculate the levels of positive immune-expression for caspase-1 immunohistochemical staining, six distinct fields (magnification, \u0026times;400) were chosen at random for each tissue section of every sample. The Leica application module for tissue sections analysis, connected to a Full HD microscope imaging system (Leica Microsystems GmbH, Germany), was utilized to collect morphological measurements and analyze the data. Image quantitation was carried out with image software (version 1.48) to determine the area percent (A %) [27]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.15. Statistical analysis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data was presented using the mean \u0026plusmn; standard deviation (SD). To compare parametric data from more than two groups, analysis of variance (ANOVA) with post hoc test (Tukey\u0026rsquo;s Multiple Comparison Test) was employed to evaluate individual groups. Statistical significance was determined at P \u0026lt; 0.05. The data analysis was performed using IBM SPSS statistics (V.19.0, IBM Corp., USA, 2010).\u003c/p\u003e"},{"header":"3. Results ","content":"\u003cp\u003e\u003cstrong\u003e3.1. Mortality rate and morphological changes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThroughout the duration of the experiment, all animals in the four groups were found to have survived. Additionally, a decrease in daily food intake and physical activity was noted in both the DOX group and the SEC+DOX-treated group. It is worth mentioning that a significant fever was observed for only 48 hours at the beginning of the experiment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2. Effect of SEC on final body weight, heart weight and cardiac index\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn comparison to the control group, rats treated with DOX experienced a noticeable decrease in final body weight by 7.48%. Additionally, there was a significant increase in cardiac weight and cardiac index by 25% and 35.1% respectively (P \u0026lt; 0.0001). Conversely, when intoxicated rats were administered SEC, their body weight increased significantly by 6.31%. Furthermore, there was a decrease in both their cardiac weight and index by 15.1% and 20.1% respectively compared to the DOX group (P \u0026lt; 0.0001). Rats that received both SEC and DOX displayed a significant increase in body weight by 4.62%. Moreover, there was a significant reduction in cardiac weight and index by 7.1% and 11.1% respectively compared to the DOX group (P \u0026lt; 0.0001) \u003cstrong\u003e(Table 2)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u0026nbsp;\u003c/strong\u003eEffect of SEC on body weight, heart weight and cardiac index.\u003c/p\u003e\n\u003cp\u003eEffect of SEC on body weight, heart weight and cardiac index.\u003c/p\u003e\n\u003ctable width=\"714\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"97\"\u003e\n\u003cp\u003e\u003cstrong\u003eTested groups\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"8\" width=\"312\"\u003e\n\u003cp\u003e\u003cstrong\u003eBody Weight (gm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"186\"\u003e\n\u003cp\u003e\u003cstrong\u003eHeart Weight(gm)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"2\" width=\"119\"\u003e\n\u003cp\u003e\u003cstrong\u003eCardiac index x 10^3\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\" width=\"120\"\u003e\n\u003cp\u003e\u003cstrong\u003eInitial\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"29\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"163\"\u003e\n\u003cp\u003e\u003cstrong\u003eFinal\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"50\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"97\"\u003e\n\u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e166.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e3.33\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"29\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"59\"\u003e\n\u003cp\u003e173.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"55\"\u003e\n\u003cp\u003e2.98\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e0.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e0.029\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e3.16\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"50\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"97\"\u003e\n\u003cp\u003e\u003cstrong\u003eDOX\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e176.0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e3.92\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"29\"\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"59\"\u003e\n\u003cp\u003e160.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"55\"\u003e\n\u003cp\u003e2.81\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e0.69\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e0.014\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e4.27\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"50\"\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"97\"\u003e\n\u003cp\u003e\u003cstrong\u003eSEC\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e166.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e4.45\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"29\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"59\"\u003e\n\u003cp\u003e170.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"55\"\u003e\n\u003cp\u003e4.33\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e0.58\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e0.032\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e3.41\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"50\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"97\"\u003e\n\u003cp\u003e\u003cstrong\u003eSEC+DOX\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e172.0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"46\"\u003e\n\u003cp\u003e6.22\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"29\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"59\"\u003e\n\u003cp\u003e168.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"55\"\u003e\n\u003cp\u003e5.96\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"48\"\u003e\n\u003cp\u003e0.64\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"24\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e0.066\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,c\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e3.79\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"50\"\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,c\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;Data are represented as mean \u0026plusmn; SD (n = 7). a, b, c: Statistically significant from the control, DOX and SEC group, respectively at P \u003cem\u003e\u0026lt; \u003c/em\u003e0.05 using one-way ANOVA followed by Tukey\u0026lsquo;s test for multiple comparisons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3. Protective Effect of SEC on abnormal ECG \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe intoxication of DOX resulted in bradycardia, prolonged durations QRS complex, PR interval, and QTc interval exhibited significant differences in comparison to the control group. Conversely, the administration of SEC to intoxicated rats successfully reversed all ECG abnormalities induced by DOX. This was demonstrated by an increase in heart rate and a decrease in the duration of QRS interval, PR interval, and QTc when compared to the DOX group\u003cstrong\u003e (Fig.2)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4. Effect of SEC on histopathological alterations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe heart tissue from the normal group displayed well-organized cardiomyocytes with normal histological features and no signs of degeneration or necrosis. In contrast, the DOX group exhibited degenerative changes in cardiomyocytes, myofibril fragmentation, pyknosis, and inflammatory cell infiltrates. However, co-treatment with SEC and DOX effectively improved these abnormalities. SEC co-treatment demonstrated significant cytoprotective effects on myocardial cells, reducing infiltration and degenerative changes in cardiomyocytes. Treatment with SEC alone also showed well-organized cardiomyocytes with some degenerated cardiac cells. These findings indicate the cardioprotective effects of SEC against DOX-induced cardiomyopathy in rats (Fig.3)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5. Effect of SEC on the serum cardiotoxicity indices\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eSerum levels of CK-MB and c-TnI were evaluated as markers for myocardial injury. In the DOX group, there was a notable increase in serum CK-MB by 56.9% and c-TnI by 63.2% compared to the control group (P \u0026lt; 0.0001). However, co-treatment with SEC resulted in a significant decrease in serum CK-MB by 23.9% and c-TnI by 16.6% when compared to the DOX group (P \u0026lt; 0.0001) \u003cstrong\u003e(Table 3).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3\u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eEffect of SEC on serum CK-MB and cTnI.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable width=\"514\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"119\"\u003e\n\u003cp\u003e\u003cstrong\u003eTested groups\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"175\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u0026nbsp; CK-MB (U/l)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"220\"\u003e\n\u003cp\u003e\u003cstrong\u003ecTnI (Pg/ml)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"119\"\u003e\n\u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"51\"\u003e\n\u003cp\u003e19.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"23\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"44\"\u003e\n\u003cp\u003e0.86\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"57\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e24.6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"23\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"62\"\u003e\n\u003cp\u003e0.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"67\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"119\"\u003e\n\u003cp\u003e\u003cstrong\u003eDOX\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"51\"\u003e\n\u003cp\u003e31.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"23\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"44\"\u003e\n\u003cp\u003e1.43\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"57\"\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e40.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"23\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"62\"\u003e\n\u003cp\u003e4.36\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"67\"\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"119\"\u003e\n\u003cp\u003e\u003cstrong\u003eSEC\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"51\"\u003e\n\u003cp\u003e21.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"23\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"44\"\u003e\n\u003cp\u003e0.98\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"57\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e26.9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"23\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"62\"\u003e\n\u003cp\u003e1.05\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"67\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"119\"\u003e\n\u003cp\u003e\u003cstrong\u003eSEC+DOX\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"51\"\u003e\n\u003cp\u003e23.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"23\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"44\"\u003e\n\u003cp\u003e1.91\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"57\"\u003e\n\u003cp\u003e\u003cstrong\u003ea,b\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"68\"\u003e\n\u003cp\u003e33.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"23\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"62\"\u003e\n\u003cp\u003e0.83\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"67\"\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,c\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;Data are represented as mean \u0026plusmn; SD (n = 7). a, b, c: Statistically significant from\u0026nbsp; the control, DOX and SEC group, respectively at P \u003cem\u003e\u0026lt; \u003c/em\u003e0.05 using one-way ANOVA\u0026nbsp; followed by Tukey\u0026lsquo;s test for multiple comparisons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6. Effect of SEC on DOX-Induced Oxidative Stress\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4\u003c/strong\u003e displays the MDA and GSH concentrations in the cardiac homogenate. The DOX group exhibited a notable decrease in GSH levels (20.4%), while the content of MDA increased significantly (116.7%) compared to the normal group (P \u0026lt; 0.0001). Conversely, rats administered with SEC+DOX demonstrated a significant rise in GSH levels (15.9%) and a decrease in MDA levels (36%) compared to the DOX group (P \u0026lt; 0.0001), indicating the antioxidant properties of SEC in combating DIC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4\u0026nbsp;\u003c/strong\u003eEffect of SEC on MDA and GSH in cardiomyocytes.\u003c/p\u003e\n\u003ctable width=\"481\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"102\"\u003e\n\u003cp\u003e\u003cstrong\u003eTested groups\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"177\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; MDA\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"202\"\u003e\n\u003cp\u003e\u003cstrong\u003eGSH\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\" width=\"177\"\u003e\n\u003cp\u003e(nmol/mg total protein)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"202\"\u003e\n\u003cp\u003e(mmol/mg total protein)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"102\"\u003e\n\u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"52\"\u003e\n\u003cp\u003e7.6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"47\"\u003e\n\u003cp\u003e0.58\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e0.63\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"26\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e0.023\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"102\"\u003e\n\u003cp\u003e\u003cstrong\u003eDOX\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"52\"\u003e\n\u003cp\u003e16.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"47\"\u003e\n\u003cp\u003e2.21\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e0.50\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"26\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e0.007\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"102\"\u003e\n\u003cp\u003e\u003cstrong\u003eSEC\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"52\"\u003e\n\u003cp\u003e9.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"47\"\u003e\n\u003cp\u003e1.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e0.61\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"26\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e0.064\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"102\"\u003e\n\u003cp\u003e\u003cstrong\u003eSEC+DOX\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"52\"\u003e\n\u003cp\u003e10.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"47\"\u003e\n\u003cp\u003e1.71\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e\u003cstrong\u003ea,b\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"69\"\u003e\n\u003cp\u003e0.58\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"26\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e0.060\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;Data are represented as mean \u0026plusmn; SD (n = 7). a, b,: Statistically significant from the control and DOX group, respectively at P \u003cem\u003e\u0026lt; \u003c/em\u003e0.05 using one-way ANOVA followed by Tukey\u0026lsquo;s test for multiple comparisons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7. Effect of SEC treatment on inflammatory markers\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDOX treatment significantly increased the production of IL-17A and IL-1\u0026beta; in cardiomyocytes by 463% and 127.3%, respectively, compared to the normal group (P \u0026lt; 0.0001). Conversely, co-administration of SEC led to a notable decrease in these cytokines by 22.5% and 38.9% when compared to the DOX group (P \u0026lt; 0.0001) (\u003cstrong\u003eTable 5\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 5:\u0026nbsp;\u003c/strong\u003eEffect of SEC on IL-17A and IL-1\u0026beta; in heart tissue\u003c/p\u003e\n\u003ctable width=\"632\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" width=\"127\"\u003e\n\u003cp\u003e\u003cstrong\u003eTested groups\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"229\"\u003e\n\u003cp\u003e\u003cstrong\u003eIL-17A\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"277\"\u003e\n\u003cp\u003e\u003cstrong\u003eIL-1\u0026beta;\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\" width=\"229\"\u003e\n\u003cp\u003e(Pg/mg total protein)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd colspan=\"4\" width=\"277\"\u003e\n\u003cp\u003e(ng/mg total protein)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"127\"\u003e\n\u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003e141.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e11.68\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"110\"\u003e\n\u003cp\u003e0.77\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"42\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e0.03\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"127\"\u003e\n\u003cp\u003e\u003cstrong\u003eDOX\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003e794.02\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e60.01\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"110\"\u003e\n\u003cp\u003e1.74\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"42\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e0.24\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"127\"\u003e\n\u003cp\u003e\u003cstrong\u003eSEC\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003e155.37\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e24.19\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u003cstrong\u003eB\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"110\"\u003e\n\u003cp\u003e0.72\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"42\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e0.06\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e\u003cstrong\u003eB\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"127\"\u003e\n\u003cp\u003e\u003cstrong\u003eSEC+DOX\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"90\"\u003e\n\u003cp\u003e615.52\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"25\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"60\"\u003e\n\u003cp\u003e43.70\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"54\"\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,c\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"110\"\u003e\n\u003cp\u003e1.06\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"42\"\u003e\n\u003cp\u003e\u0026plusmn;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"53\"\u003e\n\u003cp\u003e0.08\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"71\"\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,c\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eData are represented as mean \u0026plusmn; SD (n = 7). a, b, c: Statistically significant from the control, DOX and SEC group, respectively at P \u003cem\u003e\u0026lt; \u003c/em\u003e0.05 using one-way ANOVA followed by Tukey\u0026lsquo;s test for multiple comparisons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.8. Effect of SEC treatment on NF\u0026kappa;B Gene Expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn \u003cstrong\u003e(Fig.4),\u003c/strong\u003e it is evident that rats administered with DOX experienced a 1.81-fold increase in NF-kB mRNA expression level, in contrast to the control group (P \u0026lt; 0.0001). Conversely, NF-kB mRNA expression level was reduced by 0.79-fold in SEC co-treatment compared to the DOX group\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;(P \u0026lt; 0.0001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.9. Effect of SEC treatment on NLRP3 level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdministration of DOX resulted in a notable increase of 130.4% in NLRP3 level in cardiomyocytes compared to the control group (P \u0026lt; 0.0001). Conversely, rats co-treated with SEC showed a significant reduction of 36.5% in NLRP3 level compared to the DOX group (P \u0026lt; 0.0001) \u003cstrong\u003e(Fig.5).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.10. Effect of SEC treatment on caspase-1 protein expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUpon DOX intoxication, the immunohistochemical analysis of caspase 1 expression displayed a significant increase, indicated by the intense brown staining (164.3%). in contrast to the control group (P \u0026lt; 0.0001). Conversely, pretreatment of intoxicated rats with SEC resulted in a notable decrease in caspase 1 content, as evidenced by the faint brown staining (41.2%) compared to the DOX group (P \u0026lt; 0.0001) \u003cstrong\u003e(Fig.6).\u003c/strong\u003e\u003c/p\u003e"},{"header":"4. Discussion ","content":"\u003cp\u003eThe primary adverse effect of DOX as a potent anticancer medication is dose-dependent cardiotoxicity, leading to cardiomyopathy and significantly limiting its clinical application [28]. Hence, there is a critical requirement for novel therapeutic strategies to safeguard against DIC. Inflammation plays a crucial role in various cardiovascular diseases (CVDs), and the potential use of anti-inflammatory treatment in CVDs could be a key area for future investigation [29]. The anti-inflammatory approach is vital in managing the inflammatory cascade at an early stage [30]. The specific neutralization of IL-1 through Canakinumab (CANTOS trial) in patients with myocardial infarction notably decreased cardiovascular mortality [31]. Conversely, cardiovascular mortality remained unaffected following the use of non-specific anti-inflammatory treatment [32]. Given these points, highly specific molecular therapies directed at individual cytokines or their receptors are urgently warranted. Monoclonal antibodies directed against the IL-17-IL-17R pathway offer promising treatment possibilities for inflammatory autoimmune disorders [33]. SEC, a human monoclonal antibody that specifically blocks the interaction between IL-17A and its receptor, has shown long-lasting effectiveness in individuals suffering from psoriasis and ankylosing spondylitis [17]. While it has shown success in trials for treating inflammatory disorders clinically [34], its impact on CVDs remains uncertain. Therefore, the objective of this study was to explore and compare the potential cardioprotective effects of SEC against DIC.\u003c/p\u003e\n\u003cp\u003eIn this investigation, rats co-administered with DOX experienced substantial myocardial damage, as confirmed by histopathological analysis and the presence of ECG abnormalities. These abnormalities included bradycardia, prolonged QTc, and elevated PR interval durations. Additionally, the activities of two serum cardiac markers, CK-MB and cTnI, were significantly elevated. Previous studies have suggested that DOX-induced cardiotoxicity may be mediated by both oxidative stress and inflammation [28, 35-36]. Consistent with these findings, our data demonstrated that DOX administration to rats resulted in a notable increase in lipid peroxidation, as evidenced by elevated levels of cardiac MDA and a significant decrease in GSH. This pronounced oxidative stress within cardiomyocytes may contribute to degenerative changes in heart tissue, such as necrosis [19].\u003c/p\u003e\n\u003cp\u003eInterestingly, co-administration of SEC maintained the normal structure of cardiomyocytes, cardiac conduction, and biochemical cardiac indicators. Additionally, it diminished cardiac MDA levels and preserved cardiac GSH production that was reduced by DOX toxicity, indicating its cardioprotective function against DIC. Numerous studies advocate that inflammation plays a crucial role in the development of DIC [37, 38]. DOX can enhance various inflammatory factors, including IL-1\u0026beta;, IL-6, IL-8, IL-10, IL-17, and TNF-\u0026alpha; [36, 37]. IL-17A is recognized as a potent proinflammatory factor and is the most extensively studied member of the IL-17 family [8]. Markedly elevated cardiac levels of IL-17A were observed following DOX treatment. The interaction of IL-17A with IL-17RA has been shown to stimulate interstitial remodeling, proliferation, and inflammation through IL17R/NF-\u0026kappa;B signaling [39], as evidenced by the upregulation of NF-\u0026kappa;B gene expression in DOX-intoxicated rats in our study. Furthermore, our findings highlighted the robust anti-inflammatory properties of SEC as another critical mechanism underlying its promising cardioprotective impact against DIC, as demonstrated by the suppression of both IL-17A and NF-\u0026kappa;B inflammatory markers.\u003c/p\u003e\n\u003cp\u003eNF-\u0026kappa;B is recognized as a key regulator of cellular inflammatory responses triggered by proinflammatory stimuli [40]. It plays a pivotal role in modulating molecular pathways associated with inflammation [41]. Activation of NF-\u0026kappa;B signaling induces the transcription of pro-IL-1\u0026beta; and NLRP3, which is essential for inflammasome activation [42]. NLRP3 is the most extensively studied inflammasome sensor in the heart [43], forming oligomers and binding to pro-caspase-1 via apoptosis-associated speck-like, resulting in caspase-1 activation [42]. Active caspase-1 then cleaves pro-IL-1\u0026beta; into its mature form, after which the activated NLRP3 inflammasome and caspase-1 are partially released from the cells along with IL-1\u0026beta; [44]. This pathway was confirmed in the current study, where administration of DOX increased the levels of NLRP3, caspase-1, and IL-1\u0026beta; in the heart. Conversely, co-treatment with SEC reduced their levels, indicating that the cardioprotective role of SEC in DIC may be achieved through modulation of the NF\u0026kappa;B/NLRP3/caspase1/IL-1\u0026beta; axis. In conclusion, our research demonstrated that co-administration of SEC with DOX maintained serum cardiac indices and cardiac levels of GSH, while also decreasing cardiac MDA, IL-17A, and IL-1\u0026beta; levels. This suggests the potent antioxidative and anti-inflammatory properties of SEC. Moreover, this is the initial study to highlight the role of SEC in improving the NFKB/NLRP3/caspase1/IL-1\u0026beta; axis in DIC. Further investigations are necessary to elucidate the precise mechanism of SEC. It is advisable to conduct additional clinical trials utilizing different doses of SEC to uncover its beneficial effects in a clinical environment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eall authors contributed to the study conception and design. material preparation, data collection and analysis were performed by mostafa drawy hassen. the first draft of the manuscript was written by nahla osama mohamed. the review and editing were carried out by sara \u0026nbsp;mustafa abd elsalam radwan. all these work was under supervision of refaat mohamed refaat gabr.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;No funding was received to assist with the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u0026nbsp; All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or non-financial interest in the subject matter or materials discussed in this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eHaupt, L. P., Rebs, S., Maurer, W., H\u0026uuml;bscher, D., Tiburcy, M., Pabel, S., ... \u0026amp; Streckfuss-B\u0026ouml;meke, K. (2022). Doxorubicin induces cardiotoxicity in a pluripotent stem cell model of aggressive B cell lymphoma cancer patients. Basic research in cardiology, 117(1), 13. https://doi.org/10.1007/s00395-022-00918-7\u003c/li\u003e\n \u003cli\u003eJain, A., \u0026amp; Rani, V. (2018). Assessment of herb-drug synergy to combat doxorubicin induced cardiotoxicity. Life Sciences, 205, 97-106.https://doi.org/10.1016/j.lfs.2018.05.021\u003c/li\u003e\n \u003cli\u003eAl-Salam, S., Kandhan, K., Sudhadevi, M., \u0026amp; Tariq, S. (2022). Nootkatone Ameliorates Doxorubicin Induced Myocardial Injury through Modulation of NF-\u0026kappa;B Signals and Oxidative Stress. Cell Physiol. Biochem, 56, 401-417. DOI: 10.33594/000000559\u003c/li\u003e\n \u003cli\u003eRenu, K., Abilash, V. G., PB, T. P., \u0026amp; Arunachalam, S. (2018). Molecular mechanism of doxorubicin-induced cardiomyopathy\u0026ndash;An update. European journal of pharmacology, 818, 241-253.https://doi.org/10.1016/j.ejphar.2017.10.043\u003c/li\u003e\n \u003cli\u003eZhao, L., \u0026amp; Zhang, B. (2017). Doxorubicin induces cardiotoxicity through upregulation of death receptors mediated apoptosis in cardiomyocytes. Scientific reports, 7(1), 44735.https://doi.org/10.1038/srep44735\u003c/li\u003e\n \u003cli\u003eYang, H. L., Hsieh, P. L., Hung, C. H., Cheng, H. C., Chou, W. C., Chu, P. M., ... \u0026amp; Tsai, K. L. (2020). Early moderate intensity aerobic exercise intervention prevents doxorubicin-caused cardiac dysfunction through inhibition of cardiac fibrosis and inflammation. Cancers, 12(5), 1102.https://doi.org/10.3390/cancers12051102\u003c/li\u003e\n \u003cli\u003eShi, S., Chen, Y., Luo, Z., Nie, G., \u0026amp; Dai, Y. (2023). Role of oxidative stress and inflammation-related signaling pathways in doxorubicin-induced cardiomyopathy. Cell Communication and Signaling, 21(1), 61.https://doi.org/10.1186/s12964-023-01077-5\u003c/li\u003e\n \u003cli\u003eWang, B., Hou, X., Sun, Y., Lei, C., Yang, S., Zhu, Y., ... \u0026amp; Song, L. (2022). Interleukin-17A influences the vulnerability rather than the size of established atherosclerotic plaques in apolipoprotein E-deficient mice. Open Life Sciences, 17(1), 1104-1115. https://doi.org/10.1515/biol-2022-0072\u003c/li\u003e\n \u003cli\u003eRobert, M., \u0026amp; Miossec, P. (2020). Interleukin-17 and lupus: enough to be a target? For which patients?. Lupus, 29(1), 6-14.https://doi.org/10.1177/0961203319891243\u003c/li\u003e\n \u003cli\u003eGe, Y., Huang, M., \u0026amp; Yao, Y. M. (2020). Biology of interleukin-17 and its pathophysiological significance in sepsis. Frontiers in immunology, 11, 548387.https://doi.org/10.3389/fimmu.2020.01558\u003c/li\u003e\n \u003cli\u003eShi, W., Jin, M., Chen, H., Wu, Z., Yuan, L., Liang, S., ... \u0026amp; Ou, C. (2023). Inflammasome activation by viral infection: mechanisms of activation and regulation. Frontiers in Microbiology, 14, 1247377. https://doi.org/10.3389/fmicb.2023.1247377\u003c/li\u003e\n \u003cli\u003eChan, A. H., \u0026amp; Schroder, K. (2019). Inflammasome signaling and regulation of interleukin-1 family cytokines. Journal of Experimental Medicine, 217(1), e20190314. https://doi.org/10.1084/jem.20190314\u003c/li\u003e\n \u003cli\u003eWu, J., Dong, E., Zhang, Y., \u0026amp; Xiao, H. (2021). The role of the inflammasome in heart failure. Frontiers in physiology, 12, 709703.https://doi.org/10.3389/fphys.2021.709703\u003c/li\u003e\n \u003cli\u003eZahid, A., Li, B., Kombe, A. J. K., Jin, T., \u0026amp; Tao, J. (2019). Pharmacological inhibitors of the NLRP3 inflammasome. Frontiers in immunology, 10, 2538. https://doi.org/10.3389/fimmu.2019.02538\u003c/li\u003e\n \u003cli\u003eTanase, D. M., Valasciuc, E., Gosav, E. M., Ouatu, A., Buliga-Finis, O. N., Floria, M., ... \u0026amp; Serban, I. L. (2023). Portrayal of NLRP3 inflammasome in atherosclerosis: current knowledge and therapeutic targets. International Journal of Molecular Sciences, 24(9), 8162. https://doi.org/10.3390/ijms24098162\u003c/li\u003e\n \u003cli\u003eȚiburcă, L., Bembea, M., Zaha, D. C., Jurca, A. D., Vesa, C. M., Rațiu, I. A., \u0026amp; Jurca, C. M. (2022). The treatment with interleukin 17 inhibitors and immune-mediated inflammatory diseases. Current Issues in Molecular Biology, 44(5), 1851-1866. https://doi.org/10.3390/cimb44050127\u003c/li\u003e\n \u003cli\u003eFrieder, J., Kivelevitch, D., \u0026amp; Menter, A. (2018). Secukinumab: a review of the anti-IL-17A biologic for the treatment of psoriasis. Therapeutic advances in chronic disease, 9(1), 5-21. https://doi.org/10.1177/2040622317738910\u003c/li\u003e\n \u003cli\u003eMedovic, M. V., Jakovljevic, V. L., Zivkovic, V. I., Jeremic, N. S., Jeremic, J. N., Bolevich, S. B., ... \u0026amp; Srejovic, I. M. (2022). Psoriasis between autoimmunity and oxidative stress: changes induced by different therapeutic approaches. Oxidative medicine and cellular longevity, 2022. https://doi.org/10.1155/2022/2249834\u003c/li\u003e\n \u003cli\u003eHaybar, H., Goudarzi, M., Mehrzadi, S., Aminzadeh, A., Khodayar, M. J., Kalantar, M., \u0026amp; Fatemi, I. (2019). Effect of gemfibrozil on cardiotoxicity induced by doxorubicin in male experimental rats. Biomedicine \u0026amp; Pharmacotherapy, 109, 530-535. https://doi.org/10.1016/j.biopha.2018.10.101\u003c/li\u003e\n \u003cli\u003eLiu, S. P., Huang, L., Flores, J., Ding, Y., Li, P., Peng, J., ... \u0026amp; Tang, J. P. (2019). Secukinumab attenuates reactive astrogliosis via IL‐17RA/(C/EBP\u0026beta;)/SIRT1 pathway in a rat model of germinal matrix hemorrhage. CNS neuroscience \u0026amp; therapeutics, 25(10), 1151-116. https://doi.org/10.1111/cns.13144\u003c/li\u003e\n \u003cli\u003eMustafa, H. N., Hegazy, G. A., El Awdan, S. A., \u0026amp; AbdelBaset, M. (2017). Protective role of CoQ10 or L-carnitine on the integrity of the myocardium in doxorubicin induced toxicity. Tissue and Cell, 49(3), 410-426.https://doi.org/10.1016/j.tice.2017.03.007\u003c/li\u003e\n \u003cli\u003eSaleh, D., Abdelbaset, M., Hassan, A., Sharaf, O., Mahmoud, S., \u0026amp; Hegazy, R. (2020). Omega-3 fatty acids ameliorate doxorubicin-induced cardiorenal toxicity: In-vivo regulation of oxidative stress, apoptosis and renal Nox4, and in-vitro preservation of the cytotoxic efficacy. Plos one, 15(11), e0242175. https://doi.org/10.1371/journal.pone.0242175\u003c/li\u003e\n \u003cli\u003eRazmaraii, N., Babaei, H., Nayebi, A. M., Asadnasab, G., Helan, J. A., \u0026amp; Azarmi, Y. (2016). Cardioprotective effect of phenytoin on doxorubicin-induced cardiac toxicity in a rat model. Journal of cardiovascular pharmacology, 67(3), 237-245. DOI: 10.1097/FJC.0000000000000339\u003c/li\u003e\n \u003cli\u003eBancroft, J. D., \u0026amp; Gamble, M. (Eds.). (2008). Theory and practice of histological techniques. Elsevier health sciences.\u003c/li\u003e\n \u003cli\u003eChen, W., Chen, W., Zhu, J., Chen, N., \u0026amp; Lu, Y. (2016). Potent anti-inflammatory activity of tetramethylpyrazine is mediated through suppression of NF-k. Iranian journal of pharmaceutical research: IJPR, 15(1), 197. PMID: 27610159 .PMCID: PMC4986104\u003c/li\u003e\n \u003cli\u003eAbo-El Fetoh, M. E., Abdel-Fattah, M. M., Mohamed, W. R., Ramadan, L. A., \u0026amp; Afify, H. (2023). Cyclooxygenase-2 activates EGFR\u0026ndash;ERK1/2 pathway via PGE2-mediated ADAM-17 signaling in testosterone-induced benign prostatic hyperplasia. Inflammopharmacology, 31(1), 499-516.https://doi.org/10.1007/s10787-022-01123-7\u003c/li\u003e\n \u003cli\u003eEl-Rous, M. A., Saber, S., Raafat, E. M., \u0026amp; Ahmed, A. A. (2021). Dapagliflozin, an SGLT2 inhibitor, ameliorates acetic acid-induced colitis in rats by targeting NF\u0026kappa;B/AMPK/NLRP3 axis. Inflammopharmacology, 29(4), 1169-1185. https://doi.org/10.1007/s10787-021-00818-7\u003c/li\u003e\n \u003cli\u003eEisvand, F., Imenshahidi, M., Ghasemzadeh Rahbardar, M., Tabatabaei Yazdi, S. A., Rameshrad, M., Razavi, B. M., \u0026amp; Hosseinzadeh, H. (2022). Cardioprotective effects of alpha‐mangostin on doxorubicin‐induced cardiotoxicity in rats. Phytotherapy research, 36(1), 506-524.https://doi.org/10.1002/ptr.7356\u003c/li\u003e\n \u003cli\u003eWang, Y., Liu, X., Shi, H., Yu, Y., Yu, Y., Li, M., \u0026amp; Chen, R. (2020). NLRP3 inflammasome, an immune‐inflammatory target in pathogenesis and treatment of cardiovascular diseases. Clinical and Translational Medicine, 10(1), 91-106. https://doi.org/10.1002/ctm2.13\u003c/li\u003e\n \u003cli\u003eZhang, Z., Chen, F., Wan, J., \u0026amp; Liu, X. (2023). Potential traditional Chinese medicines with anti-inflammation in the prevention of heart failure following myocardial infarction. Chinese Medicine, 18(1), 28.https://doi.org/10.1186/s13020-023-00732-w\u003c/li\u003e\n \u003cli\u003eRidker, P. M., Everett, B. M., Thuren, T., MacFadyen, J. G., Chang, W. H., Ballantyne, C., ... \u0026amp; Glynn, R. J. (2017). Antiinflammatory therapy with canakinumab for atherosclerotic disease. New England journal of medicine, 377(12), 1119-1131. DOI: 10.1056/NEJMoa1707914\u003c/li\u003e\n \u003cli\u003eRidker, P. M., Everett, B. M., Pradhan, A., MacFadyen, J. G., Solomon, D. H., Zaharris, E., ... \u0026amp; Glynn, R. J. (2019). Low-dose methotrexate for the prevention of atherosclerotic events. New England Journal of Medicine, 380(8), 752-762. DOI: 10.1056/NEJMoa1809798\u003c/li\u003e\n \u003cli\u003eSisto, M., \u0026amp; Lisi, S. (2023). Targeting Interleukin-17 as a Novel Treatment Option for Fibrotic Diseases. Journal of Clinical Medicine, 13(1), 164. https://doi.org/10.3390/jcm13010164\u003c/li\u003e\n \u003cli\u003eKlint, S., Feldwisch, J., Gudmundsdotter, L., Dillner Bergstedt, K., Gunneriusson, E., H\u0026ouml;id\u0026eacute;n Guthenberg, I., ... \u0026amp; Frejd, F. Y. (2023, December). Izokibep: preclinical development and first-in-human study of a novel IL-17A neutralizing Affibody molecule in patients with plaque psoriasis. In MAbs (Vol. 15, No. 1, p. 2209920). Taylor \u0026amp; Francis. https://doi.org/10.1080/19420862.2023.2209920\u003c/li\u003e\n \u003cli\u003eQuagliariello, V., Vecchione, R., Coppola, C., Di Cicco, C., De Capua, A., Piscopo, G., ... \u0026amp; Maurea, N. (2018). Cardioprotective effects of nanoemulsions loaded with anti-inflammatory nutraceuticals against doxorubicin-induced cardiotoxicity. Nutrients, 10(9), 1304.https://doi.org/10.3390/nu10091304\u003c/li\u003e\n \u003cli\u003eWang, Z., Wang, M., Liu, J., Ye, J., Jiang, H., Xu, Y., ... \u0026amp; Wan, J. (2018). Inhibition of TRPA1 attenuates doxorubicin-induced acute cardiotoxicity by suppressing oxidative stress, the inflammatory response, and endoplasmic reticulum stress. Oxidative Medicine and Cellular Longevity, 2018. https://doi.org/10.1155/2018/5179468\u003c/li\u003e\n \u003cli\u003eReis-Mendes, A., Padr\u0026atilde;o, A. I., Duarte, J. A., Gon\u0026ccedil;alves-Monteiro, S., Duarte-Ara\u0026uacute;jo, M., Remi\u0026atilde;o, F., ... \u0026amp; Costa, V. M. (2021). Role of inflammation and redox status on doxorubicin-induced cardiotoxicity in infant and adult CD-1 male mice. Biomolecules, 11(11), 1725. https://doi.org/10.3390/biom11111725\u003c/li\u003e\n \u003cli\u003eReis-Mendes, A., Ferreira, M., Duarte, J. A., Duarte-Ara\u0026uacute;jo, M., Remi\u0026atilde;o, F., Carvalho, F., ... \u0026amp; Costa, V. M. (2023). The role of inflammation and antioxidant defenses in the cardiotoxicity of doxorubicin in elderly CD-1 male mice. Archives of Toxicology, 97(12), 3163-3177. https://doi.org/10.1007/s00204-023-03586-1\u003c/li\u003e\n \u003cli\u003eMa, L., Jiang, M., Zhao, X., Sun, J., Pan, Q., \u0026amp; Chu, S. (2020). Cigarette and IL-17A synergistically induce bronchial epithelial-mesenchymal transition via activating IL-17R/NF-\u0026kappa;B signaling. BMC Pulmonary Medicine, 20, 1-7. https://doi.org/10.1186/s12890-020-1057-6\u003c/li\u003e\n \u003cli\u003eUcci, M., Di Tomo, P., Tritschler, F., Cordone, V. G., Lanuti, P., Bologna, G., ... \u0026amp; Pandolfi, A. (2019). Anti-inflammatory role of carotenoids in endothelial cells derived from umbilical cord of women affected by gestational diabetes mellitus. Oxidative medicine and cellular longevity, 2019.https://doi.org/10.1155/2019/8184656\u003c/li\u003e\n \u003cli\u003eLuo, Q., Ma, H., Guo, E., Yu, L., Jia, L., Zhang, B., ... \u0026amp; Liu, R. (2022). MicroRNAs promote the progression of sepsis-induced cardiomyopathy and neurovascular dysfunction through upregulation of NF-kappaB signaling pathway-associated HDAC7/ACTN4. Frontiers in Neurology, 13, 909828. https://doi.org/10.3389/fneur.2022.909828\u003c/li\u003e\n \u003cli\u003eAcevedo, W., Mor\u0026aacute;n-Figueroa, R., Vargas-Chacoff, L., Morera, F. J., \u0026amp; Pontigo, J. P. (2023). Revealing the Salmo salar NLRP3 Inflammasome: Insights from Structural Modeling and Transcriptome Analysis. International Journal of Molecular Sciences, 24(19), 14556.https://doi.org/10.3390/ijms241914556\u003c/li\u003e\n \u003cli\u003eNapodano, C., Carnazzo, V., Basile, V., Pocino, K., Stefanile, A., Gallucci, S., ... \u0026amp; Marino, M. (2023). NLRP3 Inflammasome Involvement in Heart, Liver, and Lung Diseases\u0026mdash;A Lesson from Cytokine Storm Syndrome. International Journal of Molecular Sciences, 24(23), 16556. https://doi.org/10.3390/ijms242316556\u003c/li\u003e\n \u003cli\u003eBaroja-Mazo, A., Mart\u0026iacute;n-S\u0026aacute;nchez, F., Gomez, A. I., Mart\u0026iacute;nez, C. M., Amores-Iniesta, J., Compan, V., ... \u0026amp; Pelegr\u0026iacute;n, P. (2014). The NLRP3 inflammasome is released as a particulate danger signal that amplifies the inflammatory response. Nature immunology, 15(8), 738-748.https://doi.org/10.1038/ni.2919\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Doxorubicin, Cardioprotective, Interleukin-17A, Nuclear factor kappa beta, Secukinumab, Pyrin domain containing 3.","lastPublishedDoi":"10.21203/rs.3.rs-4314388/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4314388/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Doxorubicin (DOX) is a medication employed in the treatment of cancer as a chemotherapeutic agent. However, it induces cardiotoxicity via activating inflammatory pathways. Cytokines dysregulation is a key factor that can lead to activation of inflammatory mechanisms. Interleukin-17A (IL-17A) is a pro-inflammatory cytokine that triggers pathogenic immune responses. The objective of this study was to investigate the defensive power of secukinumab (SEC), a fully human monoclonal IgG1/κ antibody targeting IL-17A, designed to combat DOX-induced cardiotoxicity (DIC). Male Wistar rats were treated with DOX and co-treated with SEC for two weeks. The results showed that DOX caused heart tissue injury, increased cardiotoxicity markers significantly (P \u003c 0.0001), oxidative stress and inflammation. Additionally, DOX activated the nuclear factor kappa beta (NF-κB) pathway and Pyrin domain containing 3 (NLRP3) inflammasome, potentially contributing to DIC. The co-treatment with SEC successfully reversed all DOX-related abnormalities by restoring cardiac functions to normal levels, decreasing levels of inflammatory cytokines, including IL-17A and Interleukin-1β (IL-1β), and improving oxidative stress by lowering malondialdhyde (MDA) levels and increasing reduced glutathione (GSH) levels. Furthermore, it also decreased the upregulation of the NF-κB/NLRP3 axis induced by doxorubicin. This study highlights the protective properties of SEC against DIC by modulating the NF-κB/NLRP3/caspase1/IL-1β axis.","manuscriptTitle":"Secukinumab’ Cardioprotective Effect in Doxorubicin-induced cardiomyopathy: Targeting the NF-κB/NLRP3 Pathway in Rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-29 07:56:01","doi":"10.21203/rs.3.rs-4314388/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3a45ce85-6f6e-49d3-8fc5-c239ccfb147c","owner":[],"postedDate":"April 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-27T14:48:58+00:00","versionOfRecord":{"articleIdentity":"rs-4314388","link":"https://doi.org/10.1007/s10753-024-02187-z","journal":{"identity":"inflammation","isVorOnly":false,"title":"Inflammation"},"publishedOn":"2025-03-11 00:00:00","publishedOnDateReadable":"March 11th, 2025"},"versionCreatedAt":"2024-04-29 07:56:01","video":"","vorDoi":"10.1007/s10753-024-02187-z","vorDoiUrl":"https://doi.org/10.1007/s10753-024-02187-z","workflowStages":[]},"version":"v1","identity":"rs-4314388","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4314388","identity":"rs-4314388","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}